Datasets:

anumafzal94

/

pubmed_full_finetuning

like 0

You are an expert at summarizing long articles. Proceed to summarize the following text: actinomycosis is a rare granulomatous disease caused by filamentous gram - positive anaerobic bacteria actinomyces . infection of the abdomen or abdominal actinomycosis ( aa ) often presents with nonspecific symptoms , which can mimic inflammatory bowel disease , diverticulitis and even carcinoma [ 1 , 2 ] . we report two adult cases of aa who initially presented with a clinical picture of appendicitis . the intermittent cramp - like discomfort occurred every 2 weeks , lasting for 23 days before self - resolving without medical treatment . the patient was completely well between episodes of pain and had no significant past medical history . there was mild tenderness in the right lower quadrant on examination with no peritonism or mass felt . laboratory investigations were unremarkable with white cell count and c - reactive protein ( crp ) within reference ranges . abdominal computed tomography ( ct ) the patient underwent a prompt surgical review and a laparoscopic appendicetomy was arranged . at operation , the appendix was thickened and densely adherent to ileal mesentery . the appendix was excised and histologic examination showed foci of actinomyces in the lumen ( fig . no acute inflammation was seen ; however , lymphoid hyperplasia and chronic inflammatory cells were present in muscularis propria and serosa . the patient was diagnosed with aa of the appendix and treated with intravenous ( i.v . ) there is no appendicolith and no free gas or discrete collection to suggest perforation . focus of actinomycosis with surrounding chronic inflammatory cells and foamy macrophages ( haematoxylin eosin stain , original magnification 200 ) . focus of actinomycosis with surrounding chronic inflammatory cells and foamy macrophages ( haematoxylin eosin stain , original magnification 200 ) . a 54-year - old woman presented with an 8-day history of progressively worsening right iliac fossa pain associated with fevers and increased frequency of bowel motions . her medical background was significant for thalassemia trait and obesity . on examination , she was febrile ( 38c ) and tender in the right iliac fossa over mcburney s point with no peritonitis . she had a normal white cell count and an elevated crp of 126 mg / l . abdominal ct showed a markedly thickened appendix of 18 mm with periappendiceal fat stranding and a 30 30 43 mm collection posterior to the ascending colon ( fig . associated with the body of the appendix is a collection located posterior to the ascending colon ( arrows ) . abdominal ct of case 2 . markedly thickened retrocaecal appendix with associated periappendiceal fat stranding . associated with the body of the appendix is a collection located posterior to the ascending colon ( arrows ) . ct - guided drainage of periappendiceal collection was performed with 5 ml of purulent material aspirated . the patient s fevers and abdominal pain settled with the above treatment and she was discharged on oral antibiotics . an elective laparoscopic appendicectomy performed 6 weeks later showed a retrocaecal appendix with multiple adhesions , which were removed . on histology , sections of the appendix showed suppurative granulomatous inflammation with clusters of filamentous organisms consistent with actinomyces ( fig . the patient recovered from the operation and commenced on a prolonged course of penicillin . sulfur granules showing clusters of gram - positive filamentous non - spore forming actinomyces with adjacent neutrophilic infiltrate . the filaments are surrounded by eosinphilic proteinaceous material which represents a host reaction ( haematoxylin eosin stain , original magnification 200 ) . sulfur granules showing clusters of gram - positive filamentous non - spore forming actinomyces with adjacent neutrophilic infiltrate . the filaments are surrounded by eosinphilic proteinaceous material which represents a host reaction ( haematoxylin eosin stain , original magnification 200 ) . actinomyces are normal commensals of the oral cavity , gastrointestinal and urogenital tracts but can become pathogenic when the mucosa barrier is breached . actinomycoses israelii is the most frequent human pathogen accounting for up to 90% of infections . orocervicofacial infection is the commonest form of disease in 50% of cases , followed by aa in 20% of cases . although the pathogenesis of aa is poorly understood , the critical step appears to be the disruption of the mucosal barrier . the appendix and ileocaecal region appear to be most commonly involved ; however , cases of hepatic , retroperitoneal , adrenal and pelvic aa have also been described . predisposing factors of aa include recent abdominal surgery , bowel perforation , neoplasia , poor oral hygiene and intrauterine contraceptive devices . symptoms such as abdominal pain , fever and weight loss are usually nonspecific . given the rarity of aa , other diagnoses are entertained first leading to morbidity associated with delayed diagnosis and unnecessary surgery . a clue that points to actinomycosis as a cause is the indolent , slowly progressive nature of the infection which was seen in our first case . cross - sectional imaging with ct or magnetic resonance imaging are useful for determining the anatomic location and extent of disease but are nonspecific . common features of aa include bowel thickening , and either solid or cystic masses with contrast enhancement . in later stages of infection , infiltration across tissue planes can be seen with fistulae formation to the abdominal wall , perianal area , other organs or between bowel loops . there still lacks a good , non - invasive , diagnostic test for aa to prevent unnecessary surgery . a definitive diagnosis is obtained by visualization of characteristic sulfur granules and/or culture of actinomyces obtained from needle aspiration of a collection or from a surgical specimen . although diagnosis of aa by colonoscopy and biopsy has been reported , endoscopic biopsies usually demonstrate chronic inflammation without sulfur granules due to limited depth of tissue sampling . sulfur granules represent colonies of actinomyces and , although highly suggestive , are not pathognomonic of actinomycosis . adding to the difficulty in diagnosis , actinomyces must be cultured on selective agar medium under anaerobic conditions for at least 7 days . penicillin g ( 1824 million units / day ) for 26 weeks followed by oral penicillin v or amoxicillin for 612months is reasonable for extensive disease . cure after limited courses of 3 months or less have been reported for treating pelvic actinomycosis . although no guidelines exist , the duration of antibiotics depends on initial extent of disease and clinical and radiological response to treatment . surgery is usually reserved for bulky necrotic lesions , large abscesses , fistulas or inability to exclude malignancy . once a diagnosis of aa is made , the prognosis is favorable in more than 90% of cases after medical and surgical therapy . in conclusion , aa is a rare differential diagnosis for appendicitis and should be considered in patients with an indolent course and nonspecific abdominal symptoms . the diagnosis of aa relies on histologic examination and is infrequently made by routine investigations prior to invasive procedures . treatment with prolonged antibiotic therapy either alone or in combination with surgery is very effective . written informed consent was obtained from the two patients for publication of this case report and any accompanying images . we certify that the submission is original work and has not been published previously elsewhere . ken liu : drafting of the manuscript , literature review and research ; david joseph : critical revision of the article , final approval of the article ; ken lai : critical revision of the article , provision of histopathology pictures ; james kench : critical revision of the article , provision of histopathology pictures ; meng chong ngu : initial conception of article idea , critical revision of the article and final approval of the article .

abdominal actinomycosis ( aa ) is a rare infection caused by filamentous gram - positive anaerobic bacteria actinomyces . we report two cases of adults with aa who initially presented with clinical and radiological features of appendicitis . both patients underwent appendicectomy with histopathology diagnostic for actinomycosis of the appendix and subsequently completed prolonged courses of oral penicillin . aa is a rare differential diagnosis for appendicitis and should be considered especially in patients with a chronic , indolent course and nonspecific abdominal symptoms . a high index of suspicion may avoid unnecessary surgery , as treatment with prolonged antibiotic therapy is very effective .

You are an expert at summarizing long articles. Proceed to summarize the following text: glaucoma is the second leading cause of blindness worldwide , but its etiology is complex and only partially understood . frequently associated with elevated intraocular pressure ( iop ) leading to a stereotypical pattern of retinal ganglion loss and cup excavation , glaucoma may result from closure of the iridocorneal angle , blockage of the trabecular meshwork responsible for aqueous humor outflow , pupil block of the space between the lens and iris necessary for humor circulation between the anterior and posterior chambers , and several other causes . loss of the leucine - rich repeat domain - containing g protein - coupled receptor 4 ( lgr4 , also called gpr48 ) has been implicated in anterior segment dysgenesis including iridocorneal attachment and elevated intraocular pressure leading to early onset retinal ganglion cell loss in mice that is similar to glaucomatous damage in humans . recently published work identifies lgr4 as a receptor for norrin , a secreted protein with established roles in retinal neuron protection and retinal vascularization and therefore suggests an additional mechanism by which lgr4 functions to prevent glaucoma . this paper will provide an overview of lgr4 signal transduction and its role in a wide variety of developmental processes , followed by a focus on recent developments in the role of lgr4 in glaucoma . the leucine - rich repeat domain - containing g protein - coupled receptors ( lgrs ) feature a large n - terminal extracellular domain containing multiple leucine - rich repeats and are subdivided into three groups . one group consists of the three glycoprotein hormone receptors : lutenizing hormone receptor , follicle - stimulating hormone receptor , and thyroid stimulating hormone receptor . the second group contains lgr46 , three receptors sharing high homology ( ~50% sequence identity ) that were recently found to act as receptors for the wnt - potentiating r - spondins , indicating that this group can signal through both g protein - coupled as well as wnt - signaling pathways . the third group is comprised of the relaxin receptors lgr7 and 8 . lgr4 has been shown to signal through classical gs - mediated signaling in multiple systems . in this pathway ( figure 1 ) , ligand binding to lgr4 leads to g - protein activation through gtp binding . coupled gs then dissociates from lgr4 to activate adenylyl cyclase resulting in elevated levels of the second messenger cyclic amp ( camp ) ; camp , in turn , activates protein kinase a ( pka ) , which phosphorylates the transcription factor cre - binding protein , leading to elevated expression of target genes containing cre binding motifs in their promoter . known lgr4 targets regulated through camp / pka / cre signaling include the mineralocorticoid receptor , estrogen receptor in the male reproductive tract , atf4 in bone development and definitive erythropoiesis [ 5 , 6 ] , and pitx2 in eye development . however , a constitutively active mutant , t755i lgr4 , has been reported which results in elevated cellular camp levels and creb activity [ 1 , 7 ] . the lgr4 family members lgr5 and 6 have been implicated in stem cell maintenance in a variety of tissues . lgr5 is a stem cell marker in the small intestine , stomach , liver , hair follicle , and , most recently , mammary gland [ 12 , 13 ] . a single lgr5 expressing colon cell was able to generate organoids that persist in culture and can engraft to form functional crypts in vivo . conditional loss of lgr5 leads to depletion of stem cells in the mammary gland , implying that lgr5 signaling has a functional role in stem cell self - renewal . the most likely mechanism for this role is by a second signal transduction pathway : lgr mediation of wnt signaling potentiation by r - spondin . r - spondin binding to lgr46 inhibits znrf3 and rnf43 , negative regulators of wnt signaling which promote degradation of the wnt receptor frz and the wnt coreceptors lrp5/6 . thus , lgr4 and its family members function to increase the membrane concentration of wnt receptors in the presence of r - spondin , enhancing the signaling response to low levels of wnt ligand . an alternative mechanism for r - spondin signaling has also been proposed , in which r - spondin - bound lgrs bind directly to lrp6 to augment lrp6 phosphorylation in response to wnt - fzd binding . clathrin was also reported to be required for lgr4 mediation of r - spondin in vitro . most recently , lgr4 was shown to be a receptor for norrin , another canonical wnt signaling potentiator , providing another means by which lgr4 modulates wnt signaling . lgr4 mrna expression in mice was first detected at e7 and in adult mice was the highest in liver , then kidney , with moderate expression in muscle , heart , and brain , and low levels in testes and lung . ( 2004 ) first described the mouse expression pattern of lgr4 protein , using both ihc staining of wild - type tissue as well as transgenic mice expressing -galactosidase from the lgr4 promoter . they noted moderate lgr4 expression in neonatal kidney , adrenal , stomach , spine , ribs , brain , nasal cavity , heart , and intestines , with lower levels in liver , lung , and spleen . adults had a very similar pattern of lgr4 expression , with reduced heart lgr4 and higher liver levels ; also , no lung or spleen expression was detected in adult lgr4 . lgr4 mrna expression in adult humans is the highest in the pancreas , with moderate levels in liver , heart , and muscle , and very low brain and kidney expression . two approaches have been used by different labs to generate lgr4 mice . in one approach , a gene trap cassette was inserted in the first intron to generate a chimeric mrna containing the n - terminal leucine - rich repeat of lgr4 fused to the cd4 transmembrane domain and the -galactosidase coding sequence [ 1 , 20 ] . this approach showed that lgr4 is an essential gene for embryonic development ; 60% of expected lgr4 pups died in utero , and the majority of remaining lgr4 null pups died perinatally in a c57bl6j x swiss webster background ; modest ( ~10% ) declines in expected numbers of lgr4 mice were also reported . lgr4 pups showed embryonic growth retardation ( 14% decrease in lgr4 neonatal pup weight ) , with a significant decrease in liver and kidney weight . background strain has a strong effect on the embryonic and perinatal survival of lgr4 mice , with higher lethality in 129ola x c57bl6 mice , but 60% of lgr4 null mice on a cba background survive ; most cd1 strain lgr4 mice also survive to adulthood . the alternative approach is to perform targeted knockout of lgr4 exon 18 , containing the seven - transmembrane domain . this approach revealed a similarly high level of embryonic lethality , with embryonic kidney hypoplasia , later shown to be accompanied by premature ureteric bud differentiation . in addition to the embryonic lethality and decreased growth noted above and the eye defects discussed below , midgestational erythropoiesis is disrupted in lgr4 embryos , with a 32% decrease in ter119 cells at e13.5 as compared to wild type . lgr4 loss delays osteoblast differentiation , resulting in decreased embryonic bone formation ; bone formation kinetics and bone mineral density were decreased through adulthood in lgr4 mice . lgr4 mice also lack a gall bladder and cystic duct , although the common hepatic duct and intrahepatic bile duct appeared unchanged . lgr4 regulates expression of the mineralocorticoid receptor , implicating lgr4 in electrolyte homeostasis . both male [ 4 , 22 , 23 , 26 ] and female reproductive tract formation is impaired in lgr4 , leading to infertility in homozygous null mice . intestinal epithelial cell proliferation was reduced in lgr4 mice , with an 80% decrease in crypt paneth cells , suggesting that lgr4 plays a crucial role in intestinal stem cell maintenance ; lgr4 also appears to play a protective role against inflammatory bowel disease . conditional knockout approaches have also been used to avoid the embryonic lethality of lgr4 loss and have revealed additional developmental phenotypes . mice with specific ablation of lgr4 in cells expressing keratin 5 showed focal alopecia and fewer hair placodes , implicating lgr4 action in hair follicle development . loss of lgr4 in keratin 5 cells also disrupted mammary gland branching morphogenesis and delayed ductal elongation and was proposed to impair oviduct function in promoting embryo development . therefore , lgr4 is a key regulator of organ development in a wide variety of extraocular systems . lgr4 is normally expressed in a finely tuned spatiotemporal pattern in the developing eye . using lgr4-driven -galactosidase expression to probe for lgr4 expression in lgr4 heterozygotes , we found that at e12.5 , lgr4 is primarily expressed in a layer of mesenchymal cells between the surface ectoderm and the optic cup ; limited expression is also detectable in the lens and the outer layer of the optic cup ( figure 2 ) . by e16.5 , high - level lgr4 expression is seen in the tips of the optic cup and surrounding mesenchyme , which later form the iris and ciliary body , with lower levels in the cornea , retina , and lens . neonatal mice retain strong expression in the ciliary body , iris stroma , lens , and corneal epithelial cell layer , with lower expression in keratocytes and endoepithelial cells . adult lgr4 mice express lgr4 in the lens epithelium , retinal ganglion and inner nuclear layer , iris stroma , and outer ciliary body cell layer . using the gene trap approach described above , we generated lgr4 mice which had multiple ocular defects . 25 out of 47 lgr4 mice had microphthalmia , with a much higher incidence in males ( 75% ) compared to females ( 37% ) , suggesting that lgr4 interacts with a sex - linked factor in this phenotype . partial corneal opacity , usually accompanied by corneal neovascularization , was present in 18 of 47 mice . a variety of keratopathies ( corneal epithelial plug , corneal inflammation , corneal cyst - like structures , and corneal vascular pannus ) were each found in 4 or more mice , with a higher frequency in male mice . cataracts formed in 13 of 47 lgr4 mice , which were correlated with higher levels of insoluble a - crystallin in the lenses of lgr4 mice . 85% of lgr4 mice had a failure of eyelid fusion in utero leading to eye open at birth , and adult lgr4 mice exhibited exposure keratitis . in a separate paper using an lgr4 exon 18 deletion , lgr4 mice had complete eye open at birth penetrance , but these mice did not survive to adulthood . lgr4 mouse eyelids were morphologically similar to those of lgr4 at e12.5 but had decreased eyelid epithelial cell proliferation . eyelid extension towards the corneal center was noticeably decreased by e15.5 in the absence of lgr4 , with fewer filopodia . cultured lgr4 keratinocytes had decreased migration and proliferation and decreased phospho - egfr , suggesting that lgr4 regulates egfr activation . inhibition of egfr reduced keratinocyte proliferation and migration to levels seen in lgr4 cells , and inhibitory antibodies against hb - egf also reduced wild - type keratinocyte proliferation to lgr4 levels , suggesting that lgr4 may activate egfr signaling in keratinocytes through upregulation of metalloproteases that generate hb - egf ; however , this model awaits confirmation in vivo . finally , anterior segment dysgenesis ( asd ) was common in mice lacking lgr4 . lgr4 mice displayed iris hypoplasia with decreased stroma and smooth muscle as early as postnatal day 4 , diminished ciliary body size and folding , compressed trabecular meshworks with fewer and smaller beams , and a sharper iridocorneal angle that in some cases ( 13% ) was completely closed . lgr4 retinas had detectable loss of inner nuclear layer ganglion cells and disruption of the outer nuclear layer beginning at 6 months of age in 42% of mice examined ( 10 of 24 ) , strongly implicating asd resulting from lgr4 loss in early - onset glaucoma . several lines of evidence implicate the axenfeld - rieger syndrome - related gene pitx2 as a key mediator of lgr4 in eye development . first , the asd phenotype in lgr4 mice closely matches that seen in pitx2 mice , including iris hypoplasia and periocular musculature defects . second , pitx2 was the only transcription factor out of a panel of fourteen key eye development genes to be downregulated in lgr4 mice . finally , pitx2 was shown to be a direct downstream target of lgr4 signaling through the camp / pka / creb pathway . axenfeld - rieger syndrome ( ars ) is a rare genetic disease generally with autosomal dominant inheritance characterized by ocular disorders ( potentially including iris hypoplasia , corectopia , pseudopolycoria , posterior embryotoxon , and iris strands connecting to the trabecular meshwork or other angle structure anomalies ) resulting in elevated intraocular pressure , sometimes accompanied by craniofacial abnormalities ( telecanthus , hypertelorism ) or dental defects ( small or missing teeth ) . cardiovascular abnormalities are also reported in ars patients [ 3639 ] , as well as hearing loss in some cases [ 36 , 40 ] . mutations in either pitx2 or foxc1 have been estimated to account for 40% of ars cases [ 35 , 4145 ] . mice heterozygous for pitx2 display multiple anterior segment defects similar to ars , including corneal endoderm and iris stroma agenesis , corneal mesothelial thickening , coloboma formation , and shortened ventral retina , and pitx2 mice are embryonic lethal due to incomplete closure of the ventral body wall [ 46 , 47 ] . loss of extraocular musculature has also been reported in pitx2 heterozygotes , with a more severe phenotype in pitx2 mice . pitx2 is normally expressed in the neural crest during development beginning at e9.5 , as well as in the developing eye mesoderm , hyaloid space , and eyelid mesenchyme [ 49 , 50 ] . there is a strong dosage dependence of pitx2 for proper development ; transgenic mice overexpressing pitx2a in the corneal mesenchyme and iris show corneal hypertrophy , corneal opacification , iridocorneal attachments , and retinal degeneration . intriguingly , a downstream target of pitx2 is the wnt - signaling antagonist dkk2 , which plays a crucial role in regulating anterior segment morphogenesis . key components of the pathway are the wnt proteins , a family of 19 secreted glycoproteins , the frizzled ( fzd ) receptors , which are seven membrane - spanning receptors for wnt , and the wnt coreceptors lrp5 and 6 . wnt binding results in activation of the downstream transducer dishevelled ( dsh ) , which phosphorylates glycogen synthase kinase 3 ( gsk-3 ) resulting in inactivation of the axin / apc complex that normally ubiquitylates -catenin ( figure 1 ) . as a consequence , -catenin accumulates and translocates to the nucleus , where it associates with tcf / lef transcription factors to regulate gene transcription . negative regulators of wnt signaling include the dikkopf ( dkk ) and secreted frizzled - related proteins ( sfrp ) which bind to frz or wnt , respectively , to inhibit cascade activation . loss of -catenin in the periocular ectoderm results in ectopic lentoid body formation whereas presumptive lens ectoderm expression of dominant active -catenin suppresses lens development , suggesting that low levels of -catenin signaling are required for proper lens formation . ectoderm - specific active -catenin expression disrupts optic cup patterning resulting in a lack of cornea , conjunctiva , and eyelid development . dkk2 mice display a transformation of corneal epithelium into a stratified epithelium , iridocorneal adhesion , eye open at birth phenotype with hypomorphic eyelids and ectopic hair follicles in the presumptive conjunctiva , and ectopic corneal stroma vasculature . therefore , proper spatiotemporal control of wnt/-catenin pathway signaling intensity is essential for anterior segment development . in addition to playing a crucial role in anterior segment development , wnt signaling was reported to have a significant ongoing function in trabecular meshwork ( tm ) cell regulation . rna differential display of cultured human tm cells identified elevated expression of the wnt antagonist secreted frizzled - related protein 1 ( sfrp1 ) in cells from glaucomatous donors , and perfusion of sfrp1 into cultured human eyes resulted in decreased canonical wnt signaling and reduced aqueous outflow . intraocular injection of adenoviral vectors to express sfrp-1 in balb / c mice resulted in a twofold increase in intraocular pressure ( iop ) , an increase that was partially reversible through topical application of a gsk-3 inhibitor , suggesting that sfrp-1 increased iop through inhibiting canonical wnt/-catenin signaling . intriguingly , pitx2 had been reported to be a direct wnt target gene in culture [ 57 , 58 ] , and dkk2 mice have elevated pitx2 expression in the corneal stroma , suggesting the existence of a negative feedback loop regulating pitx2 expression during eye development . we speculate that lgr4 may play a crucial role in integrating these signaling circuits , as lgr4 binding to r - spondin potentiates wnt signaling , leading to pitx2 expression , and activation of g protein signaling through a binding of an unknown ligand to lgr4 results in pitx2 activation and resulting dkk2 expression , which then inhibits wnt signaling even in the presence of both r - spondin and wnt . whether the failure of this signaling circuit is responsible for the ocular defects in lgr4 mice remains to be determined . norrin has been shown to enhance wnt signaling in vitro and to selectively bind to the wnt receptor fzd4 with high affinity to activate canonical wnt/-catenin signaling . mutations in the ndp gene encoding norrin result in norrie disease , an x - linked congenital syndrome characterized by retinal vascularization failure leading to blindness , often accompanied by microcephaly , deafness , hypogonadism , or mental retardation . familial exudative vitreoretinopathy , a less severe disruption in peripheral retina vascularization , can also be caused by mutations in ndp , or alternatively by mutations in fzd4 or lrp5 . loss of the mouse homologue , ndp , causes defects in retinal vasculature which lead to blindness as well as cochlear vasculature , and results in female infertility due to defects in decidualization [ 5963 ] . curiously , a similar defect in retinal vascularization has been reported in mice lacking the wnt receptor fzd4 or coreceptor lrp5 . norrin has very recently been reported to be a ligand for lgr46 , suggesting that it plays a role in wnt signal potentiation similar to that played by r - spondin family members . norrin is normally expressed by mller glial cells of the mouse retina ; however , retinal vascularization defects in ndp mice are overcome by lens - specific expression of norrin , implying a paracrine mode of action that does not require spatial concentration gradient formation . systemic norrin overexpression is embryonic lethal , marked by defective angiogenesis , but can be rescued on either an fzd4 or an lrp5 background . retinal pigment epithelial cell expression of norrin ablated the extent of oxygen - induced retinopathy in young ( p711 ) mice , implying a protective effect of norrin on retinal vasculature . angiopoetin-2 , an angiogenic growth factor expressed in the retinal microvasculature endothelium , has been proposed to be a downstream mediator of norrin 's role in angiogenesis , based on ( 1 ) a similar defect in retinal vascularization in ang-2 mice , ( 2 ) evidence for norrin regulation of ang-2 expression in vivo , and ( 3 ) loss of norrin - induced increased endothelial cell proliferation in the presence of ang-2-blocking antibodies [ 67 , 69 , 70 ] . in addition to the retinal vascularization defects , ndp mice exhibit a loss of retinal ganglion cells ( rgcs ) , with concomitant decrease in normal retinal function [ 60 , 61 , 66 ] . lens - specific transgenic expression of norrin increased rgc proliferation and resulted in thicker retinas in mice two days postnatal . ocular injection of norrin reduced the extent of rgc apoptosis and axon loss following nmda injection , which is in agreement with a report demonstrating antiapoptotic effects of norrin on a cultured rgc cell line . the rgc protective effect of norrin was partially mediated through induction of several growth factors ( including fibroblast growth factor 2 , ciliary neurotrophic growth factor , and brain - derived neurotrophic growth factor ) by mller cells , and partly through a direct effect of norrin on rgcs . intriguingly , no activation of canonical wnt/-catenin signaling was detected in rgcs following norrin treatment , suggesting that norrin acts through a yet - undiscovered signal transduction pathway to prevent excitotoxicity in rgcs . given the recent finding that lgr4 is able to bind norrin , this leads to the speculation that this neuroprotective effect of norrin may be mediated by g protein - coupled signaling downstream of lgr4 . in summary , there is strong evidence that lgr4 is a key regulator of pitx2 in anterior segment formation and that disruption of this signaling network can result in early - onset glaucoma in a mouse model . furthermore , tantalizing new evidence suggests that lgr4 functioning as a receptor for norrin may be implicated in retinal vascularization and/or other functions of norrin , such as retinal neuron protection from damage . first , what is the endogenous ligand activating lgr4 signaling through the camp / pka pathway resulting in regulation of pitx2 and multiple other downstream targets ? identification of this unknown lgr4 activator is essential for mapping the spatiotemporal profile of lgr4 activity during development and may serve as a starting point for designing small - molecule agonists or inhibitors for potential therapeutic use . could norrin be the unknown sex - linked factor responsible for the higher incidence of microphthalmia in male lgr4 mice ? deciphering the relative importance of classical g protein - coupled versus wnt/-catenin signaling in lgr4 function remains to be unraveled . an area of particular therapeutic interest is the use of stem cells for glaucoma treatment . some evidence exists suggesting the existence of stem or progenitor cells in the region of schwalbe 's line ( called by several names including schwalbe 's line cells , trabecular meshwork insert cells , and progenitors for endothelium and trabeculum , and functionally assayed using sphere formation in vitro ; see for an excellent review ) . given the roles of lgr5 and lgr6 in stem cell self - renewal in a wide variety of tissues , together with the established function of r - spondin ( and norrin ) to potentiate wnt signaling through lgr46 , we speculate that lgr4 or its family members may play a key role in maintenance of stem / progenitor cells in this region . understanding such a role will be vital in progress towards using stem cells to regenerate a blocked trabecular meshwork as an approach towards relieving intraocular pressure .

the leucine - rich repeat - containing g protein - coupled receptor 4 ( lgr4 , also called gpr48 ) plays a key role in multiple developmental processes , and mice lacking lgr4 display anterior segment dysgenesis leading to early - onset glaucomatous retinal ganglion cell loss as well as defective eyelid formation . this paper will review lgr4 signaling and its regulation of the axenfeld - rieger syndrome gene pitx2 , a crucial developmental transcription factor . in addition , wnt signaling plays an important role in eye development , with norrin functioning to activate the wnt receptor frizzled 4 required for proper retinal vascularization . recent discoveries identifying lgr4 as a receptor for norrin highlight the potential for lgr4 function in retinal vascularization . finally , several unanswered questions impeding a full understanding of lgr4 in glaucoma are considered as avenues for further research .

You are an expert at summarizing long articles. Proceed to summarize the following text: hepatocellular carcinoma ( hcc ) is a rare tumor in western countries , accounting for less than 2% of all neoplasms in united states . in contrast , hcc is relatively common in asian countries , where the hepatitis b virus is endemic27 ) . the survival of patients with hcc has been prolonged with improvements in various diagnostic tools and treatment modalities1023 ) . hcc has been also reported to metastasize frequently to the skeletal system - vertebrae , pelvis , ribs , etc .- with an incidence ranging from 2% to 16%122226 ) . the treatment of metastatic spine disease has evolved significantly in the past decade with the advancements in surgical and radiation techniques2 ) . as surgical techniques and instruments improve , surgical treatment followed by adjuvant radiotherapy is affording a longer survival period and better quality of life than radiotherapy alone92128 ) . recently , a minimally invasive surgical technique , spine radiosurgery , and new targeted chemotherapy have been introduced . these treatment modalities are being applied clinically4813172435 ) . if a patient experiences neurologic deterioration or loss of stability , surgical decompression and stabilization with instrumentation may be a better option than radiotherapy , considering the delayed response of solid tumors to radiotherapy692834 ) . the aim of the study was to determine the long - term surgical treatment outcomes associated with the systemic condition of hcc presenting with spine metastases , and to figure - out the survival - related factors . patients who underwent an operation for spinal hcc metastases from february 2005 to december 2013 in the spine center of the authors ' institute were enrolled in this study . patients with susceptive instability , spinal instability neoplastic score ( sins ) over score of 6 , and/or patients who already received radiotherapy , or stereotactic radiosurgery , underwent operation . patients who underwent a vertebroplasty or kyphoplasty procedure were not included in this study patient demographics and clinical characteristics were obtained from the patients ' electronic medical records . the general condition of patients , including liver function , was evaluated using the child - pugh classification29 ) . to evaluate instability of tumor sins was calculated11 ) . to evaluate a condition of tumor the tokuhashi scoring system ( general condition , number of extraspinal bone metastases foci , number of metastases in the vertebral body , metaseses to the major internal organs , primary site of the cancer , and palsy)31 ) , and the tomita scoring system ( primary site of the cancer , number of visceral metastases , and number of bone metastases)32 ) was calculated in all patients . recently , the authors have proposed revisions , resulting in modified tomita and tokuhashi scoring systems for spinal metastasis20 ) . even with an ambulatory aid was considered as possible , and a patient who could not walk at the out - patient department after the operation was considered as not - possible . patients with refractory pain , neurological deficit , or the potential for neurological deficit were indicated for surgery . three patients had two spinal operations each , at different levels , so 36 operations were performed in all . the goals of the metastatic spinal tumor surgery were : to decompress a neural component and/or stabilize the spine to improve neurological deficits and alleviate pain . in most cases , instrumentation was performed for stabilization , by anterior , posterior , or circumferential means . preoperatively , conventional radiotherapy to the index spine was performed in 11 cases ( total dose range , 20 gy to 39 gy ) . statistical analyses of variables were carried out using commercial software ( pasw statistics , version 22 ; spss inc . , the survival rate was estimated by the kaplan - meier method , and differences were analyzed by the log - rank test . comparison between preoperative status and postoperative status was analyzed by a wilcoxon signed rank test . patients who underwent an operation for spinal hcc metastases from february 2005 to december 2013 in the spine center of the authors ' institute were enrolled in this study . patients with susceptive instability , spinal instability neoplastic score ( sins ) over score of 6 , and/or patients who already received radiotherapy , or stereotactic radiosurgery , underwent operation . patients who underwent a vertebroplasty or kyphoplasty procedure were not included in this study patient demographics and clinical characteristics were obtained from the patients ' electronic medical records . the general condition of patients , including liver function , was evaluated using the child - pugh classification29 ) . to evaluate instability of tumor sins was calculated11 ) . to evaluate a condition of tumor the tokuhashi scoring system ( general condition , number of extraspinal bone metastases foci , number of metastases in the vertebral body , metaseses to the major internal organs , primary site of the cancer , and palsy)31 ) , and the tomita scoring system ( primary site of the cancer , number of visceral metastases , and number of bone metastases)32 ) was calculated in all patients . recently , the authors have proposed revisions , resulting in modified tomita and tokuhashi scoring systems for spinal metastasis20 ) . even with an ambulatory aid was considered as possible , and a patient who could not walk at the out - patient department after the operation was considered as not - possible . patients with refractory pain , neurological deficit , or the potential for neurological deficit were indicated for surgery . three patients had two spinal operations each , at different levels , so 36 operations were performed in all . the goals of the metastatic spinal tumor surgery were : to decompress a neural component and/or stabilize the spine to improve neurological deficits and alleviate pain . in most cases , instrumentation was performed for stabilization , by anterior , posterior , or circumferential means . preoperatively , conventional radiotherapy to the index spine was performed in 11 cases ( total dose range , 20 gy to 39 gy ) . statistical analyses of variables were carried out using commercial software ( pasw statistics , version 22 ; spss inc . , the survival rate was estimated by the kaplan - meier method , and differences were analyzed by the log - rank test . comparison between preoperative status and postoperative status was analyzed by a wilcoxon signed rank test . the patients ' median age at the initial operation was 56 years ( range , 28 years to 71 years ) . four patients had been diagnosed with spinal metastases simultaneously ( within one month ) of their primary hcc diagnoses . in the other 29 patients , the spinal metastases occurred more than 6 months after the diagnosis of primary hcc ( median interval , 18 months ; range , 6 - 86 months ) . twenty - nine patients were hepatitis b viral carriers , one was a hepatitis c viral carrier , and other three patients were non - hepatitis b , non - hepatitis c viral carriers . among the three patients , one patient had a history of heavy alcoholic consumption . preoperatively , 29 patients were child - pugh class a , 4 were class b , and no patient was class c. preoperatively , 11 patients lost their ambulatory function , and 25 patients maintained their ambulatory function . there was no statistically significant difference between the pre - and post - operative status of child - pugh classification and ambulatory function . spinal metastases were located at the cervical level ( n=10 ) , thoracic level ( n=15 ) , and lumbar level ( n=11 ) . in terms of sins , 2 patients were score of 6 , 29 patients were between 7 and 12 , 5 patients were between 13 and 18 . among the subjects , there were several post - operative complications . there was one case of operative site infection . during the follow - up period , 27 patients died , three patients were lost to follow - up , and three patients survived . the median overall survival was 261 days ( range , 22 - 1359 days ) after the diagnosis of metastasis , and 180 days ( range , 19 - 1351 days ) after the initial operation . as determined by kaplan - meier survival analysis , the survival time was not related with age , sex , location of tumor , preoperative child - pugh classification , preoperative ambulatory function , preoperative radiotherapy status , type of operation , or the administration of sorafenib ( table 1 ) . when patients were classified by tomita score , there was a statistically significant difference between the groups ( p=0.023 ) . applying the revised tokuhashi and tomita scoring systems , the results were quite similar ( table 2 , fig . the patients ' median age at the initial operation was 56 years ( range , 28 years to 71 years ) . four patients had been diagnosed with spinal metastases simultaneously ( within one month ) of their primary hcc diagnoses . in the other 29 patients , the spinal metastases occurred more than 6 months after the diagnosis of primary hcc ( median interval , 18 months ; range , 6 - 86 months ) . twenty - nine patients were hepatitis b viral carriers , one was a hepatitis c viral carrier , and other three patients were non - hepatitis b , non - hepatitis c viral carriers . among the three patients , one patient had a history of heavy alcoholic consumption . preoperatively , 29 patients were child - pugh class a , 4 were class b , and no patient was class c. preoperatively , 11 patients lost their ambulatory function , and 25 patients maintained their ambulatory function . there was no statistically significant difference between the pre - and post - operative status of child - pugh classification and ambulatory function . spinal metastases were located at the cervical level ( n=10 ) , thoracic level ( n=15 ) , and lumbar level ( n=11 ) . in terms of sins , 2 patients were score of 6 , 29 patients were between 7 and 12 , 5 patients were between 13 and 18 . among the subjects , there were several post - operative complications . during the follow - up period , 27 patients died , three patients were lost to follow - up , and three patients survived . the median overall survival was 261 days ( range , 22 - 1359 days ) after the diagnosis of metastasis , and 180 days ( range , 19 - 1351 days ) after the initial operation . as determined by kaplan - meier survival analysis , the survival time was not related with age , sex , location of tumor , preoperative child - pugh classification , preoperative ambulatory function , preoperative radiotherapy status , type of operation , or the administration of sorafenib ( table 1 ) . when patients were classified by tomita score , there was a statistically significant difference between the groups ( p=0.023 ) . applying the revised tokuhashi and tomita scoring systems , the survival time of patients with hcc has increased to more than 2 years during the past decade33 ) . hence , it is more common to encounter a patient with spinal metastases . spinal metastases can cause neurologic deficits with or without compression fractures , and back pain , both of which affect the patient 's quality of life and result in poor outcomes1 ) . recent studies show poor overall survival after a diagnosis of spinal metastasis , usually around a year71936 ) . chen et al.7 ) compared the existing preoperative scoring systems - the tokuhashi scoring system , the tomita scoring system , the van der linden scoring system , and the bauer and wedin scoring system - to find useful prognostic factors . in addition , serum albumin ( 37 g / l ) and ldh ( < 200 however , our study and a study by zhang et al.36 ) , show the tomita scoring system is an independent prognostic factor . these studies show the limitations of the existing preoperative scoring system , and suggest a need for a new prognostic scoring system . due to advances in medical treatment and anesthesology , researchers have proposed a new prognostic scoring system by modifying the tokuhashi and tomita scoring systems20 ) . the resulting systems seem to be more prognostic than previous scoring systems for patients with tumors of the entire spine . but , with the small number of patients , the validation was limited in this study . kim et al.19 ) suggest that preoperative ambulatory status and hepatic function ( child - pugh classification ) were significantly correlated with survival time . but , child - pugh classification was not shown to predict the prognosis of hcc patients with spinal metastases in our study . the current recommendation of high - grade spinal cord compression for solid spine metastases is surgical decompression and radiotherapy to achieve local tumor control . patchell et al.28 ) in 2005 showed better outcomes for patients undergoing surgery and radiation therapy compared to patients undergoing radiation treatment alone . they suggested the time interval between treatment modalities should be at least 1 week to minimize wound complications . maranzano and latini25 ) reported that radioresistant tumors , such as hcc , demonstrated only a 20% response rate in conventional radiotherapy ; in contrast , radiosurgery for spine metastases has demonstrated better clinical responses . yamada et al.35 ) published a prospective cohort study , regarding treatment with radiosurgery for radioresistant oligometastatic tumors . with dose - escalation from 18 gy to 24 gy , many other studies reported that radiosurgery for metastatic spine disease is safe and effective with durable symptomatic responses and local control for radioresistant histologies3451430 ) . as confidence and experience with the use of radiosurgery as a postoperative adjuvant grow , surgical resection of metastatic disease has become less aggressive , with the expectation that radiosurgery will control the residual disease . preoperative radiation therapy was not shown to help prolong the overall survival of the patients . sorafenib is an orally active multi - kinase inhibitor that has proven to prolong overall survival and progression - free survival in advanced hcc824 ) . but , the difference of survival time between the group who were prescribed sorifenib and the group that did not receive it was not significant in the hcc with spinal metastasis patients . the most important goal of surgical resection in patients with spinal metastases is to preserve or restore neurological function . kim et al.19 ) reported a 29% ( 4/14 ) rate of restoration of ambulatory function . preoperative ambulatory ability was significantly correlated with the postoperative ambulation period in their study16 ) . in contrast , our study shows an 18% ( 2/11 ) rate of restoration of ambulatory function . in fact , there was no difference of ambulatory ability status between pre- and post - operatively in the present study . most patients had surgical decompression within a week after visiting the hospital . however , 6 patients visited the hospital more than one week after the symptom occurred , and some came after 20 days . is based on a retrospective medical record review , the data is limited , and a prospective study should be conducted to further validate its findings . chen et al.7 ) compared the existing preoperative scoring systems - the tokuhashi scoring system , the tomita scoring system , the van der linden scoring system , and the bauer and wedin scoring system - to find useful prognostic factors . in addition , serum albumin ( 37 g / l ) and ldh ( < 200 however , our study and a study by zhang et al.36 ) , show the tomita scoring system is an independent prognostic factor . these studies show the limitations of the existing preoperative scoring system , and suggest a need for a new prognostic scoring system . due to advances in medical treatment and anesthesology , researchers have proposed a new prognostic scoring system by modifying the tokuhashi and tomita scoring systems20 ) . the resulting systems seem to be more prognostic than previous scoring systems for patients with tumors of the entire spine . but , with the small number of patients , the validation was limited in this study . kim et al.19 ) suggest that preoperative ambulatory status and hepatic function ( child - pugh classification ) were significantly correlated with survival time . but , child - pugh classification was not shown to predict the prognosis of hcc patients with spinal metastases in our study . the current recommendation of high - grade spinal cord compression for solid spine metastases is surgical decompression and radiotherapy to achieve local tumor control . patchell et al.28 ) in 2005 showed better outcomes for patients undergoing surgery and radiation therapy compared to patients undergoing radiation treatment alone . they suggested the time interval between treatment modalities should be at least 1 week to minimize wound complications . maranzano and latini25 ) reported that radioresistant tumors , such as hcc , demonstrated only a 20% response rate in conventional radiotherapy ; in contrast , radiosurgery for spine metastases has demonstrated better clinical responses . yamada et al.35 ) published a prospective cohort study , regarding treatment with radiosurgery for radioresistant oligometastatic tumors . with dose - escalation from 18 gy to 24 gy , many other studies reported that radiosurgery for metastatic spine disease is safe and effective with durable symptomatic responses and local control for radioresistant histologies3451430 ) . as confidence and experience with the use of radiosurgery as a postoperative adjuvant grow , surgical resection of metastatic disease has become less aggressive , with the expectation that radiosurgery will control the residual disease . preoperative radiation therapy was not shown to help prolong the overall survival of the patients . sorafenib is an orally active multi - kinase inhibitor that has proven to prolong overall survival and progression - free survival in advanced hcc824 ) . but , the difference of survival time between the group who were prescribed sorifenib and the group that did not receive it was not significant in the hcc with spinal metastasis patients . the most important goal of surgical resection in patients with spinal metastases is to preserve or restore neurological function . kim et al.19 ) reported a 29% ( 4/14 ) rate of restoration of ambulatory function . preoperative ambulatory ability was significantly correlated with the postoperative ambulation period in their study16 ) . in contrast , our study shows an 18% ( 2/11 ) rate of restoration of ambulatory function . in fact , there was no difference of ambulatory ability status between pre- and post - operatively in the present study . most patients had surgical decompression within a week after visiting the hospital . however , 6 patients visited the hospital more than one week after the symptom occurred , and some came after 20 days . is based on a retrospective medical record review , the data is limited , and a prospective study should be conducted to further validate its findings . for patients with spinal metastases from hcc , survival time was not correlated with age , sex , level , preoperative child - pugh classification , preoperative ambulatory function , preoperative radiotherapy , type of operation , administration of sorafenib at any point , or the tokuhashi scoring system . only the tomita scoring system was shown to provide practicable and highly predictive prognostic value in patients with spinal metastases from hcc . considering the other reports , the existing scoring system has limitations for patients with spinal metastses . a new prognostic scoring system should be introduced . still , surgical treatment is a prerequisite for the restoration of stability or immediate decompression . the technology and other advancements in chemotherapy and radiotherapy are rapidly improving , so target agents or radiosurgery are potentially very promising . with the advent of effective multimodality treatments , the patients ' survival and quality of life will be improved .

objectiverecently , the survival of patients with hepatocellular carcinoma ( hcc ) has been prolonged with improvements in various diagnostic tools and medical treatment modalities . consequently , spine metastases from hcc are being diagnosed more frequently . the accurate prediction of prognosis plays a critical role in determining a patient 's treatment plan , including surgery for patients with spinal metastases of hcc . we investigated the clinical features , surgical outcomes , and prognostic factors of hcc presenting with spine metastases , in patients who underwent surgery.methodsa retrospective review was conducted on 33 hcc patients who underwent 36 operations ( three patients underwent surgical treatment twice ) from february 2006 to december 2013 . the median age of the patients was 56 years old ( range , 28 to 71 ; male : female=30 : 3).resultsoverall survival was not correlated with age , sex , level of metastases , preoperative child - pugh classification , preoperative ambulatory function , preoperative radiotherapy , type of operation , administration of sorafenib , or the tokuhashi scoring system . only the tomita scoring system was shown to be an independent prognostic factor for overall survival . comparing the child - pugh classification and ambulatory ability , there were no statistically differences between patients pre- and post-operatively.conclusionthe tomita scoring system represents a practicable and highly predictive prognostic tool . even though surgical intervention may not restore ambulatory function , it should be considered to prevent deterioration of the patient 's overall condition . additionally , aggressive management may be needed if there is any ambulatory ability remaining .

You are an expert at summarizing long articles. Proceed to summarize the following text: a variety of foreign bodies like glass fragments , metal , and wood splinters can be retained in the nasal cavity and paranasal sinuses ( pns ) following penetrating injuries of the facio - maxillary region . a 16-year - old male met with a road traffic accident in which he suffered facial injuries . computed tomography ( ct ) scan of pns showed multiple facial fractures with retained nasal secretions and hematoma . the patient underwent intermaxillary fixation for the facial fractures and was discharged in a stable condition . he presented 8 months later with complaints of right nasal block and foul - smelling nasal discharge . rigid nasal endoscopy showed medialized inferior turbinate with granulation tissue and adhesions in the right inferior meatus . a repeat ct scan [ figures 1a and b ] showed three hyperdense cylindrical foreign bodies ( white arrow ) in the right inferior meatus , surrounded by hypodense secretions . on review of previous ct [ figure 1c and d ] , well - marginated cylindrical hypodense lesions [ hounsfield units ( hu ) -272 ] , which resembled air density , were noted in the right inferior meatus , surrounded by hypodense secretions ( white arrow ) . on comparison , a provisional diagnosis of retained intranasal wooden foreign bodies was made . at surgery , three wooden pieces [ figure 1e ] were found in the inferior meatus covered with granulation tissue , which were completely removed . postoperatively , the patient reported significant resolution of his symptoms and is doing well on follow - up . a 16-year - old boy with chronic right - sided mucopurulent nasal discharge and history of facial trauma 8 months back . ct pns axial and coronal images ( a and b ) reveal well - defined hyperdense cylindrical foreign bodies ( arrow ) in the right inferior meatus , surrounded by hypodense secretions . previous ct pns axial and coronal images ( c and d ) acquired after trauma reveal well - marginated cylindrical air attenuation lesions ( arrow ) at the same site . inferior meatus and the region anterior to middle turbinate are the common sites for retained foreign bodies . in the acute stage , swelling of the surrounding mucosa can result in impaction and non - visualization of the foreign body . gradually , due to chronic inflammation , deposition of calcium , magnesium phosphate , and carbonate occurs , resulting in the formation of a rhinolith . complications associated with sinonasal foreign bodies include epistaxis , orbital cellulitis , and subperiosteal abscess . takasaki et al . have reported a case of chronic retention of multiple wooden toothpicks in an adult prisoner . they concluded that ct may not adequately distinguish wood from surrounding soft tissues and recommended magnetic resonance imaging for detection of intranasal wooden foreign bodies . on ct , in the acute stage , it presents as low - attenuation linear or cylindrical focus surrounded by hypodense inflammatory soft tissue . in the chronic stage , due to mineral deposition , it becomes hyperdense . on mri , in the acute stage , it appears as t1- and t2-hypointense cylindrical focus with surrounding t2-hyperintense inflammatory tissue . in soft tissues and orbit , high contrast with surrounding skeletal muscle and fat a wooden foreign body can be missed in the acute stage on ct due to lack of contrast with intranasal air . however , the presence of well - marginated geometrical shape to the apparent air attenuation structure should arouse suspicion of an intranasal wooden foreign body . in addition , as noted in our case , the hu of the wooden pieces ( hu -272 ) was relatively less compared to that of air ( -900 to -1000 ) . retrospective viewing of the ct images at wider window settings ( like bone window and lung window ) helped in better differentiation of the wooden foreign bodies from air . image viewing using a combination of coronal and axial planes , slice thickness of 3 mm , window width ( ww ) of 3000 , and window level ( wl ) of 500 is recommended for detection of intranasal wooden foreign bodies . ho et al . have noted that a ww of 1000 hu and wl of -500 hu ( lung window ) is optimal for the detection of wooden foreign bodies on ct . on the contrary , in the chronic stage , mineralized hyperdense wooden foreign bodies can be easily detected due to high contrast with the surrounding air . our case demonstrates the importance of imaging in the detection of intranasal foreign body , especially in the acute setting of facial trauma wherein the excessive swelling of nasal mucosa may impair the clinical visualization of foreign body . in a chronic setting too , granulation tissue may impede the clinical detection of the foreign body . in the setting of suspected foreign body , we recommend that initially a ct scan should be done to detect any metallic foreign body . these ct images should also be viewed in wide window widths [ bone window ( wl of around 500 hu , ww of 3000 hu ) and lung window ( wl of -500 hu , ww of 1500 hu ) ] to look for non - radiopaque foreign bodies like wooden foreign bodies , which may appear hypodense and of apparent air attenuation on the soft - tissue window settings . however , on wider window settings , they are seen to be less hypodense than air . mri may be required in certain instances to demonstrate impacted wooden foreign bodies the detection of intranasal wooden foreign body in the acute stage and prompt removal can prevent significant morbidity to the patient . our case highlights the role of imaging in detecting intranasal wooden foreign bodies in different stages and a possibility of error in diagnosis . intranasal wooden foreign body may be missed in the acute stage because of apparent air attenuation of the foreign body and lack of contrast with the surrounding intranasal air . radiologists need to be aware of the ct imaging appearances of wood in various stages for early detection and management .

we report a case of post traumatic impacted intranasal wooden foreign body in a 16 year old boy , which was undetected on computed tomography in the acute stage . intranasal wooden foreign body may be missed on ct in the acute stage because of apparent air attenuation of the foreign body and lack of contrast with the surrounding intranasal air . radiologists need to be aware of the ct imaging appearances of wood in various stages for early detection and management .

You are an expert at summarizing long articles. Proceed to summarize the following text: steinman was a physician at massachusetts general hospital ( boston , ma ) in 1968 when his interest in immunology was first piqued by a lecture series on new cellular immunology . macfarlane burnet 's clonal selection theory , which proposed that every antigen is recognized by a single , clonal immune cell , was then about a decade old and had become the bedrock of immunology . b and t cells had been identified as the perpetuators of antibody- and cell - mediated immunity , respectively , and their mechanisms were being rapidly uncovered . but despite all the advances in understanding the immune system since burnet 's time , steinman notes , one fundamental question remained unanswered : we still did n't know how an immune response got started.we were still thinking of dcs only as cells that instigated a primary immune response . what we did n't appreciate was that there were many different facets of the immune response that dcs could control.-ralph steinman we were still thinking of dcs only as cells that instigated a primary immune response . what we did n't appreciate was that there were many different facets of the immune response that dcs could control . as a physician , steinman had firsthand experience with this mystery . the immune systems of tuberculosis patients and of healthy humans who had been vaccinated with the tuberculosis vaccine recognized the bacterial antigens in skin tests . we had the beautiful clonal selection theory , which proposed that a preexisting clone would recognize and respond to any antigen that comes along , says steinman . but there was this big glaring gap where , in some instances , a foreign antigen was simply not inducing a response [ in nonexposed individuals ] . to understand how antigens prompt immune reactions , steinman began postdoctoral work in the laboratory of zanvil cohn at rockefeller university . cohn was a pioneer in the study of macrophages and their role in taking in and breaking down proteins and infectious agents . in this lab , steinman began by studying how macrophages captured and presented soluble antigens to initiate an immune response . the macrophage was regarded as a good system to study immune response initiation , says steinman , because they were thought to present intact antigen . but he found that the macrophages did n't present whole antigen ; they simply degraded it ( 1 ) . leaving macrophages behind , steinman turned to a mixture of cells from the mouse spleen . suspensions of cells from this organ , which is one of the sites where immune responses get started , had been recently shown to induce antibody responses against sheep red blood cells ( 2 ) . but lymphocytes purified from the spleen could not bring about these responses unless they were mingled with a population of so - called accessory cells , a portion of which were macrophages . i did something that evidently had not been done before , he says . he found , mixed in with the macrophages , star - shaped cells unlike any immune cell seen before . when they crawled , the newcomers extended and retracted their radial branches . since they were not phagocytic , they were lighter than macrophages on density gradients . as a result , recalls steinman , we could separate them cleanly from macrophages , even though this was before the days of monoclonal antibodies . these cells were not just a culture dish artifact ; steinman found them in mouse peripheral lymphoid organs . and unlike the more populous macrophages steinman and cohn were convinced that a new cell type had arrived in the immune world they christened them dendritic cells and described their physical and physiological features in two papers in the journal of experimental medicine ( 3 , 4 ) . the papers generated a spirited debate about whether these cells were a new class of white blood cells or merely an artifact . for believer steinman , however , the next step was to test whether the dcs were the missing link between recognition and immune response . he designed a protocol to purify dcs from mouse spleen fractions that michel nussenzweig , one of steinman 's first graduate students , calls a cumbersome , onerous task that yielded only a tiny number of dcs . nussenzweig made the enrichment process easier when he developed a dc - specific antibody a few years later ( 5 ) . wesley van voorhis , another graduate student , later used the same protocol to isolate dcs from human blood ( 6 ) . a phase contrast image shows a dendritic cell . using the enriched population , steinman found that these cells expressed very high levels of a surface antigen called mhc class ii , which was later shown to be an antigen - presenting molecule . steinman tested whether dcs might be better than known antigen - presenting cells ( apcs ) at initiating immune responses . he and his then technician , maggi pack , added dcs or known apcs to a mixture of lymphocytes from two different donors an assay known as a mixed leukocyte reaction ( mlr ) . they found that the dcs were an impressive 100-fold better at activating t cells in the mix than were macrophages or b cells ( 7 ) . i was shocked by the numbers , says pack , but ralph had already moved on to designing the next experiment . we presented our findings at a faseb meeting and angered a lot of people , he recalls . they were so attached to the idea that human monocytes were the best antigen presenters . the assay proved that dcs presented their own antigens to t cells . but to prove that dcs were relevant physiologically , the team had to show that dcs could pick up external antigens , process and present them , and thereby activate lymphocytes . only the dcs captured the antigen and presented it to t cells , which then became cytotoxic . this was the first demonstration that dcs could prompt cd8 t cell mediated immunity ( 8).i was shocked by the numbers , says maggi pack , but ralph had already moved on to designing the next experiment . i was shocked by the numbers , says maggi pack , but ralph had already moved on to designing the next experiment . dendritic cells ( brown ) swarm around t cells ( blue ) to present them with antigen . courtesy of nikolaus romani kayo inaba , a postdoc who had just arrived in the lab , showed that dcs also induced the development of cd4 , helper t cells that then initiated potent antibody responses ( 9 ) . but steinman admits , we were still thinking of dcs only as cells that instigated a primary immune response . what we did n't appreciate was that there were many different facets of the immune response that dcs could control . dcs had so far been identified in the spleen and in the t cell areas of peyers patches . a good deal of this work had been done in steinman 's lab in new york . but robert lechler and richard batchelor at hammersmith hospital ( london ) recapitulated nussenzweig 's mlr experiment in vivo by showing that dcs injected into rats induced the rejection of foreign kidney grafts ( 10 ) . the dcs also began to show up in other areas of the immune system , including the lymph system . the identification of dcs in rabbit and rat lymph vessels , by brigette balfour , gordon macphearson , stella knight , and others in england , and hemmo drexhage in the netherlands , introduced the idea that these cells were a roving surveillance network ( 11 , 12 ) . steinman proposed that dcs were picking up antigen in peripheral tissues and then migrating to lymphoid organs to start the immune response . this idea would explain why immune responses could also begin in the draining lymph nodes nearest the site of antigen deposition . to test the idea , steinman 's team began to look for dcs in peripheral tissues . austrian scientists gerold schuler and nikolaus romani , who had been studying antigen presentation in the skin , arrived in steinman 's lab to investigate whether skin langerhans cells ( lcs ) were a form of dcs . schuler found that lcs could pick up antigen but did not stimulate t cells unless they were first cultured with the cytokine gm - csf ( 13 ) . romani found that the gm - csfmatured cells could no longer capture antigen but were adept at stimulating t cells ( 14 ) . immature dendritic cells ( left ) that capture antigen extend processes and mature into apcs ( right ) . the biggest hurdle to dc research thus far was their limited availability monoclonal antibodies and cell sorters easily sifted dcs from tissue suspensions , but dcs were a relatively rare population to begin with . people were n't even convinced that these were cells with a separate pathway of differentiation , recalls steinman . most people were n't making dcs to test them , he says . only those who took the trouble were impressed by their potency.steinman's response to all the theorizing : just do the experiment ! steinman 's response to all the theorizing : just do the experiment ! but in the early 1990s , three teams , including steinman 's group , grew dcs from different sources . steinman and his team discovered that dcs could be grown from gm - csf treated blood and bone marrow progenitor cells . teams led by jacques banchereau at schering plough in france and antonio lanzavecchia at the basel institute in switzerland found that dcs could be grown from cd34 hematopoeitic progenitor cells from humans and differentiated from human blood monocytes ( 1517 ) . immature dcs that were cultured with antigens and injected into mice jumpstarted immune responses without help from adjuvants such as alum or freund 's ( 18 ) . other groups started to exploit this adjuvant - like nature of dcs to boost the immune systems of cancer patients . monocytes were extracted from patients , differentiated into dcs , and loaded with tumor antigens . when these dc vaccines were reinfused into patients , some tumors were destroyed . but the failure of injected dcs to migrate properly and establish themselves in lymphoid tissues prevented this approach from being more successful . madhav dhodapkar , a rockefeller scientist who is using dcs to boost human immunity to multiple myeloma tumors , benefits regularly from steinman 's input . but he cautions that this research area is still very much in its early stages . many groups have shown that this approach has immune efficacy and can be carried out safely . but it is still an evolving science , and there is a lot left to do to optimize this process . steinman himself is less than pleased with the speed with which this line of work has evolved . this idea [ of dc immunotherapy ] has progressed very slowly , he laments , even though immunology clearly needs to be explored in depth to help cancer patients . he blames poor funding and badly coordinated studies for the slow progress of dcs from the lab bench to the intravenous drip . a decade after dcs were identified as powerful immune enhancers , steinman and nussenzweig now also a faculty member at rockefeller added a new twist to the dc tale . they found that when antigens were captured by dcs that were unaltered either by culturing or inflammation , the dcs killed t cells instead of activating them , thus establishing tolerance ( 19 ) . inaba , who continues to collaborate with steinman , simultaneously showed that immature dcs that corral dying infected cells also fail to activate t cells and induce tolerance ( 20 ) . steinman 's group later found that dcs also induced the expansion of regulatory t cells ( 21 ) . this work suggests that the dc network is wired to steer the body away from self - reactivity when danger is absent . mhc class ii proteins ( red ) inside immature langerhans cells ( green ) are expressed on the surface when the cells mature ( bottom ) . for steinman , the question of how antigens are delivered to start an immune response has evolved into how dcs control the quality of the immune response . he and his group are currently trying to target antigens directly to the dc receptors that take them in a process shown to enhance immunity . cd205 ( also known as dec-205 ) is the primary antigen - binding receptor in many dc subsets . coupling an anti - cd205 monoclonal antibody to an antigen increases the antigen 's presentation by 100 fold ( 22 ) . steinman also wonders how maturation signals tweak the dcs to modify immune responses , for example , to guide the development of t helper ( th)-cells into th1 or th2 subsets . we need to understand what information a t cell needs to receive from a dc before it starts responding along a particular path , he says . as dcs vary their expression of costimulatory receptors such as cd40 , cd70 , and cd80/86 depending on the maturation stimuli , the strength and quality of the stimulation signal they impart probably help determine the function of the responding cell.it took almost ten years for people to accept that dcs and their immune potency were for real . it took almost ten years for people to accept that dcs and their immune potency were for real . steinman credits the progress and interest that dc biology has enjoyed to fellow dc enthusiasts in his own lab and around the globe , endearing him to his coworkers and peers . ralph 's way of pursuing an idea was not to put one step in front of another ; he liked to get people to approach the same problem from different angles . others recall his eagerness to get to the scientific task at hand when ideas were bandied about during lab meetings . steinman 's response to all the theorizing : just do the experiment ! ralph steinman 's research career , which began with finding a new cell , resulted in the founding of an entire research field . ralph was the lone voice in the desert , says van voorhis . it took almost ten years for people to accept that dcs and their immune potency were for real . but history proved him right .

ralph steinman is perhaps best known as a codiscoverer of dendritic cells ( dcs ) and as a founding father of the research area that these cells have spawned . for his discovery , steinman was recently awarded the 2007 albert lasker award for basic medical research . yet the man behind the research holds his praise for the many other scientists in the u.s . and abroad who have further advanced the therapeutic promise of dcs .

You are an expert at summarizing long articles. Proceed to summarize the following text: the prevalence of prostatitis is 8.2% ( range 2.2%9.7% ) and the national institutes of health ( nih ) classified prostatitis into four categories : acute bacterial , chronic bacterial , chronic prostatitis / chronic pelvic pain syndrome , and asymptomatic ( 1 ) . acute bacterial prostatitis ( abp ) is a rare disease accounting for only 5% of prostatitis cases ( 2 ) . however , abp requires immediate treatment because it can lead to complications such as urosepsis ( 3 ) . inadequate antibiotic use leads to treatment failure and can increase mortality ( 4 ) . in patients with abp , fluoroquinolones are commonly used as first empirical antibiotics because of the broad action spectrum , good bioavailability , and high concentrations in the prostatic tissue ( 5 ) . unfortunately , antibiotic resistance in urinary tract infections ( utis ) has increased globally ( 6 ) . for example , the rate of ciprofloxacin resistance in the united states increased from 3% in 2000 to 17.1% in 2010 ( 6 ) . in korea , the use of fluoroquinolones has also been increasing , and consumption doubled during 20012012 ( 7 ) . with these trends , the incidence of ciprofloxacin - resistant microbes increased from 15.2% in 2002 to 22.5% in 2012 in patients with community - onset acute pyelonephritis ( 8) . based on a recent study , fluoroquinolones were not recommended as a first empirical antibiotic for complicated utis in the asia - pacific region due to the high rates of quinolone resistance ( > 20% ) ( 9 ) . in addition , the increasing extended - spectrum beta - lactamase ( esbl ) producing microbes have become a major concern . generally , esbl - producing organisms are also resistant to quinolones , aminoglycosides , and trimethoprim - sulfamethoxazole ( 10 ) . in the 2010 korean antimicrobial resistance monitoring system report , the incidence of esbl - producing escherichia coli and klebsiella pneumoniae in community - acquired infections was 9.5% and 12.8% and the incidence in hospital - acquired infections was 25% and 78.6% , respectively ( 11 ) . therefore , it is important to identify factors associated with antimicrobial resistance in order to choose an appropriate empiric antibiotic in patients with utis . risk factors for ciprofloxacin resistance in e. coli have been reported in previous studies and include advanced age , male gender , diabetes mellitus , urinary tract abnormalities , recurrent utis , previous therapy with quinolones , urinary catheterization , and presence of complicated utis ( 12131415 ) . in patients with utis , the treatment depends on the sensitivity of the microbes to the concentrations of the antibiotics in the urine rather than in the blood ( 16 ) . this suggests that it is important to examine the clinical impact of antimicrobial resistance on treatment outcomes in utis . in this study , we describe the etiologic pathogens and risk factors for ciprofloxacin - resistant e. coli and esbl - producing microbes , susceptibility to ciprofloxacin , and the incidence of esbl in patients with abp . the results of this study provide useful information for prescribing appropriate antibiotics and better abp management , particularly for its association with increased incidence in patients that previously underwent urologic manipulation . medical records of patients with abp were retrospectively reviewed to determine risk factors for and the incidence of ciprofloxacin - resistant and esbl in pathogens . we included patients who were diagnosed with acute prostatitis at the kyung hee university hospital at gangdong from january 2006 to december 2015 . acute prostatitis was diagnosed by a body temperature > 38c , painful prostate on digital rectal examination , and leukocytes in urine sediments ( 17 ) . we investigated the known factors associated with ciprofloxacin - resistant e.coli or esbl - producing microbes such as age greater than 60 years , history of prior urologic manipulation , hospital - acquired infection , history of operation in the preceding 180 days , diabetes mellitus , hypertension , antibiotic exposure during the preceding 90 days , history of uti , prostate volume over 40 ml , and alpha - blocker medication . patients who had undergone prior urologic manipulation such as urethral catheterization , transrectal prostate biopsy , urodynamic study , or urethral dilation were defined as the manipulation group . patients who did not experience urologic procedures were defined as the non - manipulation group . standard blood biochemistry , urine examination by the dipstick method , and urinary sediment were performed for all patients . the identification and antimicrobial susceptibility of isolates were confirmed with the vitek 2 system ( biomrieux , marcy ltoile , france ) or disk diffusion susceptibility tests . in addition , multivariate model analysis was performed to determine independent risk factors for ciprofloxacin resistance and esbl - producing microbes . the resistance to ciprofloxacin and esbl - producing microbes the study was approved by the institutional review board of the kyung hee university hospital at gangdong ( irb no . the study was approved by the institutional review board of the kyung hee university hospital at gangdong ( irb no . 123/307 patients ( 40.1% ) had positive urine cultures and their bacterial strains were identified , and 26/123 patients ( 21.1% ) showed ciprofloxacin resistance . esbl - producing microbes were found in 10 patients : 7 were associated with e. coli and 3 were associated with k. pneumoniae ( table 1 ) . the distribution of ciprofloxacin - resistant and esbl - producing microbes in relation with risk factors is shown in table 2 . in univariate analysis , age greater than 60 years ( p = 0.001 ) , history of prior urologic manipulation ( p < 0.001 ) , hospital acquired infection ( p = 0.001 ) , hypertension ( p = 0.021 ) , previous antibiotic use ( p = 0.018 ) , and prostate volume over 40 ml ( p = 0.030 ) were found to be significant factors associated with ciprofloxacin resistance in e. coli infections . in multivariate analysis , age greater than 60 years ( odds ratio [ or ] , 7.31 ; confidence interval [ ci ] , 1.32640.279 ; p = 0.022 ) and history of prior urologic manipulation ( or , 7.65 ; ci , 1.82432.065 ; p = 0.005 ) were associated with ciprofloxacin resistance in e. coli strains infections ( table 3 ) . in addition , prior urologic manipulation ( p < 0.001 ) , history of recent operation ( p = 0.030 ) , and hypertension ( p = 0.031 ) were risk factors for esbl - producing microbes in univariate analysis . in multivariate analysis , presence of urologic manipulation ( or , 13.640 ; ci , 2.15986.167 ; p = 0.005 ) was found to be associated with esbl - producing microbes ( table 4 ) . enterobacter , s. marcescens , citrobacter , coagulase negative staphylococcus , s. agalactiae , p. mirabilis . esbl = extended - spectrum beta - lactamases . or = odds ratio , ci = confidence interval . esbl = extended - spectrum beta - lactamases , or = odds ratio , ci = confidence interval . the non - manipulation group consisted of 104/123 ( 84.6% ) patients and the manipulation group consisted of 19/123 ( 15.4% ) patients ; 12 had urethral catheterization ( 63.2% ) , 5 ( 26.2% ) had transrectal prostate biopsy , 1 had urethral dilation ( 5.3% ) , and 1 had a urodynamic study ( 5.3% ) . the most frequent microbe was e. coli ( 67.3% in the manipulation group vs. 52.6% in the non - manipulation group ) , followed by e. faecalis ( 19.2% vs. 10.5% ) , k. pneumoniae ( 4.8% vs. 31.6% ) , and pseudomonas aeruginosa ( 2.9% vs. 0% ) . k. pneumoniae counted for a far higher proportion in the prior manipulation group than in the non - manipulation group . the incidence of e. coli that was susceptible to ciprofloxacin was 60/70 ( 85.7% ) in the non - manipulation group and 1/10 ( 10.0% ) in the manipulation group . susceptibility to amikacin , imipenem , and piperacillin / tazobactam showed a high sensitivity in both groups . the antimicrobial susceptibilities of e. coli in the non - manipulation group compared to the manipulation groups were as follows : amikacin , 100% vs. 100% ; ampicillin , 57.1% vs. 0% ; 2nd generation cephalosporin , 100% vs. 80.0% ; 3rd generation cephalosporin , 97.1% vs. 60.0% ; gentamicin 85.7% vs. 70.0% ; imipenem , 100% vs. 100% ; and tmp / smx , 78.6% vs. 50.0% . esbl - producing microbes were found in 10 patients ( 8.1% ) ; 7 were e. coli ( 5.7% ) and 3 were k. pneumoniae ( 2.4% ) . abp = acute bacterial prostatitis , nm = non - manipulation , m = manipulation , nt = not tested , esbl = extended - spectrum beta - lactamases . abp is a serious condition that can cause septicemia and urosepsis and is characterized by common symptoms including dysuria , lower urinary tract symptoms , urinary retention , fever , and malaise ( 18 ) . in terms of microbiological characteristics , e. coli is the most prevalent pathogen occurring in 67% of cases , with p. aeruginosa in 13% , klebsiella spp . in 6% , gram - positive species in 5% and others in 9% ( 19 ) . several studies reported the different distribution of pathogen according to the prior manipulation . in the manipulation group , relatively fewer were counted for higher proportion in the manipulation group ( 2021 ) . in our study , relatively fewer e. coli was detected in the group with prior manipulation and k. pneumoniae was significantly higher in the manipulation group compared with the non - manipulation group . previous studies reported that the progression of chronic bacterial prostatitis and inflammatory chronic pelvic pain syndrome was 1.3% and 10.5% after abp treatment ( 22 ) . therefore , appropriate therapeutic strategies for abp are important for adequate treatment and prevention of progression to chronic infection . fluoroquinolones are commonly used as first empirical antibiotics , however , recently , the increased use of fluoroquinolone has been associated with increased resistance ( 8) . additionally , to - date , only a limited number of studies have reported risk factors for ciprofloxacin - resistant e. coli . they concluded that advanced age , male gender , diabetes mellitus , urinary tract abnormalities , recurrent utis , previous therapy with quinolones , urinary catheterization , and presence of complicated utis were risk factors for ciprofloxacin - resistance among uropathogens ( 12131415 ) . this study showed that presence of prior urologic manipulation , age greater than 60 years , hospital - acquired infection , hypertension , history of prior use of antibiotics , and prostate size over 40 ml were found to be risk factors for the developing ciprofloxacin resistance in univariate analysis . multivariate analysis indicated that age and history of prior manipulation were independent risk factors that contributed to ciprofloxacin resistance . in addition , prior urologic manipulation , history of recent operation , and hypertension were associated with esbl - producing microbes in univariate analysis . in multivariate analysis , it is well known that quinolone resistance impairs the capacity of e. coli to invade local tissue of the prostate and kidney ( 2324 ) . some studies have reported that exposure to quinolone antibiotics results in the reduced production of certain factors that contribute to the virulence of bacteria ( 25 ) . indeed , quinolone resistant e. coli was less likely to produce invasive uti such as pyelonephritis and prostatitis than is quinolone sensitive e. coli . they suggested that the physical disruption of mucosae and host factor alterations associated with urologic manipulation may increase invasiveness of quinolone resistant e. coli . increased age may reflect the presence of age - related incontinence or other minor urologic abnormalities that are not considered to be structural abnormalities ( 26 ) . age - associated changes in immune function , exposure to nosocomial pathogens and an increasing number of comorbidities increased risk for developing infection ( 27 ) . this is similar to reported antibiotic resistance in previous study on patients with acute pyelonephritis ( 8) . this warrants caution in selecting empiric treatment for abp . in this study , each group showed different results , and we found that 85.7% of susceptibility was identified in the non - manipulation group , whereas the manipulation group showed 10.0% susceptibility . in addition to fluoroquinolone resistant e. coli , we examined esbl - producing microbes . as mentioned earlier , the incidence of esbl - producing e. coli and k. pneumoniae in community - acquired infections was 9.5% and 12.8% and in hospital - acquired infections the incidence was 25% and 78.6% , respectively ( 11 ) . in this study , the incidence of esbl - producing e. coli was 2.9% in the non - manipulation group and 21.1% in the manipulation group , respectively . in regards to k. pneumoniae , the incidence was 1.0% in the non - manipulation group and 10.5% in the manipulation group . the esbl frequency was low compared with the results of a previous study because it was conducted by tertiary care centers ( 11 ) . all esbl - producing microbes showed fluoroquinolone resistance by cotransferring of quinolone resistance and esbl genes ( 28 ) . for these patients , intravenous carbapenems are recommended as first antibiotic treatments ( 29 ) . recent guideline for treatment of abp recommended the administration of a quinolone or cephalosporins alone or in combination with an aminoglycoside ( 30 ) . however , our results showed that fluoroquinolones as a first empirical antibiotic may have limited effects in patients with prior urologic manipulation . in addition , incidence of esbl was significantly higher in the group with prior manipulation . with this regard , cephalosporins with amikacin , or carbapenems , or extended - spectrum penicillin with beta lactamase inhibitor should be considered as the preferred empirical abp treatment in the patients with history of prior urologic manipulation . there were some limitations to this study , which included the small sample size and retrospective nature . therefore , we verified the diagnosis of abp with the patient s final diagnosis in the medical records . in addition , patients with mild abp cases with minimal fever may not have been included , which could have caused selection bias . another limitation is that the data for previous antibiotic use before hospital visits might be underestimated , which could cause a higher culture negative rate . in this study , we found that only 16 patients had recorded use of antibiotics before hospital visit , and of these patients , 10 patients used fluoroquinolones . therefore , the association between ciprofloxacin resistance and previous antibiotic use could be inaccurate . in order to overcome these limitations , a future prospective study with larger numbers of cases is necessary . in conclusion , this study showed microbiological aspects of abp in korea . the results indicated that abp with history of prior manipulation was associated with high resistance to fluoroquinolones and a high incidence of esbl - producing bacteria . therefore , initial treatments approaches for abp should consider patients age and whether the patient have undergone prior urologic manipulation .

the objectives of this study were to investigate risk factors and the incidence of ciprofloxacin resistance and extended - spectrum beta - lactamases ( esbl ) in patients with acute bacterial prostatitis ( abp ) . we reviewed the medical records of 307 patients who were diagnosed with abp between january 2006 and december 2015 . the etiologic pathogens and risk factors for ciprofloxacin - resistant e. coli and esbl - producing microbes , susceptibility to ciprofloxacin , and the incidence of esbl in patients with abp were described . history of prior urologic manipulation was an independent risk factor for ciprofloxacin - resistant ( p = 0.005 ) and esbl - producing microbes ( p = 0.005 ) . advanced age ( over 60 years ) was an independent risk factor for ciprofloxacin - resistant microbes ( p = 0.022 ) . the ciprofloxacin susceptibility for escherichia coli in groups without prior manipulation was documented 85.7% . for groups with prior manipulation , the susceptibility was 10.0% . incidence of esbl - producing microbes by pathogen was 3.8% for e. coli and 1.0% for klebsiella pneumonia in the absence of manipulation group , and 20% and 33.3% in the presence of manipulation group , respectively . initial treatment of abp must consider patient s age and the possibility of prior manipulation to optimize patient treatment . with the high rate of resistance to fluoroquinolone , cephalosporins with amikacin , or carbapenems , or extended - spectrum penicillin with beta lactamase inhibitor should be considered as the preferred empirical abp treatment in the patients with history of prior urologic manipulation .

You are an expert at summarizing long articles. Proceed to summarize the following text: palliative care according to the world health organization ( who ) is the active total care of patients whose disease is not responsive to curative treatment . control of pain , of other symptoms , and of psychological , social , and spiritual problems is paramount . the goal of palliative care is achievement of best quality of life for patients and their families . palliative care aims to affirm life while regarding dying as a normal process , to provide support to enable patients to live as actively as possible until death and to offer support to the family during the patient 's illness and in their bereavement . though palliative care has been somewhat established in many developed countries of the world , it is an emerging medical specialty in many developing ones with establishment of palliative care centers in india , saudi arabia , and lebanon . in nigeria , palliative care is still in its early stage of development with the establishment of the first palliative care centre in the oldest teaching and tertiary hospital in 2003 . the frequency of chronic noncommunicable diseases as major cause of morbidity and mortality in developing countries has also emphasized the need for professionals in the healthcare sector to acquire knowledge and develop skills in palliative care . the knowledge and attitude of doctors , pharmacists , nurses , and other healthcare workers toward palliative care and end of life matters had been explored in studies from pakistan , lebanon , india , and turkey . the main objective of this study was to explore the knowledge and attitude of workers in a nigerian tertiary healthcare facility about palliative care and to inform where gap in knowledge or understanding may exist . the study was carried out among healthcare workers of the ekiti state university teaching hospital , a 300-bedded tertiary care facility located in ado - ekiti , south - west nigeria . this centre has specialists in internal medicine , family medicine , surgery , psychiatry , pediatrics , community medicine , anesthesia , obstetrics and gynaecology , and pathology . it also has a large component of nursing , pharmacy , and other allied healthcare workers . the study was a cross - sectional questionnaire - based carried out during the first week of april 2013 . the study instrument ( questionnaire ) was adapted from one used in a previous study . pretested among 10 healthcare workers of the hospital and necessary adjustments made before being administered to the participants . the sample size for the study was calculated using the following assumptions : 95% confidence interval , margin of error ( 5% ) , level of response ( 50% ) , and population of 400 . a sample size of 197 was calculated and this was increased to 255 to accommodate possible nonresponders . the sampling of the different professional classes ( nurses and doctors ) was done proportionally according to their respective populations in the hospital with 120 , 100 , 20 , 10 , and 5 questionnaires were distributed to the nurses , doctors , pharmacists , social workers , and clinical psychologists , respectively . the sample sizes of the professional classes should be sufficient enough to bring out the differences in response between the aforementioned groups , a basic hypothesis of this study . convenience sampling was used as questionnaires were administered to the healthcare workers during various departmental activities . the questionnaire apart from the socio - demographic profile of respondents had sections about the definition of palliative care , its philosophy , communication issues , nonpain symptoms of palliative care , medication use in palliative care , and context of application . all questions or statements were close ended with three options ( yes , no , and do nt know ) . hard copies of the questionnaires were distributed to the healthcare workers through various unit heads and those completed and returned within the time frame of one week were used for data analysis . the information obtained from the questionnaire was coded , entered , and analyzed using ibm spss version 19 . analysis was done using descriptive statistics to obtain the general characteristics of the study participants . chi - square was employed to determine the level of significance of groups of categorical variables such as professional cadre , duration of practice , and gender with p values less than 0.05 considered significant . ethical clearance was obtained from the hospital research ethics committee before the commencement of the study . the study was carried out among healthcare workers of the ekiti state university teaching hospital , a 300-bedded tertiary care facility located in ado - ekiti , south - west nigeria . this centre has specialists in internal medicine , family medicine , surgery , psychiatry , pediatrics , community medicine , anesthesia , obstetrics and gynaecology , and pathology . it also has a large component of nursing , pharmacy , and other allied healthcare workers . the study was a cross - sectional questionnaire - based carried out during the first week of april 2013 . the study instrument ( questionnaire ) was adapted from one used in a previous study . pretested among 10 healthcare workers of the hospital and necessary adjustments made before being administered to the participants . the sample size for the study was calculated using the following assumptions : 95% confidence interval , margin of error ( 5% ) , level of response ( 50% ) , and population of 400 . a sample size of 197 was calculated and this was increased to 255 to accommodate possible nonresponders . the sampling of the different professional classes ( nurses and doctors ) was done proportionally according to their respective populations in the hospital with 120 , 100 , 20 , 10 , and 5 questionnaires were distributed to the nurses , doctors , pharmacists , social workers , and clinical psychologists , respectively . the sample sizes of the professional classes should be sufficient enough to bring out the differences in response between the aforementioned groups , a basic hypothesis of this study . convenience sampling was used as questionnaires were administered to the healthcare workers during various departmental activities . the questionnaire apart from the socio - demographic profile of respondents had sections about the definition of palliative care , its philosophy , communication issues , nonpain symptoms of palliative care , medication use in palliative care , and context of application . all questions or statements were close ended with three options ( yes , no , and do nt know ) . hard copies of the questionnaires were distributed to the healthcare workers through various unit heads and those completed and returned within the time frame of one week were used for data analysis . the information obtained from the questionnaire was coded , entered , and analyzed using ibm spss version 19 . analysis was done using descriptive statistics to obtain the general characteristics of the study participants . chi - square was employed to determine the level of significance of groups of categorical variables such as professional cadre , duration of practice , and gender with p values less than 0.05 considered significant . ethical clearance was obtained from the hospital research ethics committee before the commencement of the study . a total of 170 questionnaires were completed and returned within the stipulated time frame with a response rate of 66.7% . the response rate was different among the professional groups with social workers ( 100% ) , nurses ( 83.3% ) , doctors ( 52% ) , pharmacists ( 55% ) , and clinical psychologists ( 40% ) . female respondents constituted the majority with 110 ( 64.7% ) and the mean age of all participants was 36.6 9.3 years . the demographics of different professional groups and duration of practice are shown in table 1 while the distribution of doctors and nurses according to their cadre is shown in table 2 . gender distribution of respondents distribution of professional groups by cadre the majority ( 70.5% ) of the respondents understood palliative care to be about pain medicine , 47.9% thought it to be geriatric medicine while 135 ( 82.3% ) respondents felt palliative care is about the active care of the dying . regarding the philosophy of palliative care , 70 ( 57.9% ) thought that it affirms life while 116 ( 78.4% ) felt palliative care recognizes dying as a normal process . only 8 respondents felt that applying palliative care hastens death and 108 ( 77.7% ) believe that it aims to prolong life . regarding the group of patients requiring palliative care , 122 ( 78.7% ) respondents were of the opinion that all dying patients would require palliative care while 132 ( 93% ) knew that patients with metastatic cancers are candidates for this end of life care . most of the respondents were also aware that palliative care could be applicable for conditions like end stage organ failure ( 72.6% ) and rheumatoid arthritis ( 82.5% ) . the nonpain symptoms ( delirium , constipation , vomiting , and breathlessness ) common in patients requiring palliative care were recognized by 76.8% , 60.2% , 69.7% , and 80.5% , respectively . regarding discussion of the prognosis , 122 ( 83% ) respondents believe that the patient should be told the truth and that not doing so could lead to lack of trust ( 85% ) . regarding the membership of the palliative care team , 91.7% , 94.7% , 96.7% , and 91.8% of respondents voted in favor of medical social workers , nurses , medical doctors , and pharmacists , respectively . religious leaders and occupational therapists were also accepted for membership by 88.4% and 75% of respondents , respectively . regarding their knowledge about advance directives , 132 ( 84.6% ) respondents got the correct definition while only 62.4% knew that the term is synonymous with living will . regarding the area of opioid use in palliative care , 76% of respondents agreed that morphine improves the quality of life of patients while only 11.3% believe that the use of morphine will lead to death . majority of respondents erroneously believe that morphine and pentazocine would relieve all kinds of pain ( 73.9% and 66.2% , respectively ) . the components of a good death according to respondents were pain and symptomatic management 139 ( 92.7% ) , clear decision making 121 ( 90.3% ) , and preparation for death 135 ( 90.6% ) . a total of 149 ( 93.7% ) respondents agreed that there is a need for the hospital to have a palliative care team as soon as possible . the association between the different professional groups and knowledge about various themes of palliative care was also explored [ table 3 ] . the pharmacists were more likely to correctly define palliative care as being related to pain management than doctors and nurses respectively . doctors were also less likely to fallaciously define palliative care as geriatric medicine in comparison to pharmacists and nurses . regarding the association of the different professional classes and knowledge of the philosophy of palliative care , nurses were more likely than doctors to think that the aim of palliative care is to prolong life . the responses regarding the use of morphine in palliative care showed that more nurses erroneously believed that morphine relieves all kinds of pain . there was no statistically significant difference ( p = 0.732 ) in the duration of practice and the knowledge base of respondents in the area of definition of palliative care . from the above results , it is clear that the knowledge of respondents about the different aspects of palliative care varied . the knowledge of the respondents about the definition and philosophy of palliative care was very good while their responses regarding opioid use in palliative care and category of patients that would require palliative care were less concise . the preponderance of female respondents in this study could be explained by relatively large number of female nurses among the study population . a similar study by prem et al . on nurse 's knowledge about palliative care also had female preponderance of 89% . regarding the definition of palliative care , 70.5% of our respondents agreed that it could be defined as such while 86% also agreed that active care of the dying was a correct option . in a similar study by jahan et al . , 87.7% of participants were of the same opinion , while 60.3% felt that palliative care is the active care of the dying . in a study carried out in lebanon , 95.1% of participating medical doctors and 84.6% of the nurses were of the opinion that palliative care affirms life and regarded dying as a normal process . this result is at variance from the outcome of our study where only 57.9% and 78.4% answered in the affirmative regarding these two components of the philosophy of palliative care . the differences in responses from the two studies could be due to availability or lack of training opportunities in palliative care at both undergraduate and postgraduate levels in the countries where these studies were carried out . in an earlier cited study among medical undergraduates in lebanon , 34.2% felt that palliative care is required in all dying patients . in this study , 78.7% of respondents erroneously answered this same question ; a difference that could be due to training deficiencies among the respondents . majority ( 93% ) of our respondents agreed that palliative care was required for patients with metastatic cancers , similar to 93.2% and slightly higher than 74% found in other similar studies . this convergence of opinion is most likely due to the long standing belief that palliative care is needed only in oncology patients . with the emergence of other chronic communicable diseases , most especially , human immunodeficiency virus ( hiv ) infection and noncommunicable conditions ( osteoarthritis , organ failure and alzheimer 's disease ) , , 83% of respondents agreed that this was necessary , similar to 91.8% , 83.9% , and 83.1% found among medical undergraduates , nurses , and medical doctors in various studies . the knowledge about advanced directives among respondents in our study was also very encouraging with 84.6% choosing the correct definition despite the fact that this is a new concept in our daily clinical practice . regarding the respondents knowledge about use of opioids in palliative care , this study found some misconceptions ; 73.9% believed that morphine will relieve all kinds of pains , 11.0% of respondents believe that morphine would cause death while only 41.3% knew that morphine could improve breathlessness in heart failure . this is not surprising as many studies from different regions have shown that physicians and nurses have issues regarding the use of morphine in oncology patients . regarding components of a good death , majority of our respondents answered in the affirmative , an outcome similar to results from a previously cited study . from the results of this study , future research in the area of palliative care in nigeria should be directed at issues of communication ( truth telling especially regarding prognosis ) and opioid analgesic use among oncology patients . the main implication of this study for practice is the need for a better understanding of use of opioid analgesia for patients with terminal diseases . the study also revealed the need for a review of curriculum of healthcare workers to include the core themes of palliative care . while the results of our study may not be generalizable for the whole country , it could be representative for similar tertiary institutions in nigeria and other countries alike . limitations arising from the study 's design and methodology would include those associated in general with questionnaire - based studies . they include bias of the respondents toward certain issues , inaccurate responses , and incidence of skipped questions . the relatively low response rate of medical doctors and the low number of other allied healthcare workers were additional limitations of this study . limitations arising from the study 's design and methodology would include those associated in general with questionnaire - based studies . they include bias of the respondents toward certain issues , inaccurate responses , and incidence of skipped questions . the relatively low response rate of medical doctors and the low number of other allied healthcare workers were additional limitations of this study . our study clearly showed the gaps in the knowledge of healthcare workers in the area of palliative care . there is a need to introduce or reinforce the study of palliative care in the curriculum of medical doctors , nurses , pharmacists , and other healthcare workers both at undergraduate and postgraduate levels .

background : palliative care is an emerging area of medicine with potential to affect positively many chronically ill patients . this study investigated the knowledge and attitude of healthcare workers in a tertiary level hospital in nigeria where a palliative care unit is being established.material and methods : the study was a cross - sectional questionnaire - based study carried out among healthcare workers in ekiti state university teaching hospital , ado - ekiti , south - west nigeria . the questionnaire had sections about definition of palliative care , its philosophy , communication issues , medications , and contexts about its practice . the information obtained from the questionnaire was coded , entered , and analyzed using ibm spss version 19.results:a total of 170 questionnaires were returned within the stipulated time frame with response rate of 66.7% . majority , ( 135 , 86% ) respondents felt palliative care was about the active management of the dying while 70.5% of respondents equated palliative care to pain management . regarding the philosophy of palliative care , 70 ( 57.9% ) thought that it affirms life while 116 ( 78.4% ) felt palliative care recognizes dying as a normal process . one hundred and twenty - two ( 78.7% ) respondents were of the opinion that all dying patients would require palliative care . the patient should be told about the prognosis according to 122 ( 83% ) respondents and not doing so could lead to lack of trust ( 85% ) . regarding the area of opioid use in palliative care , 76% of respondents agreed that morphine improves the quality of life of patients.conclusion:there are plausible gaps in the knowledge of the healthcare workers in the area of palliative care . interventions are needed to improve their capacity .

You are an expert at summarizing long articles. Proceed to summarize the following text: titer of contact hypersensitivity ( tch ) is a reliable method of measuring the degree of contact hypersensitivity to parthenium plantseverity of dermatitis caused by parthenium hysterophorus varies with seasoneffect of seasonal change on patch test and tch has not been studied . titer of contact hypersensitivity ( tch ) is a reliable method of measuring the degree of contact hypersensitivity to parthenium plant severity of dermatitis caused by parthenium hysterophorus varies with season effect of seasonal change on patch test and tch has not been studied . allergic contact dermatitis to weed parthenium , known as parthenium dermatitis , has become a major dermatological problem in india . it is the most common cause of airborne contact dermatitis ( abcd ) in our country , which primarily affects farmers and other outdoor workers . in a recent study from south india on patients presenting with plant dermatitis , maximum patch positivity was found with parthenium hysterophorus ( 52% ) , and it was statistically significant . the disease is more severe during the summer season which is considered to be one of the important points in making a clinical diagnosis of the disease . however , the diagnosis is confirmed by patch test , which is considered a gold standard investigation for the same . titer of contact hypersensitivity ( tch ) is used to determine the degree of contact hypersensitivity in an individual to an allergen which is determined by doing the serial dilutions of the standard extract of the allergen and the highest dilution which elicits a clear positive patch test reaction is the tch in that individual . it has been used as a reliable method to measure the degree of contact hypersensitivity to parthenium in patients with abcd to parthenium . since the severity of dermatitis caused by p. hysterophorus varies with season , the patch test , and tch may also vary in these patients . however , the effect of seasonal change on patch test and tch has not been studied . therefore , we studied the effect of seasonal variation on tch in patients with parthenium dermatitis . this data came out of a prospective investigational study on patients with abcd , due to p. hysterophorus ( parthenium dermatitis ) . the study subjects were recruited from the outpatient department , and allergy clinic of the department of dermatology of our center and the study was approved by the institutional ethics board . since these patients were to be treated with azathioprine , pregnant and lactating females , children < 15 years of age and patients with active liver , kidney , or hematological disorder were excluded . the patients who were recruited in summers ( april to september ) and whose repeat patch test and tch were determined in winters ( october to march ) were identified as group i and those who were recruited in winters ( october to march ) and whose repeat patch test and tch were done in summers ( april to september ) were identified as group ii . patch test was done with antigen impregnated discs prepared using an aqueous extract of the plant material ( leaves ) as per method described by pasricha and singh and standardized in our laboratory . mature , healthy looking leaves of p. hysterophorus were cleaned , air dried at room temperature over 710 days and powdered in a blender . fifty grams of the dried leaf powder was thoroughly mixed with 300 ml of water and filtered through whatman no . 1 filter paper to obtain a clear filtrate which was standard plant extract . to determine the tch , 10-fold dilutions varying from 1:10 to 1:10 were prepared by diluting the standard plant extract with distilled water and antigen impregnated discs were prepared from each of these dilutions . the patients were patch tested with each of these dilutions in addition to the undiluted standard extract , using the standard technique . the maximum dilution which produced a definite dermatitic reaction in the patient was taken as the tch . as per the study protocol , each patient was first patch tested at baseline ( period i ) and again after 6 months ( period ii ) to determine the tch on both occasions . demographic details of all patients such as age , gender , and duration of disease were noted . data were presented as number and percentage or mean standard deviation or median and range as appropriate . tch was compared between the two sequences of group i ( summer winter ) and group ii ( winter summer ) using analysis of variance . in the usual crossover study , we study the treatment effect ( drug vs. placebo ) , period effect ( the order in which each patient received the two treatments ) and finally , interaction of treatment and period is studied . in this study , the seasonal variation of tch was called season effect and the order in which each patient 's tch value was measured between the two seasons ( summer to winter / winter to summer ) was called period effect . hence , in order to study , the interaction between season and period , we analyzed this study as a 2 2 cross over model . statistical analysis was carried out using stata 11.0 ( statacorp , college station , texas , usa ) . the results were reported as treatment effect ( 95% confidence interval [ ci ] ) . this data came out of a prospective investigational study on patients with abcd , due to p. hysterophorus ( parthenium dermatitis ) . the study subjects were recruited from the outpatient department , and allergy clinic of the department of dermatology of our center and the study was approved by the institutional ethics board . since these patients were to be treated with azathioprine , pregnant and lactating females , children < 15 years of age and patients with active liver , kidney , or hematological disorder were excluded . the patients who were recruited in summers ( april to september ) and whose repeat patch test and tch were determined in winters ( october to march ) were identified as group i and those who were recruited in winters ( october to march ) and whose repeat patch test and tch were done in summers ( april to september ) were identified as group ii . patch test was done with antigen impregnated discs prepared using an aqueous extract of the plant material ( leaves ) as per method described by pasricha and singh and standardized in our laboratory . mature , healthy looking leaves of p. hysterophorus were cleaned , air dried at room temperature over 710 days and powdered in a blender . fifty grams of the dried leaf powder was thoroughly mixed with 300 ml of water and filtered through whatman no . 1 filter paper to obtain a clear filtrate which was standard plant extract . to determine the tch , 10-fold dilutions varying from 1:10 to 1:10 were prepared by diluting the standard plant extract with distilled water and antigen impregnated discs were prepared from each of these dilutions . the patients were patch tested with each of these dilutions in addition to the undiluted standard extract , using the standard technique . the maximum dilution which produced a definite dermatitic reaction in the patient was taken as the tch . as per the study protocol , each patient was first patch tested at baseline ( period i ) and again after 6 months ( period ii ) to determine the tch on both occasions . demographic details of all patients such as age , gender , and duration of disease were noted . data were presented as number and percentage or mean standard deviation or median and range as appropriate . tch was compared between the two sequences of group i ( summer winter ) and group ii ( winter summer ) using analysis of variance . in the usual crossover study , we study the treatment effect ( drug vs. placebo ) , period effect ( the order in which each patient received the two treatments ) and finally , interaction of treatment and period is studied . in this study , the seasonal variation of tch was called season effect and the order in which each patient 's tch value was measured between the two seasons ( summer to winter / winter to summer ) was called period effect . hence , in order to study , the interaction between season and period , we analyzed this study as a 2 2 cross over model . statistical analysis was carried out using stata 11.0 ( statacorp , college station , texas , usa ) . the results were reported as treatment effect ( 95% confidence interval [ ci ] ) . this data came out of a prospective investigational study on patients with abcd , due to p. hysterophorus ( parthenium dermatitis ) . the study subjects were recruited from the outpatient department , and allergy clinic of the department of dermatology of our center and the study was approved by the institutional ethics board . since these patients were to be treated with azathioprine , pregnant and lactating females , children < 15 years of age and patients with active liver , kidney , or hematological disorder were excluded . the patients who were recruited in summers ( april to september ) and whose repeat patch test and tch were determined in winters ( october to march ) were identified as group i and those who were recruited in winters ( october to march ) and whose repeat patch test and tch were done in summers ( april to september ) were identified as group ii . patch test was done with antigen impregnated discs prepared using an aqueous extract of the plant material ( leaves ) as per method described by pasricha and singh and standardized in our laboratory . mature , healthy looking leaves of p. hysterophorus were cleaned , air dried at room temperature over 710 days and powdered in a blender . fifty grams of the dried leaf powder was thoroughly mixed with 300 ml of water and filtered through whatman no . 1 filter paper to obtain a clear filtrate which was standard plant extract . to determine the tch , 10-fold dilutions varying from 1:10 to 1:10 were prepared by diluting the standard plant extract with distilled water and antigen impregnated discs were prepared from each of these dilutions . the patients were patch tested with each of these dilutions in addition to the undiluted standard extract , using the standard technique . the maximum dilution which produced a definite dermatitic reaction in the patient as per the study protocol , each patient was first patch tested at baseline ( period i ) and again after 6 months ( period ii ) to determine the tch on both occasions . demographic details of all patients such as age , gender , and duration of disease were noted . data were presented as number and percentage or mean standard deviation or median and range as appropriate . tch was compared between the two sequences of group i ( summer winter ) and group ii ( winter summer ) using analysis of variance . in the usual crossover study , we study the treatment effect ( drug vs. placebo ) , period effect ( the order in which each patient received the two treatments ) and finally , interaction of treatment and period is studied . in this study , the seasonal variation of tch was called season effect and the order in which each patient 's tch value was measured between the two seasons ( summer to winter / winter to summer ) was called period effect . hence , in order to study , the interaction between season and period , we analyzed this study as a 2 2 cross over model . statistical analysis was carried out using stata 11.0 ( statacorp , college station , texas , usa ) . the results were reported as treatment effect ( 95% confidence interval [ ci ] ) . the study had 47 patients , 33 males and 14 females , between 30 and 72 years of age . the baseline demographic profile of the patients in two groups is summarized in table 1 . the tch values varied from undiluted to 1:1000 in these patients . the seasonal variation of tch in the two groups the mean tch values for summer to winter group ( group i ) in period i and in period ii was 0.11 0.28 and 0.76 0.41 , respectively , and the difference between the two periods was 0.66 0.54 . similarly , the mean tch values for winter to summer group ( group ii ) in period i and period ii was 0.34 0.44 and 0.17 0.32 , respectively , and the difference between the two periods was 0.17 0.61 . therefore , the difference in tch values with a change of season shown as season effect ( 95% ci ) , was 0.41 ( 0.58 , 0.24 ) , and it was statistically significant ( p < 0.0001 ) . this shows that tch values were significantly lower in summer as compared to winter in both groups , suggesting that increased sensitivity to parthenium in summer is reflected in patch tests as well . in keeping with the above observation , tch values increased in 19 patients and became negative ( undetectable ) in 2 patients in group i from summer to winter and decreased in 13 patients in group ii from winter to summer . however , an opposite trend was seen in a subset of patients - tch decreased in 1 patient ( by 1:10 dilution ) in group i and increased in 6 ( by 1:10100 dilution ) in group ii . there was no change in tch in 1 patient in group i and 5 patients in group ii . periodic variation in tch in two groups the order in which the tch values were measured was called period effect . the magnitude of period effect ( 95% ci ) was 0.49 ( 0.82 , 0.15 ) and the difference between the means of tch was significant ( p = 0.006 ) showing a systematic period effect . hence , the period effect reassures that the tch is lower in summers as compared to winters . the sequence effect was also found to be statistically significant ( p = 0.009 ) meaning that there is a season period interaction ( season period effect ) . however , the difference in seasonal variation of tch was higher when the readings were done in summer to winter , than in winter to summer [ figure 1 ] . mean of titer of contact hypersensitivity values in two seasons and periods ( the solid black line represents summer to winter , that is , group i ; the dashed line represents winter to summer , that is , group ii ; and whiskers represent the standard error ) parthenium dermatitis has become a major problem in india , and about 40% patients attending a contact dermatitis clinic of tertiary care center in north india were reported to have parthenium dermatitis . tch is a method for assessing the degree of sensitivity to the allergen in patients affected with parthenium dermatitis . the reproducibility of tch in parthenium dermatitis has been studied , and it has been found to be a reproducible and reliable test . a subsequent study evaluated the correlation among tch , clinical severity and therapeutic response in parthenium dermatitis which demonstrated complete clearance to significant reduction in clinical severity following therapy but did not show a corresponding change in tch values ( p = 0.15 ) . hence , it was concluded that tch neither correlates with clinical severity of disease nor with the response to therapy . the disease is much more severe in summer than in winter , and some patients have a complete remission in winter , but the disease relapses in summer . however , there are no studies done to determine the effect of this seasonal variation on patch test outcomes in these patients . the present study is the first attempt to investigate the effect of seasonal variation on the degree of contact hypersensitivity as determined by tch in parthenium dermatitis . our study patients had increased sensitivity to parthenium allergen in summer as compared to winter . the exact reason for this increased sensitivity in summer is unknown , but it may be due to several reasons such as excess growth and drying up of leaves of the weed during summers which get suspended in the air making large amount of allergen available in the atmosphere , increased sweating as well as less clothing during summer etc . hence , under hot and humid conditions in tropical countries like india , increased sweating may increase plant allergen penetration and accordingly increasing the chances of patch test positivity . on the contrary , the studies looking at the effect of meteorological conditions on patch testing found increased incidence of irritant reactions under cold / arid conditions with some known allergens such as formaldehyde , paraben and fragrance mix , nickel , thiomersal and para phenylene diamine . some studies suggested that patch positivity decreases in summers , which may be due to increased sweating leading to poor occlusion and ultraviolet induced cutaneous immunosuppression . on the other hand , katsarou et al . showed no influence of seasonal variation on patch testing . our study revealed that the order in which repeat patch testing is done in patients with parthenium dermatitis also affects the results . when patch test sequence was summer to winter , the mean tch values increased almost 7-fold . however , when patch test sequence was winter to summer , the tch values reduced only 2-fold . on the whole , it means that the same patient may show different sensitivity toward p. hysterophorus when observed over same seasons of different calendar years . the exact reasons for this effect are unknown , but it may have occurred since several patients dependent and environment dependent factors may alter a patient 's sensitivity toward the plant . this factor may be a consideration when comparative , prospective clinical trials involving parthenium dermatitis patients recruited over different time frames are planned and analyzed . more robust conclusions could be drawn regarding the effect of seasonal change on patch test results in our series if we could have followed up our study group into 1 more calendar year and repeated their patch tests . variation in patch test positivity in a given patient , if recorded over the same seasons of different calendar years , would provide better understanding of the environmental and patient factors that influence the clinical manifestations of parthenium dermatitis as well as the patch test results . another research implication of our study would be to evaluate the effect of seasonal variations on results of patch testing in other dermatoses known to be affected by weather such as hand dermatitis and atopic dermatitis . our analysis indicates that the patients of parthenium dermatitis have increased sensitivity to an allergen in summer season which can be picked up by even higher dilutions of the antigen extract ( lower tch values ) on patch test . on the other hand , the patch test may be negative in winters due to lowered antigen sensitivity which may result in a negative patch test . hence , we recommend that in a clinically suspected patient of parthenium dermatitis , patch test should be repeated in the summer season if it is negative or doubtful positive in winters . difference in titer of contact hypersensitivity ( tch ) values with change of season was statistically significant , having lower tch values in summers and reflecting increased sensitivity to parthenium in summerspatch test to parthenium should be repeated in the summer season if it is negative or doubtful positive in winters . difference in titer of contact hypersensitivity ( tch ) values with change of season was statistically significant , having lower tch values in summers and reflecting increased sensitivity to parthenium in summers patch test to parthenium should be repeated in the summer season if it is negative or doubtful positive in winters . difference in titer of contact hypersensitivity ( tch ) values with change of season was statistically significant , having lower tch values in summers and reflecting increased sensitivity to parthenium in summerspatch test to parthenium should be repeated in the summer season if it is negative or doubtful positive in winters . difference in titer of contact hypersensitivity ( tch ) values with change of season was statistically significant , having lower tch values in summers and reflecting increased sensitivity to parthenium in summers patch test to parthenium should be repeated in the summer season if it is negative or doubtful positive in winters . difference in titer of contact hypersensitivity ( tch ) values with change of season was statistically significant , having lower tch values in summers and reflecting increased sensitivity to parthenium in summerspatch test to parthenium should be repeated in the summer season if it is negative or doubtful positive in winters . difference in titer of contact hypersensitivity ( tch ) values with change of season was statistically significant , having lower tch values in summers and reflecting increased sensitivity to parthenium in summers patch test to parthenium should be repeated in the summer season if it is negative or doubtful positive in winters .

background : titer of contact hypersensitivity ( tch ) is a measure of contact hypersensitivity to an allergen in an individual . clinical severity of parthenium dermatitis varies with season . however , the effect of seasonal variation on the tch as determined by patch test to parthenium has not been studied . objective : to study the effect of seasonal variation on tch to parthenium hysterophorus in patients with parthenium dermatitis.materials and methods : it was a prospective investigational study on clinically and patch test confirmed patients with airborne contact dermatitis to p. hysterophorus . the tch values at baseline and after 6 months were recorded . the patients who were recruited in summers ( april to september ) and whose repeat patch test and tch were determined in winters ( october to march ) were identified as group i and those who were recruited in reverse order were identified as group ii.results:the study had 47 patients , of which 23 were in group i and 24 in group ii . mean tch in group , i ( summer to winter ) in period i ( summer ) was 0.11 0.28 whereas that in period ii ( winter ) , was 0.76 0.41 . similarly , mean tch in group ii ( winter to summer ) in period i ( winter ) and period ii ( summer ) were 0.34 0.44 and 0.166 0.32 , respectively . the difference in tch values ( 95% confidence interval ) in the two groups with a change of season was 0.41 ( 0.58 , 0.24 ) ( p < 0.0001).conclusions : tch values in parthenium dermatitis are lower in the summer season , indicating increased sensitivity to parthenium allergen in summer .

You are an expert at summarizing long articles. Proceed to summarize the following text: individual patient - level genetic and phenotypic data were extracted from european studies in a prior large - scale genotyping experiment conducted in the breast cancer association consortium ( bcac ) , part of the collaborative oncological gene - environment study ( cogs ) initiative18 . for this study , we selected women of european descent inferred from genetic ancestry with invasive breast cancer , who have had no previous diagnosis of the disease . subjects missing follow - up information on vital status , time to vital status , date of study entry and cause of death data were excluded . the selection of only er - negative patients in this study was strongly motivated by prior insight . a swedish study of the breast cancer prognosis of 834 sister pairs in which both were affected showed that younger sisters with poor older sister survival had worse survival than younger sisters with good older sister survival ( number of breast cancer deaths within 5 years from diagnosis in younger sisters , nevent=65 , p=0.02 in a multivariate proportional hazard ( cox ) analysis)3 . when stratified by er subtypes , the increased risk of death from er - negative breast cancer for younger sisters with poor older sister survival compared with younger sisters with good older sister survival was found to be almost sevenfold ( n=139 sister pairs , nevent=28 , hazard ratio ( hr)=6.69 ( 1.3632.91 ) , p=0.02 ) in contrast to sister pairs with the er - positive disease ( n=584 sister pairs , nevent=28 , hr=1.54 ( 0.484.98 ) , p=0.50 ) ( unpublished data ) . in addition , in a recent breast international group phase iii trial , increasing lymphocytic infiltration was found to be associated with excellent prognosis only for patients with node - positive , er - negative / her2-negative disease19 . twenty studies with er - negative cases and at least one event ( breast cancer - specific death ) were eligible for the combined analysis ( supplementary table 1 ) . as we were primarily interested in response to chemotherapy , patients missing information on chemotherapy were not considered in our analyses . the 14 studies ( n=1,804 ) included in the combined analysis for the chemotherapy - treated subgroup are summarized in supplementary table 2 . a total of 279 breast cancer - specific deaths were recorded in a 15-year follow - up . for the replication phase , four icogs asian studies with er - negative breast cancer cases treated with chemotherapy and at least one death due to breast cancer in a 15-year follow - up were analysed ( n=522 , 53 events , supplementary table 3 ) . early - onset breast cancer patients from the independent prospective study of outcomes in sporadic versus hereditary breast cancer ( posh ) study2021 were used as a second replication data set . in particular , we performed our replication using er - negative breast cancer patients treated with chemotherapy in the posh study s stage 1 discovery data set samples ( n=315 , 108 events ) selected to facilitate studies on breast cancer prognosis22 . the breast cancer - specific death rate is thus particularly high and there were few cases that drop out due to lack of phenotype information . all women in participating studies had provided written consent for the research and approval for each study was obtained from their local ethical review board ( supplementary tables 1 and 3 ) . collection of blood samples and clinical data from subjects was performed in accordance with local guidelines and regulations . genotyping was conducted using a custom illumina iselect genotyping array ( icogs ) , comprising 211,115 snps . briefly , individuals were excluded for any of the following reasons : genotypically not female xx ( xy , xxy or xo ) , overall call rate < 95% , low or high heterozygosity ( p<1 10 , determined separately for individuals of european and east asian ancestry ) , genotypes discordant with those determined in previous genotyping such that the individual appeared to be different , genotypes for the duplicate sample that seemed to be from a different individual and cryptic duplicates . snps with call rates of < 95% , snps that deviated from hardy weinberg equilibrium in controls at p<1 10 and snps for which the genotypes were discrepant in > 2% of duplicate samples across all cogs consortia were excluded . the final analyses in the parent cogs study were based on data from 199,961 snps . key genes related to human immunology and inflammation were identified from two comprehensive and highly curated gene panels ( ncounter gx human immunology kit and ncounter gx human inflammation kit , nanostring technologies , seattle , wa , usa ) , which are commercially available ( supplementary data 1 ) . we identified all snps on the icogs within a 50-kb window of any gene on the panel . out of 8,237 unique snps extracted from cogs , we further removed snps with low minor allele frequency ( < 0.05 ) and low call rate ( < 0.95 ) . after quality - control exclusions , we analysed 7,020 non - overlapping snps in 557 unique gene regions ( from 597 genes on the original ncounter panels ) . in the posh study briefly , genotyping for the samples was conducted in two separate batches in two locations ( mayo clinic and the genome institute of singapore ) . to ensure harmonization of the genotype calling , the intensity data were combined and used to generate genotypes based on the algorithm available in the genotyping module of illumina s genome studio software . breast cancer survival , right - truncated at 15 years after diagnosis , was modelled by using multivariate cox proportional hazard analyses , treating each snp as an ordinal variable ( that is , 0 , 1 and 2 copies of minor allele ) . analyses were partially adjusted for age at diagnosis ( years ) , study and seven principal components ( as recommended by cogs ) as covariates . as comparisons of survival are often confounded by differences in the patients , their tumours or the treatments , we further included covariates on tumour characteristics and treatment in a fully adjusted model , which is presented as the main analysis in this study . the fully adjusted model was additionally adjusted for tumour size ( 2 , > 2 and 5 , or > 5 cm ) , presence of distant metastasis ( m from the tumour , nodes and metastasis ( tnm ) staging system ) , lymph node status ( negative / positive ) , histopathological grade ( well , moderately or poorly differentiated ) , surgery ( no surgery , breast - saving or mastectomy with or without axillary ) , hormone therapy ( yes / no ) and radiotherapy ( no radiation , breast only , breast and lymph nodes or lymph nodes only ) . between - study heterogeneity was evaluated by using the q statistic and the i metric23 . estimated hrs and confidence limits are presented for heterozygotes and minor allele homozygotes , relative to the major allele homozygotes . delayed entry ( left truncation ) was allowed for all models to adjust for the timing of blood draw . the proportional hazards assumption for each snp was assessed using schoenfeld s test statistics24 . the kaplan meier estimator for delayed - entry data was computed using the survfit function from the survival package in r. the nagelkerke pseudo r - squared statistic was used to assess variance explained25 . to adjust for multiple testing without overly penalizing the tests snps were thinned using the indep - pairwise option in plink26 such that all snps within a window size of 50 snps ( step size of 10 ) were required to have r<0.2 . this procedure resulted in a set of 2,184 independent snps pruned by linkage disequilibrium . the bonferroni - adjusted threshold for 2,184 independent tests is 2.29 10 . in addition to standard bonferroni adjustment , a 10% false discovery rate ( fdr ) threshold was applied to try to identify more candidate snps associated with breast cancer outcome . an fdr - adjusted p - value of 0.10 implies that 10% of significant tests will result in false positives . the results for tests of association between 7,020 human immunology and inflammation snps and risk of death from er - negative breast cancer are summarized in supplementary data 2 and 3 . the deviation of the smaller observed p - values from those expected ( =1.16 ) is consistent with multiple weak associations between these snps and survival for er - negative breast cancer patients ( fig . 1 ) . in particular , for a single snp rs4458204_a located on chromosome 2:228637113 ( minor allele frequency=0.12 ) , the ( 1df ) association test statistic was much higher than for the other snps and was close to surpassing the threshold for experiment - wide significance after bonferroni adjustment ( p<2.29 10 ) in the partially adjusted analysis stratified by study and adjusted for only population stratification and age ( n=2,218 , 332 events , per - allele hr=1.54 ( 1.261.90 ) , p for trend=3.62 10 , supplementary data 3 ) . however , after further adjusting for appropriate patient tumour and treatment characteristics , the snp association surpassed the threshold for genome - wide significance ( p<5 10 ) ( per - allele hr=1.83 ( 1.472.27 ) , p for trend=4.68 10 , table 1 and fig . 2 ) , a conservative threshold which is likely to be overly stringent27 . the lack of an association signal tower could be because the icogs was designed to have minimum linkage disequilibrium across snps . no snp within a 100-kb window is correlated to rs4458204 with r2>0.2 ( fig . the association was stronger for a subset of er - negative patients who had been treated with chemotherapy ( n=1,804 , 279 events , per - allele hr=1.96 ( 1.552.47 ) , p for trend=1.60 10 ) . we found no evidence of heterogeneity in the per - allele hr across 14 studies ( i=0% , p for heterogeneity=0.84 ; forest plot in fig . 4 ) . univariate kaplan meier survival curves of breast cancer - specific survival for er - negative patients treated with chemotherapy by rs4458204 genotypes are presented in fig . 5 ( log - rank p=3.18 10 ) . snps in three other loci corresponding to regions around the transforming growth factor beta receptor ii ( tgfbr2 ) , interleukin 12b ( il12b ) and interferon induced with helicase c domain 1 ( ifih1 ) genes were found to be associated with breast cancer - specific death with fdr - adjusted p<0.10 ( fig . 2 ) . from our replication study of rs4458204_a using multi - ethnic icogs asian samples ( 522 er - negative patients treated with chemotherapy , 53 events ; see supplementary table 3 ) , the per - allele hr after controlling for tumour characteristics and treatment was 1.97 ( 0.944.17 ) ; p for trend=0.07 , table 1 ) . together with multivariable - adjusted results from a second replication of the snp using early - onset breast cancer patients posh study , significant evidence of replication was observed ( combined per - allele hr=1.52 ( 1.072.15 ) , p for trend=0.02 , table 1 ) . from a meta - analysis of both discovery and replication stages , the association of the snp with risk of dying from breast cancer was found to be 1.81 ( 1.492.19 ; p for trend=1.90 10 ) with no observed heterogeneity ( i=1.4% , p for heterogeneity=0.36 ; table 1 ) . the cluster plots for the most significant snp in our analysis , rs4458204 ( ccl20 ) , and three other index snps of loci for which the associated test statistic passed fdr<0.1 , namely rs1367610 ( tgfbr2 ) , rs2569254 ( il12b ) and rs13422767 ( ifih1 ) , were examined . all snps showed good discrimination of the three genotypes in cluster plots for the bcac samples that passed quality control in the parent cogs study ( fig . rs4458204 is located ~41.5 kb upstream of the chemokine ( c c motif ) ligand 20 ( ccl20 ) gene . chemokines are important mediators of immune response , and ccl20 has previously been shown to induce migration and proliferation of breast epithelial cells28 . ccl20 has also been reported to be strongly chemotactic for lymphocytes and weakly attracts neutrophils29 . however , rs4458204 was not found to be a significant ( p for trend>0.05 ) expression trait quantitative locus in any of the tissues ( that is , adipose subcutaneous , artery tibial , blood , heart , lung , muscle skeletal , nerve tibial , skin and thyroid ) reported on the publicly available genotype - tissue expression portal30 . it is of note that the association of rs4458204_a with the survival of er - negative breast cancer patients treated with chemotherapy increased and the strength of the association became stronger after adjustment for tumour characteristics and type of treatment ( per - allele hr ( 95% confidence interval ) from 1.64 ( 1.312.05 ) to 1.96 ( 1.552.47 ) , p for trend from 1.27 10 to 1.60 10 ) . this suggests that tumour characteristics and treatment covariates are likely to be confounders and thus it is desirable to include them in the fully adjusted model to obtain a more accurate effect size of the genetic factor . moreover , it has also been shown that adjustment for prognostic factors will lead to a gain in power for statistical analyses . genes in other regions indentified by the less stringent fdr threshold ( tgfbr2 , il12b and ifih1 ) have been implicated to play a role in breast cancer disease progression , suggesting that there are potentially more variants in immune response and inflammation genes that are associated with breast cancer prognosis . although tgfbr2 is a breast cancer susceptibility locus18 , none of the snps annotated to this gene was significantly associated with breast cancer risk ( p>0.05 ) in the parent cogs study . although several gwas have aimed to find genetic markers associated with breast cancer survival to date22313233 , few credible variants have been robustly identified . the threefold greater breast cancer mortality for affected sisters is comparable in magnitude to the familial relative risk for breast cancer incidence , for which close to 100 independent susceptibility loci based on common variants ( snps ) have been identified , and these explain only a small proportion of familial aggregation of risk18 . the failure to identify a similar number of survival - associated loci influencing survival may reflect the much lower statistical power for survival analyses to date , but may also reflect the substantial heterogeneity in tumour characteristics and treatment . as such , it has been suggested that sufficiently powered studies investigating specific cancer subtypes or treatment subgroups would need to be much larger to discover more regions in the genome associated with breast cancer prognosis33 . in agreement , the association between rs4458204 and breast cancer survival for this study was found to be more pronounced ( larger hr ) for women with er - negative disease treated with chemotherapy ( table 1 ) . however , as we did not study the association for women with er - positive disease , the impact of this snp on survival for those women remains unclear . one of the strengths of our study is that we have based our gene selection on commercially pre - designed panels of genes known to be differentially expressed in immunology and inflammation , which covers a comprehensive and validated list of relevant genes . the use of the icogs array in the bcac consortium allowed us to investigate genetic variation across > 500 immune response genes and provided an unprecedented large sample size with detailed clinical information to examine their associations with breast cancer survival . the results were also replicated by the posh study , which is not part of the cogs consortium . however , snps related to immune response and inflammation were not specifically selected to be put on the icogs panel to give comprehensive coverage of these genes ; only 557 of the 597 genes ( ~93% ) were represented . the proportion of total phenotypic variance ( nagelkerke pseudo r - squared ) explained by this snp alone was also small , at ~1.3% , suggesting that many more variants will need to be discovered for such genetic data to be useful in a clinical setting . our findings suggest that host factors affecting the ability to respond to systemic treatment or to mount an effective immunologic response contribute to the heritability of prognosis . such survival - associated variants can represent ideal targets for tailored therapeutics and may also enhance our current prognostic prediction capabilities . d.e . conceived and coordinated the synthesis of the icogs array and led bcac . 2q36.3 is associated with prognosis for oestrogen receptor - negative breast cancer patients treated with chemotherapy . supplementary tables 1 - 3 list of investigated genes implicated in human immune response and inflammation . association between snps implicated in human immunology and inflammation and risk of dying from breast cancer for er - negative patients within 15 years . association between snps implicated in human immunology and inflammation and risk of dying from breast cancer for er - negative patients treated with chemotherapy within 15 years .

large population - based registry studies have shown that breast cancer prognosis is inherited . here we analyse single - nucleotide polymorphisms ( snps ) of genes implicated in human immunology and inflammation as candidates for prognostic markers of breast cancer survival involving 1,804 oestrogen receptor ( er)-negative patients treated with chemotherapy ( 279 events ) from 14 european studies in a prior large - scale genotyping experiment , which is part of the collaborative oncological gene - environment study ( cogs ) initiative . we carry out replication using asian cogs samples ( n=522 , 53 events ) and the prospective study of outcomes in sporadic versus hereditary breast cancer ( posh ) study ( n=315 , 108 events ) . rs4458204_a near ccl20 ( 2q36.3 ) is found to be associated with breast cancer - specific death at a genome - wide significant level ( n=2,641 , 440 events , combined allelic hazard ratio ( hr)=1.81 ( 1.492.19 ) ; p for trend=1.90 109 ) . such survival - associated variants can represent ideal targets for tailored therapeutics , and may also enhance our current prognostic prediction capabilities .

You are an expert at summarizing long articles. Proceed to summarize the following text: kikuchi - fujimoto disease ( kfd ) is an extremely uncommon , benign , and self - limited disease . it is also known as histiocytic necrotizing lymphadenitis , and characterized by tender lymphadenopathy in young females , occasionally associated with low - grade fever and night sweats . it was first described by kikuchi in 1972 in japan , and also by fujimoto et al . in the same year . microscopically , it is characterized by lymphadenitis with paracortical coagulative necrosis , focal proliferation of histiocytes , and extensive karyorrhexis . we report a rare case of kikuchi 's disease in a 29-year - old male patient , presented with posterior cervical lymphadenopathy for three months with spontaneous recovery on symptomatic treatment . a 29-year - old non - smoker , normotensive , non - diabetic , male patient presented with two painless , round swellings in right side of the neck for three months with low - grade fever . initial sizes of the swellings were 2 3 cm , and 2 2 cm respectively , and their sizes were not increased . other symptoms like night sweats , fatigue , skin rash , significant weight loss , and anorexia were absent . there was no past history or family history of tuberculosis or intake of antitubercular drugs . on general survey , his pulse rate was 96 beats / minute , respiratory rate 16 breaths / minute , axillary temperature was 99f , and blood pressure was 110/70 mmhg . examination of neck revealed two , non - tender , rounded swellings in posterior triangle of right side . swellings were mobile , discrete , not fixed to underlying structures or overlying skin , and firm in consistency with lobulated surface . sizes of the swellings were 2 3 cm , and 2 2 cm respectively , and margins were discrete , not palpable inferiorly . mantoux test ( 5 tu ) was negative ( induration of 6 cm at 72 hours ) . the patient was advised tablet co - amoxiclav-625 mg three times daily for seven days . as there was no improvement , fine needle aspiration cytology of cervical lymph node was done , which revealed reactive lymphoid hyperplasia only , no granuloma or malignant cell was found . finally , excision biopsy of the cervical lymph node was done to establish the diagnosis , and histopathological examination of biopsy specimen showed lymphoid follicles with germinal centers , paracortical coagulative necrosis containing karyorrhectic foci , suggestive of kikuchi 's disease . the necrotic focis are surrounded by reactive histiocytes , lymphocytes , and occasionally by plasma cells . immunohistochemistry revealed predominance of cd8 + t lymphocytes and histiocytes in the karyorrhectic foci expressed positivity for cd 68 antigen . so , our final diagnosis was kikuchi 's disease . as it is a self - limited disease entity , no active treatment was given further ; the complete recovery was documented on follow up after one month . microphotograph of biopsy specimen from right posterior cervical lymph nodes showing paracortical coagulative necrosis containing karyorrhectic foci , surrounded by reactive histiocytes and lymphocytes suggestive of kikuchi 's disease ( h and e stain , 40 ) kfd is characterized by histiocytic necrotizing lymphadenitis of unknown etiology , mainly involves cervical lymph nodes in females with a male - female ratio of 1:4 . cervical lymph nodes are predominantly involved , i.e. , in around 80% cases , and most commonly in the posterior triangle . enlarged lymph nodes may be tender , and associated with low - grade fever , upper respiratory symptoms , or less commonly with arthralgia , skin rashes , fatigue , malaise , weight loss , anorexia , night sweats , diarrhea , nausea , vomiting , chest or abdominal pain , and hepatosplenomegaly . it is an idiopathic disease ; however , association with viral infections or autoimmune diseases like systemic lupus erythematosus , mixed connective tissue disease , and still 's disease has been hypothesized in the literature , and however no causal relationship has been confirmed . epstein barr virus , human immunodeficiency virus , herpes simplex virus , dengue virus , human t lymphotrophic virus 1 , cytomegalovirus , and parvovirus b19 have been implicated as possible etiological agents . pathogenesis of kikuchi 's disease is still not clear ; however , it is thought that primary inciting agent results in activation of t lymphocytes and histiocytes . proliferating t cells undergo apoptosis , leading to multiple paracortical areas of coagulative necrosis within the lymph nodes , which is followed by removal of nuclear debris by histiocytes . complete hemogram only reveals raised erythrocyte sedimentation rate , and atypical lymphocytes are seen in 25 to 31% patients in peripheral blood . c - reactive protein may be raised . diagnostic yield of fine needle aspiration of cytology is only 56% ; in most cases , the report is reactive hyperplasia of lymph nodes . histopathologically , there are multiple paracortical areas of coagulative necrosis with abundant karyorrhectic debris , incomplete distortion of the nodal architecture , and large number of different types of histiocytes at the margin of the necrotic areas . these karyorrhectic foci are formed by cd68 + histiocytes , plasmacytoid monocytes , immunoblasts , small and large lymphocytes , mainly cd8 + t lymphocytes . plasma cells are almost absent , which separates the disease from lupus lymphadenitis , and also anti - nuclear antibody and anti - dsdna antibody are negative in kikuchi 's disease . based on histopathologically , kuo described three types of kikuchi 's disease : proliferative , necrotizing , and xanthomatous . incomplete architectural effacement with patent sinuses , presence of multiple reactive histiocytes , scarce or absent mitotic figures , and absence of reed - sternberg cells on microscopic examination differentiate kikuchi 's disease from hodgkin 's disease or non - hodgkin 's lymphoma . supportive treatments like paracetamol or non - steroidal anti - inflammatory drugs are given to alleviate tender lymphadenopathy or fever . early establishment of tissue diagnosis of enlarge lymph nodes is essential to exclude two most common etiologies like tuberculosis and lymphoma . although kikuchi 's disease is rare , it mimics tuberculosis or lymphoma ; hence , early diagnosis by excision biopsy alters the common treatment protocol and the thinking regarding prognosis .

kikuchi - fujimoto disease , characterized by histiocytic necrotizing lymphadenitis , closely mimics tuberculosis , and lymphoma are two most common etiologies of cervical lymphadenitis . it is a rare , benign , and self - limited disease . viral infections or autoimmunity are hypothesized as its etiology , but no causal relationship is definitely established till date . no specific treatment is available , only supportive treatment is given . here , we represent a rare case of kikuchi 's disease in a 29-year - old male patient who presented to us with right - sided posterior cervical lymphadenopathy with low - grade fever for three months .

You are an expert at summarizing long articles. Proceed to summarize the following text: rhabdomyosarcoma ( rms ) is the most common histologic type of soft tissue sarcoma in children , accounting for 6% of all malignancies in patients under 15 years of age.1 2 males have a slight predilection , with a male - to - female ratio of 1.31.3 the most common sites of this tumor in children are head and neck ( 35% ) , followed by the genitourinary tract ( 23% ) , and extremities ( 17%).4 head and neck locations are anatomically divided into two categories : parameningeal ( including rms of the nose , nasopharynx , paranasal sinuses , middle ear , mastoid , infratemporal fossa , and pterygopalatine fossa ) and non - parameningeal ( including rms of the scalp , orbit , parotid gland , oral cavity , oropharynx , and larynx ) . oral lesions are uncommon and account for 1012% of all head and neck rms cases.4 5 based on the morphologic features and molecular analysis , the current world health organization classification categorizes rms into three main subtypes : embryonal ( encompassing the botryoid , spindle cell , and anaplastic variants ) , alveolar ( including the solid variant ) , and pleomorphic.6 there are certain distinctive clusters of features regarding age at diagnosis , site of primary location , and histology . embryonal subtypes are often localized with a favorable prognosis ; in contrast , alveolar subtypes present with distant metastasis and less favorable prognosis . despite improved outcomes of children with rms in developed countries , survival rates of patients in limited - resource countries continue to remain poor.7 poverty , illiteracy , advanced stage at presentation , lack of access to health care , and poor treatment infrastructure pose a major challenge in management of cancer in these countries . this paper aims to explore the epidemiological and pathological characteristics among children with orofacial rms visiting one of the most important pediatric oncology centers of morocco . the results can help in developing management strategies to improve the outcomes of our patients . we performed this retrospective study at a pediatric hematology and oncology unit from january 2003 to december 2013 . our unit is one of the five moroccan units dedicated to pediatric oncology , where 350 newly - diagnosed children with cancer receive treatment annually . despite improvements in recent years , prevention and treatment of childhood cancer continue to face challenges such as absence of standards for the diagnosis and treatment management , inadequate health coverage with high cost of management , lack of information and communication with patients , and unavailability of palliative care and psychosocial support . hence , more epidemiological studies in these fields are needed in our country for good monitoring and better planning of health services . for this study , children affected by histologically confirmed rms occurring as a primary lesion in the oral and orofacial area were included . exclusion criteria included incomplete clinical data , orbital tumors , reports with doubtful or controversial diagnosis , and cases of non - moroccan nationals . we retrospectively reviewed medical records , pathology reports , imaging , surgical treatment , chemotherapy , and radiotherapy protocols . patients were assigned according to the surgical - histopathologic grouping system used in the inter - group rhabdomyosarcoma studies8 ( table 1 ) , and to the clinical tnm pretreatment staging system based on site , size , clinical regional nodal status , and distant spread , using preoperative imaging and physical findings9 ( table 2 ) . abbreviations : m0 , absence of metastatic spread ; m1 , presence of metastatic spread beyond the primary site and regional lymph nodes ; n0 , absence of nodal spread ; n1 , presence of regional nodal spread beyond the primary site ; t1 , tumor confined to anatomic site of origin ( noninvasive ) ; t2a , tumor extension and/or fixation to surrounding tissue ( invasive ) , tumor 5 cm in maximum diameter ; t2b , tumor extension and/or fixation to surrounding tissue ( invasive ) , tumor > 5 cm in maximum diameter ; x , unknown n status . chemotherapy was used for primary cytoreduction and eradication of gross and micrometastases ; local therapy ( radiotherapy and/or surgery ) was performed in residual tumor cases . chemotherapy regimens were as follow : vincristine , actinomycin d , cyclophosphamide ( vac ) ; ifosfamide , vincristine , actinomycin d ( iva ) ; vincristine , actinomycin d , doxorubicin ( vad ) ; carboplatin , epirubicin , and vincristine ( cev ) ; vincristine , ifosfamide , etoposide ( vie ) . we valuated event - free survival ( efs ) from the date of diagnosis to the date of disease progression , recurrence , or death due to any cause . out of 181 patients diagnosed with rms in our institution between 2004 and 2013 , 31 ( 17.2% ) had orofacial location . the median age of patients was 8 4.22 years ( range : 3 months 15 years ) . there were 20 boys ( 64.5% ) and 11 girls ( 35.5% ) ; with a male to female ratio of 1.8:1 ( table 3 ) . when residence location was classified using rural - urban areas , 41.9% of the patients lived in rural areas . more than 70% of the patients did not have health care insurance and less than 55% had a low socioeconomic status . clinical manifestations of the malignancy varied largely depending on the areas involved in the tumor . the main drivers for patients to seek treatment were accelerated growth of masses resulting in facial disfigurement and development of pain . median duration of symptoms before referral to our unit was three months ( range : 20 days 9 months ) . bony sites ( 96.7% ) were more involved than soft tissues sites ( 3.3% ) . bony sites included the maxillary sinus , ethmoid sinus , body of the mandible , maxillary alveolar process , hard palate , temporomandibular joint , and pterygopalatine fossa . twenty - four ( 77.4% ) of the 31 patients presented with primary tumors greater than 5 cm in diameter and more than 80% had a parameningeal involvement . according to the pretreatment staging system,9 19.3% of the patients were stage 2 , 58.1% were stage 3 , and 22.6% were stage 4 ( table 4 ) . regardless of the tumor localization and stage , multidrug chemotherapy regimens were used in all our patients as first line of therapy . patients with tumors in stage iii were treated by chemotherapy in 45.8% of cases or by chemotherapy + radiotherapy in 45.8% , less than 9% received chemotherapy + surgery radiotherapy . patients with stage 4 were treated with chemotherapy exclusively ( 85.7% ) , while only 14.3% underwent chemotherapy and surgery ( table 5 ) . the mean follow - up of all the patients was 11 12.7 months , ranging from 7 days to 5 years . during the first year , deaths occurred in 35.5% of the cases , abandonment of treatment was found in 16.1% . patients with stage 4 showed a dismal outcome , with death occurring in 85.7% and abandonment of treatment in 14.3% . the 2-year event - free survival rate ( efs ) was 17.7 7.8% for all the patients ( fig . 1 ) . according to stage , efs was 41.7 22.2% for stage 2 , 21.6 10.9% for stage 3 , and 0% for stage 4 ( p = 0.05 ) ( fig . despite the predilection of rms for the head and neck region , orofacial presentations are rare.4 in our population , oral and maxillofacial lesions accounted for 17.2% of all cases of rms . the mean age of 8 years derived from this study is younger than the mean age of 10 from al - khateeb et al5 , but is older than the mean age of 4 years reported by sbeity et al.10 males were more affected than females , with a male to female ratio of 1.8:1 . embryonal subtype was largely predominant in our cases ( 93.5% ) , supporting previous observations in the oral and perioral region.5 11 12 currently , the majority of our patients present with advanced disease . more than half ( 58.1% ) of the cases presented in stage 3 , while 19.3% had stage 2 , and 22.6% had stage 4 . tumors more frequently affected the parameningeal sites ( 80.6% ) and had over 5 cm in size for 77.4% of the cases . furthermore , our patients showed a low survival rate with an efs of 17.7 7.8% for all the patients after two years . we found significant delays in diagnosis and delays in admission to our center of treatment . time interval from onset of symptoms to referral to hospital ranged from 20 days to 9 months . this time appears excessive in comparison to previous studies where duration of lesions varied between 2 weeks and 4 months.10 12 in all delay studies conducted so far , socioeconomic and environmental factors seem to affect access to specialist services and impact the time taken to complete diagnostic investigations . among our patients , 70.9% of them have access to a medical assistance scheme ( ramed ) , which covers costs of care in health centers , dispensaries , diagnostic centers , and public hospitals , but does not shoulder the cost of primary diagnosis examinations ( i.e. , laboratory exams , radiological explorations , molecular biology ) , which are typically only available in private clinics . populations living far from our hospital face even more obstacles , since traveling to the center of treatment represents a financial cost , in addition to the physical difficulties . missed follow - up is another important cause for the dismal prognosis of patients with malignancies in our country . reasons for abandonment are complex , but often include parental perception of the disease , socio - economic constraints of the families , and access to facilities with appropriate health services . problems related to transportation and distances and the amount of time required to travel to the treatment center could be other reasons to miss hospital appointments . regarding our patients , ( 54.8% ) had lower income , ( 41.9% ) are localized in rural areas , and 80.6% are living more than 100 km from our center of treatment . on the other hand , lack of uniformity in the treatment protocols was another cause of dismal outcome in our advanced cases.13 unavailability of some chemotherapy drugs ( e.g. , ifosphamide ) , lack of locoregional control when needed , and abandonment of treatment were determinant in treatment failure and relapse . based on these findings , at least three critical lines of actions are needed to improve the prognosis of rms in morocco : accessibility to health services for indigent patients with complex needs ; reduction of delays between the onset of the first symptoms and the beginning of anticancer treatment , availability of cancer drugs , and use of modern treatment even in resource - limited settings . this study showed that children with maxillofacial rms in our institution present late and advanced diseases with a dismal outcome . to enhance the likelihood of disease control , more studies are needed to analyze in detail the distribution delays among patients , practitioners , and the health care system regarding the social and the economic specificities in our population .

introduction rhabdomyosarcoma ( rms ) is the most common soft tissue sarcoma encountered in childhood and adolescence . early diagnosis of pediatric cases is critical to improving outcomes , especially when socioeconomic status and geographical access to specialist services can reduce opportunities for early cancer detection and treatment.objective the objective of this study is to determine factors that can delay referral and treatment in specialist pediatric oncology center upon our population specificities.methods this retrospective study involved 31 children between 2003 and 2013 . children affected by histologically confirmed rms occurring as a primary lesion in the orofacial area were included.results the median age was 8 4.22 years ( range : 3 months 15 years ) . the male to female ratio was 1.8:1 . most of the patients had advanced stage disease at presentation ( 81.7% group had 34 pretreatment staging ) with parameningeal involvement in 80.6% of the cases . the 2-year event - free survival rate was 17.7 7.8% for all the patients . delay of admission to our unit and abandonment of treatment seem to be important factors for the dismal prognosis.conclusion patient 's location , socioeconomic status and health care coverage have had an impact on longer delays in seeking care and on follow - up . more studies are needed for implementation of a better management practices and a better supportive care upon specificities of our population .

You are an expert at summarizing long articles. Proceed to summarize the following text: desmoplastic fibroma of bone is a rare locally aggressive but non - metastatic tumor which was first described by jaffe in 1958 ( 1 ) . the most commonly involved site is the mandible , followed by the femur and pelvis . in this case report bone tumors of the clavicle are rare , especially desmoplastic fibromas involving the clavicle are extremely rare , with only 2 cases reported in the literature before 1985 ( 2 ) . we present here this unusual tumor with radiologic findings from conventional radiography , magnetic resonance imaging ( mri ) and histopathology . a 28-year - old man , with a history of sudden right shoulder pain during forceful flexion of his upper arm visited our hospital complaining of tenderness , resting pain , and limitation of range of motion due to pain . initial work - up with plain radiograph demonstrated an oval shaped osteolytic lesion on the medial one - third of the right clavicle with pathologic fracture ( fig . the lesion showed hypointense to isointense signal compared to its adjacent muscle on t1-weighted images , and hypointense to isointense signal on t2-weighted images . the mass showed a expansile bulging contour with endosteal erosion and periosteal reaction with enhancement . the aggressiveness of the tumor could not be evaluated easily due to the combined fracture . our initial impression was benign primary bone tumor with low aggressiveness rather than malignant tumor . histologically , the tumor was generally hypocellular to moderately cellular and composed of bland fibroblasts in a background of numerous thick and wavy collagen fibers . multiple sections of the tumor presented no evidence of cellular pleomorphism , changes in the nuclear cytoplasmic ratio , nuclear hyperchromasia , or mitotic activity . despite its bland appearance , the tumor showed multifocal soft tissue extension ( fig . thus , the tumor was diagnosed as a desmoplastic fibroma of bone , which is considered as an intraosseous counterpart of soft tissue desmoids . finally , a wide resection including the lesion and adjacent tissues was done with an allogenous fibular bone graft and an autogenous corticocancellous iliac bone graft . desmoplastic fibroma is a rare benign primary bone tumor , which histologically similar to the soft tissue desmoid tumor . the incidence of desmoplastic fibroma is reported to comprise 0.1 - 0.3% of all primary bone tumors . the mandible ( 22% ) , pelvic bones ( 13% ) and long bones such as the femur ( 15% ) , radius ( 12% ) , tibia ( 9% ) are known as the most frequent sites of involvement ( 2 , 3 ) . on the other hand , furthermore , the majority of tumors , such as myeloma , osteosarcoma , and ewing 's sarcoma , are malignant ( 4 , 5 ) . therefore , desmoplastic fibromas involving the clavicle are extremely rare , with only 2 cases reported in the literature before 1985 ( 2 ) . pathologic fractures are reported in 9 - 15% of cases ( 6 - 8 ) . in the literature , the most consistent radiographic findings are well defined non - sclerotic marginated geographic lesions ( 94% ) , with internal pseudotrabeculation ( 91% ) and bone expansion ( 89% ) ( 7 , 8) . on mr imaging , histologically fibrous tissues are expected to show t2 shortening , and the majority of reported cases have shown hypointense or isointense signal on t1-weighted images , compared to the adjacent muscle , as well as hypointense or isointense signal on t2-weighted images . after intravenous gadolinium contrast administration , the mass shows a heterogeneous enhancement pattern , and these enhancement patterns seem to reflect the variable composition of the cellular part and collagenous matrix ( 9 , 10 ) . in our case , the mass showed hypointense to isointense signal on both t1 and t2 weighted images with a heterogeneous enhancement pattern , and showed enhancement of the adjacent bone marrow and periosteal soft tissue beyond the cortex . on plain radiograph , this well - defined non - sclerotic marginated geographic lesion can not be differentiated easily from various benign and malignant tumors . however , on mri , radiologic features of a predominantly osteolytic lesion with prominent t2 shortening makes the diagnosis of demoplastic fibroma plausible ( 9 ) . this t2 shortening is a differential feature from common clavicle tumors such as myeloma , osteosarcoma , and ewing 's sarcoma . but , some rare clavicle tumors such as non - ossifying fibroma , fibrous dysplasia , giant cell tumor , low - grade fibrosarcoma , and malignant fibrous histiocytoma also could show t2 shortening , so they needed to be included in differential diagnosis . generally , non - ossifying fibroma and giant cell tumor show hyperintense signal on t2-weighted image . low - grade fibrosarcoma and malignant fibrous histiocytoma mostly show ill - defined border and soft tissue extension . in summary , we report a desmoplastic fibroma of the clavicle presented with pathologic fracture . desmoplastic fibroma should be considered in the differential diagnosis of a locally aggressive lesion with hypointense signal on t2-weighted images , although its involvement of the clavicle is very rare .

desmoplastic fibroma of bone is a rare locally aggressive , but non - metastatic tumor . in this case report , we present a desmoplastic fibroma in an unusual location , the clavicle . desmoplastic fibroma involving the clavicle is extremely rare , with only 2 reported cases before 1985 . we report the imaging findings of a desmoplastic fibroma of the clavicle with a review of the relevant literature .

You are an expert at summarizing long articles. Proceed to summarize the following text: sample collection : samples were mainly collected in kirikkale [ ( 3950 n ; 3331 e ; altitude 700 m ) ] . there were 45,664 dairy cattle in kirikkale and approximately 13,000 cattle over 15 months of age . a low rate of abortions is usually observed on farms , and 3 abortions per 100 pregnancies per year are often considered a normal the blood samples were collected from 390 dairy cattle over 15 months of age with a history of abortion and/or infertility from randomly selected herds in kirikkale province . the remaining blood samples were collected in ankara ( 3956 n ; 3252 e ; altitude 870 m ; n=91 ) , corum ( 3914 n ; 3827 e ; altitude 810 m ; n=86 ) and yozgat ( 3950 n ; 3448 e ; altitude 1418 m ; n=89 ) provinces , which all border kirikkale province . whole blood samples were collected into edta - coated tubes and stored in 20c until rna or dna isolation . blood samples were collected into tubes without an anticoagulant for separation of serum , allowed to clot at room temperature and centrifuged at 2,000 rpm for 10 min . serological tests for detection of brucellosis : rbpt and stat were performed according to the procedures described by the manufacturer of the kits ( pendik institute , istanbul , turkey ) . the stat was considered positive , if there were any signs of agglutination in the rbpt and the titer was1:80 . elisa : commercial elisa kits were used according to the manufacturers instructions to detect the antibodies against bvdv ( bvdv ab elisa , idexx , westbrook , me , u.s.a . ) , bhv-1 ( herdchek ibr ge , idexx ) and bhv-4 ( bio - x diagnostics , rochefort , belgium ) and the antigen of bvdv ( elisa bvd / md antigen mix screening , institut pourquier , montpellier , france ) . optical densities at appropriate wavelengths were measured by an automated elisa reader ( sirio s elisa reader , reiged diagnostics , jakarta , indonesia ) . pcr and rt - pcr : to detect the bhv-1 , bhv-4 or bhv-5 gene , dna was extracted from blood using a spin column system ( high pure pcr template preparation , roche , mannheim , germany ) according to the manufacturer s instructions . to detect the bhv-1 gb , bhv-4 gb and bhv-5 gd genes , pcr was performed with the primers shown in table 1table 1.primers used for rt - pcr and pcr in this studyvirusprimer name5 3length of base pairreferencepan - pestivirus324atgcccwtagtaggactagca288 bp326tcaactccatgtgccatgtacbvdv-1a1aftcgacgccttrrcatgaaggt169 bpbvdv-1b1bftcgacgctttggaggacaagcbvdv- 1a/1b1abrccatgtgccatgtacagbvdv-2b5actagcggtagcagtgag221 bpb6ctagcggaatagcaggtcbhv-1bhv-1gb1aagcgcaaaaacgtgtg323 bpbhv-1gb2tgcaggtacagcttggcbhv-4bhv-4gb1cccttctttaccaccacctaca615 bpbhv-4gb2tgccatagcagagaaacaatgabhv-5bhv-5gd1gcccgcagtttcccctacc564 bpbhv-5gd2cgcacccgctctcaatctt . the mixture for all pcr reactions contained 5 l dna , 25 mm tris - hcl ( ph 8.9 ) , 3 mm mgcl2 ( mbi fermentas , vilnius , lithuania ) , 2 mm of dntp mix ( mbi fermentas ) , 10 pmol of each primer and 1 u of taq dna polymerase ( mbi fermentas ) . the reaction conditions for pcr were as follows : 95c for 2 min ; 35 cycles of 95c for 30 sec , 58c , 56c or 59c for 30 sec ( bhv-1 gb ) , 45 sec ( bhv-4 gb ) or 1 min ( bhv-5 gd ) , respectively , and 72c for 30 sec ; and finally 72c for 10 min . to detect bvdv gene , rna was extracted from blood using a spin column system ( high pure viral rna kit , roche ) according to the manufacturer s instructions . cdna synthesis and rt - pcr were performed according to sarikaya et al . with the primers shown in table 1 . all pcr or rt - pcr reactions were carried out in a bo - pcr-5 thermal cycler ( boeco , hamburg , germany ) . an ingenius lhr ( syngene , cambridge , u.k . ) was used to visualize pcr amplicons after electrophoresis in 1% agarose gel and ethidium bromide staining . nucleotide sequence analysis and accession numbers : amplified fragments were purified from agarose using a geneclean iii kit ( mp biomedicals , illkirch - graffenstaden , france ) following the manufacturer s instructions . direct sequencing of the dna fragments was performed for each pcr product by a commercial company ( iontek , istanbul , turkey ) . nucleotide sequences were compared with analysis software ( mega 6 and clustal omega ) . the nucleotide sequences were deposited in the genbank database under the accession numbers for bvdv ( fig . whole blood and serum samples were collected from a total of 656 cows in ankara ( n=91 ) , corum ( n=86 ) , kirikkale ( n=390 ) and yozgat ( n=89 ) provinces . forty - five of 656 serum samples ( 6.86% ) were found to be positive for brucella spp . by rbpt , and all rbpt - positive serum samples were confirmed by stat to determine their titers . the titers of 41 of the 656 serum samples ( 6.25% ) were found to be1/80 . a total of 615 serum samples ( excluding sera positive for brucella spp . ) were further tested with elisa to determine the seropositivity rate against bvdv , bhv-1 and bhv-4 . the elisa seropositivity rate for bvdv was 70.89% ( 436/615 ) ( table 2table 2.seroprevalence rates for bvdv , bhv-1 and bhv-4 in serum samples negative for brucella spp . the values represent the numbers of seropositive samples detected by rt - pcr and the numbers of pcr - positive samplesvirusprevalence ( % ) antibodiesgenebvdv436/615 ( 70.89%)18/506 ( 3.55%)bhv-1254/615 ( 41.3%)1/254 ( 0.39%)bhv-4177/615 ( 28.78%)0/177bhv-5not performed0/254**pcr performed with 254 bhv-1 seropositive samples for bhv-5 ) . there was limited information about vaccination against bhv-1 in the cattle herds accordingly , all animals were considered vaccinated , and bhv-1 ge elisa was used to distinguish naturally infected cattle from vaccinated cattle . the bhv-1 seropositivity rate was 41.3% ( 254 out of 615 ) ( table 2 ) . the seropositivity rate detected for bhv-4 was 28.78% ( 177 out of 615 ) ( table 2 ) . * pcr performed with 254 bhv-1 seropositive samples for bhv-5 for genotypic determination of bvdv , a total of 506 whole blood samples ( 436 antibody positive and 70 antigen positive by elisa ) were subjected to rt - pcr , and 18 ( 3.55% ) of them were positive ( table 2 ) . when a second round of pcr was carried out with internal primers for determination of subtypes bvdv 1a , bvdv 1b and bvdv-2 , no amplicons were observed . for genome detection of bhv-1 , pcr was carried out in 254 seropositive samples , and 1 ( 0.39% ) whole blood sample was found to be positive ( table 2 ) . pcr was performed to test 177 bhv-4 seropositive samples for bhv-4 and 254 bhv-1 seropositive samples for bhv-5 , and no amplicons were observed for bhv-4 and bhv-5 ( table 2 ) . the prevalences were calculated depending on the provinces in which the serum samples were collected . the seropositivity rates in kirikkale were 316/365 ( 85.47% ) for bvdv , 189/365 ( 51.78% ) for bhv-1 and 107/365 ( 29.31% ) for bhv-4 . the seropositivity rates in yozgat were 97.46% ( 77/79 ) , 79.74% ( 63/79 ) and 62.02% ( 49/79 ) for bvdv , bhv-1 and bhv-4 , respectively . in ankara , elisa revealed that 43.02% ( 37/86 ) , 2.32% ( 2/86 ) and 24.41% ( 21/86 ) of the samples were positive for bvdv , bhv-1 and bhv-4 , respectively . the seropositivity rate for bvdv in corum was 6/85 ( 7.05% ) , and no specific antibody was detected for bhv-1 and bhv-4 ( table 3table 3.seroprevalence of bvdv , bhv-1 and bhv-4 in serum samples negative for brucella spp . according to the provinces sampledprovinceprevalence ( % ) bvdv ab ( + ) bhv-1 ab ( + ) bhv-4 ab ( + ) kirikkale316/365 ( 86.57%)189/365 ( 51.78%)107/365 ( 29.31%)corum6/85 ( 7.05%)0/850/85yozgat77/79 ( 97.46%)63/79 ( 79.74%)49/79 ( 62.02%)ankara37/86 ( 43.02%)2/86 ( 2.32%)21/86 ( 24.41% ) ) . no antibody response against bvdv , bhv-1 or bhv-4 was observed for 143 of 615 ( 23.25% ) samples ( fig . 1.the seropositivity rates of bhv-1 , bhv-4 and bvdv infections in cattle sera . a , single- , double- and triple - positive samples ; b , samples seronegative for bvdv , bhv-1 and bhv-4 . ) . however , 111 of 615 ( 18.04% ) samples had antibodies against three of the viruses in combination . the rates of double positivity for bvdv / bhv-1 , bvdv / bhv-4 and bhv-1/bhv-4 were 20.65% ( 127/615 ) , 6.82% ( 42/615 ) and 0.65% ( 4/615 ) , respectively ( fig . the seropositivity rates of bhv-1 , bhv-4 and bvdv infections in cattle sera . a , single- , double- and triple - positive samples ; b , samples seronegative for bvdv , bhv-1 and bhv-4 . a phylogenetic tree of bvdv was generated by comparison of the nucleotide sequences between the previously reported 5-utr of the pestivirus genome and our study . the nucleotide sequences found in this study have the highest sequence similarity with hq393488 and the lowest sequence similarity with gu979818 ( fig . the phylogenetic maximum likelihood tree for the 5-utr of the pestivirus genome was generated by using the mega 6 software . sequences generated in this study were as follows : 119-kf425303 , 74-kf434627 , 60-kf434625 , 62-kf434626 , 32-kf434623 , 24-kf434622 , 22-kf434621 , 20-kf434620 , 14-kf434618 , 16-kf434619 , 12-kf425300 , 45-kf425299 , 413-kf425302 , 414-kf425301 , 90-kf434630 , 84-kf434629 , 81-kf434628 and 42-kf434624 . sequences not generated in this study were derived from genbank and were as follows : hq393488 , hq393489 , eu716142 , eu716128 , dq973179 , eu716151 , af298062 , eu716126 , af298069 , af298066 , fj493485 , af299317 , eu716118 , dq973172 and eu716125 for bvdv-1 ; eu542421 and ab042676 for bvdv-2 ; am418428 , fj493487 , gu979820.1 , gu979819.1 and gu979818.1 for bdv ; and aj605590 for csfv . ) . the bhv-1 sequence was deposited in genbank under accession number kf716130.1 . according to phylogenetic analysis , the sequence obtained in this study showed the highest similarity to the reported sequences ef175730.1 and kf584168.1 of the bhv-1 gb gene deposited in genbank ( fig . 3fig . sequences ( ef175730.1 , kj652520.1 , kj652518.1 , kf584168.1 , kc479146.1 , kf601566.1 , kf601565.1 , kc479149.1 , kc479143.1 , jf920419.1 , dq006854.1 , kf734616.1 , kc682098.1 , jn106444.1 , ay330349.1 , eu272475.1 , jf920420.1 , jf920418.1 , eu523744.1 , af258347.1 , dq006857.1 , ef624475.1 , kj652519.1 and jx898220.1 ) were not generated by this study , but were derived from genbank for the kf716130.1 sequence . ) . the phylogenetic maximum likelihood tree for the 5-utr of the pestivirus genome was generated by using the mega 6 software . sequences generated in this study were as follows : 119-kf425303 , 74-kf434627 , 60-kf434625 , 62-kf434626 , 32-kf434623 , 24-kf434622 , 22-kf434621 , 20-kf434620 , 14-kf434618 , 16-kf434619 , 12-kf425300 , 45-kf425299 , 413-kf425302 , 414-kf425301 , 90-kf434630 , 84-kf434629 , 81-kf434628 and 42-kf434624 . sequences not generated in this study were derived from genbank and were as follows : hq393488 , hq393489 , eu716142 , eu716128 , dq973179 , eu716151 , af298062 , eu716126 , af298069 , af298066 , fj493485 , af299317 , eu716118 , dq973172 and eu716125 for bvdv-1 ; eu542421 and ab042676 for bvdv-2 ; am418428 , fj493487 , gu979820.1 , gu979819.1 and gu979818.1 for bdv ; and aj605590 for csfv . the phylogenetic tree for the gb gene of bhv-1 . sequences ( ef175730.1 , kj652520.1 , kj652518.1 , kf584168.1 , kc479146.1 , kf601566.1 , kf601565.1 , kc479149.1 , kc479143.1 , jf920419.1 , dq006854.1 , kf734616.1 , kc682098.1 , jn106444.1 , ay330349.1 , eu272475.1 , jf920420.1 , jf920418.1 , eu523744.1 , af258347.1 , dq006857.1 , ef624475.1 , kj652519.1 and jx898220.1 ) were not generated by this study , but were derived from genbank for the kf716130.1 sequence . the livestock industry is severely affected by production losses due to abortion , neonatal deaths and infertility , which can be prevented by investigations of the causing infections . this study shows that bvdv , bhv-1 , bhv-4 and bhv-5 may play an important role in genital disorders and abortions in cattle in ankara , corum , kirikkale and yozgat provinces , turkey . although noninfectious factors , such as genetic , hormonal and metabolic disorders , feeding problems and unsuitable vaccination programs , cause reproductive problems , most of the reported main factors for abortion , neonatal death and infertility are still due to viral , bacterial , protozoal and fungal infections . the abortions and stillbirths of 8,995 cattle were investigated over a 10-year period , and 2,723 ( 30.38% ) of the abortions were determined to have resulted from infectious agents , while 219 ( 2.44% ) cases were the result of noninfectious causes . the rates of abortion caused by infection with viruses , bacteria and fungi were 10.57% , 14.49% and 5.31% , respectively . the etiology of the remaining 6,020 ( 67.17% ) abortions could not be determined . at the end of 2011 , schmallenberg virus was announced as a prevalent novel virus that causes abortions in european countries as well as turkey [ 6 , 23 ] . another recently discovered virus , hobi - like virus , was also found to be a reason for cattle abortions and neonatal deaths . these recently discovered viruses could have played a role in undetermined abortions reported in previous studies . in this study , we aimed to focus on viral agents , as there was limited information regarding the sampling area and cause of genital disorders ( abortion , infertility , etc . ) . samples seropositive for brucella were excluded , and a total of 615 negative serum samples were tested with commercial elisa kits to detect specific antibodies for bvdv , bhv-1 and bhv-4 . in our study , it was determined that the rate of bvdv seropositivity was 70.89% ( 436 out of 615 ) by elisa , and 3.55% ( 18 out of 506 ) of whole blood samples were positive for the bvdv gene . the seropositivity and antigen ( or genome ) rates for bvdv were 46.2286% and 2.34.9% in previous studies of cattle in turkey , respectively [ 3 , 46 , 58 ] . bvdv-1 and bvdv-2 have been reported in many countries around the world , and bvdv-1a , 1b , 1d , 1f , 1h , 1 g and 2a genotypes have already been reported in turkey [ 27 , 37 , 39 , 41 ] . investigated the genetic variability in the 5-utr of bvdv from samples obtained from kirikkale and detected bvdv-1a ( 0.625% ) and bvdv-2 ( 7.5% ) . in this study , bvdv subtypes ( bvdv 1a , bvdv 1b and bvdv-2 ) were investigated with internal primers , but no amplicons were detected . the observed difference between this study and that of sarikaya et al . suggested that the bvdv circulating among the cattle in the study area showed high relatedness according to phylogenetic analyses , although there was a difference in genotype . hence , although there is a high relatedness between the circulating strains , we speculated that there could be other genotypes besides bvdv 1a , bvdv 1b and bvdv-2 in this area . according to phylogenetic analysis , the bvdv sequences determined in this study were close to those of bvdv-1 previous reported in kirikkale , turkey . the ge blocking elisa is suitable for differentiating between infected cattle and cattle vaccinated with a ge - negative vaccine . comparison of the ge - elisa with the highly sensitive gb - elisa revealed a relative specificity of 99% and a relative sensitivity of 92% . in the present study , previous studies reported a seropositivity rate for bhv-1 of between 9.2574% in turkey [ 4 , 5 , 12 , 39 ] . the prevalences of bvdv , bhv-1 and bhv-4 were higher in kirikkale and yozgat in comparison with ankara and corum . the blood samples were collected from dairy cattle herds managed by an intensive cattle production system in ankara and corum , while they were randomly collected in kirikkale and yozgat . the observed results suggested that the intensive cattle production systems may be a limiting factor for the circulation of viral agents amongst dairy cattle farms . analysis of overlapping seroprevalence showed that the rates of double positivity were 20.65% for bvdv / bhv-1 , 6.82% for bvdv / bhv-4 and 0.65% for bhv-1/bhv-4 . the seroprevalence rates for bvdv , bhv-1 and bhv-4 in cattle with abortion problems were previously reported as rates of double seropositivity for bhv-1/bvdv ( 23.6% ) and bhv-1/bhv-4 ( 6.4% ) . furthermore , the highest rates of double seropositivity in other studies were 40.2% and 33.33% for bhv-1/bvdv . thus , it was speculated that the abortion and infertility problems in cattle were mainly caused by bhv-1 and bvdv together . bhv-1 can become latent following a primary infection with a field isolate or vaccination with an attenuated strain in sensory neurons and in non - neural sites [ 11 , 35 ] . stressful conditions , such as transport and parturition and the application of corticosteroids , can be reasons for reactivation of a latent infection . in this study , detection of the bhv-1 gb gene was carried out in 254 samples found to be seropositive for bhv-1 , and only one out of 254 ( 0.39% ) whole blood samples was detected as positive by pcr . bhv-1 circulating in this area was genetically close to bhv-1 isolates reported in india ( ef175730.1 ) and israel ( kf584168.1 ) . this is the first nucleotide sequence of bhv-1 circulating in this area of turkey to be deposited in genbank . calves up to 6 months of age are sensitive for bvh-5 compared with adult cattle , and bhv-5 persists in the nervous system or brain tissue after experimental or natural infections . in our study , all anti - bhv-1 antibody - positive samples were tested for the bhv-5 gd gene by pcr , but there were no positive results . sampling of older cattle could be one of the reasons for bhv-5 negativity in blood samples . on the other hand , bhv-5 could be present in several nervous system tissues during latent infection . thus , sampling of nervous system tissues could be preferable in future studies to obtain more effective results for detection of bhv-5 infection . bhv-4 has been identified in cases of vulvovaginitis , endometritis , mastitis and abortion and also from apparently healthy cattle . several studies reported that the seroprevalence rate for bhv-4 varies between 20.22 and 69.6% in turkey [ 5 , 10 , 22 , 28 , 57 ] . in our study , the bhv-4 seropositivity rate was 28.78% , and the comparative rates of double seropositivity for bhv-4/bhv-1 and bhv-4/bvdv were 0.51% and 8.2% , respectively . pcr was performed for 177 samples positive for the bhv-4 antibody , but no amplicons were observed for bhv-4 . however , the determined rate of bhv-4 seropositivity may be related to genital system problems in cattle of the study area . in conclusion , bhv-1 , bvdv and bhv-4 , in dairy cattle farms in ankara , corum , kirikkale and yozgat provinces . our observed seropositivity rates could be considered important , as these agents may lead to abortion in cattle in this region . a study of the genetic diversity of bvdv and bhv-1 is useful for understanding the field distribution of pestivirus , for epidemiological studies and for establishment of further preventative measures and vaccination programs in turkey . this study shows the necessity of investigation of these infectious diseases that cause economic losses in dairy farms . therefore , thorough investigation of these infection agents and genotypic characterization of them in the future are crucial to the design of detailed survey studies and development of control measures .

the aim of the study was to determine the epidemiological data of bovine viral diarrhea virus ( bvdv ) , bovine herpesvirus-1 ( bhv-1 ) , bovine herpesvirus-4 ( bhv-4 ) , bovine herpesvirus-5 ( bhv-5 ) and brucella associated cattle that were previously reported to have abortion and infertility problems in ankara , corum , kirikkale and yozgat provinces , turkey . whole blood and sera samples were obtained from 656 cattle , and antibodies against brucella spp . were detected in 45 ( 6.86% ) and 41 ( 6.25% ) animals by rose bengal plate and serum tube agglutination tests , respectively . the seropositivity rates against bvdv , bhv-1 and bhv-4 were 70.89% , 41.3% and 28.78% , respectively . rt - pcr and pcr were performed to detect rna and dna viruses in blood samples , respectively . the bvdv 5-untranslated region and bhv-1 gb gene detected in this study were phylogenetically analyzed . the bvdv strains analyzed in this study were closely related to those previously reported from turkey . the nucleotide sequence from the bhv-1 strain detected in this study is the first nucleotide sequence of bhv-1 circulating in this area of turkey deposited in the genbank . the presence of brucella spp . and prevalence of bhv-1 , bhv-4 and bvdv in cattle should be further investigated throughout these regions .

You are an expert at summarizing long articles. Proceed to summarize the following text: natural rubber latex is one of the most important industrial raw materials . currently over 12 million tons of natural rubber is produced annually , which is used in many industries to manufacture millions of consumer and commercial products such as gloves , tires , condoms , balloons , rubber boots , mattresses , swim caps , catheters , and vial stoppers . however , natural rubber latex contains fifteen proven allergenic proteins ( hev b1 to hev b15 ) , which can elicit a hypersensitive immune response in the latex - responsive population and may lead to death if severe ( anaphylaxis ) . the outbreak of latex allergy in the late 1980s and 1990s among healthcare workers has drawn great attention from biomedical researchers , clinicians , and occupation safety regulatory agencies , and thus far , millions of affected individuals have been identified . data published in the early 21 century have shown that approximately 10%-17% healthcare workers and as much as 73% patients with spina bifida have been diagnosed with latex allergy . this article aims to evaluate the current prevalence rate of latex allergy among healthcare workers , susceptible patients , and general population , on the basis of publications and data from the last five years . as latex allergy is a hypersensitive allergic reaction occurring when people come in contact with latex allergic proteins , we also strive to identify latex - containing products and understand the possible sources of latex allergen exposure . because latex allergy affects not only workers in occupations such as healthcare and those where latex gloves are frequently used but also the general population without occupational exposure to latex products , we also investigated the possible exposure routes to latex allergens . it has been well known that healthcare workers ( such as physicians , dentists , nurses , clinical laboratory workers , sonographer , and practicing midwife ) are the most affected occupational group for latex allergy due to their frequent use of latex gloves to prevent transmittable infections since 1980s . with the introduction of powder - free low - protein ( pflp ) latex gloves and synthetic gloves ( latex - free ) , occupational hazards due to latex among healthcare workers seem to have been effectively halted . however , the risk remains , particularly in those countries that are short of appropriate resources or with risk of possibly further exposure to other latex - containing products . table 1 summarizes recent studies on the prevalence of latex sensitization and allergy among healthcare workers . although both latex sensitization and latex allergy are ige - mediated hypersensitivities in response to natural rubber latex allergen exposure , latex sensitization is asymptomatic . if latex exposure continues , latex sensitization can deteriorate and become latex allergy , which presents with clinical manifestations such as itchy skin , itchy nose , urticarial , angioedema , swellings , cough , asthma , and anaphylactic reactions . based on these data , the current prevalence of latex allergy and sensitization among healthcare workers worldwide are 9.7% and 12.4% , respectively . epidemiologic studies have also revealed that patients , particularly those undergoing surgical procedures ( such as spina bifida , cesarean delivery , and bladder exstrophy ) , under anesthesia , or with catheterization ( such as urological abnormalities , cloacal anomalies , and diabetes with insulin injections ) , have higher chance to be exposed to latex allergens and therefore have higher risk to develop latex allergy . for example , reviewing 8 studies published between 1966 and 2011 suggested that the average time for presenting allergic reaction was 59.8 minutes after anesthetic induction . table 2 summarizes recent studies on the prevalence of latex sensitization and allergy among patients who have high chance of exposure to latex during medical care . based on these studies , the current prevalence of latex allergy and sensitization among patients are 7.2% and 30.4% , respectively . in addition to healthcare workers and their patients , other occupational workers including rubber industry workers , researchers who work in biology or chemistry laboratories , housekeeping personnel , gardeners , hairdressers , and food handlers , are also at high risk for latex allergy . sensitization or allergy to latex and latex - containing products may pose life - threatening risks for astronauts because of limited access to medical resources during their space travel . attention is needed to monitor their occupational exposure to latex and to prevent latex allergy health risks . it is worth noting that latex allergy does not exist exclusively among the aforementioned occupational groups . reports have suggested that general populations who have not had occupational contact with latex products can also develop latex sensitization and latex allergy ( table 3 ) . data analysis from limited studies suggests that the average latex allergy prevalence among the general population worldwide is 4.3% . it has been well known that healthcare workers ( such as physicians , dentists , nurses , clinical laboratory workers , sonographer , and practicing midwife ) are the most affected occupational group for latex allergy due to their frequent use of latex gloves to prevent transmittable infections since 1980s . with the introduction of powder - free low - protein ( pflp ) latex gloves and synthetic gloves ( latex - free ) , occupational hazards due to latex among healthcare workers seem to have been effectively halted . however , the risk remains , particularly in those countries that are short of appropriate resources or with risk of possibly further exposure to other latex - containing products . table 1 summarizes recent studies on the prevalence of latex sensitization and allergy among healthcare workers . although both latex sensitization and latex allergy are ige - mediated hypersensitivities in response to natural rubber latex allergen exposure , latex sensitization is asymptomatic . if latex exposure continues , latex sensitization can deteriorate and become latex allergy , which presents with clinical manifestations such as itchy skin , itchy nose , urticarial , angioedema , swellings , cough , asthma , and anaphylactic reactions . based on these data , the current prevalence of latex allergy and sensitization among healthcare workers worldwide are 9.7% and 12.4% , respectively . epidemiologic studies have also revealed that patients , particularly those undergoing surgical procedures ( such as spina bifida , cesarean delivery , and bladder exstrophy ) , under anesthesia , or with catheterization ( such as urological abnormalities , cloacal anomalies , and diabetes with insulin injections ) , have higher chance to be exposed to latex allergens and therefore have higher risk to develop latex allergy . for example , reviewing 8 studies published between 1966 and 2011 suggested that the average time for presenting allergic reaction was 59.8 minutes after anesthetic induction . table 2 summarizes recent studies on the prevalence of latex sensitization and allergy among patients who have high chance of exposure to latex during medical care . based on these studies , the current prevalence of latex allergy and sensitization among patients are 7.2% and 30.4% , respectively . in addition to healthcare workers and their patients , other occupational workers including rubber industry workers , researchers who work in biology or chemistry laboratories , housekeeping personnel , gardeners , hairdressers , and food handlers , are also at high risk for latex allergy . sensitization or allergy to latex and latex - containing products may pose life - threatening risks for astronauts because of limited access to medical resources during their space travel . attention is needed to monitor their occupational exposure to latex and to prevent latex allergy health risks . it is worth noting that latex allergy does not exist exclusively among the aforementioned occupational groups . reports have suggested that general populations who have not had occupational contact with latex products can also develop latex sensitization and latex allergy ( table 3 ) . data analysis from limited studies suggests that the average latex allergy prevalence among the general population worldwide is 4.3% . although public attention has been directed to the possible health risks of latex allergen exposure and the development of countermeasures including latex - free alternative products , recent reports indicate that the prevalence of latex allergy remains 9.7% , 7.2% , and 4.3% among healthcare workers , susceptible patients , and general population , respectively ( table 1 - 3 ) . as latex allergy is a hypersensitive immune response when an individual comes in contact with latex allergic proteins , understanding the sources of latex allergen exposure will help prevent allergy development and minimize the health risks . according to the international rubber study group , global natural rubber production continued to annually increase from 2000 to 2014 , and approximately 12.1 million tons of natural rubber was produced in 2014 ( fig . latex has been processed to produce many products , such as gloves , tires , condoms , balloons , rubber boots , mattresses , swim caps , catheters , and vial stoppers . with the advent of technical abilities to produce suitable and flexible natural rubber latex materials for commercial application , latex has been used to manufacture medical gloves for over 100 years . to prevent medical workers from dermatitis due to contact with chemicals , dr . william halsted , an american surgeon at johns hopkins hospital , invented latex surgical gloves . in the 1980s , healthcare workers dramatically increased the use of latex gloves because of concerns of infectious agents ( such as hiv and hepatitis b viruses ) . when compared with synthetic gloves ( nitrile and vinyl ) , latex gloves appear to be stronger , more flexible , and protective , and hence are better acceptable by workers . today , rubber latex is present in many food and medical products . food and drug administration ( fda ) has approved the application of natural rubber latex in food additives ( such as chewing gum ) , food packaging ( such as adhesives , pressure - sensitive adhesives , resinous and polymeric coatings , and antioxidants and/or stabilizers for polymers ) , and medical devices ( such as dental , gastroenterology - urology , plastic surgery , obstetrical , and gynecological devices ) . table 4 lists the regulations passed by fda to allow the usage of natural rubber latex in food and medical industries as of september 1 , 2014 . today , latex - derived products exist everywhere and have become a part of our daily life . from your home , school , and office to your daily personal care and sport activities ( table 5 ) , the chance of you coming in contact with products totally devoid of latex are limited . in a bill introduced in the house of representatives ( h.con.res.387 ; july 27 , 2000 ) , it stated that " latex exposure is ubiquitous and over 40,000 consumer products contain natural rubber latex " . searching " rubber latex " as keyword in www.walmart.com and www.amazon.com , we also found 136,032 and 73,875 results ( as of august 26 , 2015 ) , respectively . therefore , it will be extremely challenging for us able to live in a completely latex - free environment . with the advent of technical abilities to produce suitable and flexible natural rubber latex materials for commercial application , latex has been used to manufacture medical gloves for over 100 years . to prevent medical workers from dermatitis due to contact with chemicals , dr . william halsted , an american surgeon at johns hopkins hospital , invented latex surgical gloves . in the 1980s , healthcare workers dramatically increased the use of latex gloves because of concerns of infectious agents ( such as hiv and hepatitis b viruses ) . when compared with synthetic gloves ( nitrile and vinyl ) , latex gloves appear to be stronger , more flexible , and protective , and hence are better acceptable by workers . today , rubber latex is present in many food and medical products . food and drug administration ( fda ) has approved the application of natural rubber latex in food additives ( such as chewing gum ) , food packaging ( such as adhesives , pressure - sensitive adhesives , resinous and polymeric coatings , and antioxidants and/or stabilizers for polymers ) , and medical devices ( such as dental , gastroenterology - urology , plastic surgery , obstetrical , and gynecological devices ) . table 4 lists the regulations passed by fda to allow the usage of natural rubber latex in food and medical industries as of september 1 , 2014 . today , latex - derived products exist everywhere and have become a part of our daily life . from your home , school , and office to your daily personal care and sport activities ( table 5 ) , the chance of you coming in contact with products totally devoid of latex are limited . in a bill introduced in the house of representatives ( h.con.res.387 ; july 27 , 2000 ) , it stated that " latex exposure is ubiquitous and over 40,000 consumer products contain natural rubber latex " . searching " rubber latex " as keyword in www.walmart.com and www.amazon.com , we also found 136,032 and 73,875 results ( as of august 26 , 2015 ) , respectively . therefore , it will be extremely challenging for us able to live in a completely latex - free environment . because latex allergy affects not only workers in occupations such as healthcare and those that frequently use latex gloves but also the general population without occupational exposure to latex products , it is important to understand the possible exposure routes of latex allergens . direct skin contact with latex - derived products studies on healthcare workers have suggested that latex sensitivity appears to build up and increase with exposure time . in addition to latex - containing gloves and medical devices that have attracted significant attention , thousands and thousands of products may also contain natural rubber latex ( table 4 , 5 ) that is either present in the product itself or the packaging or is introduced during the manufacturing process or storage . therefore , the chance for our skin directly coming in contact with latex allergens is almost everywhere . in addition to direct skin contact with latex - derived products , people can be exposed to latex by other routes , which have been far neglected . for example , airborne latex antigens can be inhaled into the lungs and cause allergic reactions . two main sources of airborne inhalable latex allergens include cornstarch particles that are used in powdered natural rubber latex gloves and tire dusts ( especially residents living near a busy road ) . latex allergic proteins from gloves can attach to the particles of powder , which can become airborne and trigger allergic reactions . introducing powder - free gloves has been shown to result in significant decreases in the latex allergy prevalence and workers ' compensation claims . it has been reported that latex allergies can be caused by food contaminated by workers wearing latex gloves and medicines / vaccines contaminated by latex - containing vial or medical devices . natural rubber is a widely used material approved by fda for food additive , packaging , and medical devices ( table 4 ) . the centers for disease control and prevention has maintained an updated list of vaccine packaging that contains latex , possibly in vial , vial stopper , tip cap , and/or syringe ( http://www.cdc.gov/vaccines/pubs/pinkbook/downloads/appendices/b/latex-table.pdf ) . therefore , latex contamination is a " hiding " hazard to those with latex sensitivity . studies have shown that tropical fruits ( such as avocado , banana , chestnut , and kiwi ) contain proteins having allergenic similarities with latex . patients with allergy to these fruits have high risk of cross - reactivity and develop allergy known as " latex - fruit syndrome " when they come in contact with latex - derived products . approximately 30%-50% of individuals with latex allergy show an associated hypersensitivity to one or more fruits . direct skin contact with latex - derived products is the primary route for developing a latex allergy . studies on healthcare workers have suggested that latex sensitivity appears to build up and increase with exposure time . in addition to latex - containing gloves and medical devices that have attracted significant attention , thousands and thousands of products may also contain natural rubber latex ( table 4 , 5 ) that is either present in the product itself or the packaging or is introduced during the manufacturing process or storage . therefore , the chance for our skin directly coming in contact with latex allergens is almost everywhere . in addition to direct skin contact with latex - derived products , people can be exposed to latex by other routes , which have been far neglected . for example , airborne latex antigens can be inhaled into the lungs and cause allergic reactions . two main sources of airborne inhalable latex allergens include cornstarch particles that are used in powdered natural rubber latex gloves and tire dusts ( especially residents living near a busy road ) . latex allergic proteins from gloves can attach to the particles of powder , which can become airborne and trigger allergic reactions . introducing powder - free gloves has been shown to result in significant decreases in the latex allergy prevalence and workers ' compensation claims . it has been reported that latex allergies can be caused by food contaminated by workers wearing latex gloves and medicines / vaccines contaminated by latex - containing vial or medical devices . natural rubber is a widely used material approved by fda for food additive , packaging , and medical devices ( table 4 ) . the centers for disease control and prevention has maintained an updated list of vaccine packaging that contains latex , possibly in vial , vial stopper , tip cap , and/or syringe ( http://www.cdc.gov/vaccines/pubs/pinkbook/downloads/appendices/b/latex-table.pdf ) . therefore , latex contamination is a " hiding " hazard to those with latex sensitivity . studies have shown that tropical fruits ( such as avocado , banana , chestnut , and kiwi ) contain proteins having allergenic similarities with latex . patients with allergy to these fruits have high risk of cross - reactivity and develop allergy known as " latex - fruit syndrome " when they come in contact with latex - derived products . approximately 30%-50% of individuals with latex allergy show an associated hypersensitivity to one or more fruits . compared with data published in the early 21 century , analysis of current latex allergy prevalence rate suggests that a high prevalence of latex allergy remains among healthcare workers , susceptible patients , and general population worldwide ( 9.7% , 7.2% , and 4.3% , respectively ) . owing to the millions of products containing latex and many routes of exposure to latex , it is not surprising that approximately 4% of the general population worldwide exhibit a latex allergy ( table 3 ) . preventing contact with latex allergens and reducing the prevalence of latex allergy are more challenging than what we have expected . developing alternative materials for latex and increasing the ability to identify and label latex - derived products are effective approaches to control the health risks associated with latex . acknowledgments : this article was prepared in part with support from a nasa epscor grant # nnx13an08a .

objectives : this article aims to review the current prevalence rate of latex allergy among healthcare workers , susceptible patients , and the general public , and to investigate why latex is still a ubiquitous occupational health hazard . methods : scientific publications on pubmed , particularly those published within the last five years , and current regulations from agencies such as food and drug administration ( fda ) were reviewed . consumer and commercial products that may contain latex were also surveyed . results : approximately 12 million tons of natural rubber latex is produced annually and is widely used to manufacture millions of consumer and commercial products . only limited number of latex - derived products have been approved and regulated by government agencies , such as fda , whereas the majority of finished products do not label whether they contain latex . owing to millions of unidentifiable products containing latex and many routes for exposure to latex , preventing contact with latex allergens and reducing the prevalence of latex allergy are more difficult than expected . reported data suggest that the average prevalence of latex allergy worldwide remains 9.7% , 7.2% , and 4.3% among healthcare workers , susceptible patients , and general population , respectively . conclusions : latex - derived products are ubiquitous , and latex allergy remains a highly prevalent health risk in many occupations and to the general population . developing alternative materials and increasing the ability to identify and label latex - derived products will be practicable approaches to effectively control the health risks associated with latex .

You are an expert at summarizing long articles. Proceed to summarize the following text: although atherosclerosis was long thought to be mainly a degenerative disease , it is now well ascertained that its pathogenesis is inflammatory . this antigen could be a fragment of oxidized low - density lipoproteins digested by macrophages , heat shock protein 60 , 2-glycoprotein i , or fragments of bacterial antigens . for interaction between the immunological cells , the presence of cd40 receptor on macrophages and its ligand cd40l on the surface of t lymphocytes are necessary . during the interaction between these cells an immunological type t helper 1 or th1 response and its mediators interferon , tumor necrosis factor , interleukin-1 , interleukin-12 and interleukin-18 enhance atherogenesis , whereas treg response and its mediators interleukin-10 and transforming growth factor ( tgf- ) inhibit the development of atherosclerosis . apoe - knockout mice played an important role in the history of a new theory of atherogenesis since there has been lack of unequivocal evidence of an important inflammatory component in atherogenesis . gene targeting for the invention of which mario r. capecchi , martin j. evans and oliver smithies received the nobel prize in physiology or medicine in 2007 . this technique enabled the investigators to create apoe - knockout mice , an ideal animal model to test the influence of singular proteins participating in the inflammatory response on the development of atherosclerosis . these studies showed , for example , that the absence of only 1 cytokine , interferon ( ifn- ) , reduced atherosclerosis by 60% . the overexpression of adhesive molecules ( vascular adhesion molecule 1 and intercellular adhesion molecule 1 ) at sites with atheromatous changes was also observed in apoe - knockout mice . monocyte chemotactic protein ( mcp-1 ) was shown to play an important part in the progression of atheromatous lesions . finally , in apoe - knockout mice with severe combined immunodeficiency ( scid ) , atherosclerosis was reduced by 70% in comparison to the control group , due to a significantly lower number of lymphocytes in mice with scid . it was demonstrated that transfer of t cells to these mice aggravated atherosclerosis by 164% . atherosclerosis is therefore a chronic inflammatory disease , in most cases initiated by hypercholesterolemia . nowadays , the concept of atherosclerosis as inflammatory disease is fairly new , but it is already considered as an undisputable achievement of science and has particular therapeutic consequences [ 1113 ] . our goal was to investigate whether 3 different substances that can decrease the development of atherosclerosis nebivolol , ave 0991 and doxycycline [ 1416 ] could at the same time diminish the level of inflammatory indicators interleukin-6 ( il-6 ) , interleukin-12 ( il-12 ) , serum amyloid a ( saa ) , and monocyte chemotactic protein-1 ( mcp-1 ) . forty female apoe - knockout mice on the c57bl/6j background were obtained from taconic ( ejby , denmark ) . mice were maintained on 12-h dark/12-h light cycles in air - conditioned rooms ( 22.50.5c , 505% humidity ) and access to food and water ad libitum . all animal procedures were approved by the jagiellonian university ethics committee on animal experiments ( approval nr zi/496/2009 ) . at the age of 8 weeks , mice were put on chow diet made by ssniff ( soest , germany ) for 4 months . three experimental groups ( in each n=10 ) received the same diet as a control group , mixed with : ave 0991 ( a kind gift from sanofi - aventis deutschland gmbh , frankfurt am main , germany ) at a dose 0.58 mol per kg of body weight per day , or nebivolol ( a kind gift from janssen pharmaceutica , geel , belgium ) at a dose 2.0 mol per kg of body weight per day , as well as doxycycline ( sigma aldrich , st . louis , mo , usa ) at a dose 1.5 mg per kg of body weight per day [ 1719 ] . at the age of 6 months , 1000 ui of fraxiparine ( sanofi - synthelabo , france ) was injected i.p . and after 10 min mice were sacrificed in a chamber filled with carbon dioxide . plasma was separated by centrifugation at 1000 g at 4c for 10 min and stored in 80c . plasma levels of interleukin-6 ( il-6 ) , interleukin-12 ( il-12 ) and serum amyloid a ( saa ) ( all from r&d systems , minneapolis , mn , usa ) and macrophage chemotactic protein-1 ( mcp-1 ) ( biosource , camarillo , ca , usa ) were measured using elisa test . the nonparametric mann - whitney u test was used for statistical analysis of the data . forty female apoe - knockout mice on the c57bl/6j background were obtained from taconic ( ejby , denmark ) . mice were maintained on 12-h dark/12-h light cycles in air - conditioned rooms ( 22.50.5c , 505% humidity ) and access to food and water ad libitum . all animal procedures were approved by the jagiellonian university ethics committee on animal experiments ( approval nr zi/496/2009 ) . at the age of 8 weeks , mice were put on chow diet made by ssniff ( soest , germany ) for 4 months . three experimental groups ( in each n=10 ) received the same diet as a control group , mixed with : ave 0991 ( a kind gift from sanofi - aventis deutschland gmbh , frankfurt am main , germany ) at a dose 0.58 mol per kg of body weight per day , or nebivolol ( a kind gift from janssen pharmaceutica , geel , belgium ) at a dose 2.0 mol per kg of body weight per day , as well as doxycycline ( sigma aldrich , st . louis , mo , usa ) at a dose 1.5 mg per kg of body weight per day [ 1719 ] . at the age of 6 months , 1000 ui of fraxiparine ( sanofi - synthelabo , france ) was injected i.p . and after 10 min mice were sacrificed in a chamber filled with carbon dioxide . plasma was separated by centrifugation at 1000 g at 4c for 10 min and stored in 80c . plasma levels of interleukin-6 ( il-6 ) , interleukin-12 ( il-12 ) and serum amyloid a ( saa ) ( all from r&d systems , minneapolis , mn , usa ) and macrophage chemotactic protein-1 ( mcp-1 ) ( biosource , camarillo , ca , usa ) were measured using elisa test . the nonparametric mann - whitney u test was used for statistical analysis of the data . all inflammatory indicators : mcp-1 , il-6 , il-12 and saa were diminished by ave 0991 . there was also a tendency to lower mcp-1 , il-6 , il-12 and saa levels by nebivolol as well as by doxycycline ; however , it did not reach statistical significance . as regards mcp-1 , the level was 789 pg / ml in the control group , 445 pg / ml ( p<0.05 ) in the ave 0991-treated group , 697 pg / ml ( p>0.05 ) in the nebivolol - treated group , and 746 pg / ml ( p>0.05 ) in the doxycycline - treated group . as for il-6 , in control group the level was 79276 pg / ml , in the ave 0991-treated group it was 44724 pg / ml ( p<0.05 ) , in the nebivolol - treated group it was 68567 pg / ml ( p>0.05 ) , and in the doxycycline - treated group it was 71469 pg / ml ( p>0.05 ) . il-12 : in the control group the level was 84595 pg / ml , in the ave 0991-treated group it was 52465 pg / ml ( p<0.05 ) , in the nebivolol - treated group it was 73667 pg / ml ( p>0.05 ) , and in the doxycycline - treated group it was 77486 pg / ml ( p>0.05 ) . as for saa , in control group the level was 173 g / ml , in the ave 0991-treated group it was 81 g / ml ( p<0.05 ) , in the nebivolol - treated group it was 142 g / ml ( p>0.05 ) , and in the doxycycline - treated group it was 162 g / ml ( p>0.05 ) ( figures 14 ) . angiotensin ii ( ang ii ) is involved in physiology and pathology of the cardiovascular system . recent evidence shows that the renin - angiotensin system is a crucial player in the atherosclerotic processes . it was also proved that ang ii promotes atherogenesis . on the other hand , angiotensin-(17 ) [ ang-(17 ) ] therefore , we would like to find out whether angiotensin-(17 ) receptor agonist : ave 0991 , could ameliorate atherosclerosis progression in an experimental model of atherosclerosis : apolipoprotein e ( apoe ) knockout mice . the renin - angiotensin system ( ras ) is a highly complicated hormonal system controlling the cardiovascular system , kidney and adrenal glands , and is thus crucial for hydro - electrolyte balance and blood pressure regulation . ang ii increases activity of sympathetic nervous system , acts as a vasoconstrictor , and increases aldosterone release and sodium retention . additionally , ang ii stimulates free radical production , plasminogen activator inhibitor-1 ( pai-1 ) release , and expression of tissue factor ( tf ) and adhesion molecules ( vcam-1 ) . importantly , ang ii inhibits nitric oxide synthase ( nos ) , thus diminishing all beneficial effects of nitric oxide ( no ) . moreover , it opposes ang ii mitogenic , arrhythmogenic and procoagulant activities . enhancing natriuresis and diuresis recently it has been shown that vasodilatative and diuretic activities of ang-(17 ) are mediated via mas , g - coupled protein receptor . furthermore , some activities of ang-(17 ) are blocked by at1 and at2 receptors antagonists . on the other hand , ang-(17 ) , independent of mas - receptor , increases bradykinin activity and antagonizes hypertrophic action of ang ii . in 2002 non - peptide antagonist of ang-(17 ) first , ang ii may indirectly influence the atherogenic process via hemodynamic effects resulting from increased arterial blood pressure . marked increases in arterial blood pressure have been demonstrated to increase the severity of experimental atherosclerosis . second , ang ii has been demonstrated to exert several direct effects relevant to the development of atherosclerosis , including stimulation of monocyte recruitment , activation of macrophages , and enhanced oxidative stress , all of which have been linked to an increase in the atherogenesis process . these effects of ang ii occur independent of elevations in arterial blood pressure . in our experiment this phenomenon is in agreement with general anti - ang ii action of ang-(17 ) . since ang ii is a potent proatherogenic agent , its functional antagonist was able to diminish all markers of inflammation to a statistically significant degree . the endothelium plays a crucial role in vessel wall homeostasis and its inflammatory and proliferative phenotype influences the progression of atherosclerosis . nebivolol , a novel third generation 1-selective antagonist has been shown to increase bioavailability of endothelium - derived nitric oxide ( no ) and to attenuate inflammatory activation of endothelial cells . here , using an atherosclerosis model of apoe - knockout mice , we confirmed the anti - atherogenic action of nebivolol . although the details of endothelial action remain unclear , it seems that nebivolol augments vascular nitric oxide release via endothelial 2- or 3-adrenergic receptors . furthermore , it was shown that nebivolol prevents vascular nitric oxide synthase ( nos ) iii uncoupling in experimental hyperlipidemia and inhibits nadph oxidase activity in endothelial and inflammatory cells . recently , nebivolol appeared to be a potent antioxidant and has been shown to reduce expression of inflammatory adhesion molecules ( icam-1 , e - selectin ) and cytokines ( tnf- , il-6 ) , as well as prothrombotic factors ( pai-1 ) on endothelial and smooth muscle cells . our preliminary data show that inhibition of atherogenesis by nebivolol in apoe knockout mice is associated with its tendency to decrease of plasma sicam-1 and vcam-1 levels ( unpublished data ) . furthermore , baumhakel et al . reported that nebivolol , but not metoprolol , improved endothelial function of the corpus cavernosum in apoe - knockout mice . interestingly , the third generation of -adrenoreceptor antagonists with ancillary vasodilator properties ( nebivolol and carvedilol ) possesses superior clinical efficacy as compared to the classical -blockers . this seems to be related not to their -blocking properties , but to their ability to reverse endothelial dysfunction . indeed , nebivolol , but not atenolol , reversed endothelial dysfunction in patients with heart failure and hypertension . however , even though there was a tendency to diminish the level of inflammatory markers , it did not reach statistical significance . extracellular matrix ( ecm ) degradation is tightly regulated within the normal vessel wall through a balance between proteinases and their endogenous inhibitors . however , within the atherosclerotic plaque the balance may become shifted towards matrix degradation , since accumulating macrophages and phenotypically altered smooth muscle cells secrete a plethora of proteinases , including matrix metalloproteinases ( mmps ) . although undetectable in normal arteries , mmp-1 expression has been localized to the fibrous cap and the shoulder regions of carotid atherosclerotic lesions . in the latter tissue , the cellular sources of mmp-1 morphological analysis of the plaques have , in addition , revealed higher mmp-1 transcript levels in carotid lesions with a large lipid core and thin fibrous cap as compared with fibrous lesions with thick fibrous caps . the latter findings suggest an increased mmp-1 expression associated with plaque vulnerability , which has also been supported by the mmp-1 messenger rna ( mrna ) levels detected in carotid lesions derived from patients with recent ischemic manifestations . finally , a study of carotid lesions derived from patients undergoing repeated vascular intervention has shown that an increased mmp-1 expression correlated with the more foam cell - dominated late lesions compared with early restenotic lesions , which were characterized by increased smc content . taken together , these studies support a role of mmp-1 derived from inflammatory cells in ecm degradation associated with plaque rupture . exogenous synthetic inhibitors generally contain a chelating group that binds the catalytic zinc atom in the enzyme active site . doxycycline , already at sub - antimicrobial doses , inhibits mmps activity , and has been used in various experimental setups for this purpose . it is used clinically for the treatment of periodontal disease and is the only mmp inhibitor that is widely available clinically . mmps have been also considered as putative therapeutic targets in the prevention of atherogenesis . in experiments made by madan et al . , there was a positive effect of doxycycline on atherogenesis in a special apoe heterozygote murine model infected with porphyromonas gingivalis . therefore , our data , provided on apoe - knockout mice , broaden the current knowledge about the positive effect of doxycycline in sub - antimicrobial doses on atherogenesis . here , as in the case of nebivolol , there was a tendency to diminish the level of inflammatory markers , which , however , did not reach statistical significance . from the 3 checked substances ave 0991 , nebivolol and doxycycline that were able to inhibit atherosclerosis ( an inflammatory disease ) , only ave 0991 was at the same time able to diminish the rise of inflammatory markers . therefore , drug manipulations in the renin - angiotensin - aldosterone axis seem to be the most potent and promising in the future treatment of atherogenesis .

summarybackgroundthe aim of this study was to investigate whether the 3 different substances that can decrease the development of atherosclerosis nebivolol , ave 0991 and doxycycline could at the same time diminish the level of inflammatory indicators interleukin-6 ( il-6 ) , interleukin-12 ( il-12 ) , serum amyloid a ( saa ) , and monocyte chemotactic protein-1 ( mcp-1).material / methodsforty 8-week - old female apoe knockout mice on the c57bl/6j background were divided into 4 groups and put on chow diet for 4 months . three experimental groups received the same diet as a control group , mixed with ave 0991 at a dose 0.58 mol per kg of body weight per day , nebivolol at a dose 2.0 mol per kg of body weight per day , and doxycycline at a dose 1.5 mg per kg of body weight per day . at the age of 6 months , the mice were sacrificed.resultsall inflammatory indicators ( mcp-1 , il-6 , il-12 and saa ) were diminished by ave 0991 . there was also a tendency to lower mcp-1 , il-6 , il-12 and saa levels by nebivolol and doxycycline ; however , it did not reach statistical significance.conclusionsof the 3 presented substances , only ave 0991 was able to diminish the rise of inflammatory markers . therefore , drug manipulations in the renin - angiotensin - aldosterone axis seem to be the most promising in the future treatment of atherogenesis .

You are an expert at summarizing long articles. Proceed to summarize the following text: its simplicity , ease of administration and avoidance of side effects of general anesthesia are main advantages . however , a short postoperative duration of analgesia is a limitation . alpha-2 ( 2 ) adrenergic receptor agonists act at supraspinal and spinal level of central nervous system to modulate pain relief . various routes of administration of these drugs such as oral , spinal , epidural have been found to prolong the duration of spinal block . however , literature on the effects of intraoperative infusion of clonidine or dexmedetomidine on spinal block and postoperative analgesic requirement is sparse and conflicting . this study was conducted to evaluate the effects of intravenous ( iv ) infusion of dexmedetomidine and clonidine on spinal block and its postoperative analgesic effect in patients undergoing elective orthopedic surgery under spinal anesthesia . the study was conducted after institutional ethical committee clearance and written informed consent in 120 patients , 18 - 60 years of age , either sex , american society of anesthesiologists ( asa ) i and ii posted for elective fixation of long bones fractures of lower limb under spinal anesthesia . exclusion criteria 's included patient refusal for the spinal block , bmi > 30 kg / m , history of preoperative intake of beta blockers , 2 adrenergic receptor antagonists , calcium channel blockers or angiotensin converting enzyme inhibitors . patients with preoperative cardiac rhythm abnormalities - like bradycardia or a - v junction block were also excluded . the patients were randomly allocated by sealed envelope method into three equal groups to receive iv dexmedetomidine1 g / kg / h for 15 min followed by infusion of 0.3 g / kg / h till the end of surgery ( group i ) , iv clonidine 2 g / kg / h for 15 min followed by infusion of 0.5 g / kg / h till end of surgery ( group ii ) , or 15 ml of normal saline for 15 min followed by infusion at 50 ml / h till end of surgery ( group iii ) . patients in all the groups were kept fasting for solids for 6 - 8 h and received oral alprazolam 0.25 mg night before and 2 h before surgery . in the operating room , the patients were preloaded with 500 ml ringer lactate followed by administration of spinal anesthesia with 2.5 ml of 0.5% heavy bupivacaine mixed with 10 g fentanyl utilizing 23 - 25 g quincke 's needle . the patients were turned supine , and the infusion of the test drug started as per the group allotment . time taken to achieve the sensory and motor block height of t10 or above was noted . bromage score was used for assessing motor blockade and pin prick sensation for sensory blockade . vital parameters such as nibp , heart rate ( hr ) were recorded every 2 min for first 15 min and thereafter every 5 min till the end of surgery . hypotension ( fall in blood pressure > 20% of baseline ) was treated initially with fast infusion of ringer lactate 250 ml and iv mephentermine 5 mg bolus if not responding to fluid administration . bradycardia ( hr < 45 beats / min ) was treated with iv atropine 0.6 mg . ramsay sedation score was used to evaluate the perioperative sedation of the patient , after 15 min of starting the infusion and then every 30 min till end of surgery . at the end of surgery infusions pain assessment in postoperative period was done utilizing visual analogue score(vas ) and rescue analgesic in form of iv tramadol 100 mg iv was administered when vas score was > 4 . time for achieving sensory block to t12-l1 dermatome and bromage score of 0/1 was noted in the postoperative ward . presence of complications such as nausea , vomiting , shivering , bradycardia , hypotension were also noted . sample size calculation was based on a previous study , assuming use of 2 agonist to increase the duration of analgesia by 20% , with the level of significance of 95% , power of study 80% , error of 0.05 and error of 0.2 , 35 patients per group were needed . the patients in the groups were comparable with regards to age , sex , asa grade and weight [ table 1 ] . inadequate spinal block was seen in one patient , three patients and seven patients in groups i , ii and iii respectively . these patients were included in the demographic profile , but excluded from the final analysis . the median height of sensory block in all the groups was t8 with the range of t6-t10 . time required to achieve the block height was 5.7 2.2 min in group i as compared to 7.4 3.1 min in group ii and 7.4 2.6 min in group iii . the onset of sensory block was significantly faster in group i as compared to group iii ( p = 0.000 ) , while it was comparable between groups i and ii , and groups ii and iii . the mean duration of time for regression of sensory block to t12/l1 dermatome was 230.8 21.3 min in group i , 196.3 20.3 min in group ii and 163.9 15.5 min in group iii respectively . regressionof sensory block was delayed in group i compared to groups ii and iii ( p < 0.001 ) . the mean duration for regression of motor block to bromage 0/1 in unaffected limb was 274 21.3 min , 234.3 32.4 min and 130.1 20.7 min in groups i , ii and iii respectively . the mean duration of motor block was significantly prolonged in group i & ii compared to group iii ( p < 0.001 ) . a fall in hr was seen in all the groups compared to the baseline value . the values were lowest in group i at all time of observations [ figure 1 ] . heart rate at different time intervals hypotension was observed at all times of observations in all the groups . statistically significant hypotension was seen in five patients in group i and seven patients in group ii necessitating the use of iv mephentermine in two patients in group i and five patients in group ii . perioperative decrease in spo2 < 94% was observed in five patients in group i and two patients in groups ii and iii each [ table 3 ] . mean blood pressure at different time intervals incidence of intraoperative complications postoperative analgesia with iv tramadol was demanded after 353.1 39.6 min , 314.4 30.6 min and 193.3 17.7 min in groups i , ii and iii respectively of administration of spinal block . the time duration for need of rescue analgesic was significantly longer in group i and ii compared to the control group ( p < 0.001 ) . compared to group ii , time for administration of rescue analgesic was also prolonged in group i ( p < 0.001 ) . total cumulative dosage of tramadol required in first 24 h were 145.0 50.4 mg , 162.5 49.0 mg and 265.0 48.3 mg in groups i , ii and iii respectively . the cumulative doses of tramadol needed were comparable between groups i and ii ( p = 0.515 ) while it was significant between groups i and iii ( p < 0.001 ) and group ii and iii ( p < 0.001 ) . median vas score was also less in groups i and ii compared to group iii . use of 2 agonists is associated with prolongation of effects of local anesthetics , mechanisms postulated being peripheral , spinal and supra - spinal in location . supraspinal effects are a result of inhibition of locus ceruleus in brainstem resulting in disinhibition of noradrenergic nuclei and descending inhibitory effect on nociception in the spinal cord . the bolus and infusion doses of dexmedetomidine and clonidine used is varied among different studies . we selected the dose of 1 mcg / kg / h for dexmedetomidine and 2 mcg / kg / h for clonidine for bolus infusion over first 15 minutes instead of 1 mcg / kg for dexmedetomidine and 2 mcg / kg for clonidine . the dosage for bolus infusion as well as maintenance is lower than studies of various authors . the timing of starting the maintainence infusions in our studies was as soon as the patient was turned supine while in other studies it was after 15 - 20 minutes of administration of spinal block . the onset of the motor and sensory block in our study demonstrated an early response to dexmedetomidine compared to clonidine and control . a similar early onset of block was demonstrated by harsoor et al . and reddy et al . prolongation of motor and sensory block with the use of 2 agonist occurs as a result of differential block of a and c fibers . motor blockade by 2 agonist results from the direct inhibition of impulse transmission in large , myelinated a fibers . the ec50 of 2 agonist is four fold less in large fibers compared to unmyelinated c fibers . this is probably the cause of increased sensory block leading to prolonged analgesia compared to the motor block . 2 agonists leads to decreased myocardial contractility , systemic vascular resistance , cardiac output and systemic blood pressure . rapid injection results in the initial increase in blood pressure followed by a fall in blood pressure and hr . the initial increase results from peripheral vasoconstriction due to stimulation of the peripheral 2 receptors . riker and fraser have postulated use of either slow iv infusion of the loading dose or complete omission of same to decrease these hemodynamic variations . it acts at nucleus tractus solitaries in the medulla reducing the sympathetic outflow , thereby reducing hr and arterial pressure . peripheral activities at presynaptic 2 receptors causes vasodilatation and vasoconstriction at postsynaptic 2 and 1 receptors . the sedative effects of 2 agonist is due to its effect similar to endogenous sleep . the quality of sedation produced by dexmedetomidine is different when compared to sedatives acting through gamma - aminobutyric acid systems . the similarity between natural sleep and dexmedetomidine induced hypnosis results from ion conductance inhibition through l and p type calcium channels and facilitation of conductance through voltage gated potassium ion channels . inhibition of the locus coeruleus leads to disinhibition of the noradrenergic nuclei , exerting descending inhibitory effect on nociception at the spinal cord and contributing to prolonged postoperative analgesia . rescue analgesic requirements in the postoperative period were delayed in our study with the use of dexmedetomidine and clonidine . the effective doses of analgesic can not be compared with the previous studies as most have used either patient controlled analgesia or nurse controlled analgesia pumps for rescue analgesia . because of the lack of such facilities in our setup , we used 100 mg of tramadol iv on demand . we observed a lower incidence of bradycardia ( 2.5% compared to 8% and 4% respectively ) and sedation ( 5% vs. 8% ) , but a higher incidence of hypotension ( 12.5% vs. 8% and 4% respectively ) and respiratory depression ( 12.5% vs. nil ) with dexmedetomidine respectively . use of clonidine was associated with a higher incidence of hypotension ( 17.5% vs. 11.5% and 12% respectively ) and respiratory depression ( 5% vs. 0% each ) but a lower incidence of nausea / vomiting ( 2.5% vs. 8% ) and bradycardia ( 5% vs. 15.3% and 16% respectively ) compared to study of rhee et al . and lugo et al . thus co - administration of iv dexmedetomidine or clonidine improves spinal block characteristics and increases the duration of postoperative analgesia without significant motor blockade . their use may be recommended to reduce postoperative pain , analgesic requirements and improve the patient 's satisfaction in settings of limited resources . respiratory depression is a possibility which needs vigilant monitoring there are no conflicts of interest .

background and aims : different routes of administration of 2 adrenergic receptor agonists have been found to prolong the duration of spinal block.material and methods : one hundred and twenty patients , aged 18 - 60 years , of asa physical status i or ii posted for elective fixation of fractures of lower limb under spinal anesthesia were selected . spinal anesthesia was administered with 2.5 ml of 0.5% bupivacaine mixed with 10 g fentanyl . the patients were randomized to receive intravenous ( iv ) dexmedetomidine 1 g / kg / h for 15 min followed by infusion of 0.3 g / kg / h ( group i ) , iv clonidine 2 g / kg / h for 15 min followed by infusion of 0.5 g kg / h ( group ii ) or 15 ml of normal saline for 15 min followed by infusion at 50 ml / h ( group iii ) . motor and sensory blockade was evaluated using bromage score and pin prick method respectively.results:the median block height in all groups was t8 . time to achieve block height was fastest in group i. time of regression of sensory block to t12/l1 dermatome was 230.75 21.25 min ( group i ) , 196.25 20.27 min ( group ii ) and 163.88 15.46 min ( group iii ) respectively . regression of motor blocks to bromage 0/1 was 274 21.25 min , 234.25 32.41 min and 130.12 20.70 min in groups i , ii and iii respectively . bradycardia was seen in one patient in group i and two patients in group ii . hypotension was seen in five patients in group i and seven patients in group ii . first requirement for postoperative analgesic was after 353.13 39.60 min , 314.38 30.64 min and 193.25 17.74 min in groups i , ii and iii respectively.conclusion:iv 2 agonists are useful adjuvants for prolongation of the duration of spinal block . iv dexmedetomidine produces a better clinical profile compared to clonidine .

You are an expert at summarizing long articles. Proceed to summarize the following text: intraradicular posts are commonly used to restore endodontically treated teeth when their remaining coronal tissue can no longer provide adequate support and retention for the restoration . although the use of prefabricated posts has gained popularity because post placement is fast , and dental structures are preserved to a greater extent12,20,23 , the custom cast post and core system has been used for several years to retain the restorations , presenting a high level of clinical success18 . however , in some situations , mainly when the length and/or the diameter of the cast posts is unsatisfactory , or when the apical seal of the filling is inappropriate , endodontic retreatment is needed . in these situations , an atraumatic and efficient post removal is essential for optimal non - surgical endodontic management1 . drills and extractors exert high force on the root and can result in root fractures3 . ultrasonic energy is transmitted to the post , causing cracks in the cement , thus facilitating post removal5,10 . for post removal , several factors can interfere in the ultrasonic efficiency , such as the type of luting agent , and this demands particular attention10,15 . zinc phosphate cement is the main material used to lute cast posts and cores with a satisfactory performance13,14 . when root canals are short , excessively tapered or irregular , stronger cements may be recommended to improve post retention . glass ionomer and resin cements present a higher cohesive strength than does zinc phosphate cement and can be recommended in these situations8,13 . in addition , these luting materials provide favorable bond strength to the dentin root canal walls15 . it has been demonstrated that the improvement in the mechanical properties , together with the bond strength , challenges post removal by tensile tests after the use of an ultrasonic device9,10 . however , there is no consensus regarding the length of ultrasonic vibration time needed for removal of adhesively luted intraradicular cast posts . thus , the aim of this in vitro study was to evaluate the effect of the luting agent on the time required for intraradicular cast post removal from the root canal using an ultrasonic device . the tested null hypothesis was that the different luting agents do not influence the time required to remove the cast post from the root canal . thirty extracted human canines without endodontic treatment and with well - preserved coronal and radicular structures were selected from the tooth bank of the dental school of the state university of montes claros , mg , brazil . the selection criteria included : single - rooted teeth without pronounced flattening and straight roots with a single root canal . the teeth were previously examined under light at 10x magnification and those with cracks or fractures were discarded . after coronal access , the teeth were treated endodontically according to a crown - down technique with a # 50 k - file ( dentsply / maillefer , ballaigues , switzerland ) as the master apical file . all enlargement procedures were followed by irrigation with 2.5% sodium hypochlorite ( biodinmica produtos qumicos ltda , so paulo , sp , brazil ) . the smear layer was then removed using a 14.3% edta solution ( ph 7.4 ; odahcam - herpo produtos dentrios , petrpolis , rj , brazil ) for 3 min and a subsequent irrigation with sodium hypochlorite . the prepared root canals were dried with paper points and filled with guttapercha cones ( odous , belo horizonte , mg , brazil ) and pulp canal sealer - ewt cement ( kerr corporation , orange , ca , usa ) using the lateral condensation technique . after this period , each tooth was horizontally sectioned above the cementoenamel junction with a carborundum disc ( dentorium , new york , ny , usa ) to obtain a remaining root approximately 15 mm long . the crowns were discarded and the roots were embedded in autopolymerizing acrylic resin cylinders ( clssico , rio de janeiro , rj , brazil ) to facilitate handling . the post - holes were subsequently prepared using # 1 and # 2 largo drills ( dentsply / maillefer ) at a depth of 10 mm . impressions of the prepared root canal were made with autopolymerizing acrylic resin ( duralay , reliance dental , worth , il , usa ) and the posts were cast in a nickel - chromium alloy ( wironia , bego , bremen , germany ) . next , the specimens were randomly divided into 3 groups ( n=10 ) according to the luting material : g1- zinc phosphate ( s.s . white dental products , rio de janeiro , rj , brazil ) ( control group ) , g2 - glass ionomer cement ( vidrion c ; s.s . white dental products ) , and g3 - autopolymerizing resin cement ( c&b ; bisco dental products , inc . , itasca , il , usa ) . g2 the mixed cement was inserted in the post - holes with a lentulo spiral ( dentsply / maillefer ) , and the post was covered with the same cement and inserted into the root canal . in g3 , the dentin walls of the root canal were etched with 32% phosphoric acid ( bisco dental products , inc . ) for 30 s , rinsed with water and gently air- dried . two coats of the adhesive one - step plus ( bisco dental products , inc . ) were applied . the air spread was applied for 20 s and the adhesive was light - polymerized ( optilight plus , gnatus , ribeiro preto , sp , brazil ) for 30 s. the resin cement was applied as described for g1 and g2 . excess cement was removed with cotton , and the core was maintained under constant finger pressure for 1 min . the teeth were stored at 37c and 100% humidity for at least 24 h before testing . white dental products ) and # 3203 tapered diamond burs ( kg sorensen , rio de janeiro , rj , brazil ) at high speed , cutting an estimated 2.0 mm gutter around the post ( figure 1a and 1b ) . an ultrasound device ( enac , osada electric co ltd . , tokyo , japan ) with an st 09 tip ( osada electric co. ltd . , tokyo , japan ) was used at maximum power under water cooling by a single calibrated operator . vibration was applied successively to the buccal , mesial , lingual , distal and incisal surfaces ( figure 1c ) . the time required to completely dislodge each post was recorded with a digital progressive chronometer ( tecnbrs indstria e comrcio ltda , so paulo , sp , brazil ) . the values obtained were analyzed by anova and tukey 's test ( p<0.05 ) . the roots were removed from the acrylic resin and inspected under light and magnification to detect cracks and/or fractures . table 1 shows the mean time necessary to dislodge the intraradicular posts during ultrasonic vibration . means followed by different letters are statistically different ( tukey test , p < 0.05 ) . the posts luted with resin cement ( g3 ) required the longest time to be removed . in addition , two posts of g3 resisted ultrasonic removal and in one of these cases a vertical fracture line developed . g2 ( glass ionomer ) posts were removed more rapidly than those luted with zinc phosphate cement ( g1 ) , which presented an intermediate removal time . in restorations of endodontically treated teeth , the use of prefabricated posts reinforced with either glass - fiber or carbon , and cemented with adhesive materials present favorable biomechanical properties , and the elasticity modulus is close to that of dentin16,23 . nevertheless , to manage extensive coronal destruction , particularly of pillar teeth of partially fixed or removable prostheses , cast metal posts are still recommended19 . the use of ultrasound for post removal has been proven a valuable technique , contributing to the preservation of root integrity1,5,9 . in several studies , the enac - osada piezoelectric ultrasound device has been used for post removal5,9,15 . when an ultrasonic unit is used for post removal , thus , the vibration is expected to cause the cement to fracture and facilitate the post removal procedure . instead , due to the difference in mechanical properties , several studies have reported that the type of luting agent can have an influence on the ultrasonic efficiency9,10,20 . in view of the increasing number of adhesive materials zinc phosphate cement was used as the control because it is has traditionally been indicated for metal post cementation for several years8,14 . in the present study , the type of cement had a direct influence on the time required for post removal . a recent study17 found no difference in post retention when cemented with zinc phosphate or glass ionomer cements . another investigation10 demonstrated that ultrasonic vibration for 10 min reduces the retention of zinc phosphate and glass ionomer sealers by 39% and 33% , respectively . in the present study , by using these types of cement , the cast metal posts were successfully removed by ultrasonic vibration in a short time interval ( mean time up to 3 min ) . however , the time required for posts cemented with zinc phosphate was almost three times longer . considering that glass ionomer cement has adhesive properties and a viscoelastic nature that is able to attenuate vibrations and absorb the ultrasonic energy transmitted to the posts15 , a better performance of this cement could be expected . thus , post retention is mainly maintained through sliding friction4 , such as with zinc phosphate cements . there may be some explanations for the longer time required for removing the post luted with zinc phosphate . the glass ionomer has a higher solubility ( 1.25 versus 0.06 ) than does zinc phosphate21 . furthermore , the solubility of glass ionomer solubility increases when this material is used for cementation due to the lower powerliquid ratio . thus , the water from cooling the ultrasonic devices may more easily solubilize the glass ionomer cement and contribute to post removal . another explanation for the results is the possible incorporation of bubbles and other defects during the insertion of the glass ionomer cement . glass ionomer flow is low and it is difficult to manipulate , making this cement more complicated to insert . removal of the post cemented with resin cement required a longer ultrasonic application time than the other cements . this may be explained by the superior mechanical properties of this luting material . despite this improvement in mechanical properties , ultrasonic vibration seems be effective in fracturing the cement line obtained with the resin cement . however , gomes , et al.10 found no reduction in the force necessary to remove posts cemented with a resin cement after the application of ultrasonic vibration for 10 min . to the contrary , 80% of the samples luted with resin cement were successfully removed in a mean time of approximately 5 min in the present study . the difference in the results may be explained by the wear of the core and cementation line with burs performed in the present study before ultrasound application . the manufacturer of this cement recommends its use associated with the all&bond 2 or one - step adhesive systems . despite the possible incompatibility between two steps of etch&rinse adhesives with self - polymerized resin cements22 , one - step adhesive system was chosen because of its thinner adhesive layer7 . it is also important to emphasize that the low compliance of the cavity renders it nearly impossible to accommodate resin cement polymerization shrinkage during post cementation . in addition , moisture control , adhesive application , and light curing are compromised in adhesive procedures in the root canal , and low bond strength is expected . goracci , et al.11 demonstrated that the main factor contributing to the resistance to dislocation of the posts luted with resin cement seems to be achieved by sliding friction . thus , adhesive systems that present a thin layer , combined with an autopolymerizing resin cement , are preferable . considering the low bond strength and close contact between the resin cement and the dentin walls , post removal depends on the cement fracturing . consequently , the longer removal time found for the resin cement may be explained by its better mechanical properties in comparison with the other evaluated cements21 . another finding of this study was the occurrence of root fractures when resin cement was used for cast post fixation . one possible explanation is the tight bonding of this cement to the dentin root canal walls , mainly in the cervical third19 . this bonding may transmit the ultrasonic vibration to root canal walls and contribute to their fracture . despite the few root fractures and greater difficulty when compared to other cements , ultrasonic vibration was shown to be a safe and efficient method for facilitating the removal of posts luted with resin cements . within the limitations of this in vitro study , it may be concluded that the type of cement had a direct influence on the time required for intraradicular cast post removal by ultrasound . when compared to zinc phosphate and glass ionomer cements , the resin cement , required a longer ultrasonic vibration time . in addition , the majority of the posts luted with resin cement were successfully removed in a relatively short time ( mean time up to 5 min ) .

objective : this in vitro study evaluated the influence of luting agents on ultrasonic vibration time for intraradicular cast post removal.material and methods : after endodontic treatment , 30 roots of extracted human canines were embedded in resin cylinders . the post - holes were prepared at 10 mm depth and their impressions were taken using autopolymerizing acrylic resin . after casting procedures using a nickel - chromium alloy , the posts were randomly distributed into 3 groups ( n=10 ) according to the luting material : g1- zinc phosphate ( ss white ) ( control group ) , g2 - glass ionomer cement ( vidrion c ; ss white ) , and g3- resin cement ( c&b ; bisco ) . in g3 , the adhesive procedure was performed before post cementation . after 24 h , the cement line was removed at the post / tooth interface using a fine diamond bur , and the st-09 tip of an enac ultrasound unit was applied at maximum power on all surfaces surrounding the posts . the application time was recorded with a chronometer until the post was completely dislodged and data were analyzed by anova and tukey 's test ( p<0.05).results : the roots were removed from the acrylic resin and inspected to detect cracks and/or fractures . the means for g1 , g2 , and g3 were 168.5 , 59.5 , and 285 s , respectively , with statistically significant differences among them . two g3 posts resisted removal , one of which developed a vertical fracture line.conclusions:therefore , the cement type had a direct influence on the time required for ultrasonic post removal . compared to the zinc phosphate and glass ionomer cements , the resin cement required a longer ultrasonic vibration time .

You are an expert at summarizing long articles. Proceed to summarize the following text: glutamate ( glu ) is one of the key neurotransmitters in the mammalian central nervous system responsible for fast excitatory synaptic signaling in the brain . high levels of glu resulting in activation of respective receptors lead to neuronal cell death called excitotoxicity that is involved in pathophysiology of various neurodegenerative diseases , epilepsy , hypoxia or stroke ( peng et al . 2011 ) . to exert its function their structure and function were recently reviewed in detail ( lau and tymianski 2010 ) , thereby we only want to stress that glutamate receptors constitute two main groups : metabotropic glutamate receptors ( mglurs ) , which belong to the superfamily of g - protein coupled receptors , and ionotropic receptors ( iglurs ) , which form ion channels . based on the sequence homology and intracellular signal transduction mechanisms , mglurs have been classified into three subgroups : mglur1 and mglur5 , coupled to the phospholipase c , belong to group i ; group ii consists of mglur2 and mglur3 , whereas group iii contains mglur4 , mglur6 , mglur7 and mglur8 , which are all negatively coupled to adenylate cyclase . metabotropic glurs function as dimers , with two glutamate molecules being required for full receptor activation . likewise , the iglurs are divided into three groups based on structural similarities and named according to the type of synthetic agonist that activates them : n - methyl - d - aspartate ( nmda ) receptors ( nmdars ) , amino-3-hydroxy-5-methyl-4-isoxazolepropionate ( ampa ) receptors ( ampars ) , and 2-carboxy-3-carboxymethyl-4-isopropenylpyrrolidine ( kainate , ka ) receptors ( kars ) . nmdars are assembled from seven subunits : nr1 , nr2a / b / c / d , nr3a / b , each one being a product of a separate gene . nmdars consist of two obligatory nr1 subunits and two of four types of regulatory subunits , nr2a , b , c and d , which assemble as a dimer of dimers . the resulting complex might eventually join with either nr3a or nr3b , which , in such a case , replaces one of the nr2 subunits . moreover , glycine is a requisite natural agonist for nmdars ( kew and kemp 2005 ; mayer 2005 ) . for the nmdars , the nr1 subunit is necessary for calcium conductivity of the channel , while nr2 and nr3 subunits determine electrophysiological and pharmacological properties of the receptor ( traynelis et al . ampa receptors are composed of four subunits : glur1/2/3/4 , that show 70 % of homology while being products of separate genes . the glur2 subunit plays a critical role in the determination of the ca permeability of the ampars . interestingly , the genomic dna of the glur2 subunit contains a code for a glutamine ( q ) residue at amino acid 607 , but during the process of nuclear rna - editing glutamine is replaced by arginine ( r ) in the vast majority of neuronal cells , which results in a very low calcium permeability for receptors containing the glur2 subunit ( kew and kemp 2005 ; lau and tymianski 2010 ; palmer et al . 2005 ) . kainate receptors comprise two types of subunits : glur5/6/7 and ka1 and ka2 , which form homo or heterotetramers . ka1/2 homotetramers , even though they combine with the agonist , remain inactive . functional receptors that consist of ka1/2 subunits interestingly , glur2 , glur5 and glur6 undergo glutamine / arginine editing ( contractor et al . therefore , an opportunity of receptors formation with distinct physicochemical and pharmacological properties exists due to the diversity of ionotropic receptor subunits . glutamate has been proven to regulate proliferation , migration , and survival of neuronal progenitor cells and immature neurons during brain development ( ikonomidou et al . the ability of uncontrollable propagation and migration characterizes neoplastic cells as well ; therefore , glutamate was suggested as a potential growth factor in tumor development . support for this hypothesis was provided by studies that showed the generation of neurotoxic quantities of glutamate by glial tumor cells ex vivo ( in surgical specimens ) ( takano et al . 2001 ) as well as in vitro in glioma cell lines , where extracellular glutamate concentrations up to 500 mol / l were demonstrated ( ye and sontheimer 1999 ) . moreover , genetic modifications of c6 rat glioma cells facilitated creation of cell lines that release excessive amounts of glu along with non - secreting lines . subsequent xenograft studies proved that experimental tumors created from cells that release high amounts of glu grow more aggressively than those from non - modified cells ( which release moderate amounts of glu ) or from non - secreting cells ; this phenomenon was closely related to animals overall survival times ( takano et al . 2001 ) . recent studies showed also that excessive glutamate concentrations ( in the range of 100 m ) might be found in the extracellular space at the tumor margin in glioblastoma - bearing patients ( de groot and sontheimer 2011 ) resulting in neuronal cell death , which in turn facilitates tumor growth ( rothstein and brem 2001 ) and possibly relates to epileptic seizures in glioma patients ( oberndorfer et al . interestingly , the latter observation has recently been supported by a study that proved the relationship between increased levels of an excitatory neuropeptide , dynorphin 117 that comprises glutamate , and cell death or surgery - related tissue injury in vivo in epilepsy patients ( broderick et al . such levels of glu might arise from glutamate uptake / release systems that are aberrantly expressed and/or activated in glioma cells . it has also been proven that glutamate release in gliomas is , at least in part , mediated by a na - independent cystine glutamate exchanger xc system , expressed in glioma cell lines and patient - derived glioma cells ( lyons et al . pharmacologic inhibition of this system slows tumor growth and extends survival of tumor - bearing animals ( chung et al . importantly , xc system seems to be up - regulated in glioma cells acting in concert with the lack of functional na - dependent transport systems of the excitatory amino acid transporters ( eaats ) , which are responsible for glutamate uptake and are amply expressed in nonmalignant glial cells ( lyons et al . in glioma cells , eaat1/2 transporters ( especially eaat2 ) seem to inversely correlate with the degree of malignancy with almost no expression in gbms ( de groot and sontheimer 2011 ) . accordingly , glioma cells not only release glu to enhance their highly malignant behavior but also are incapable of its reuptake . more recently , it has also been demonstrated that cells from non - cns cancers may secrete glu . mda - mb-231 ( human breast ) , b16f1 ( mouse melanoma ) and matlylu ( rat prostate ) cancer cell lines release significant quantities of glutamate into their extracellular environment ( seidlitz et al . a very recent study reported that prostate cancer - bearing patients have serum glutamate levels directly correlating with gleason score ( 6 vs. 8 ) and primary prostate cancer aggressiveness ( koochekpour 2013 ) . glutamate tissue levels in fresh frozen human normal pancreatic tissue , chronic pancreatitis ( cp ) and pancreatic ductal adenocarcinoma ( pdac ) tissues demonstrated a striking increase of glutamate in cp and pdac samples , suggesting that glu might serve as a molecular switch that decreases the threshold of k - ras - induced oncogenic signaling and increases the chance of malignant transformation of pancreatic cancer precursor lesions ( herner et al . glutamate and synthetic glur agonists stimulated proliferation of a549 lung cancer cells in vitro ( rzeski et al . 2001 ; stepulak et al . 2005 , 2007 ) and invasion of pdac ( herner et al . 2011 ) . thereby , released glu can act as a growth factor and a signal mediator in non - neuronal tumor tissues , in both , autocrine and paracrine fashions . a long - standing paradigm suggested that glutamate signaling is limited to the central nervous system . recently , however this opinion has been changed owing to the studies that proved glutamate receptors existence in peripheral organs and neoplastic cells ( hinoi et al . 2004 first studies in the mid - nineties of the last century provided evidence that labeled nmda agonist ( [ 3h]mk801 ) couples with cns tumor cells ; moreover , in vitro glutamate application resulted in ca influx into those cells ( ohkuma et al . follow - up studies proved the existence of ionotropic glur1 and glur4 ( korczak et al . 1995 ) , glur2/3/4/6/7 , ka1 ( yoshioka et al . 1996 ) ] , nr1 and nr2c ( casado et al . 1996 ) , or glur1/2/3/4 in surgical samples of glioblastomas ( ishiuchi et al . 2002 ) along with various other combinations of subunits in cell lines and cns tumor samples ( aronica et al . 2001 ; de groot et al . it has been also demonstrated that glutamate receptor subunits are expressed in a variety of cancer cell lines and tumors , originating outside of cns such as colorectal ( chang et al . 2011 ) , hepatocellular ( li et al . 2012 ) or gastric cancer ( liu et al . 2007 ) , breast cancer ( north et al . 2010b ) , ovarian cancer ( choi et al . 2012 ) , lung cancers ( north et al . 2010a ) , thyroid cancer ( stepulak et al . 2009 ) , oral squamous cell carcinoma ( scc ) ( park et al . 2007 ) , larynx cancer ( stepulak et al . 2011 ) , prostate cancer ( abdul and hoosein 2005 ) , melanoma ( marin and chen 2004 ; pollock et al . 2003 ) or osteosarcoma ( kalariti et al . 2004 ) , as well as blood neoplasms such as leukemia and lymphoma ( ganor et al . 2009 ) . still , the majority of the existing studies describe single receptor or its subunit expression in selected types of cancers while a more detailed analysis of glutamate receptor subunit expression in cancer cell lines or solid tumors remains scarce . hence , we decided to analyze the presence of iglurs and mglurs receptor subunits in several cancer cell lines of neuronal and non - neuronal origin . these studies revealed differential patterns of receptor subunit expression , with some specificity for particular neoplasms ( stepulak et al . interestingly , the nr1 subunit of the nmda receptor , although present in other cell lines derived from cns neoplasms , was lacking in glioma cell lines ( stepulak et al . this observation is supported by previous studies , which showed that four analyzed glioma cell lines and patient - derived gliomas were devoid of nr1 subunit ( lyons et al . 2007 ) or that its expression was very rare in pediatric gbms ( brocke et al . 2010 ) . in contrast to nmdars , ampa receptors are abundantly expressed in glioma cells , where they play an important role in glutamate - mediated proliferative signals thus enhancing its malignant phenotype ( de groot and sontheimer 2011 ; sontheimer 2008 ) . as a matter of fact , all ampa receptor subunits were found in cns - derived tumors ( aronica et al . furthermore , the presence or lack of glur2 subunit seems to be crucial for glioma cells invasion potential . it was observed that the majority of invasive gliomas either lack glur2 expression ( lyons et al . 2007 ) or glur2 is expressed at significantly lower levels , as demonstrated in highly malignant pediatric glioblastomas , ependymomas or medulloblastomas ( all who iii or iv ) in contrast to low - grade astrocytomas ( who i or ii ) ( brocke et al . 2010 ) . additionally , rnai experiments in a low - grade glioma cell line demonstrated that down - regulation of glur2 expression caused a significant increase of cell proliferation ( beretta et al . 2009 ) . on the other hand , over - expression of edited glur2 subunit by adenovirus - mediated transfer inhibited migration of glioma cells both in vitro and in vivo ( ishiuchi et al . 2002 ) , proving that ca - permeable ampa receptors are crucial for glioma invasion . importantly , the presence of unedited ( q ) or edited ( r ) glur2 ( q / r site ) subunit is critical for calcium permeability of ampa receptor . developmentally controlled replacement of the arginine with glutamine at this critical site ( q / r site ) during an rna - editing process renders ampa receptors permeable ( unedited glur2 ) or non - permeable to ca ( hollmann and heinemann 1994 ; seeburg 1993 ) . edited form of glur2 exists exclusively in the adult brain while unedited forms are present in the fetal brain ( burnashev et al . 1992 ) and in some cancer cells or tumors ( brocke et al . 2010 ; maas et al . 2001 ; stepulak et al . when analyzing glur2 q / r - editing status in different cancer cell lines , it has been shown that some of them exclusively express the unedited form of glur2 ( sk - na - s , neuroblastoma ) or both , the edited and the unedited glur2 forms ( moggccm , astrocytoma ) . interestingly , unedited glur2 rna was found also in sk - lu-1 lung cancer cells ( stepulak et al . 2009 ) , forming highly malignant tumors with a tendency to set distant metastases . this shows that cancer cells could express ampa receptor forms characteristic for ca - permeable fetal cells , which could in turn contribute to cancer cells invasion potential , as it has been demonstrated for glioma cells ( ishiuchi et al . 2002 ) . of particular interest is the fact that glioblastoma - tumor initiating cells express high levels of functional , calcium - permeable ampa receptors containing glur1 and glur4 subunits , when compared with the differentiated tumor cultures consisting of non - stem cells derived from the same tumor tissues ( oh et al . these finding suggests that functional ampa receptors can be formed in specific areas of the tumor . as mentioned above , in contrast to ampars , moderate to high expression of nr1 subunit of nmdar has been demonstrated in prostate cancer samples , whereas its expression in normal prostate tissue and benign prostate hyperplasia was very low or absent . similar expression pattern was found in normal colon or cancer specimens ( abdul and hoosein 2005 ) . nr1 subunit immunohistochemical reactivity was observed in the majority of small - cell lung ( north et al . 2010a ) or breast cancer samples , where nr2b subunit was also detected ( north et al . 2010b ) . different combinations or single subunits of nmdars were demonstrated in cell lines derived from colon cancer ( stepulak et al . 2004 ) , laryngeal carcinoma ( stepulak et al . 2011 ) , lung cancers ( north et al . 2005 , 2007 ) , prostate cancer ( abdul and hoosein 2005 ) , thyroid cancer ( stepulak et al . watanabe et al . 2008 ) , esophageal ( kim et al . 2006 ) , and hepatocellular carcinomas ( yamaguchi et al . 2013 ) . interestingly , the expression of kainate receptors in cancer cells has not been extensively studied . the presence of glur57 subunits in human glioneuronal tumors ( aronica et al . 2001 ) , glur57 and ka1 in medulloblastomas , and additionally ka2 subunit in neuroblastoma cell lines ( yoshioka et al . 1996 ) or genome - wide association studies have recently identified glur5 expression in hepatocellular carcinoma samples ( li et al . 2012 ) , whereas glur6 subunits were detected in gastric cancer tissue and gastric cancer cell lines ( wu et al . likewise , our earlier study demonstrated the presence of glur5 in u343 glioma cells , whereas glur6 , glur7 , ka1 and ka2 subunits were found in all 12 analyzed cancer cell lines , which suggests a role of kainate receptors in metabolism and proliferation of cancer cells ( stepulak et al . however , when analyzing relative glutamate receptor subunit amounts in cancer cells in comparison to their expression in normal human brain on mrna level , significant differences were observed . as measured by means of real - time pcr technique , the majority of cancer cell lines expressed either nmda or ampa / kainate receptor subunits at much lower levels than the normal human brain ( hb ) . nmdar nr2b subunit expression level in cancer cell lines was very low compared to hb , with the exception of the human colon adenocarcinoma cell line ls180 , which showed an expression level approximating 50 % of the estimated level of nr2b subunit expression in hb . similarly , a strong expression of glur4 ampa receptor subunit was detected in two cell lines : te671 ( rhabdomyosarcoma / medulloblastoma ) and rpmi ( plasmocytoma ) , and of glur6 kainate receptor subunit in sk - na - s ( neuroblastoma ) and moggccm ( astrocytoma ) cell lines at levels comparable to those in the hb . similar levels of expression of ka2 were found also in human te671 and the hb ( stepulak et al . expression of nr2d , nr3a , ka1 , glur4 , mglur1 , mglur4 , mglur5 and mglur6 was higher in the high - grade tumors compared to human brain . in low - grade astrocytomas , expression of these glutamate receptor subunits was comparable or lower than in hb ( brocke et al . aforementioned studies provide compelling evidence that glutamate receptors are expressed at higher level in the tumors and neoplastic cell lines of brain origin than in those derived from peripheral cancers . the observation that glurs subunits , which are poorly represented in the adult brain , are expressed in cancer cells ( stepulak et al . 2009 ) is of interest as well . on the other hand , it has been shown that the expression of nmda receptor subunits in the brain varies during development ; especially nr2d subunits are present at high levels prenatally in rapidly dividing cns cells with subsequent decrease postnatally . in adults , nr2d presence is limited to small numbers of cells in selected regions of the brain ( cull - candy et al . thus , expression of nr2d subunits in all the virtually analyzed cancer cell lines ( stepulak et al . 2009 ) suggests that the re - expression of nr2d in cancer cells may correlate with their proliferative potential . interestingly , silencing of nr2d subunit did not influence cancer cells phenotypes . the same was observed for ka2 subunit , also present in all cancer cell lines analyzed ( luksch et al . it has been demonstrated with patch - clamp electrophysiological recordings that glutamate might evoke whole - cell currents in human hypothalamic hamartoma slices immediately after surgical resection ( wu et al . similarly , glutamate and nmdars agonists in the presence of glycine increased membrane - depolarization currents in neuroblastoma cells ( north et al . 1997 ) , and glioblastoma , astrocytoma , and oligodendroglioma cells responded to kainate by depolarization of tumor cells in culture or tissue slices ( labrakakis et al . it was also demonstrated that iglurs are active and functional in cancer cells derived from peripheral tumors . an analysis of whole - cell patch - clamp recordings of membrane currents proved that in a549 lung cancer and te671 ( rhabdomyosarcoma / medulloblastoma ) cell lines application of glutamate ( 10 mm ) resulted in inward currents that were almost completely blocked by application of nmda and ampa receptor antagonists . interestingly , the evoked currents were small , which is consistent with the low expression of these receptors in examined cancer cells ( stepulak et al . importantly , experimental data have also implicated important role of mglurs in malignant tumor metabolism and progression . likewise iglurs , metabotropic receptors were first detected in tumors of cns origin such as gliomas ( albasanz et al . 1997 ) , gangliogliomas and dysembryoplastic neuroepithelial tumors ( aronica et al . 2001 ) . interestingly , mglur3 receptors were present in almost all of the glioma tumor samples ( nicoletti et al . 2007 ) , including glioma initiating cells ( ciceroni et al . 2008 ) and glioma cell lines ( nicoletti et al . 2007 ) with exception of the u343 cell line ( stepulak et al . 2009 ) . in contrast , mglur1 and mglur5 were highly represented in the neuronal components of brain tumors ( aronica et al . 2001 ) . in pediatric cns tumors , the metabotropic glutamate receptor subtypes mglur1 , mglur2 , mglur4 , mglur5 and mglur6 were expressed at higher levels in the malignant tumors than in low - grade astrocytomas . glioblastoma , ependymoma and low - grade astrocytoma all showed low expression levels of mglur8 , whereas expression of mglur8 was firmly up - regulated in medullo - blastomas ( brocke et al . similarly , most of the analyzed medulloblastoma tissue samples and medulloblastoma cell lines displayed the presence of mglur4 receptors , which inversely correlated with tumor growth ( iacovelli et al . parallel to cns tumors , mglurs have been shown to be over - expressed in some types of peripheral cancers and neoplasms . high expression of mglur1 was reported in primary and metastatic prostate cancers , in contrast to non - cancerous prostate tissues in immunohistochemical analysis ( koochekpour et al . 2012 ) . moreover , mglur1 expression displayed a cell type - dependent pattern , being higher in androgen - independent and metastatic cell lines rather than in androgen - sensitive or primary prostate cancer cell lines ( koochekpour et al . mglur1/2/3/4/5 expression was demonstrated in both androgen - dependent pc-3 and androgen - independent lncap prostate cancer cell lines , whereas mglur6/8 were present in lncap cells only ( pissimissis et al . mglur4 was reported to be more specifically expressed in colorectal cancers than in normal tissues ( chang et al . 2005 ) ; different mglur combinations were also demonstrated in colon cancer derived cell lines , including ls180 cell line , where all mglurs types were detected ( stepulak et al . given the fact that mglur4 mediates 5-fluorouracil resistance in human colon cancer cells , which is a major obstacle in chemotherapy of this cancer type ( yoo et al . 2004 ) , it seems that the presence of mglur4 in some cancers could have functional significance . mglur4 was also present in the 50 % of immunohistologically analyzed laryngeal carcinomas , with lower expression in stomach , gall bladder and pancreas adenocarcinomas ( 1733 % ) . very low presence of mglur4 was demonstrated in thyroid , adrenal glands , and kidney cancers ( 813 % ) , whereas it was not detected in esophageal , endometrial and prostate cancers , as well as in neoplasms derived from salivary glands and testis ( chang et al . single studies presented an expression of different mglurs in several cancer cell lines , including those originating from thyroid and breast cancers and blood malignancies ( stepulak et al . recent studies proved that mglur1 are responsible for cell growth regulation in breast ( speyer et al . 2012 ) and renal cancer cells ( martino et al . 2013 ) , both in vitro and in vivo ; simultaneously their presence was not found in oral cancer tissues and cell lines , in contrast to mglur5 , which was present in the majority of oral cancer specimens and weakly in adjacent dysplastic oral mucosa ( park et al . moreover , melanoma development was connected with the presence of mglur1 receptors ( ohtani et al . 2008 ) , a finding that was supported by observations showing its expression in melanoma cell lines and melanoma samples , but not in normal melanocytes and benign nevi ( pollock et al . , considerable evidence exists for glutamate receptors expression in a variety of tumors and cancer cell lines along with proofs that they are functional , thereby might play an important role in neoplastic transformation and cancer progression . to substantiate the hypothesis that glutamate receptors are functionally important for tumor growth , several studies evaluated their involvement in tumorigenesis and subsequently proved that at least some of the glurs might have oncogenic properties . the impact of metabotropic glutamate receptors on tumor growth was highlighted by a series of experiments which showed causal relationship between mglur1 expression and melanoma development . chen s group was the first to demonstrate that ectopic expression of mglur1 in melanocytes , which normally lack this receptor , was sufficient to induce transformation to malignant melanoma in vivo ( pollock et al . , they were able to show that mglur1 was indispensable for the maintenance of transformation of immortalized melanocytes into tumors with short 35 days latency . their tumorigenic potential in both immunodeficient nude and syngenic mice suggested that the immune system does not influence either tumors formation or distant intestine and muscle metastases formation ( shin et al . direct evidences for mglur1-driven melanoma formation and progression were provided in the same year by ohtani and coworkers who showed that mglur1 conditionally expressed in melanocyte - induced pigmented lesions at the first stage , followed by appearance of melanoma tumors 52 weeks after transgene activation . when the transgene was inactivated , melanoma growth was inhibited as compared to animals bearing tumors with persistent mglur1 expression ( ohtani et al . similar findings were reported for mglur5 transgene activation in mice , resulting in skin hyperpigmentation , seconded by melanoma tumor formation with metastases or primary melanoma lesions detected in lymph nodes , lungs , spleen , liver , uvea and meninges that eventually penetrated into the skull bones ( choi et al . mouse kidney epithelial cells displayed in vivo tumorigenicity , when transfected to ectopically express functional mglur1 , resulting in tumor formation in nude mice . parallel , sirna - mediated inhibition of mglur1 expression in renal cancer cells impaired tumor growth in vivo , thus suggesting that sustained expression of mglur1 is necessary for neoplastic transformation and tumor progression ( martino et al . 2013 ) , whereas targeting mglur1 gene using shrna - expressing lentiviral construct reduced growth of breast cancer cells both in vitro and in vivo ( speyer et al . changes in the levels of expression of ionotropic glutamate receptors or their single subunits in experimental conditions were also demonstrated to be important for cancer cells proliferation and invasion , which suggests the involvement of glurs in cancer progression . as demonstrated in knockout experiments , diminished expression of glur1 ( ampar ) subunit at mrna and protein levels inhibited proliferation of glioma cells in vitro and in vivo ( de groot et al . another study presented that rnai - mediated suppression of glur1 or glur2 did not affect pancreatic cancer cell growth , however significantly decreased invasion in vitro , and inhibited tumor cell settling in a mouse model in vivo ( herner et al . similar , knock - down of the glur3 gene reduced proliferation and migration , as well as enhanced apoptosis of pancreatic cancer cells , while over - expression of this gene was reported to have opposite effect in vitro and in a subcutaneous xenograft model ( ripka et al . in contrast , the silencing of glur2 by sirna transfection increased glioma cell proliferation ( beretta et al . 2009 ) , whereas gene silencing of glur4 modulated the mrna expression of various tumor - suppressor genes , oncogenes and other genes involved in invasion , adhesion and metastatic capabilities , which resulted in significant increase of cell viability of human rhabdomyosarcoma / medulloblastoma ( te671 ) and human multiple myeloma rpmi8226 cells . 2011 ) . similarly to ampar subunits , modulation of expression of genes for nmdar subunits influenced behavior of cancer cells . silencing the nr2a subunit - targeted gene inhibited gastric cancer cells proliferation and cell cycle progression resulting in increased proportion of cells in g1 phase ( watanabe et al . te671 and a549 lung cancer cells demonstrated reduced cell viability after transfection and specific knockdown of nr1 gene ( luksch et al . importantly , the expression of glurs as well as their function in cancer development and progression is influenced by genomic and epigenetic modifications resulting in aberrant posttranscriptional processing . causative for the aberrant cellular function of glutamate receptors in cancer are changes in genomic sequences for mglurs and selected subunits of iglurs . of particular importance is the notion that the presence of rearranged or mutated forms of glutamate receptor subunits might activate cancer cell growth . as mentioned above , insertional mutagenesis of an ectopically expressed mglur1 in mouse results in melanoma development ( pollock et al . 2003 ) . likewise , somatic mutations within mglur3 gene result in an activation of gpcr - mediated mitogen - activated protein kinase 1/2 signaling that results in a transformed cells phenotype , which renders an increased migration of melanoma cells along with a loss of anchorage dependency in growth regulation ( prickett et al moreover , a very recent study highlighted the importance of naturally occurring grm1 somatic mutations for mglur1 surface expression , altered basal and agonist - dependent activity , and disruption of intracellular signaling pathways downstream of the receptor , including inositol phosphate ( ip ) formation , and altered erk1/2 kinases activity ( esseltine et al . 2013 ) . since these mutations were identified in different types of neoplasms including lung adeno- and scc ( kan et al . 2008 ) , it has been hypothesized that they are relevant and contribute to a cancer phenotype ( esseltine et al . 2013 ) . clinical genetic analysis of grm1 showed that single nucleotide polymorphism of the c allele of rs362962 ( coding mglur1 ) contributes to human melanoma susceptibility , especially in a subgroup of patients with a low level of sun exposure and tumors located on the trunk and extremities ( ortiz et al . a similar study performed in women carrying breast cancer revealed a significant correlation between the grm1 cc genotype of rs362962 and the development of hormone receptor - negative breast cancer and association of rs6923492 and rs362962 genotypes with age at diagnosis ( mehta et al . in contrast to metabotropic receptors , somatic mutations of iglur subunits in cancers were scarcely investigated . whole - exome sequencing analysis revealed moderate to high prevalence of somatic mutations in genes coding nr2a , and nr1 subunits of nmda receptors in melanoma ( wei et al . 2011 ) ; however , their possible consequences are not known ( prickett and samuels 2012 ) . nonetheless , in addition to genetic rearrangements , epigenetic alterations seem to play an important role in cancer development and progression . human cancers are characterized by a global impairment of dna methylation . still , hypermethylation of some dna regions , especially at the promoter cpg islands of tumor - suppressor genes , is observed ( virani et al . , considerable interests were demonstrated regarding methylation status of nmdar subunits : nr2a and nr2b promoters . aberrant promoter cpg islands hypermethylation of grin2b ( nr2b coding gene ) during breast cancer progression was reported , showing higher methylation levels and frequencies in ductal carcinoma in situ when compared with preinvasive lesions such as flat epithelial atypia or atypical ductal hyperplasia ; significantly higher methylation frequencies in grade iii than in grade i of invasive ductal carcinoma have also been shown which suggests that cpg island methylation of grin2b might be an early event in breast cancer progression ( park et al . other groups , on the other hand , found that nr2b promoter methylation exhibits tumor - suppressive activity in human esophageal ( kim et al . 2007 ) , as well as in non - small cell lung carcinoma ( tamura et al . 2011 ) . aberrant methylation status of nr2b promoter was present in more than 60 % of human gastric and non - small cell lung carcinoma samples , whereas the grin2b methylation status alterations were found in no more than 5 % of corresponding normal tissues ( liu et al . interestingly , gene methylation of nr2b displayed an inverse correlation with gene ( kim et al . 2011 ) expression , suggesting that nr2b inactivation occurs mainly through epigenetic events ( kim et al . moreover , reintroduction of this gene in esophageal cancer or forced expression in gastric cancer cell lines was accompanied by apoptosis or inhibited cell colony formation , respectively , suggesting tumor - suppressor activity for nr2b ( kim et al . , the same research group demonstrated similar results for nr2a subunit in colorectal cancers ( kim et al . nr2b methylation was significantly associated with a better prognosis regarding survival of patients with scc rather than those with adenocarcinoma ( tamura et al . therefore , rearrangements of glutamate receptors at different genetic and epigenetic levels seem to play a distinct role in their expression and function . despite the fact that the issue at hand requires more extensive studies , one may already hypothesize that different modifications of glurs and their respective genes exist in cancer cells , as demonstrated recently by the discovery of new spliced variants of human grm1 gene in melanoma cells ( diraddo et al . the unequivocally proven role of glurs in oncogenesis turned attention towards their potential clinical significance in different types of tumors . thus , in the clinical settings the expression of glutamate receptors might influence histological differentiation , clinical tumor staging , the presence of metastases and/or overall patient survival rate . one of the key features that distinguish various tumors relates to their histological differentiation and histological signs of malignancy , classified as tumor grading that influences tumor s malignancy potential and its clinical course . it has been reported that glutamate receptors expression is associated with differentiation status in a variety of tumor subtypes . in pancreatic cancer , precursor lesions as well as pancreatic intraepithelial neoplasia ampar glur1 subunit levels were increased in a step - wise manner , suggesting glutamate involvement in a malignant transformation . on the other hand , however , the expression of glur1 , glur2 and glur4 subunits was down - regulated in pdac ( herner et al . 2011 ) . moreover , in other tumor types a direct relationship between the degree of malignancy and glurs expression was found . in brain tumors , glur1 subunit was differentially expressed according to the tumor grading , being elevated in glioblastomas when compared with anaplastic astrocytomas and low - grade astrocytomas , hence correlating with tumor aggressiveness ( de groot et al . opposite association was observed when expression of glur2 was analyzed , which proved to be present in slow - growing gbm - derived tumor stem cells ( gbm tscs ) and low - grade tumor samples but not in fast - growing gliomas or high - grade tumor specimens , indicating that glur2 expression is associated with a low degree of malignancy ( beretta et al . likewise , immunohistochemistry with an anti - glur2 antibody showed a significant difference in the positivity of staining that was uniformly present in virtually 100 % of benign secretory prostatic epithelium when compared with a high - grade prostatic intraepithelial neoplasia and low gleason - patterned carcinomas where scarcely any or very low immunoreactivity of glur2 was observed . this suggests that the presence of glur2 in benign glands , including post - atrophic and adenosis - type ones , readily distinguishes them from prostate cancer ( hechtman et al . an opposite pattern was observed in normal oral mucosa showing very weak expression of nr1 subunit of nmdar , whereas majority of analyzed oral scc specimens expressed this subunit ; albeit the presence of nr1 did not correlate with histological grading of this cancer type ( choi et al . another study that implemented human tissue microarrays revealed that nmdar subunit nr2b expression was associated with the her2-positive breast cancer subtype , in contrast to the luminal subtype , where nr2b expression was not observed ( li and hanahan 2013 ) . in medulloblastoma , mglu4 receptor immunoreactivity highly correlated with the histological features showing decreasing expression levels of this receptor in the following rank order : nodular desmoplastic > classic large - cell anaplastic tumors ( iacovelli et al . 2006 ) . the relationship between glurs expression and aforementioned clinical features of cancers has been scarcely investigated though . only a few reports demonstrated that the tumor size , presence of lymph node metastases and cancer stage were significantly related to high nr1 ( choi et al . 2007 ) expression in oral scc , whereas significantly lower expression levels of mglu4 receptors were correlated with spinal cord metastases , csf spreading , and recurrence of medulloblastoma ( iacovelli et al . . tumor progression along with its dissemination and recurrence are closely related to patients prognosis and overall survival . it has been demonstrated that nr1 subunit expression was associated with unfavorable outcome in patients with oral scc ( choi et al . 2004 ) , whereas mglur5 expression showed positive correlation with an overall survival of patients with the same malignancy ( park et al . similarly , in medulloblastoma the expression of mglur4 was higher in patients , who survived 5-year after surgery ( iacovelli et al . , overexpression of mglur4 is associated with a poor prognosis in colorectal carcinoma ( chang et al . interestingly , glur2 expression showed a significant correlation with longer progression - free and overall survivals and was down - regulated in chemoresistant tumors , proving to be a positive prognostic factor for patients with advanced serous papillary ovarian adenocarcinoma ( choi et al . gene expression analysis of several hundred glioblastoma samples revealed that a loss of gria2 ( gene for glur2 ) expression was 1 of the 38 gene changes that predict a poor prognosis in glioblastoma ( colman et al . whenever high nr2b expression levels correlated with high vglut2 vesicular glutamate transporter expression , the survival of patients bearing glioblastoma was significantly shorter , when compared with the patients groups that expressed low levels of nr2b / vglut2 ( li and hanahan 2013 ) . research into the role of glu signaling in cancer development and progression is still in its infancy ; however , important progress has been made in recent years . considerable evidence exists and indicates that glutamate plays an important role in tumor development , acting as a growth factor and a signal mediator in neural as well as non - neuronal tumors tissues , in both autocrine and paracrine fashions . it has been proven that its actions involve mainly a family of receptors consisting of metabotropic glutamate receptors and ionotropic glutamate receptors whose presence has been proven in a variety of benign and malignant lesions throughout the body . their actions , however , might differ significantly due to the fact that glurs are combined from various subunits , which result in a large diversity of intracellular signaling and distinct pharmacological properties . moreover , receptor subunits such as the nr1 subunit of the nmda receptor are prone to post - transcriptional events ( rna editing and alternative splicing of rna ) , which may result in distinct isoforms ( for example eight in case of nr1 subunit ) due to the presence of independent sites of alternative splicing . on top of that receptor subunits might undergo further posttranslational and epigenetic modifications resulting in even more complex glutamate signal transduction . thus , the clinical significance of glutamate receptor expression may differ among tumor entities and it is difficult to predict how the expression of a particular subunit will influence cancer behavior . still , it is tempting to speculate that glurs and their signaling pathways render promising targets for therapeutic interventions . as a matter of fact , in recent years , there have been multiple attempts to implement iglur and mglur antagonists , in particular in malignant glioma treatment . drugs such as ampar / kr inhibitors , zk 200775 and gyki 52466 , despite having little effect on glioma growth in vitro , have been shown to exert anti - proliferative and anti - excitotoxic effects in rat hippocampal glioma models . similar results were obtained for the nmdar antagonists , norketamine 72 and mk801 ( memantine ) . in fact , memantine has even been employed in a phase ii clinical trial to determine its safety / efficacy in glioma patients ; however , results are not yet available ( http://clinicaltrials.gov # nct01260467 ) . similarly , the effectiveness of talampanel ( an ampar antagonist ) against glioma has been explored in the clinic . this study was completed with results that were not encouraging though ( de groot and sontheimer 2011 ) . interestingly , despite all of the preclinical work and clinical trials ( in progress or completed ) involving iglur antagonists , studies targeting mglur in glioma treatment are lacking . mglurs , being able to form functional homodimers as typical gpcrs , are considered more susceptible to anti - cancer drug design ( willard and koochekpour 2013 ) and may constitute better drug targets than iglurs ( teh and chen 2012 ) . yet , no clinical trials are currently ongoing . future studies in this field are clearly needed to determine the efficacy of mglur antagonists and glu release inhibitors such as riluzole against tumors . it is clear that more research is needed to define the clinical significance of glu glur expression and signaling in various cancers . given existing preliminary studies , it will be extremely interesting to follow the field of glutamatergic signaling in cancer in future years .

glutamate , a nonessential amino acid , is a major bioenergetic substrate for proliferating normal and neoplastic cells on one hand and an excitatory neurotransmitter that is actively involved in biosynthetic , bioenergetic , metabolic , and oncogenic signaling pathways on the other . it exerts its action through a family of receptors consisting of metabotropic glutamate receptors ( mglurs ) and ionotropic glutamate receptors ( iglurs ) , both of which have been implicated previously in a broad spectrum of acute and chronic neurodegenerative diseases . in this review , we discuss existing data on the role of glutamate as a growth factor for neoplastic cells , the expression of glutamate receptors in various types of benign and malignant neoplasms , and the potential roles that glurs play in cancer development and progression along with their clinical significance . we conclude that glutamate - related receptors and their signaling pathways may provide novel therapeutic opportunities for a variety of malignant human diseases .

You are an expert at summarizing long articles. Proceed to summarize the following text: the combination of positron emission tomography ( pet ) with its high sensitivity and the possibility for quantitative imaging and magnetic resonance imaging ( mri ) has the potential to become the next generation of hybrid imaging techniques . in contrast to the combination of pet with computed tomography ( ct ) , mri offers a better soft tissue contrast and does not use ionizing radiation , thus reducing the overall required radiation dose significantly . to enable the full potential of a hybrid pet / mri system , both imaging modalities have to work simultaneously , especially to enable a high quality spatial and temporal registration of imaging data at shorter scan times . an mri system basically consists of three main components , namely a strong magnet , a gradient system and a radio frequency ( rf ) system . new detector systems inside the mri bore , e.g. a preclinical pet insert , have the potential to interfere with all these subsystems of the mri system and vice versa . [ 24 ] observe image degradation on the mri side caused by the presence of a pet detector , other groups observe a direct influence on the pet performance caused by the rf pulses of the mri or switching gradients . the first step to enable the usage of a pet detector inside the mri was the replacement of photomultiplier tubes with solid state photo detectors , e.g. silicon photomultipliers ( sipm ) . especially fully digital silicon photomultipliers ( dsipms ) offer a good timing , energy and spatial resolution as well as a good temperature stability and they are a promising candidate concerning their mr - compatibility . however , they tend to generate digital electromagnetic noise patterns which might degrade the mr image quality . thus , proper pet system design and shielding is required to avoid interference . in this work , we started to investigate the interference phenomena and we tested the dsipms and our detector architecture concerning mr - compatibility . the hyperion - ii pet / mr insert and all its support electronics are installed ( as shown in fig . 1 ) on a patient tabletop and trolley , creating a easy to handle and quickly installable system . the pet ring is made up of ten pet singles detection modules ( sdm ) which are mounted on a mr - compatible gantry , thus creating a pet ring with diameter of around 210 mm . 2 ) hosts up to six detector stacks in a 23 arrangement ( at this stage only two stacks per module are installed ) and the communication and synchronization of multiple modules is done via plastic optical fibers ( pof ) to avoid galvanic connections between the modules and the data acquisition and processing server ( daps , similar to the architecture described in ) outside the mr examination room . one detector stack is composed of a crystal array ( 3030 , 1 mm pitch ) , a 2 mm light guide for light sharing , an 88 dsipm array ( dpc 3200 - 22 - 44 by philips digital photon counting ) and a local fpga . the sdm is housed inside an almost gamma transparent carbon fiber screen which shows good rf shielding properties while being mostly transparent for gradients . the insert is designed to fit into a philips achieva 3 t mri system and is equipped for mr acquisition with a dedicated pet transparent t / r mouse proton rf - coil ( 12 leg birdcage , high pass ) , which has an inner diameter of 46 mm . consequently , the combined field - of - view ( fov ) in this configuration is 46 mm33 mm ( one of the three possible pet rings installed ; up to 46 mm 100 mm when all detector stacks are installed ) . to investigate the interference on the mri system , signal - to - noise ratio ( snr ) measurements without and with the pet detector ( 10 sdms ) therefore , a transversal slice of a 50 mm cylindrical phantom ( 1000 ml demi water , 770 mg cuso45 h2o , 2000 mg nacl , 0.05 ml h2so4 0.1n solution ) is imaged using spin echo ( se ) sequences ( tr / te : 1000/50 ms , voxel size : 0.250.251 mm , flip angle : 90 ) . to study the noise creation by the pet electronics , dedicated noise scans ( tse sequence , tr / te : 1044/256 ms , tse factor : 32 , acq . matrix : 10241024 , bandwidth per pixel : 180 hz ) are performed with the complete pet detector and with single pet modules . experiments with subsystems replacing the complete pet detector are conducted to study the rf interference in detail and to identify the noise 's origin . improvements of the shielding of the power supply unit ( psu ) are also realized and tested with these noise scans . the pet performance and stability during simultaneous operation was studied with one pet module ( equipped with one stack ) by single event detection . pet data and system parameters like voltages , currents and temperatures are acquired using a na point source ( activity : 2.8 mbq ) over a longer time period ( several minutes up to 45 min ) . during this data acquisition ( as shown in fig . 3 ) , highly demanding rf and gradient stress tests ( with various switching directions ) are performed in smaller time windows ( 30 s2 min ) . for the gradient tests , epi sequences ( epi factor : 49 ) with maximum gradient strength ( 30 mt ) , maximal slew rates and minimal tr with defined switching directions ( the individual parameters are listed in table 1 ) are used and for the rf test a highly demanding tse sequence ( tse factor : 16 , te / tr : 21/333 ms , peak b1 amplitude : 20t ) is executed . to investigate the interference on the mri system , signal - to - noise ratio ( snr ) measurements without and with the pet detector ( 10 sdms ) are performed . therefore , a transversal slice of a 50 mm cylindrical phantom ( 1000 ml demi water , 770 mg cuso45 h2o , 2000 mg nacl , 0.05 ml h2so4 0.1n solution ) is imaged using spin echo ( se ) sequences ( tr / te : 1000/50 ms , voxel size : 0.250.251 mm , flip angle : 90 ) . to study the noise creation by the pet electronics , dedicated noise scans ( tse sequence , tr / te : 1044/256 ms , tse factor : 32 , acq . matrix : 10241024 , bandwidth per pixel : 180 hz ) are performed with the complete pet detector and with single pet modules . experiments with subsystems replacing the complete pet detector are conducted to study the rf interference in detail and to identify the noise 's origin . improvements of the shielding of the power supply unit ( psu ) are also realized and tested with these noise scans . the pet performance and stability during simultaneous operation was studied with one pet module ( equipped with one stack ) by single event detection . pet data and system parameters like voltages , currents and temperatures are acquired using a na point source ( activity : 2.8 mbq ) over a longer time period ( several minutes up to 45 min ) . during this data acquisition ( as shown in fig . 3 ) , highly demanding rf and gradient stress tests ( with various switching directions ) are performed in smaller time windows ( 30 s2 min ) . for the gradient tests , epi sequences ( epi factor : 49 ) with maximum gradient strength ( 30 mt ) , maximal slew rates and minimal tr with defined switching directions ( the individual parameters are listed in table 1 ) are used and for the rf test a highly demanding tse sequence ( tse factor : 16 , te / tr : 21/333 ms , peak b1 amplitude : 20t ) is executed . the snr study shows a strong influence of the pet system on the mr performance : while the reference scan without pet detector delivers an mr image with a snr ( calculated according to nema standard ) of 159 , the measurement with the pet detector ( 10 sdms , power on , data acquisition ) reveals a snr degradation by a factor of 2 ( snr : 81 ) . fig . 4 shows the corresponding noise spectrum of the rf system without pet detector ( black ) and with detector ( green : powered off and unplugged from the ac outlet , blue : data acq . , the noise floor is strongly increased , when the pet detector is switched on ( in the frequency range of the se images by a factor of approx . 1.9 , thus explaining the observed snr degradation ) , and features broad peaks which are shifting as a function of time , especially in the heat up phase of the scanner . these peaks are approximately 250 khz apart , which is also the switching frequency of the last converter in the employed switched mode psu . experiments with purely resistive loads replacing the pet modules have identified clearly common mode noise originating from the psu as main noise source . as a consequence 5 ( left : improved version , right : unmodified psu ) : all shielding pcbs are replaced by thick copper plates , cables near the fan grilles and the cooling fans themselves are removed to avoid field leaking through the fan grilles , and we installed additional fan grilles on the outside as a second chamber , to reduce the leaking electromagnetic ( em ) fields . a drawback of this solution is the creation of a second dc star point : the shields of the power cables ( one sdm is provided by three power cables ) are connected together on the psu side and module side , thus creating potentially problematic loops in which switching gradients and rf pulses from the mri could couple in and could cause trouble with the supply of the sdms . based on this restrictions , the presented solution might be seen as intermediate step towards a final solution . 6 shows the resulting noise scans of one sdm ( equipped with one stack ) with the different psu versions . no obvious difference between the reference noise floor ( black , without pet , average noise floor ( floating point values ( fpv ) ) : 239.7 ( stdv : 7.9 ) ) and the one with the modified psu ( red , average noise floor ( fpv ) : 239.9 ( stdv : 7.8 ) ) can be observed . in comparison to the unmodified psu , the modifications show clearly an improvement of the noise situation and so far , the drawbacks of the modifications have not harmed the operation of one single sdm . on top of that , 7 , green , average noise floor ( fpv ) : 239.5 ( stdv : 5.0 ) ) show only a slight increase in the noise floor compared to the reference scan ( black , average noise floor ( fpv ) : 235.3 ( stdv : 4.6 ) ) . the noise scan does not show any digital noise which manifests itself as sharp spikes in the scan : the emitted digital noise seems to fall into a frequency range in which the mri acquisition chain is insensitive and thus does not appear in the mri noise scans . it is to note at this point that these measurements are performed with one single sdm equipped with one stack . a fully equipped pet ring consists of 10 sdms containing 60 detector stacks and has the potential to disturb the acquisition of the mri much more . a first evaluation of acquired pet data inside and outside the mri shows no degradation of pet data quality and pet performance : for instance , flood histograms and energy resolution remain unaffected . the singles data rates of the pet modules are stable even during harsh mri sequences . however , the stress tests as described in 2.2 reveal sensitivity for gradient switching . fig . 8 shows the singles rate ( for one sensor tile , quality requirements : energy cut ( ( 51130 ) kev ) , all neighboring pixels around the main pixel present ( quality cut on the light distribution ) ) for different bias voltages vb ( upper row : vb=25.8 v , over voltage ( ov ) = 2.9 v ; bottom row : vb=25.4 v , ov = 2.5 v ) as a function of time . the time windows with the corresponding gradient switching directions are indicated by color ( red and green ) shaded areas . while the measurement with the ov of 2.9 v shows singles rate drops in time regions with active z gradients by about 5.6% , the measurement with the lower bias voltage shows a stable data acquisition without any rate drops . interestingly , the measurement with the higher ov ( 2.9 v ) shows a lower count rate than the one with the lower ov indicating that the higher ov is not good operating point . this hypothesis is supported by a worse energy resolution for the higher ov ( energy resolution without gradient switching : 15.3% for ov=2.9 v and 12.9% for ov=2.5v ) . fig . 9 shows the corresponding singles energy spectra ( same quality cuts as before except energy cut ) in time windows without gradients ( black , shaded ) and with active z gradient ( red ) . for the measurement with 2.9 v ov ( top row ; left : overall energy spectrum , right : photo peak range ) , we observe a broadening effect of the energy resolution by 2% ( without gradients : 15.3% ; with gradients : 17.3% ) which causes , after applying the energy cut , the described singles rate drop of 5.6% . furthermore , the singles count ( integral over the entire energy spectrum ) with active gradients naz is in comparison with the number of singles without gradient switching nnz slightly reduced ( n = nnznaz=65591461 ( ratio : naz / nnz=0.994 ) ) . in contrast to this finding , the measurements with low vb ( bottom row ; left : overall energy spectrum , right : photo peak range ) show no broadening effect ( energy resolution : 12.9% ) and thus no drops in the singles rate . the overall count of singles is not significantly affected by the presence of switching gradients ( n = nnznaz=21553089 ( ratio : naz / nnz=0.9995 ) ) . measurements of vb ( top ) and bias current ib ( bottom ) during data acquisition without and with active z gradients ( black : ov = 2.5 v , red : ov = 2.9 v ) are shown in fig . 10 : the switching z gradients generate obviously a ripple on vb and ib which is especially dominant for an ov of 2.9 v. it seems that this vb setting is chosen too high since ib fluctuates strongly and uncontrollably . one explanation for this strong response on the gradient induced vb fluctuations might be that the active quenching mechanism does not work properly anymore . this would also be an explanation for the observed degradation of the energy resolution ( which is only present at the higher ov setting ) since the reload mechanism of the micro cells is disturbed , leading to an additional spread of the photon count values . it is to note that the origin of the vb fluctuations and the exact influence of these fluctuations on the detector performance is unclear at this stage . the above mentioned explanation is currently a working theory and has to be proven by further investigations . the snr study shows a strong influence of the pet system on the mr performance : while the reference scan without pet detector delivers an mr image with a snr ( calculated according to nema standard ) of 159 , the measurement with the pet detector ( 10 sdms , power on , data acquisition ) reveals a snr degradation by a factor of 2 ( snr : 81 ) . fig . 4 shows the corresponding noise spectrum of the rf system without pet detector ( black ) and with detector ( green : powered off and unplugged from the ac outlet , blue : data acq . , the noise floor is strongly increased , when the pet detector is switched on ( in the frequency range of the se images by a factor of approx . 1.9 , thus explaining the observed snr degradation ) , and features broad peaks which are shifting as a function of time , especially in the heat up phase of the scanner . these peaks are approximately 250 khz apart , which is also the switching frequency of the last converter in the employed switched mode psu . experiments with purely resistive loads replacing the pet modules have identified clearly common mode noise originating from the psu as main noise source . as a consequence 5 ( left : improved version , right : unmodified psu ) : all shielding pcbs are replaced by thick copper plates , cables near the fan grilles and the cooling fans themselves are removed to avoid field leaking through the fan grilles , and we installed additional fan grilles on the outside as a second chamber , to reduce the leaking electromagnetic ( em ) fields . a drawback of this solution is the creation of a second dc star point : the shields of the power cables ( one sdm is provided by three power cables ) are connected together on the psu side and module side , thus creating potentially problematic loops in which switching gradients and rf pulses from the mri could couple in and could cause trouble with the supply of the sdms . based on this restrictions , the presented solution might be seen as intermediate step towards a final solution . 6 shows the resulting noise scans of one sdm ( equipped with one stack ) with the different psu versions . no obvious difference between the reference noise floor ( black , without pet , average noise floor ( floating point values ( fpv ) ) : 239.7 ( stdv : 7.9 ) ) and the one with the modified psu ( red , average noise floor ( fpv ) : 239.9 ( stdv : 7.8 ) ) can be observed . in comparison to the unmodified psu , the modifications show clearly an improvement of the noise situation and so far , the drawbacks of the modifications have not harmed the operation of one single sdm . on top of that , 7 , green , average noise floor ( fpv ) : 239.5 ( stdv : 5.0 ) ) show only a slight increase in the noise floor compared to the reference scan ( black , average noise floor ( fpv ) : 235.3 ( stdv : 4.6 ) ) . the noise scan does not show any digital noise which manifests itself as sharp spikes in the scan : the emitted digital noise seems to fall into a frequency range in which the mri acquisition chain is insensitive and thus does not appear in the mri noise scans . it is to note at this point that these measurements are performed with one single sdm equipped with one stack . a fully equipped pet ring consists of 10 sdms containing 60 detector stacks and has the potential to disturb the acquisition of the mri much more . a first evaluation of acquired pet data inside and outside the mri shows no degradation of pet data quality and pet performance : for instance , flood histograms and energy resolution remain unaffected . the singles data rates of the pet modules are stable even during harsh mri sequences . however , the stress tests as described in 2.2 reveal sensitivity for gradient switching . fig . 8 shows the singles rate ( for one sensor tile , quality requirements : energy cut ( ( 51130 ) kev ) , all neighboring pixels around the main pixel present ( quality cut on the light distribution ) ) for different bias voltages vb ( upper row : vb=25.8 v , over voltage ( ov ) = 2.9 v ; bottom row : vb=25.4 v , ov = 2.5 v ) as a function of time . the time windows with the corresponding gradient switching directions are indicated by color ( red and green ) shaded areas . while the measurement with the ov of 2.9 v shows singles rate drops in time regions with active z gradients by about 5.6% , the measurement with the lower bias voltage shows a stable data acquisition without any rate drops . interestingly , the measurement with the higher ov ( 2.9 v ) shows a lower count rate than the one with the lower ov indicating that the higher ov is not good operating point . this hypothesis is supported by a worse energy resolution for the higher ov ( energy resolution without gradient switching : 15.3% for ov=2.9 v and 12.9% for ov=2.5v ) . 9 shows the corresponding singles energy spectra ( same quality cuts as before except energy cut ) in time windows without gradients ( black , shaded ) and with active z gradient ( red ) . for the measurement with 2.9 v ov ( top row ; left : overall energy spectrum , right : photo peak range ) , we observe a broadening effect of the energy resolution by 2% ( without gradients : 15.3% ; with gradients : 17.3% ) which causes , after applying the energy cut , the described singles rate drop of 5.6% . furthermore , the singles count ( integral over the entire energy spectrum ) with active gradients naz is in comparison with the number of singles without gradient switching nnz slightly reduced ( n = nnznaz=65591461 ( ratio : naz / nnz=0.994 ) ) . in contrast to this finding , the measurements with low vb ( bottom row ; left : overall energy spectrum , right : photo peak range ) show no broadening effect ( energy resolution : 12.9% ) and thus no drops in the singles rate . the overall count of singles is not significantly affected by the presence of switching gradients ( n = nnznaz=21553089 ( ratio : naz / nnz=0.9995 ) ) . measurements of vb ( top ) and bias current ib ( bottom ) during data acquisition without and with active z gradients ( black : ov = 2.5 v , red : ov = 2.9 v ) are shown in fig . 10 : the switching z gradients generate obviously a ripple on vb and ib which is especially dominant for an ov of 2.9 v. it seems that this vb setting is chosen too high since ib fluctuates strongly and uncontrollably . one explanation for this strong response on the gradient induced vb fluctuations might be that the active quenching mechanism does not work properly anymore . this would also be an explanation for the observed degradation of the energy resolution ( which is only present at the higher ov setting ) since the reload mechanism of the micro cells is disturbed , leading to an additional spread of the photon count values . it is to note that the origin of the vb fluctuations and the exact influence of these fluctuations on the detector performance is unclear at this stage . the above mentioned explanation is currently a working theory and has to be proven by further investigations . we have successfully operated a fully digital pet detector inside a 3 t mri . on the mri side , we observed a snr degradation by a factor of 2 which is mainly caused by common mode noise from the switched mode power supply . improvements on the psu 's shielding lead to a notable reduction of the noise . in the latest modification no difference between the reference noise floor and the one during pet acquisition is visible . although we observed no technical problems with the modifications during the operation with one sdm , a final evaluation with a complete pet scanner has to be done . until this test is conducted , the presented solution can only be seen as intermediate step . on the pet side , we notice that our pet system works stable even under unrealistic demanding stress tests . up to now we observe a ripple on the bias voltage and a broadening effect of the energy resolution for an aggressive chosen bias voltage setting . after application of a narrow energy cut ( ( 51130 ) kev ) around the photo peak , this broadening effect leads to a singles rate drop by approx . the coupling mechanism of the gradients causing the vb fluctuations as well the influence of these fluctuations on the energy resolution is unclear at this stage .

in this work , we present an initial mr - compatibility study performed with the world 's first preclinical pet / mr insert based on fully digital silicon photo multipliers ( dsipm ) . the pet insert allows simultaneous data acquisition of both imaging modalities and thus enables the true potential of hybrid pet / mri . since the pet insert has the potential to interfere with all of the mri 's subsystems ( strong magnet , gradients system , radio frequency ( rf ) system ) and vice versa , interference studies on both imaging systems are of great importance to ensure an undisturbed operation . as a starting point to understand the interference , we performed signal - to - noise ratio ( snr ) measurements as well as dedicated noise scans on the mri side to characterize the influence of the pet electronics on the mr receive chain . furthermore , improvements of sub - components shielding of the pet system are implemented and tested inside the mri . to study the influence of the mri on the pet performance , we conducted highly demanding stress tests with gradient and rf dominated mr sequences . these stress tests unveil a sensitivity of the pet 's electronics to gradient switching .

You are an expert at summarizing long articles. Proceed to summarize the following text: a 40-year - old patient was admitted to the hospital on january 29 , 2004 , with fever , generalized weakness , diarrhea , and vomiting . initial blood tests showed hemoglobin level of 8.5 g / dl , leukocyte count of 4.9 x 10/l , and platelet count of 110 x 10/l . erythrocyte sedimentation rate was elevated at 88 mm / h . her serum glucose was 8.5 mmol / l , and urea and electrolytes were normal . she was started on intravenous ciprofloxacin , but her fever persisted , and she became increasingly confused . her old hospital records became available shortly after her death , and we noted that she had been diagnosed with systemic lupus erythematosus ( sle ) in 1994 . when she last attended the outpatient department 3 months before her hospital admission , she was prescribed 50 mg azathioprine and 5 mg prednisolone daily . she was a housewife and lived in cit la cure , a poor suburb of the capital city port - louis . , her home becomes very muddy after heavy rainfall , and her feet were often in mud while performing her household duties . after 5 days of incubation , it produced colonies that appeared dry and rugose on the plates after 48 h and was identified as b. pseudomallei by using api 20ne ( biomrieux , marcy letoile , france ) with the profile 1156577 . antimicrobial susceptibility testing by disc diffusion showed the organism to be resistant to colistin , ampicillin , cephalexin , gentamicin , and ciprofloxacin and susceptible to co - amoxiclav , tetracycline , cefotaxime , ceftriaxone , ceftazidime , piperacillin , and meropenem . a large zone of inhibition was seen around the co - trimoxazole disc , within which a thin film of growth was observed . we are not aware of any study looking for the organism in soil in this country . groodoyal , pers . comm . ) . whether human cases of melioidosis have been missed in the past is not known , and cases may be missed currently . recognizing the disease depends on awareness on the part of clinicians and on the ability of microbiology laboratories to identify the causative organism ( 1,8 ) . before 1998 , oxidase - positive , gram - negative bacilli other than p. aeruginosa were not identified to species level in laboratories in mauritius . since then , at our laboratory , which receives specimens for bacteriologic investigations from all government healthcare institutions , such organisms are routinely identified by api 20ne when isolated in pure culture from blood , but only occasionally when isolated from nonsterile sites such as sputum and pus swabs . some clinicians routinely request blood cultures from patients with high fever before starting antimicrobial drugs , although in practice , the specimen is often collected by nursing staff after the first dose has already been administered . other clinicians only request blood cultures if fever persists after a few days of empiric antimicrobial therapy . in the case reported here , prior administration of cefotaxime may have delayed b. pseudomallei culture from blood until 5 days of incubation , when the median time to obtain a positive blood culture result is typically 48 hours ( 1 ) . an association between rainfall and melioidosis has long been recognized ; most cases in thailand ( 9 ) and northern australia ( 10 ) occur during the wet season . the increased number of cases noted during the rainy season may be caused by the movement of b. pseudomallei from deeper layers toward the surface when dry topsoil is moistened by rainfall ( 2 ) . in mauritius 196 mm rainfall was recorded in port - louis , which is 37% higher than the 19712000 mean rainfall for the region during this month . january 2004 was the sixth wettest january of the past 30 years in port - louis . recent reviews have suggested a predominant role for percutaneous b. pseudomallei infection in the pathogenesis of melioidosis ( 11 ) . studies carried out in regions where melioidosis is endemic have shown that exposure to wet soil and water are associated with increased risk for disease ( 9 ) . the feet of our patient were regularly exposed to wet soil during rainy periods . in melioidosis - endemic areas , although a large percentage of the population has been exposed to b. pseudomallei , as determined by seroprevalence studies , only a few develop melioidosis ( 12 ) . most cases occur in patients with underlying illnesses , such as diabetes mellitus , renal disease , and alcoholism ( 9,10 ) or in those who are immunosuppressed ( 1 ) . this first case of melioidosis in mauritius occurred in an immunosuppressed patient who had a history of prolonged and regular exposure to mud during a year when rainfall was higher than average . this combination of 3 risk factors does not occur regularly , and it is possible that few additional cases will be recorded in mauritius in the future . however , clinicians and laboratory staff must remain aware of this disease , particularly because in a noncommunicable disease survey carried out in 1998 , almost 20% of the mauritian population > 20 years of age were found to have type 2 diabetes mellitus ( 14 ) , the most common predisposing condition for melioidosis ( 1 ) . determining the distribution of b. pseudomallei in soil in mauritius by conducting environmental investigations will also be useful .

we report the first case of human melioidosis from mauritius , where burkholderia pseudomallei has never been isolated . the patient was immunocompromised , had never traveled abroad , and had a history of regular exposure to mud . she became ill at a time when rainfall was higher than the monthly average .

You are an expert at summarizing long articles. Proceed to summarize the following text: more recently , its use was realized as an application following surgery to prevent scarring in circular structures in ophthalmology and otorhinolaryngology . the first article about using mmc to reduce living cells in vitro dates from 1968 . the g-1 phase is the first stage of the cell cycle where the amount of cytoplasm and proteins increases in preparation of the fourth stage : mitosis . by this disrupting action , it inhibits the formation of rna and protein synthesis and in this way inhibits the proliferation of fibroblasts . an additional function is the induction of apoptosis in the fibroblasts [ 2 , 3 ] . because of the induction of apoptosis mmc can be toxic when given as systemic treatment . as topical therapy , however , it can be of good help , as it seems not to induce systemic toxicity . in recent literature and clinical practice , there is still no consensus whether it is safe or not to use mmc , concerning the ( long term ) side effects . effect relation , but still there are conflicts of results . in ophthalmology , the use of mmc has proved to positively contribute treatment regimes . in ocular and lacrimal duct surgery , mmc is known as a chemostatic agent [ 6 , 7 ] . however , it is not free of local side effects . khong and muecke stated that 34% of the population developed an allergic reaction , and 14% of their patients developed epiphora as a result of punctal stenosis . one patient developed ptosis as a result of eye - lid edema . despite these side effects , khong and muecke state that mmc is safe to use and that no serious complications were observed . currently , mmc is more and more used as an anti - fibrotic agent [ 8 , 9 ] . in a randomized clinical trial ( rct ) , tabatabaie et al . used mmc after treatment of nasolacrimal duct obstruction . they found a significantly better result using mmc in comparison with a saline solution intraoperatively . only one of 88 patients developed a granuloma near the punctum of the lacrimal duct . yildirim et al . in their rct , found no beneficial effect of mmc after external dacryocystorhinostomy ( ext - dcr ) . one of 20 eyes in the mmc group developed epiphora , which was not significantly less compared with the control group . in the upper aerodigestive tract , mmc is mostly used for the prevention of scarring . because mmc is more and more used as an anti - fibrogenetic agent in adults as well in children , it is important to present a clear view on any reported side effects and to report about its safety . the purpose of this study is to find out whether it is safe enough to use mmc topically in the upper aerodigestive tract . a search for articles about the use of mmc in the aerodigestive tract was performed in pubmed . the following mesh headings were used : mitomycin along with choanal atresia , glottis , larynx , nose , ( o)esofagus , pharynx , stenosis or trachea . for inclusion of studies , the following criteria were used : the use of mmc to prevent scar formation and/or stenosis in animals and humans after intervention in the aerodigestive tract.study design had to be randomized or prospective clinical trial , case series , case reports or review . the use of mmc to prevent scar formation and/or stenosis in animals and humans after intervention in the aerodigestive tract . study design had to be randomized or prospective clinical trial , case series , case reports or review . these 46 consisted of 11 case reports [ 1020 ] , 9 case series [ 2129 ] , 7 prospective clinical trials [ 3 , 3035 ] , 5 rcts [ 3640 ] , 2 reviews [ 41 , 42 ] , 12 animal studies [ 4 , 5 , 4352 ] . the first article about the topical use of mmc in the upper aerodigestive tract dates from 1998 . the mesh heading ( o)esofagus provided articles that were not contributing in the context of our study , as almost all dealt with the use of mmc as a chemotherapeutic agent for cancer . of the 46 selected articles , 32 are used for human population with a total number of 538 patients . of these patients , 257 are males and 165 are females , while the gender of the remaining 116 patients is not mentioned . of 490 patients , the age has been recorded : 137 are children ( < 16 years ) and 353 are adults . a summary of the articles with the patient characteristics is shown in table 1.table 1mmc in the aerodigestive tract in human studies : study design , patient characteristics , application details , follow - up and side effectsreferencesdesignnmean patient age at start mmc ( years)application dose ( mg / ml)mmc application time ( min)number of applicationssaline irrigation ( y / n)follow - up period ( months)side effects / complicationsafzal case report11.50.122n18noneagrawal case report1570.4not reported1n36squamous cell carcinomaanand rct29490.551n15synechia / stenosischan rct45490.551n6nonechung rct5544.50.441y4.1nonedolmetsch case series605.60.551n12.3nonegupta prospective clinical trial30300.441ynot reportednonehartnick rct113.60.221nnot reportednonehueman case series4444.80.410414nnot reportedpartial airway obstructionisa case series440.50.441y31nonekonstantinidis rct3029.50.552y7.2nonekim prospective clinical trial20310.451n13.3nonekoshkareva case series15540.4not reported1nnot reportednonekubba case series22<1221n7nonemathiasen case report13.50.441n12nonemonnier case report41221n24nonemonoo - kuofi case series2851.70.6513n22nonenouraei case series3147131n14.6reduced free intervalpenafiel case report1not reported0.521n24noneperepelitsyn case series16not reported0.4413y4nonephillips case report118242n12nonerahbar prospective clinical trial155.70.441y18nonerahbar prospective clinical trial14340.4413y18noneroh case report1450.451n24noneroh prospective clinical trial1457.70.451nnot reportedglottic webroh prospective clinical trial17410.451y18nonerosseneu prospective clinical trial1640.13.5112n60nonesalvado case report1680.441n15noneunal case report10.8151n4nonevaldez case series650not reportednot reported12n75.5noneward case report37.50.121n24nonezur case report1151not reported2n33nonetotal538mmc mitomycin c , rct randomized clinical trial , a adult , c child , a / c the mmc was used on adults and children but exact data is lacking , y yes , n no , none no reported side effects mmc in the aerodigestive tract in human studies : study design , patient characteristics , application details , follow - up and side effects mmc mitomycin c , rct randomized clinical trial , a adult , c child , a / c the mmc was used on adults and children but exact data is lacking , y yes , n no , none no reported side effects all 32 human studies used mmc topically . different concentrations were used , ranging from 0.1 to 10 mg / ml ( median 0.4 , modus 0.4 ) . the number of applications differs from 1 in most studies up to 12 times in one study ( mean 1.17 , median 1 , modus 1 ) . the mean application time of all patients was 4.06 min ( median 4 min , modus 4 and 5 min ) . twenty - seven out of 28 studies reported the use of cottonoid pledges or non - woven neuropatties soaked in an mmc solution were used . eight of 28 studies reported that the operation site was irrigated with an isotonic saline solution , after the use of mmc . the average follow - up period ( which was reported in 27 of 32 studies ) was 14.5 months , with a median of 18 months . not any of the side effects was reported in the studies where the wound was irrigated with a saline solution afterwards . studies in which no side effects were reported will not be discussed in this paper . fourteen of all 46 studies that were researched are animal studies ( n = 12 ) or reviews ( n = 2 ) . four of the animal studies report side effects , and these studies will also be clarified and discussed . performed an rct in which they applied mmc at one side after bilateral ethmoidectomy and maxillary antrostomy . there was no statistically significant difference between the user and the non - user group . hueman and simpson treated 44 patients suffering from laryngotracheal stenosis with mmc in two different doses . eighty - five procedures with mmc were performed . a supersaturated dose of mmc ( 10 mg / ml ) was used when a low - dose solution of mmc ( 0.4 mg / ml ) was not effective after applying up to four times . four patients developed complications due to severe local reaction : two children , in whom the high concentration of mmc was used , and two adults where the low - dose mmc was applied . all four patients suffered from respiratory distress , as a result of edema and debris . in one of the two children , this eventually led to expiration . the patient was known with glottic stenosis and recurrent respiratory papillomatosis that was treated with laser removal and cidofovir , followed by scar dilatation and the use of mmc . after 2 days , the child developed dyspnoea and eventually experienced a respiratory arrest . he expired 10 days later , due to local consequences in the larynx ( debris and inflammation ) . however , in this case series , there was no significantly higher rate of complications in the high - dose group ( 2 of 14 procedures ) in comparison with the low - dose group ( 2 of 71 procedures ) . hueman and simpson state that this can be a result of the small number of patients . in a non - controlled , non - randomized study , roh and yoon looked for the outcome after the treatment for anterior commissure carcinomas ( microsurgery with immediate mmc application 0.4 mg / ml for 5 min ) . in 5 of 15 patients , an acceptably small web was formed . eventually , no significant local side effects resulted from the mmc and no vocal fold atrophy was found in the patients with limited microsurgery . agrawal and morrison wrote a case report about a 57-year - old non - smoking and non - drinking male with a long history of chronic laryngitis with the removal of a polyp and keratosis ( left vocal fold ) . this was treated with microlaryngoscopy , laser and application of topical mmc 0.4 mg / ml . during follow - up , the patient developed a granuloma and a new anterior web occurred . this was also treated with laser . after 2.5 years , a t1an0m0 squamous cell carcinoma on the right vocal fold developed . nouraei et al . did a study towards the optimal treatment of post - intubation airway stenosis . they compared a group of 11 patients with fresh lesions and stenoses with a group of 20 patients with mature stenoses . the first group was treated with intralesional steroids , laser , reduction in granulation tissue and balloon dilatation . the second group was treated with radial laser incision , balloon dilatation and immediate mmc application ( 1 mg / ml ) during 3 min . the outcome of this case series showed a statistically significant difference in intervention - free interval in favour of the non - mmc group . garret et al . examined the influence of mmc on vocal fold healing after micro - flap excision in a prospective controlled canine model . they treated the excision site with mmc ( 0.4 mg / ml ) for 3 min . after 4 weeks , 3 of the 6 dogs showed a persistent concavity in the vocal fold at the mmc treated excision site . this resulted in a negative effect on the vibratory pattern of the treated vocal folds when compared with the opposite side . they induced inflammation by circumferential resection and end - to - end anastomosis of a tracheal annulus in 18 rabbits . three treatment groups where made : topical saline ( isotonic sodium chloride solution , group a ) , low dose ( 0.2 mg / ml , b ) and high dose ( 0.5 mg / ml , c ) topical mmc . the effect of mmc was dose related . in group c , most rabbits progressed to stenosis with a decrease in airway diameter that was significantly larger than in the other two groups ( p < 0.001 ) . the mean percentage of maximum stenosis in group c was 51% . in groups no significant differences in tracheal stenosis between groups a and b were observed . when compared with the other two groups , the high - dose mmc group had a significant increase in fibroproliferative tissue . the authors conclude that the topical mmc is not effective in avoiding tracheal stenosis and may provoke the opposite effect when the dose is not carefully selected . studied the recovering process after diode laser surgery in the posterior subglottis combined with topical treatment of a 0.4 mg / ml ( group a ) , 10 mg / ml mmc ( b ) or saline solution ( c ) . either solution was randomly applied during 5 min in 60 rabbits . animals were killed at 4 weeks , and gross and histologic findings were compared among different groups and ten age - matched , non - wound , normal controls ( d ) . thirty - two of the 60 ( 53% ) animals died mainly of acute airway obstruction by necrotic debris , sloughs on or cartilage collapse of the unhealed posterior subglottis during early weeks after wounding . this was higher in groups a and b ( 67% ) than in group c ( 25% ) ( p = 0.007 ) . this resulted from the significant delay of wound healing in groups a and b when compared with group c ( p = 0.012 ) . after 4 weeks , the surviving 28 rabbits of groups a , b and c showed a significantly decreased cross - sectional area of the scarred lumen in comparison to rabbits in group d. there was no statistically significant difference between the treated groups with regard to cross - sectional area , re - epithelialization or collagen deposition . due to the significant risk of acute airway obstruction from delayed wound healing in rabbits , the authors suggest that clinicians should pay attention to the side effects of mmc , especially when it is used on exposed cartilage of the airway . in yet another rabbit model , roh et al . made two wounds in 60 rabbits , one in the upper trachea and one in the lower trachea . one group had both wounds as full thickness wounds on the anterior part of the trachea ( a ) , one group had the two wounds as partial thickness wounds on the anterior part ( b ) and the final group had both wounds as partial thickness wounds on the circumferential mucosa ( c ) . in each rabbit , one of the wounds was randomly treated with mmc 1 mg / ml during 5 min , the other with a saline solution . the incidence of early death was higher in groups a and c than in group b. this was mainly a result of airway obstruction at the mmc treated sites . they found comparable cross - sectional area of the lumen between in mmc and saline - treated wounds , but re - epithelization was significantly delayed in all mmc wounds . in conclusion , the authors state that mmc - treated rabbits with tracheal wounds develop a significant risk of acute airway obstruction . performed an rct in which they applied mmc at one side after bilateral ethmoidectomy and maxillary antrostomy . there was no statistically significant difference between the user and the non - user group . hueman and simpson treated 44 patients suffering from laryngotracheal stenosis with mmc in two different doses . eighty - five procedures with mmc were performed . a supersaturated dose of mmc ( 10 mg / ml ) was used when a low - dose solution of mmc ( 0.4 mg / ml ) was not effective after applying up to four times . four patients developed complications due to severe local reaction : two children , in whom the high concentration of mmc was used , and two adults where the low - dose mmc was applied . all four patients suffered from respiratory distress , as a result of edema and debris . in one of the two children , this eventually led to expiration . the patient was known with glottic stenosis and recurrent respiratory papillomatosis that was treated with laser removal and cidofovir , followed by scar dilatation and the use of mmc . after 2 days , the child developed dyspnoea and eventually experienced a respiratory arrest . he expired 10 days later , due to local consequences in the larynx ( debris and inflammation ) . however , in this case series , there was no significantly higher rate of complications in the high - dose group ( 2 of 14 procedures ) in comparison with the low - dose group ( 2 of 71 procedures ) . hueman and simpson state that this can be a result of the small number of patients . in a non - controlled , non - randomized study , roh and yoon looked for the outcome after the treatment for anterior commissure carcinomas ( microsurgery with immediate mmc application 0.4 mg / ml for 5 min ) . in 5 of 15 patients , an acceptably small web was formed . eventually , no significant local side effects resulted from the mmc and no vocal fold atrophy was found in the patients with limited microsurgery . agrawal and morrison wrote a case report about a 57-year - old non - smoking and non - drinking male with a long history of chronic laryngitis with the removal of a polyp and keratosis ( left vocal fold ) . this was treated with microlaryngoscopy , laser and application of topical mmc 0.4 mg / ml . during follow - up , the patient developed a granuloma and a new anterior web occurred . after 2.5 years , a t1an0m0 squamous cell carcinoma on the right vocal fold developed . they compared a group of 11 patients with fresh lesions and stenoses with a group of 20 patients with mature stenoses . the first group was treated with intralesional steroids , laser , reduction in granulation tissue and balloon dilatation . the second group was treated with radial laser incision , balloon dilatation and immediate mmc application ( 1 mg / ml ) during 3 min . the outcome of this case series showed a statistically significant difference in intervention - free interval in favour of the non - mmc group . garret et al . examined the influence of mmc on vocal fold healing after micro - flap excision in a prospective controlled canine model . they treated the excision site with mmc ( 0.4 mg / ml ) for 3 min . after 4 weeks , 3 of the 6 dogs showed a persistent concavity in the vocal fold at the mmc treated excision site . this resulted in a negative effect on the vibratory pattern of the treated vocal folds when compared with the opposite side . they induced inflammation by circumferential resection and end - to - end anastomosis of a tracheal annulus in 18 rabbits . three treatment groups where made : topical saline ( isotonic sodium chloride solution , group a ) , low dose ( 0.2 mg / ml , b ) and high dose ( 0.5 mg / ml , c ) topical mmc . the effect of mmc was dose related . in group c , most rabbits progressed to stenosis with a decrease in airway diameter that was significantly larger than in the other two groups ( p < 0.001 ) . no significant differences in tracheal stenosis between groups a and b were observed . when compared with the other two groups , the high - dose mmc group had a significant increase in fibroproliferative tissue . the authors conclude that the topical mmc is not effective in avoiding tracheal stenosis and may provoke the opposite effect when the dose is not carefully selected . studied the recovering process after diode laser surgery in the posterior subglottis combined with topical treatment of a 0.4 mg / ml ( group a ) , 10 mg / ml mmc ( b ) or saline solution ( c ) . either solution was randomly applied during 5 min in 60 rabbits . animals were killed at 4 weeks , and gross and histologic findings were compared among different groups and ten age - matched , non - wound , normal controls ( d ) . thirty - two of the 60 ( 53% ) animals died mainly of acute airway obstruction by necrotic debris , sloughs on or cartilage collapse of the unhealed posterior subglottis during early weeks after wounding . this was higher in groups a and b ( 67% ) than in group c ( 25% ) ( p = 0.007 ) . this resulted from the significant delay of wound healing in groups a and b when compared with group c ( p = 0.012 ) . after 4 weeks , the surviving 28 rabbits of groups a , b and c showed a significantly decreased cross - sectional area of the scarred lumen in comparison to rabbits in group d. there was no statistically significant difference between the treated groups with regard to cross - sectional area , re - epithelialization or collagen deposition . due to the significant risk of acute airway obstruction from delayed wound healing in rabbits , the authors suggest that clinicians should pay attention to the side effects of mmc , especially when it is used on exposed cartilage of the airway . in yet another rabbit model , roh et al . made two wounds in 60 rabbits , one in the upper trachea and one in the lower trachea . one group had both wounds as full thickness wounds on the anterior part of the trachea ( a ) , one group had the two wounds as partial thickness wounds on the anterior part ( b ) and the final group had both wounds as partial thickness wounds on the circumferential mucosa ( c ) . in each rabbit , one of the wounds was randomly treated with mmc 1 mg / ml during 5 min , the other with a saline solution . the incidence of early death was higher in groups a and c than in group b. this was mainly a result of airway obstruction at the mmc treated sites . they found comparable cross - sectional area of the lumen between in mmc and saline - treated wounds , but re - epithelization was significantly delayed in all mmc wounds . in conclusion , the authors state that mmc - treated rabbits with tracheal wounds develop a significant risk of acute airway obstruction . the indications for topical use of mmc are surgical wounds on areas in the human body where excessive formation of fibrosis can lead to functional impairment . the human aerodigestive tract is a good example : obstruction can be life threatening . by applying a soaked cotton pledget with mmc solution on the preferred operation site , one can use it with optimal control in location and time . there is ample discussion about immediate irrigation after treatment : 33.7% of the researched patients underwent irrigation of the operation site with a saline solution , which seems to have a positive effect on functional outcome as it prevents excessive fibrin production . as it ranged from 0.1 to 10 mg / ml , one could see that there was no gold standard . have used 0.2 mg / ml mmc for 2 min , applied once to prevent post - intubation stenosis in children in an rct . after 1 year , their data safety and monitoring committee advised to terminate the rct as interim analysis showed that there was no difference in outcome . the lack of efficacy of mmc has also been expressed by other authors [ 24 , 25 , 31 , 37 ] , who used concentrations which varied from 0.4 to 2.0 mg / ml . in some studies mmc was applied more than once ( table 1 ) . there seems to be no relation between the number of mmc applications and side effects except in the study of hueman and simpson which will be discussed later . some studies report adhesions and discharge at the mmc treated side , but these appeared significantly less frequently than on a similar wound treated with saline solution . it is a principal point of discussion whether these effects can be seen as a result of the surgery proper and are in that notion not mentioned as being a side effect of topical mmc application . in our study , the stenosis and synechia formation of the maxillary and ethmoidal sinus reported by anand et al . hueman and simpson reported the death of a pediatric patient suffering from glottic stenosis and recurrent respiratory papillomatosis . as mentioned before , this death occurred in a study for the treatment of laryngeal stenosis ( n = 44 ) with the use of two different doses of mmc : 0.4 and 10 mg / ml . both groups showed local toxic effects of the mmc . the authors found that the complication rate was not significantly higher in the high - dose group . mmc was used in a 10 mg / ml concentration and the concentration was increased after four ineffective treatments ( with 0.4 mg / ml ) without complications . roh and yoon evaluated the effectiveness of topical mmc in preventing anterior glottic stenosis after transoral microresection of glottic lesions involving the anterior commissure . postoperatively , five patients ( 31% ) developed acceptably small webs in the anterior glottis . significant local side effects or atrophy of the vocal folds owing to mmc were not found . it is not sure whether the mmc induced the web , or prevented the formation of a larger web : they conclude that topical mmc may be useful in preventing anterior glottic stenosis after surgery in the anterior commissure . compared the results of treating acute post - intubation stenotic airway lesions with the results of treating mature lesions and to assess whether early intervention improves the outcome . patients with airway lesions presenting within weeks of intubation were treated with intralesional steroids , laser reduction , and balloon dilatation . patients with mature airway lesions were initially treated with laser , balloon dilatation , and topical mmc . their conclusion , that early treatment of acute fibro inflammatory airway lesions has the potential to favorably modify the natural history of post - intubation tracheal injury , is not related to beneficial or adverse effects of mmc . agrawal and morrison reported a patient with potentially mmc related laryngeal carcinoma in a non - smoking adult . this patient , however , had a long medical history of chronic laryngitis , with previous removal of a laryngeal polyp and keratosis of the vocal fold excised . the authors repeatedly treated this webbing of his anterior commissure with laser , with or without application of mmc . as between 16 and 23% patients with keratotic vocal folds with atypia will subsequently develop a carcinoma , the supposed mmc related carcinoma in this particular case can not be attributed to the use of mmc . as seen in table 1 , the longest mean follow - up period is 75.5 months . here , six patients treated with mmc were followed . a study to observe the long - term effects of the use of mmc is needed , an opinion that has been expressed by other authors as well [ 29 , 42 ] . garret et al . found a decrease in healing response with a negative consequence on the vocal fold vibratory pattern in dogs after vocal fold surgery and treatment with mmc . this finding is in contrast with the results of roh and yoon who found no influence on the vocal cord quality after treatment with mmc in humans . however , the number of animals in garrett s study ( 6 dogs ) might be too small to draw conclusions . all three studies on rabbits that were analyzed report that rabbits in the groups treated with mmc died earlier in comparison with control groups [ 48 , 50 , 51 ] . this is in contrast with the fact that all three studies report no significant airway reduction in the mmc groups compared with the saline - treated groups . two studies reported increase in inflammation , [ 50 , 51 ] and one does not . this last study describes 18 rabbits in three groups , which , again , might be too small to draw conclusions . however , no information on final wound healing is reported . only excessive fibrin production leading to acute airway obstruction ( which , of course , can be endoscopically removed ) and delayed wound healing on exposed cartilage are mentioned . it is remarkable that the use of mmc causes acute airway obstruction where the purpose of its use is to reduce the forming of fibrosis . the severity of cicatricial stenosis ( which can be seen as a late onset reaction ) is not influenced by the use of mmc in their animal studies . translation of the results on animals to the human body is disputable , as the structure of the human vocal fold is different compared with animals . as can be concluded from the results , no systemic side effects appeared during the topical use of mmc at different sites in the aerodigestive tract . the effects that did occur can be considered as a result of debris that formed after the procedure . concerning the effectiveness of mmc , no relation could be made with dose , number of applications or application time . only 3.53% of the investigated human population developed a side effect from the topical use of mmc . no side effects arose in studies where the application site was irrigated with saline afterwards application . in our opinion , these findings are no contraindication for the topical use of mmc in the aerodigestive tract . there have been reports that high - dose mmc application on denuded cartilage or traumatized mucosa can lead to temporarily airway obstruction because of fibrin excess . only one case was described where laryngeal carcinoma theoretically might be attributed to the use of mmc . this potential development of laryngeal carcinoma after the use of mmc in the larynx implies that long follow - up is imperative . these findings should lead to precautions as in strict monitoring in the short - term and to a long - term follow - up . in summary , topical application of mmc on a wound with consecutive irrigation with saline can be performed safely to prevent scar formation in circular structures of the upper aerodigestive tract .

not much is known about the side effects of mitomycin c ( mmc ) , an anti - fibrogenetic agent , in the upper aerodigestive tract . however , its use in ophthalmology is widely known and without quantitatively important side effects . a literature review was performed for side effects of mmc in the upper aerodigestive tract . forty - six articles , describing the use of mmc to prevent scarring , were retracted from pubmed . thirty - two are human studies . mmc is used in different concentrations ( 0.110 mg / ml ) with different application times ( 25 min ) and frequencies ( up to 4 times ) . five hundred and thirty - eight patients were included in those publications , of whom 19 developed side effects ( 3.53% ) . no side effects developed in studies , where post - application irrigation with saline was reported . the longest mean follow - up period is 75.5 months . direct relations between the reported side effects and mmc seem absent in most studies . serious complications seem to occur when mmc is used in high concentrations . unfortunately , sometimes crucial information is lacking . one patient was described who supposedly developed laryngeal carcinoma after repeated treatment of hyperkeratosis and anterior commissure webbing . animal studies show that excessive fibrin production can lead to acute airway obstruction . in conclusion , topical application of mmc on a wound with consecutive irrigation with saline can be performed safely to prevent scar formation in circular structures of the upper aerodigestive tract . long - term yearly control of the application site seems advisable .

You are an expert at summarizing long articles. Proceed to summarize the following text: kerman is the capital city of kerman province located in south east of iran about 1000 km far from the capital city , tehran ( fig . people are mostly busy with white - collar works at governmental sections , agriculture and marketing . the lifestyle patterns are typically aggregated in families . in 2005 , as part of the national survey on non - communicable disease risk - factors ( ncdrfs ) in kerman province , 1614 inhabitants aged 15 to 64 years were recruited . the familial aggregation of ncdrfs such as physical inactivity , obesity , high blood pressure , hyper cholestrolemia and high blood glucose with a risk ratio of 1.5 to 3.5 have been reported in a study published in 2007(2 ) . according to the national ncdrfs 20056 report(3 ) , the prevalence of different risk factors among people living in kerman were as follow : overweight 42% , obesity 12% , systolic and diastolic blood pressure more than 140/90 mmhg , 12.1% , every day cigarette smoking reported at the level of 18.6% in men . when we look at the risk factors as one combined factor , about 41.9% ( ci 95% , 33.750.5% ) of the inhabitants in kerman have a raised risk factor which put it at the 12 rank among the provinces ( out of the 31 ) in iran(3 ) . this high risk profile of the kerman community is translated into 37 incidence case ( per day ) of myocardial infarction in kerman . when we look at the impact indicators , i.e. the standardized crude mortality rate of all cardiac diseases , kerman with 320 deaths ( per 100,000 ) gets the 14 rank among the all provinces . in addition to cardiac risk - factors and diseases , the province s rank moved up to the 3 position in the country , considering the standardized crude mortality rate of addiction and drug - abuse related disorders(5 ) . several studies has explored that mental health and disorders including addiction , depression affected a considerable proportion of inhabitants in kerman which is a public health need among the all health priorities for this part of the country(5 ) . as mentioned above , the national ncd risk factor surveillance has been conducted in iran since 2005 . it has been designed to provide national estimates on major ncd risk factors by repeated survey among the iranian populations aged from 25 to 65 years old . in line with the national ncd risk factor strategic plan , kercadr has been designed and implemented to monitor the cad risk factors at individual level ( repeated measured among individuals rather than community ) with a prospective cohort study . in addition to basic routine ncd risk factors that are captured in the national ncd surveillance , kercadr includes mental health ( opium dependency , depression , and anxiety ) , oral health and hba1c . the present article aims to present the details of the sampling , measurement and analysis techniques applied in kercadr to provide the most valid and reliable estimates on ncd risk factors and monitored the trend at the individual levels in an urban setting in south - east of iran . we also present the preliminary results of the main cad risk measured in the first round of kercadr study and compared men and women accordingly . the primary objectives of the study are : to identify behavioral and biological risk factors for non - communicable diseases by a comprehensive assessment of self and familial past medical history , demographics , occupational and educational status.to identify behavioral and biological risk factors for mental health disorders by a comprehensive assessment of self and familial past medical history , demographics and occupational and educational status.to establish bio - bank for serum to be used for further cross - sectional and nested case - control studies to identify behavioral and biological risk factors for non - communicable diseases by a comprehensive assessment of self and familial past medical history , demographics , occupational and educational status . to identify behavioral and biological risk factors for mental health disorders by a comprehensive assessment of self and familial past medical history , demographics and occupational and educational status . to establish bio - bank for serum to be used for further cross - sectional and nested case - control studies the first round of the study has been initiated in kerman in 2009 to recruit 5900 subjects aged between 15 to 75 years old . the details of the recruited sample and the key findings are illustrated in table 1 . to maximize the sample size to be efficient for all the ncd and their risk factors , we have calculated the sample size for a prevalence of 50% , and consider the precision as the level of 5% . however , we have corrected the sample size based on eight strata ( 1524 , 2534 , 3554 , 5574 by sex ) , the design effect of 1.5 and the response rate 78% where lead to 5900 as the final sample size ( fig . the project has been funded by kerman university of medical sciences with the grant number 88/110 . in the first stage , 250 postal codes ( called seeds ) were selected randomly among an updated roster of residential addresses in provincial post office . the data collection team firstly mapped the seeds and then contact them one by one . after briefing the household s member , all the eligible members ( 1575 years old ) have been listed in the kish household coversheet and recruited to the study . the written informed consent was signed by all of the participants after ensuring their well - understanding of the harm and benefits of the participation in the survey . it should be noted that the study protocol and procedures were reviewed and approved by the research review board of the kerman university of medical sciences ( ethic code 88110ka ) . in the case of any household being absent for twice , the other neighborhood households from the right direction of the seed were approached systematically and with the same method , eligible people were asked to participate in the study . all recruited people were given an appointment card having the date , time and the place of attending collaborating clinic for blood sampling and face - to - face interview . they were asked to be fasted for 1214 hours before the appointment time in the morning and bring their medicines with themselves . in fig . 3 , the age distribution of the recruited sample is compared with the target population in kerman ( national consensus of population size for 2006 ) . base on the sampling methods ( non - proportionate to size ) , the younger age groups were under - sampled and the older groups have been over - sampled . although this will bring more precision to age - stratum specific estimates , the total combined estimates have to be always standardized based on the real age distribution of the target population . the standardized estimates ( based on age and sex subgroups ) for the key measures of clinical and para - clinical findings were presented separately for men and women in table 1 . , we did not present crude estimates ( as they have been confounded estimates ) . the reason for this confounding is the over - sampling of the older age - groups in the survey and the direct standardization has removed this sort of confounding . for further analysis , proportions of categorical and ordinal variables reported by sex group and then compared using chi square test . the means and 95% confidence interval ( ci ) of numerical variables were reported by sex group and compared using post - survey estimation student t - test . it is going to be repeated comparable surveys every four to five years having the components of the behavioral and biological measurements . behavioral risk factors : the nutritional habits were recorded as well as the food frequency questionnaire for all study subjects . physical activity at home and work places , daily movements and level of physical activities at recreation session was measured by global physical activity questionnaire ( gpaq ) and metabolic equivalents was used to express the intensity of physical activities(6 ) . people were categorized as the current smoker if they mentioned that they have been smoking cigarette at the time of first assessment round of the survey . for addiction , a general practitioner asked the participants to disclose whether they have ever used any type of drug and still continue . those with the positive drug history , the type of drug was also asked and recorded . physical examination and biological risk factors : anthropometric measurements as height ( a tape stadiometer with a minimum measurement of 0.1 cm in a standing position , without shoes , while the shoulders were in a normal resting state ) and weight ( light clothing without shoes measures by seca 707 weighing balance with the range of 0.1 to 150 kg , with an accuracy of up to 100 gr ) , waist circumference ( measured at the umbilical level and hip circumference was measured at the maximal level over light clothing , using a non - stretchable measuring tape , without any pressure to the body surface ; both were recorded to the nearest 0.1 cm ) , blood pressure ( standard mercury manometer model rishter , germany ) and pulse rate , fasting blood glucose ( kimia kit , code 890410 , iran ) ( hba1c - nycocard kit , code 1042184 , austria ) - for known diabetic cases and those with high fasting blood glucose after two subsequent measurements ) , triglyceride ( kimia kit , code 890201 , iran ) , total cholesterol ( kimia kit , code 890303 , iran ) ( hdl pars kit , code 89022 , iran ) - and ldl was calculated based on frieldwald formula [ ldl = total chol . ( hdl + tg/5 ) ] . medical history : hypertension and diabetes history as well as other cardiovascular and vascular diseases , the name of medicines also were recorded by a general practitioner . accordingly , all types of medical interventions and any of the mentioned disease in the immediate family were also recorded . blood pressure ( bp ) was measured in sitting position after at least 10 minutes at rest . if abnormal , bp was measured once again at the end of the session ( at least 30 minutes after the first measurement ) in the same conditions . mental health : depression was measured by a valid - translation of the 21-question beck - bdi questionnaire . anxiety score was measured by a valid - translation of the 21-question beck anxiety questionnaire , both conducted by a face to face interview . oral health : gingival index , dentition status and community periodontal index of treatment needs questionnaires were used for measuring the gingival and dmft indices and treatment needs respectively . demographic measurements : age , sex , education , familial status , location and period of residency in kerman . all the non - response households have been tracked twice and if the household did not find at the end , one neighborhood household was replaced . all the non - response in a family was track - able by kish form . this approach makes it possible to count the number of non - response cases at the family which will be used for weighted analysis based on the none - responses . all the biomedical assessment were performed free of charge for participants and the results with a recommendation note based on the results returned back to the study participants by local mail delivery system and further consultancy and required services also provided accordingly . this approach has improved the participation rate and the acceptability of the study among the local communities and families . and we believe this will continue for the next rounds of the cohort . for each participant , two subsamples of the serum have been frozen and stored at 80c for further investigation as complementary case - cohort and nested case - control studies . data entered into an epi - data 3.1 database in maximum three days of the interview . since it has been done with a specific control with several cross - check points , any type of inconsistency has been reported to the data collection team for further investigation and to be corrected even by recalling the study subjects . laboratory exams for fbs , chol , tg and hdl have been done by selectra e machine . the machine automatically has repeated the test based on the following cut points ( table 2 ) : westgard rules have been used for the quality control . shewhart chart has been developed for all the laboratory examinations and according to the standard deviation from the mean ( sd ) , necessary decisions have made . if the three rules have been rejected , the test should be repeated . in the next step , the laboratory technician will review the results and according to the following cutoffs ( table 3 ) , the tests will be repeated . in all cases , the results will be reported if in two serial exams , the results will be in the range of 5 . for , hba1c , nycocard kit is being used . hba1c results is comparing with the fbs as for fbs equal to 126 , we expected to have hba1c around 6.5 and for every unit increase in hba1c , fbs should be increase about 30 . for example , for a person with hba1c of 8% , fbs expected to be around 170 . if the expected result varies more than 0.5 from the observed result , hba1c will be repeated . the results will be reported if in two serial exams , the results will be in the range of 0.5 . to control the quality of selectra e machine , in a daily basis , the machine will be calibrated based on the standard controls from roche germany ( procured from kimia pajoohan ) . the lot number for the standard controls are varies ( as the duration of the study is about 2 years ) but has been registered . for the external quality control , four specimens from the central academic laboratory in kerman and two specimens from national reference laboratory have been sent to the laboratory to be tested and return back the results . if the results were not in the acceptable range , they will receive the feedbacks . regarding the above tests , the quality has been approved up to now . laboratory exams for fbs , chol , tg and hdl have been done by selectra e machine . the machine automatically has repeated the test based on the following cut points ( table 2 ) : westgard rules have been used for the quality control . shewhart chart has been developed for all the laboratory examinations and according to the standard deviation from the mean ( sd ) , necessary decisions have made . if the three rules have been rejected , the test should be repeated . in the next step , the laboratory technician will review the results and according to the following cutoffs ( table 3 ) , the tests will be repeated . in all cases , the results will be reported if in two serial exams , the results will be in the range of 5 . for , hba1c , nycocard kit is being used . hba1c results is comparing with the fbs as for fbs equal to 126 , we expected to have hba1c around 6.5 and for every unit increase in hba1c , fbs should be increase about 30 . for example , for a person with hba1c of 8% , fbs expected to be around 170 . if the expected result varies more than 0.5 from the observed result , hba1c will be repeated . the results will be reported if in two serial exams , the results will be in the range of 0.5 . to control the quality of selectra e machine , in a daily basis , the machine will be calibrated based on the standard controls from roche germany ( procured from kimia pajoohan ) . the lot number for the standard controls are varies ( as the duration of the study is about 2 years ) but has been registered . for the external quality control , four specimens from the central academic laboratory in kerman and two specimens from national reference laboratory have been sent to the laboratory to be tested and return back the results . if the results were not in the acceptable range , they will receive the feedbacks . regarding the above tests , ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc ) have been completely observed by the authors . the others who have contributed a lot to the project are as : medical physicians : hesami kh , yazdanpenah sh , tajadini h , ahmadi gohari n. , mir rashidi f , and dentists : foad rahim and omrani z ; interviewers : ebrahimian z. , kalantari m. , shahabi sh . , shahabi f. , nazarieh s. , administration : shadkam m. montezarolghaem r , namjoo h. , sadeghi z. , khajooei s. , bakhshi n. ; clinical laboratory : doost mohammadi m , sheikholeslami y. , khajeh hasani h. ; community / social mobilizer : nikvarz a. , nikvarz n. , iran - nejad h. , iran - nejad s. , molaei f. , panbeh foroosh a. , zakavati m. , jamali m. , sadeghi nejad s. , taghzadeh s. , jamshidi a. , mosazadeh p. , ramazani nejad f. , yazdan panah m. , shojaei a. , khadem nakhaei . , naser asadi h. , servants : soltani m. , mohammadi z. , ghanbari n. , bagheri m. , mortazapour m. , iranmanesh m. , the others who have contributed a lot to the project are as : medical physicians : hesami kh , yazdanpenah sh , tajadini h , ahmadi gohari n. , mir rashidi f , and dentists : foad rahim and omrani z ; interviewers : ebrahimian z. , kalantari m. , shahabi sh . , shahabi f. , nazarieh s. , administration : shadkam m. montezarolghaem r , namjoo h. , sadeghi z. , khajooei s. , bakhshi n. ; clinical laboratory : doost mohammadi m , sheikholeslami y. , khajeh hasani h. ; community / social mobilizer : nikvarz a. , nikvarz n. , iran - nejad h. , iran - nejad s. , molaei f. , panbeh foroosh a. , zakavati m. , jamali m. , sadeghi nejad s. , taghzadeh s. , jamshidi a. , mosazadeh p. , ramazani nejad f. , yazdan panah m. , shojaei a. , khadem nakhaei . , naser asadi h. , servants : soltani m. , mohammadi z. , ghanbari n. , bagheri m. , mortazapour m. , iranmanesh m. ,

background : this article was to present the sampling and measurements methods and the main preliminary findings of the kercadr cohort study ( first round ) in an urban and peri - urban setting , kerman , southeastern iran 200911.method:5900 ( 3238 female ) people aged between 15 to 75 years were recruited in the household survey by non - proportional to size one - stage cluster sampling . trained internal specialists , general practitioners , clinical psychologists and dentists have assessed the study subjects by person - assisted questionnaires regarding different ncd risk factors including cigarette and opium smoking , physical activity , nutrition habits , anxiety , depression , obesity , hypertension and oral health . blood samples were also collected for determining fbs , hba1c , cholesterol and triglyceride . weighted standardized prevalence estimates were calculated by stata 10 survey analysis package.results:the participation rate was more than 95% in all subgroups . cigarette smoking ( 18.4% vs. 1.2% ) , opium use ( 17.8% vs. 3.0% ) and triglyceridemia ( 16.1% vs. 12.0% ) were significantly higher among men than women . in contrast , women were presented with higher level of sever anxiety ( 29.1% vs. 16.7% ) , obesity ( 16.8% vs. 9.2% ) , low - physical activity ( 45.1% vs. 39.2% ) and uncontrolled diabetes ( 60.2% vs. 31.0% ) . more than 68% of all subjects have presented with moderate to severe gingival index scores.conclusion:the first round of the kercadr cohort with sufficient sample size and response rate provided precise estimates for the main clinical and para - clinical ncd risk factors . these evidences need to be translated into public health interventions and monitored in the next rounds of the cohort .

You are an expert at summarizing long articles. Proceed to summarize the following text: solid pseudopapillary neoplasm ( spn ) is a rare pancreatic tumors , characterized by low malignant potential and strong female predilection . this tumor had several names including frantz s tumor , solid and papillary tumor , solid - cystic tumor , papillary cystic tumor , and solid and papillary epithelial neoplasm until 1996 when world health organization defined it as solid pseudopapillary tumor of the pancreas . however , due to the recent advantages in medical imaging , the incidence of spn has increased to 5 - 6% of all diagnosed pancreatic tumors . spn is diagnosed much more common in children than in adults consisting of 26% of pancreatic tumors . spn shows a strong female predilection , 90% of them arising in adolescent and young adult women . the overall mortality rate of spn is about 2% and recurrence occurred in almost 10 - 15% of patients after resection . the predominant occurrence of spn in young women at the beginning of the reproductive period along with the presence of progesterone receptors , indicate the role of female hormones in the growth of this tumor . this idea has been supported by the fact that genital ridges are closed to the pancreatic anlage during embryogenesis . chromosomal abnormalities are the other mechanism that may have an etiological role in the development of this neoplasm . some studies suggested that mutation in b - catenin , could play a major role in the tumorogenesis of spn . according to immunohistochemical and electron microscopic studies , it has been suggested that these tumors originate from undifferentiated pluripotent emberyonal cells . herein , we describe the clinical , radiological and cytopathological features of solid pseudopapillary tumor of the pancreas ( spnp ) diagnosed by endoscopic ultrasound - guided ( eus - guided ) fine - needle aspiration ( fna ) and review of relevant literature . patients with final diagnosis of pseudo papillary tumor who referred for eus to shariati hospital , affiliated to tehran university of medical sciences from november 2010 to march 2015 were enrolled . the demographic , clinical and pathological features of all patients were recorded in the digestive disease research institute . the database included age , sex , associated symptoms , laboratory data , tumor size and location , arterial and perineural invasion , distant metastasis , lymphadenopathy , operative data , and postoperative complications . the first diagnosis in all patients was made by eus - fna cytology samples and finally by surgical tissue . the endosonographer inserted a 22 gauge needle into the target lesion and aspirated samples by three passes , almost without applying suction . aspiration of lesions located in the head of the pancreas or uncinate process was done through the transduodenal approach and lesions in the body and tail of the pancreas through the transgastric route . all samples were enough for cytologic evaluation and there was no need to repeat fna in any patient . details of fine - needle aspiration and surgical pathology results were recorded . ihc was done on fna cell block samples using dako real en vision detection system , peroxidase / dab , rabbit / mouse . the hematoxylin and eosin ( h and e ) stained sections of all fna and surgical samples were reviewed by an expert pathologist to confirm the diagnosis . the ihc markers ( primary antibodies ) used in the analysis , included vimentin ( clone ; v9 ) , pan cytokeratin ( ck ) ( clone ; ae1 and ae3 ) , -catenin ( clone ; ncl- -catenin ) , cd10 ( clone ; 56c6 ) , progesterone receptor ( pr ) ( clone ; pr88 ) , synaptophysin ( clone ; 27g12 ) , and chromogranin a ( clone ; lk2h10 ) . all of the patients underwent a variety of radiological examinations for preoperative diagnosis including transabdominal ultrasonography , computed tomography ( ct ) and magnetic resonance imaging ( mri ) . the study was approved by the ethics committee and institutional review board of the digestive disease research institute of tehran university of medical sciences , tehran , iran . data were analyzed using spss software , version 20 ( ibm , new york , usa ) . seven patients underwent surgical treatment for spn of the pancreas during the study period . preoperative diagnosis was made by eus in all patients . of these patients , 6(85.7% ) were female . the level of serum amylase and tumor markers was within the normal range in all patients except in one . the tumor cells were mostly positive for vimentin , pr and cd10 , each in 6 cases . synaptophysin was positive in 3 patients , followed by nse and cytokeratin , each in 2 patients . nse : neuron specific enolase , pr : progesterone receptor , pan ck : pan cytokeratin all patients underwent surgical treatment . the most common location of the tumor was the head and neck of the pancreas , each in 2 ( 28.5% ) patients , followed by the body , tail and both the body and tail , each in one patient . the mean diameter of the tumor was 42.5 mm ( range : 12 - 60 mm ) . two patients had perineural invasion ; however , none of the patients showed distant metastasis . the other three patients with lesions in the body and/or in the tail underwent distal pancreatectomy . a mixed solid and cystic appearance was identified in three patients , and others had predominantly solid appearance . the tumor was the head and neck of the pancreas , each in 2 ( 28.5% ) patients , followed by the body , tail and both the body and tail , each in one patient . the mean diameter of the tumor was 42.5 mm ( range : 12 - 60 mm ) . two patients had perineural invasion ; however , none of the patients showed distant metastasis . the other three patients with lesions in the body and/or in the tail underwent distal pancreatectomy . a mixed solid and cystic appearance was identified in three patients , and others had predominantly solid appearance . the most common presenting symptoms of spns are abdominal pain followed by increased abdominal girth , poor appetite and nausea resulting from tumor compression on the adjacent organs and a palpable mass . although almost 30% of patients are completely asymptomatic and discovered incidentally during routine clinical examination or diagnostic imaging procedures , some patients ( 8% ) present with acute abdomen as a result of abdominal blunt trauma or spontaneous rupture of the capsule . clinical presentations of our patients included abdominal pain , nausea and vomiting , weight loss , bloating and feeling of fullness . it has a strong female preponderance with female- male ratio of 5:1.9 and up to 10:1 . male patients presented much later compared with women ( mean age : 31 years ) . the diagnosis of spn has increased during the recent years due to advances in diagnostic imaging techniques . however , clinical and radiological findings are insufficient for reaching a definite diagnosis and tissue sampling should always be considered . eus - fna needle aspiration and cytology is the best technique for preoperative diagnosis of spn and less invasiveness than surgical procedures . eus - fna is increasingly using for identifying the tumor over the recent years , however it still constitutes fewer than 5% of performed imaging . spn lesions have been shown as well - circumscribed , hypoecho , heterogenous solid and cystic masses by eus . eus - fna is significantly more effective than ct in differentiating neoplastic from non - neoplastic , along the identifying malignant pancreatic cysts . furthermore , immunohistochemical staining and mutation analysis of beta catenin gene are helpful in distinguishing spn from other pancreatic tumors . complete surgical resection is the mainstay of treatment in all patients with spn even in the presence of local invasion or distant metastasis . the most common surgical procedures performed for pancreatic spn are distal pancreatectomy and pancreaticoduodenectomy ( whipple surgery ) . local invasion and distant metastasis were reported in 5% and 6% of spn patients , respectively . the most frequent sites affected by metastases include the liver ( 28% ) , wall of vena cava ( 27% ) and the spleen ( 17% ) . duodenum , omentum , colon , and lung are the other preference location of metastases . invasion to regional lymph nodes has been rarely reported which is consistent with our series . the efficacy of non - surgical approaches including chemotherapy and radiotherapy has not been proven . the prognosis of spn is favorable , even in the presence of metastases or invasion to other organs . considering the fact that the 5-year survival rate of spn is 94 - 97% , it is very important to differentiate it from other pancreatic lesions . however , if metastatic lesions are impossible to be removed , long - term survival is undeterminable . according to the largest report of patients with spn , pancreatic tail and the head of pancreas are the most common localizations of the tumor followed by pancreatic body , body and tail , head and body , neck and the uncinate process of the pancreas . however , in this series , only one of our patients had tumor in the tail region and most of the tumors were located in the pancreatic head and neck . in our series , perineural invasion our small sample size did not allow us to compare different tumor characteristics with the sex of the patients . lymph node metastases were not found in none of the patients in this series which is consistent with other reports . the mean follow - up period of our patients was 14 months ( 7 - 30 months ) which is short for giving a comprehensive opinion on recurrence rate . in previous studies , spn have a mean diameter of 6.08 cm ( range 0.5 to 34.5 cm ) . metastasis or local recurrence rate of spnp in patients treated by radical surgical excision is 9%- 15% . as we presented in our series , there was no association between spnp and laboratory test results including serum tumor markers . factors that can be useful in predicting the malignant potential of the tumor are perineural and vascular invasion , lymph node involvement and deep invasion of surrounding tissues . the morphological appearance is not a good predictor of clinical behavior of these tumors ; spn with subtle histological malignant appearance can show local invasion to adjacent structures . several studies indicated that male sex , large tumor size ( > 5 cm ) , and tumor necrosis could predict malignant transformation . however , most of the studies do not report any association between age and tumor location with malignant potential of spn . the clinical features and outcome of our patients were compared with recent reports from other countries in table 2 . in our study , ihc analysis showed strong positivity for vimentin , cd10 , and pr . these findings are consistent with previous studies that reported positivity for vimentin in 100% and 70% of cases , respectively . tumor cells of spn showed strong positivity for cd10 in two previous studies , in the present series , pr was positive in 6 out of 7 patients . machado et al , reported pr positivity in 80% of cases and the percentage of pr positivity was 64.5% in a study by uppin et al . taken together , the frequent expression of pr and strong female predilection of spn indicate the importance of hormone dependency in the pathogenesis of this tumor . eus - guided fna with preparing cell block from the aspiration and using ihc with relevant markers are a very helpful techniques for preoperative diagnosis of spn .

background information regarding solid pseudopapillary neoplasm ( spn ) of the pancreas is limited in iran . we aimed to review the clinicocytopathological features and follow - up of patients with spn of pancreas who were diagnosed in a single center in iran . methods seven patients with spn of the pancreas were diagnosed during january 2010 to march 2015 at the digestive disease research institute of tehran university of medical sciences . the patients were reviewed prospectively . results six out of the 7 patients were female and the mean age of all the patients was 29.4 years ranging from 15 to 61 years . the most common clinical presentation was nonspecific abdominal pain ( n=6 ) . the tumors were located mostly in head and neck of the pancreas . spn was diagnosed in all patients by fine needle aspiration through endosonography ( eus - fna ) . all patients underwent surgery . histological findings of surgical tissues were consistent with eus - fna . the postoperative follow - up period of about 14 months was uneventful . conclusion spn of the pancreas is a rare pancreatic tumor which affects primarily young women . eus - guided fna could play an important role in preoperative diagnosis of spn of the pancreas .

You are an expert at summarizing long articles. Proceed to summarize the following text: fine needle aspiration ( fna ) of salivary gland represents one of the most challenging areas of cytopathology due to a wide variety of reactive and neoplastic lesions . pathologically , salivary gland tumors have been described as one of the most heterogeneous groups of human tumors . there is marked cytomorphologic diversity and overlap between benign , malignant , and metastatic tumors . a 45-year - old male complained of bloody discharge from the right ear with progressive weakness of the right side of the face since 2 months ( right facial nerve palsy ) . on examination , a diffuse , firm swelling measuring 4 3 cm was present in right retroauricular region since 1 year which was fixed to the underlying occipital bone . another swelling was present in the infraauricular region since 3 months measuring 2 1 cm which was well - defined , globular , soft to firm , with glistening red surface . ultrasonography ( usg ) of the neck showed a well - defined mass in posterior auricular region , eroding the mastoid bone , and a possibility of malignancy was given . contrast enhanced computed tomography ( cect ) of the head and neck showed similar mass in right temporooccipital region with both extra and intracranial extension . cytological smears from both the swellings were stained with giemsa and papanicolaou stains and showed similar morphology . smears were highly cellular with cells arranged in large flat sheets , three - dimensional papillae , and cohesive clusters [ figure 1a , inset ] . at places , cells were round - to - oval showing mild - to - moderate nuclear pleomorphism , low nuclear cytoplasmic ratio , eccentric nucleus , prominent nucleolus , and granular abundant cytoplasm [ figure 1a ] . cytology smears ( a , inset ) cells arranged in three - dimensional papillaroid cohesive clusters ( giemsa 200 ) , ( a ) apocrine - like cells ( pap stain 200 ) , tissue sections ( b , inset ) tumor cells arranged in solid - cystic , glandular , cribriform , and infiltrative patterns ( h and e 100 ) , ( b ) lumen of the cysts showed mucin and muciphages ( h and e 400 ) in view of the normal salivary gland on usg , absence of normal salivary gland tissue on smears and presence of pleomorphic round cells arranged in papillae and adenoid pattern with bony and cranial extension , a possibility of metastasis from epithelial malignancy ( adenocarcinoma ) was reported on cytology . magnetic resonance imaging ( mri ) of the brain , reported later , showed lytic destruction of the right occipitotemporal bone with intracranial component . another lesion was seen in the auricular region , which was inseparable from the deep lobe of the right parotid gland . however , the infraauricular swelling that was adherent to the underlying deeper structures was not excised . the tumor was hard , vascular , extradural , adhered to dura , and involved the temporal bone . subsequently , a single soft - to - hard tissue mass measuring 9 6 3 cm was received . sections stained with hematoxylin and eosin ( h and e ) showed a partly encapsulated tumor with cells arranged in solid - cystic , glandular , and cribriform patterns [ figure 1b inset ] . the cysts were lined by single - to - multilayered ( 23 cells ) apocrine - like cells and lumen showed mucin and muciphages [ figure 1b ] . these cells had abundant eosinophilic granular cytoplasm , eccentric nucleus , vesicular chromatin , and prominent nucleolus . the following differentials were considered : salivary duct carcinoma , oncocytic carcinoma , low grade cribriform cystadenocarcinoma , mucoepidermoid carcinoma , and metastatic adenocarcinoma . mucicarmine and an immunohistochemistry ( ihc ) panel comprising of cytokeratin ( ck ) 7 , ck20 , panck , epithelial membrane antigen ( ema ) , thyroid transcription factor ( ttf-1 ) , her2/neu , s100 , smooth muscle actin ( sma ) , carcinoembryonic antigen ( cea ) , and p63 were performed . ck7 and ema were positive [ figure 2a and b ] whereas the rest of the markers were negative . ihc ( a ) ck7 ( 40 ) , ( b ) ema ( 100 ) in view of the presence of cysts lined by multilayered cells along with cribriform pattern , possibility of oncocytic carcinoma was excluded . possibility of metastasis was excluded on the basis of immunonegativity for ck20 , cea , and ttf-1 . low grade cribriform cystadenocarcinoma was excluded because cysts were multilayered with apocrine - like cells and markers like s-100 and sma were negative . a final diagnosis of salivary duct carcinoma was given and the patient was referred for radiotherapy . salivary duct carcinoma is a distinctive primary neoplasm of salivary gland , which was first described by kleinsasser et al . in 1968 . it is a rare tumor with an estimated incidence of 13% of all malignant salivary gland tumors . three - fourth of the patients are males , with peak incidence in sixth to seventh decade . this tumor is considered to be high grade , with mortality up to 70% . in the present case , facial palsy and lymph node metastasis were present , however , the patient was relatively young . histomorphologically , this tumor shows similarities with intraductal cribriform and comedocarcinoma of the female breast , thus , known as salivary duct carcinoma . the cellular yield varies from low to high , depending on the degree of desmoplasia and necrosis . the cells are arranged singly in loosely cohesive groups , three - dimensional clusters , flat sheets , papillae , and cribriform pattern . on account of its apocrine features and high nuclear grade , if cribriform groups are noted in a salivary gland aspirate , the diagnosis of salivary duct carcinoma should at least be considered . however , in the present case , cribriform pattern was not noted cytologically . the absence of cribriform or papillary groups suggests an inconclusive diagnosis and the need to establish a differential diagnosis with other salivary gland tumors , in particular with adenocarcinoma not otherwise specified and high - grade mucoepidermoid carcinoma . despite the fact that the histomorphologic features are always necessary for its characterization , treatment modalities are nonconsensual , however , some authors advocate the necessity of aggressive approach . to conclude , the preoperative diagnosis of this type of neoplasm may warrant a more extensive radiological work - up . at present , fna has gained wide acceptance as a first line procedure in the evaluation of salivary gland mass lesions .

salivary gland cytopathology is a diagnostically challenging area with overlapping cytomorphological features between benign , malignant , and metastatic tumors . we report the case of 45-year - old male who presented with two swellings in right retroauricular and infraauricular region along with a palpable single right cervical lymph node . on ultrasonography of the neck , a possibility of malignant lesion was given . contrast enhanced computed tomography of the head showed a large well - defined space occupying lesion in right temporooccipital region eroding the skull bone with both extra and intracranial extension . fine needle aspiration was performed from both swellings and cervical lymph node . based on cytological features and clinicoradiological examination , a possibility of metastasis from epithelial malignancy ( adenocarcinoma ) was suggested . the retroauricular region swelling was excised , and a diagnosis of salivary duct carcinoma was given on histopathology . in this article , we discuss the diverse presentation , cytomorphological features , and differential diagnosis of this rare salivary gland tumor .

You are an expert at summarizing long articles. Proceed to summarize the following text: de sanctis - cacchione syndrome ( mim # 278800 ) is characterized by cutaneous photosensitivity , microcephaly , mental retardation , short stature , hypogonadism , spasticity , peripheral neuropathy , and sensorineural deafness ( mckusick and kniffin , 2010 ) . a 9-year - old boy was referred to the otorhinolaryngology - head and neck surgery department at the university hospital because of a rapidly growing ulcerative lesion on the face over the past 6 months . he had a neglected case of xeroderma pigmentosum ( xp ) , was the offspring of a consanguineous marriage , and had mental retardation and photosensitivity . an informed consent was obtained from the patient s parents for this report . a large , ulcerated tumor ( 10 12 cm ) was observed on the left side of the face with involvement of the lower lid , cheek , nose , and upper lip . numerous crusted lesions were noted on the forehead , lower lip , and right cheek . the skin on the face , neck , and limbs of sun - exposed areas appeared dry with freckle - like pigmentary changes including hypopigmentation , hyperpigmentation , and atrophy ( poikiloderma ) . a mucous membrane examination was normal , except for the left eye that was covered by the tumor , so the eye could not be assessed . he had bilateral hearing loss . because of severe psychomotor retardation , ataxia , and spastic movement , he was bedridden and incontinent . a maxillofacial computed tomography ( ct ) scan demonstrated a large hypodense mass over the left maxilla , with involvement of the soft tissue in this region ( fig . 2 ) . a brain ct scan revealed severe cortical atrophy , but no calcification or mass effect was detected . a histopathologic examination of the facial skin biopsies indicated a diagnosis of squamous cell carcinoma ( scc ) . a complete blood cell count , routine blood chemistry , and urinalysis were all within normal limits . the eye had ocular surface lesions and corneal scarring , but there was no tumor involvement . the largest defect was reconstructed using a split - thickness skin graft ( fig . a large , ulcerated tumor ( 10 12 cm ) was observed on the left side of the face with involvement of the lower lid , cheek , nose , and upper lip . numerous crusted lesions were noted on the forehead , lower lip , and right cheek . the skin on the face , neck , and limbs of sun - exposed areas appeared dry with freckle - like pigmentary changes including hypopigmentation , hyperpigmentation , and atrophy ( poikiloderma ) . a mucous membrane examination was normal , except for the left eye that was covered by the tumor , so the eye could not be assessed . because of severe psychomotor retardation , ataxia , and spastic movement , he was bedridden and incontinent . a maxillofacial computed tomography ( ct ) scan demonstrated a large hypodense mass over the left maxilla , with involvement of the soft tissue in this region ( fig . 2 ) . a brain ct scan revealed severe cortical atrophy , but no calcification or mass effect was detected . a histopathologic examination of the facial skin biopsies indicated a diagnosis of squamous cell carcinoma ( scc ) . a complete blood cell count , routine blood chemistry , and urinalysis were all within normal limits . the eye had ocular surface lesions and corneal scarring , but there was no tumor involvement . the largest defect was reconstructed using a split - thickness skin graft ( fig . dry pigmented skin , is characterized by extreme skin sensitivity to ultraviolet radiation ( uvr ) and abnormal skin pigmentation , with a high incidence of skin cancers on sun - exposed areas ( kraemer and digiovanna , 1993 ) . xp consists of a group of various rare autosomal recessive inherited conditions with a defective nucleic excision repair ( ner ) pathway for dna repair . major disorders involving defective dna repair such as xp , cockayne syndrome ( cs ) , and trichothiodystrophy present with photosensitivity and overlapping genetic and clinical features . however , the development of numerous skin cancers at a young age is characteristic of xp ( digiovanna and kraemer , 2012 ) . typically , xp patients have a history of sunlight hypersensitivity , freckling , and photophobia before the age of 2 years ; develop their first skin cancer prior to the age of 10 years ; and develop their first melanoma before age 30 years ( digiovanna and kraemer , 2012 ) . confirmatory molecular genetic testing is conducted for research purposes and is not routinely available ( digiovanna and kraemer , 2012 ) . de sanctis cacchione syndrome has been regarded as one of the rarest manifestations of xp with the most severe dna repair impairment ( cleaver et al . , 1984 , cleaver and thomas , 1988 , mittal et al . , 2013 it is recognized by the typical xp skin changes accompanied by progressive neurologic degeneration , a short stature , and delayed gonadal maturation . the presence of progressive neurologic involvement and age at symptom onset correlate with the degree of dna repair impairment ( caldas and rodrigues , 2013 , hessel et al . , 1992 ) . the median life span of patients with neurologic deterioration is shorter than those without neurological degeneration ( 29 versus 37 years ) ( bradford et al . , 2011 , de sanctis and cacchione derived the term xerodermic idiocy for three brothers with xp who had microcephaly , mental deficiency , dwarfism , gonadal hypoplasia , progressive neurologic deterioration , deafness , and ataxia beginning at the age of 2 years ( de sanctis and cacchione , 1932 ) . kraemer et al . ( 1987 ) performed a review of case reports on xp beginning with 1874 , the first time xp was reported , and ending with 1982 . according to their review , microcephaly and neurologic deterioration were observed in only 37 and 27 , respectively , out of a total of 830 patients . short stature and delayed secondary sexual development were seen in only 19 patients ( kraemer et al . , 1987 ) . several neurologic abnormalities have been recognized in xp patients . a previous review ( kraemer et al . , 1987 ) reported neurologic abnormalities in 18% of patients , and the most prevalent symptoms were mental retardation , spasticity , ataxia , and microcephaly . recently , from a 39-year follow - up study involving 106 patients with xp , the national institutes of health ( nih ) revealed that 24% of patients with xp present with progressive neurologic degeneration ( bradford et al . , 2011 ) . symptoms included loss of intellectual functioning , deterioration of neurologic status , loss of hearing , areflexia , ataxia , peripheral neuropathy , and inability to walk and talk . the severity of neurologic degeneration in patients with xp is correlated with the diffuse cortical , brain stem , and cerebellar atrophy ( anttinen et al . , 2008 , fekete , 2014 , mittal et al . , 2013 ) , while brain calcification is more suggestive of cockayne syndrome ( fekete , 2014 ) . recently , the nih reported an increased frequency of different cancer types in patients with xp , as compared with the general population , as follows : tongue cancer ( 100,000 ) , nonmelanoma skin cancer ( 10,000 ) , melanoma ( 2,000 ) , anterior compartment of the eye secondary to sun exposure ( 1,000 ) , and brain and central nervous system ( 50 ) ( digiovanna and kraemer , 2012 ) . skin cancers were reported in about 50% of patients with xp who have neurologic abnormalities , a rate that was similar to patients who have xp without neurologic abnormalities ( anttinen et al . , we found a similar skin cancer rate of 42% among recent patients with xp who had neurologic abnormalities ( table 1 ) . the increased risk of conjunctival scc , skin cancer on sun - exposed areas , and progressive neurologic degeneration is believed to be caused by an impaired ner pathway in xp cells . ner is a pathway involved in the repair of nucleotide dimerization damage secondary to uvr ( digiovanna and kraemer , 2012 ) , psoralen ( corts et al . , 1991 ) , and benzopyrene ( carcinogen in cigarette smoke that mimics uvr damage ) ( maher et al . , 1977 ) . oxidative processes or reduced superoxide dismutase might induce premature neuron death ( digiovanna and kraemer , 2012 , nishigori et al . , 1989 , reardon et al . , 1997 ) . it is highly recommended that the patient s family restrict the child s exposure to sunlight and provide the child with skin and eye protection such as sunblock , long - sleeved clothing , and window tinting . vitamin d supplementation is necessary to prevent vitamin deficiency ( digiovanna and kraemer , 2012 ) . patients need to be monitored by dermatologists , ophthalmologists , and neurologists for early management of issues ( digiovanna and kraemer , 2012 , mittal et al . , 2013 ) . the earliest clinical neurologic findings are frequently an absence of deep tendon reflexes and high - frequency hearing loss ( digiovanna and kraemer , 2012 ) . the neurologic symptoms probably start slowly when patients are about 2 years of age and become apparent with cognitive and cerebellar signs in 4 - 5 years ( anttinen et al . , 2008 ) . therefore , deep tendon reflex testing and audiometry are recommended to screen for the presence of neurologic involvement ( digiovanna and kraemer , 2012 ) . molecular genetic findings have indicated that neurologic abnormalities are more prevalent in patients with certain gene mutations that were previously known as the a ( the most frequently group worldwide and in japan ) , d , and b complimentary groups for xp ( anttinen et al . , 2008 , kraemer et al . , 1987 , lai et al . , 2013 ) . neurologic abnormalities are rare in the c complimentary group , which is the most common group in the united states , europe , and the middle east ( kraemer et al . , 1987 ) . skin neoplasm management involves electrodessication , curettage , surgical excision , mohs micrographic surgery , and chemoprevention . mohs microsurgery ensures complete removal and allows maximum skin preservation for future procedures in patients with xp . in this patient , unfortunately , mohs microsurgery was not available , and the large scc lesion was surgically resected with a 1-cm margin . ( 1992 ) found that chemoprevention with a high oral dose of isotretinoin , 2 mg / kg / day , for 2 years significantly reduced ( 63% ) the number of new skin cancers in patients with xp . we initiated treatment with a lower - dose retinoid because of the potential for the side effect of xerosis in our patient ( 0.5 mg / kg / day ) . recent studies found that the successful application of topical recombinant dna repair enzymes ( e.g. , liposomal encapsulated t4 endonuclease v [ yarosh et al . , 2001 ] and liposomal photolyase with high - protection ultraviolet filters [ giustini et al . , 2014 ] ) lowers the rate of development of actinic keratosis , scc , and basal cell carcinoma in patients with xp . early diagnosis of the disorder , appropriate uvr protection , and astute management could help alleviate patients symptoms .

de sanctis cacchione ( dsc ) syndrome is one of the rarest , most severe forms of xeroderma pigmentosum ( xp ) . these patients with xp are of short stature , have mental disabilities , and develop progressive neurologic degeneration because of a severe inability to repair damaged dna . herein , we will present the case of a 9-year - old boy who had dsc syndrome with microcephaly , severe psychomotor retardation , ataxia , and hearing loss . the cutaneous manifestations included giant squamous cell carcinoma ( scc ) that covered the eye , multiple facial sccs , and pigment changes on sun - exposed areas . in addition , we include a review of reported rare cases and a brief discussion of disease management .

You are an expert at summarizing long articles. Proceed to summarize the following text: the gastrointestinal ( gi ) tract is one of the important parts of the body . this tract starts from the mouth , includes esophagus , stomach , small and large intestine , and rectum , and finally ends with anus . the human gi tract is a single tube which is approximately nine meters long in relaxed condition . disorder in any part of the gi tract results in various malfunctions such as diseases of digestive system and cancer . gi cancer is defined as the cancer of organs of the digestive system including the esophagus , gallbladder , liver , pancreas , stomach , small intestine , large intestine , rectum , and anus ( figure 1 ) . the common risk factors for gi cancer include infection , smoking , drinking alcohol , high fat diet , age , race , gender , family history , and geographical location . the occurrence of gi cancer is very high in developed countries . in the united states , gi cancer accounts to 20 percent of all newly diagnosed cancer cases . among different gi cancers , colorectal cancer is the most common cancer and is the second leading cause of death . . the major change in lifestyle which proves beneficial includes avoiding tobacco , increased ingestion of fruits and vegetables , moderate use of alcohol , caloric restriction , exercise , minimal meat consumption , intake of whole grains , proper vaccinations , and regular health checkups . the link between healthy diet and cancer has been revealed in numerous studies [ 47 ] . an inverse association between the consumption of fruits and vegetables and cancer risk was evident by an epidemiological study in netherlands . it has been found that the consumption of 21 vegetables and 9 fruits decreased the tumor growth in urothelial cancer patients . it has also been reported that asians have lower incidence of cancer than the residents of western countries , and the rate increases substantially among asians who have migrated to the west ( http://www.dietandcancerreport.org/?p=er ) . consumption of diet rich in plant products may be one of the important reasons for the low incidence of cancer in asia . a wide variety of natural products containing anticancer properties have been reported in the literature . in this paper , the role of ginger and its active ingredients against gi cancer have been discussed as it has worldwide consumption as a spice . ginger ( zingiber officinale ) , a member of the zingiberaceae family , is a popular spice used globally especially in most of the asian countries . chemical analysis of ginger shows that it contains over 400 different compounds . the major constituents in ginger rhizomes are carbohydrates ( 5070% ) , lipids ( 38% ) , terpenes , and phenolic compounds . terpene components of ginger include zingiberene , -bisabolene , -farnesene , -sesquiphellandrene , and -curcumene , while phenolic compounds include gingerol , paradols , and shogaol ( figure 2 ) . these gingerols ( 2325% ) and shogaol ( 1825% ) are found in higher quantity than others . besides these , amino acids , raw fiber , ash , protein , phytosterols , vitamins ( e.g. , nicotinic acid and vitamin a ) , and minerals are also present [ 11 , 12 ] . the aromatic constituents include zingiberene and bisabolene , while the pungent constituents are known as gingerols and shogaols . other gingerol- or shogaol - related compounds ( 110% ) , which have been reported in ginger rhizome , include 6-paradol , 1-dehydrogingerdione , 6- gingerdione and 10-gingerdione , 4- gingerdiol , 6-gingerdiol , 8-gingerdiol , and 10-gingerdiol , and diarylheptanoids [ 59 , 60 ] . the characteristic odor and flavor of ginger are due to a mixture of volatile oils like shogaols and gingerols . ginger has been used as a spice as well as medicine in india and china since ancient times . it was also known in europe from the 9th century and in england from the 10th century for its medicinal properties . therefore , it is used to prevent nausea resulting from chemotherapy , motion sickness , and surgery . ginger is also used to treat various types of other gi problems like morning sickness , colic , upset stomach , gas , bloating , heartburn , flatulence , diarrhea , loss of appetite , and dyspepsia ( discomfort after eating ) . according to indian ayurvedic medicinal system , ginger has been reported as a pain relief for arthritis , muscle soreness , chest pain , low back pain , stomach pain , and menstrual pain . it can be used for treating upper respiratory tract infections , cough , and bronchitis . as an anti - inflammatory agent , it is also used to warm the body for boosting the circulation and lowering high blood pressure . because of its warming effect , ginger acts as antiviral for treatment of cold and flu . ginger is also used as a flavoring agent in foods and beverages and as a fragrance in soaps and cosmetics . evidences from in vitro , animal , and epidemiological studies suggest that ginger and its active constituents suppress the growth and induce apoptosis of variety of cancer types including skin , ovarian , colon , breast , cervical , oral , renal , prostate , gastric , pancreatic , liver , and brain cancer . these properties of ginger and its constituents could be associated with antioxidant , anti - inflammatory , and antimutagenic properties as well as other biological activities . in this review , focus has been laid solely on gi cancers to describe whether ginger and its active components exhibit chemopreventive and chemotherapeutic potential . the in vitro ( table 1 ) , in vivo ( table 2 ) , and clinical effects ( table 3 ) of ginger have also been described . preclinical studies have shown that ginger extract and its constituents possess chemopreventive and antineoplastic properties in gastric cancer . in vitro study showed that 6-gingerol induces apoptosis of gastric cancer cells . it facilitates tnf - related apoptosis - inducing ligand- ( trail- ) induced apoptosis by increasing caspase-3/7 activation . the induction of apoptosis by 6-gingerol was mediated through downregulation of cytosolic inhibitor of apoptosis ( ciap)-1 and inhibiting trail - induced nuclear factor - kappab ( nf-b ) activation . besides 6-gingerol , 6-shogaol also reduced the viability of gastric cancer cells by damaging microtubules . when ginger extract was given to sprague - dawley rats having acetic acid - induced ulcers ginger extract also attenuated elevated activities of xanthine oxidase and myeloperoxidase , as well as malondialdehyde ( mda ) level in the ulcerated mucosa . thus , ginger extract promotes ulcer healing by acting as an antioxidant and prevents gastric mucosal damage . it is also reported to be effective in ameliorating the side effects of conventional therapeutic agents including -radiation , doxorubicin , and cisplatin by regulating p - glycoprotein . thus ginger extract exhibits chemosensitizing effects in certain neoplastic cells in vitro and in vivo . in support of this , another study showed that ginger reverses cisplatin - induced delay in gastric emptying indicating that ginger acts as an antiemetic for cancer chemotherapy . thus , it may be useful in improving the gastrointestinal side effects of cancer chemotherapy . besides ginger , zerumbone ( a sesquiterpene ) derived from a subtropical ginger zingiber zerumbet smith was also reported to have antitumor and anti - inflammatory properties in different cancers . in gastric cancer cell lines , zerumbone inhibited cell proliferation , vegf expression , and nf-b activation . thus , zerumbone acts as an antiangiogenic and antitumor drug in the treatment of gastric cancer . ginger and its constituents are also effective against pancreatic cancer . park et al . have shown that 6-gingerol inhibits the growth of pancreatic cancer hpac and bxpc-3 cells through cell cycle arrest at g1 phase and independent of p53 status . further they found that 6-gingerol decreased both cyclin a and cyclin - dependent kinase ( cdk ) expression followed by reduction in retinoblastoma ( rb ) phosphorylation and blocking of s phase entry . another study showed that 6-gingerol regulates tight junction - related proteins and suppresses invasion and metastasis of pancreatic cancer cells . these functions of 6-gingerol were mediated through nf-b / snail inhibition via inhibition of the extracellular signal - regulated kinases ( erk ) pathway . another component of ginger , 6-shogaol , triggers ca signals in the pancreatic -cells by activating the trpv1 channels . in fura-2 loaded single rat insulinoma ( ins-1e ) cells , 6-shogaol increased intracellular ca in a concentration - dependent manner . intracellular ca increase obtained by 1 m 6-shogaol was found to be greater than that obtained by 10 mm glucose . along with in vitro studies , animal studies showed that 6-shogaol suppressed growth of pancreatic cancer and potentiated the effects of gemcitabine in suppression of tumor growth . the antiproliferation and sensitization to gemcitabine by 6-shogaol was mediated through the suppression of nf-b , cyclooxygenase- ( cox- ) 2 , cyclin d1 , survivin , ciap-1 , x - linked inhibitor of apoptosis protein ( xiap ) , bcl-2 , and matrix metallopeptidase- ( mmp- ) 9 . the inhibition of this tumor growth by 6-shogaol was associated with decrease in proliferation index ( ki-67 ) and increased apoptosis . a component of asian ginger , zerumbone , also inhibits growth and proliferation of pancreatic cancer through different mechanisms . the induction of apoptosis was associated with upregulation of p53 and p21 proteins as well as production of reactive oxygen species ( ros ) in zerumbone - treated panc-1 cells . . showed that it inhibits invasion of pancreatic tumor cells by downregulating chemokine receptor cxcr4 expression . they also showed that the zerumbone - induced downregulation of cxcr4 was due to transcriptional regulation and inhibition of nf-b activation . in support of this study , recently shamoto et al . showed that zerumbone blocks angiogenesis of pancreatic cancer cells through the inhibition of nf-b and nf-b - dependent proangiogenic gene products . in vitro studies , 6-shogaol has been reported to induce apoptotic cell death of mahlavu hepatoma cells via an oxidative stress - mediated caspase - dependent mechanism . glutathione ( gsh ) depletion has been shown to be a major contributing factor in arbitrating 6-shogaol - induced apoptosis of mahlavu cells . recently jeena et al . showed that oral administration of ginger oil for one month increases antioxidant enzymes sod , gsh , and glutathione reductase in blood of mice and glutathione - s - transferase , glutathione peroxidase , and sod enzymes in liver of mice . ginger oil also produced significant reduction in acute inflammation produced by carrageenan and dextran and formalin induced chronic inflammation , indicating its role in prevention of liver carcinogenesis . besides glutathione , ros also have been involved in ginger extract - induced apoptosis of hepg2 hepatoma cells . ginger extract at a dose of 250 g / ml markedly changes morphology of cells including cell shrinkage and condensation of chromosomes in hepg2 cells . another study showed that 6-gingerol induced apoptosis of human hepg2 cells through lysosomal - mitochondrial axis , where cathepsin d played a crucial role in the process of apoptosis . 6-gingerol - induced release of cathepsin d preceded ros generation and cytochrome c release from mitochondria . it is also reported to protect the lipid peroxidation in liver tissue homogenate / mitochondria . the protective mechanism can be correlated to the radical scavenging property of ginger extract . in animal model , ginger suppresses ethionine - induced liver carcinogenesis by scavenging the free radical formation and by reducing lipid peroxidation . the major components of ginger , 6-shogaol and 6-gingerol , have shown to exert anti - invasive activity against hepatoma cells . both compounds inhibited the migratory and invasive abilities of phorbol 12-myristate 13-acetate- ( pma- ) treated hepg2 and pma - untreated hep3b cells . further it was observed that inhibition of migration and invasion were mediated by decreased activity of mmp-9 , urokinase - type plasminogen activator ( upa ) and increased expression of tissue inhibitor metalloproteinase protein- ( timp- ) 1 . further supported their observation that 6-shogaol and 6-gingerol effectively inhibit invasion and metastasis of hepatocellular carcinoma by the inhibition of mmp-2/-9 and upa , along with the suppression of mapk and pi3k / akt pathways , as well as downregulation of nf-b and stat3 activities . in animal models , habib et al . showed that ginger extract inhibits liver carcinogenesis in wistar rat through the downregulation of elevated nf-b and tnf-. thus , ginger may act as an anticancer and anti - inflammatory agent , which could be helpful in prevention and treatment of liver cancer . besides these , ginger ingredients inhibit the development of diethylnitrosamine- ( den- ) induced premalignant phenotype in rat hepatocarcinogenesis . it has been found that long - term administration of ginger extract prevented the decrease in hepatic content of metallothionein and endostatin and the increase in the growth factors induced by the carcinogen in wistar albino rats . another study showed that 6-shogaol induces apoptosis in human hepatocellular carcinoma cells through caspase activation and er stress signaling by regulating unfolded protein response ( upr ) sensor perk and its downstream target eif2. in mouse smmc-7721 xenograft model , 6-shogaol inhibited tumor growth by the activation of caspase-3 and inactivation of eif2 . thus , perk / eif2 pathway plays an important role in 6-shogaol - mediated er stress and antitumorigenesis . the inhibition of cyp enzymes by ginger extract was more than its active components , gingerols . zerumbone was also reported to induce phase ii detoxification enzymes in cultured rat normal liver epithelial cell line . in addition , it induces glutathione s - transferase in rl34 cells and it exhibits antioxidant effects by inducing nuclear localization of the transcription factor , nuclear factor- ( erythroid - derived 2 ) like 2 ( nrf2 ) that binds to antioxidant response element ( are ) of the phase ii enzyme genes . thus , authors concluded that zerumbone acts as a potential activator of the nrf2/are - dependent detoxification pathway that provides a new insight into cancer prevention . zerumbone has also shown to exert antitumorigenic effect in rat liver induced by den and 2-acetylaminofluorene . this antihepatocarcinogenic effect of zerumbone was found to be associated with suppression of pcna and inhibition of a number of apoptotic liver cells by increased bax and decreased bcl-2 protein expression . numerous in vitro studies showed that ginger and its active components inhibit growth and proliferation of colorectal cancer cells . in a study , 6-gingerol inhibited growth of colon cancer hct116 cells . the suppression of tumor growth was found to be linked with the inhibition of leukotriene a4 hydrolase activity , which was further confirmed by in silico approach . besides these , various other mechanisms were reported to be involved in 6-gingerol - induced cell growth inhibition and apoptosis in human colorectal cancer cells . these include protein degradation as well as downregulation of cyclin d1 , nag-1 beta - catenin , pkcepsilon , and gsk-3 pathways . radhakrishnan et al . reported that the anticancer activity of 6-gingerol could be associated with the inhibition of erk1/2/jnk / ap-1 pathway . administration of ginger extract to the mice pretreated with carcinogen 1,2-dimethylhydrazine ( dmh ) inhibited the levels of fecal bile acids , neutral sterols , tissue cholesterol , hmg coa reductase , free fatty acids , triglycerides , phospholipase a , and phospholipase c . thus , ginger supplementation reduced the risk of colon cancer markedly by virtue of its hypolipidemic and antioxidative effects . ginger extract not only inhibits carcinogenesis of colorectal cancer cells but also enhances the anticancer effects of chemotherapeutic drug 5-fluorouracil . it has also shown that ginger extract synergistically increases the apoptotic efficacy of gelam honey . as in vitro , 6-gingerol effectively suppresses tumor growth in nude mice . for improving the colon cancer therapeutic efficiency of ginger extract , a multiparticulate system ( ginger extract loaded with coated alginate beads ) has been designed . preclinical evaluation against dmh - induced colon cancer in male wistar rats showed that this bead has significantly better recession of the cancers compared to free ginger extract . cysteine - conjugated shogaols have also been reported to cause death of colon cancer cells through the activation of the mitochondrial apoptotic pathway . it has been observed that treatment of sw480 colon cancer cells with hexahydrocurcumin ( 100 m ) resulted in apoptosis , indicating its potential as anticancer agent . besides ginger rhizome , exposure of ginger leaf extract exhibited reduced cell viability and induced apoptosis to human colorectal cancer hct116 , sw480 , and lovo cells . this anticancer activity of ginger leaf extract was attributed to the increased expression of atf3 through erk1/2 activation in human colorectal cancer cells . another compound zerumbone , a sesquiterpene from the edible ginger ( zingiber zerumbet smith ) , has been shown to enhance the radiosensitivity of colon cancer cells . it enhanced radiation - induced dna damage and inhibited nuclear expression of dna repair proteins ataxia - telangiectasia mutated ( atm ) and dna - pkcs . upregulation of mdr1 and mrp3 genes was also observed by the exposure to ginger extract . intragastric treatment of ginger increases survival time and rate of animals bearing carcinogen - induced tumors . in nude mouse xenograft model bearing cholangiocarcinoma tumor , ginger extract also inhibited growth of tumor and exhibited anticarcinogenic property . thus , ginger can be considered as one of the promising chemotherapeutics agents for the treatment of cholangiocarcinoma . besides preclinical studies , clinical studies revealed that ginger has potential for the prevention and treatment of different gi related disorders ( table 3 ) . study in human subjects showed that ginger delays the nausea which is stimulated during chemotherapy . in this clinical study , patients with cancer receiving chemotherapy were given normal diet , protein drink with ginger , and additional high protein with ginger twice daily . they found that protein meals with ginger reduced and delayed nausea due to chemotherapy and reduced the use of antiemetic medications . in a randomized clinical study 20 subjects at increased risk for colorectal cancer were included and the patients were given 2.0 g / days ginger or placebo for 28 days . colon biopsies were obtained to determine the levels of prostaglandin ( pge)-2 , leukotriene b4 ( ltb4 ) , 13-hydroxy - octadecadienoic acids , and 5- , 12- , and 15-hydroxyeicosatetraenoic acids . they found that although ginger did not decrease eicosanoid levels in people at increased risk for colorectal cancer , however , it was both tolerable and safe . earlier in a phase ii study , zick et al . have shown no significant difference in eicosanoids level in 30 people at normal risk for colorectal cancer . however , they found a significant decrease in pge2 and 5-hydroxyeicosatetraenoic acid ( hete ) and a trend toward significant decrease in 12-hete and 15-hete normalized to free arachidonic acid . another study on 66 colorectal cancer patients receiving chemotherapy has shown that massage with ginger and coconut oil improved cellular immunity of these patients . it also decreased fatigue , presenting symptom , pain , and stress in cancer patients . in another pilot , randomized control trial with 20 patients at increased risk for colorectal cancer , ginger ( 2 g for 28 days ) supplementation was also found to reduce the proliferation of normal - appearing colorectal epithelium and increased apoptosis and differentiation of the crypts . this beneficial effect of ginger was found to be associated with downregulation of bax , human telomerase reverse transcriptase ( htert ) , and mib-1 , while p21 and bcl-2 expression remained relatively unchanged . ginger has been reported to have anti - inflammatory activities as observed in a study with 30 normal participants and 20 participants at increased risk for colorectal cancer . it has been observed that ginger significantly lowers cox-1 protein expression in participants at increased risk for colorectal cancer but not in the participants at normal risk . however , ginger did not alter 15- hydroxyprostaglandin dehydrogenase ( pgdh ) protein expression in either increased or normal - risk participants . ginger and its components have been shown to modulate a wide range of signaling molecules ( figure 3 ) . ginger may upregulate or downregulate the gene expressions , depending on the target and cellular context . component of asian ginger oil also targets to increase the phase ii detoxification enzymes as well as nuclear localization of nrf2/are . a number of targets of ginger and its components have been documented in different cancer models . these include transcription factors , enzymes , inflammatory mediators , protein kinases , drug resistance proteins , adhesion molecules , growth factors receptors , cell - cycle regulatory proteins , cell - survival proteins , chemokines , and chemokine receptors . in different gi cancers , ginger extract inhibits transcription factor nf-b , inflammatory cytokine tnf- and other enzymes and proteins , which include xanthine oxidase and myeloperoxidase , mda , hmg coa reductase , free fatty acids , triglycerides , phospholipase a , and phospholipase c. the active ingredient of ginger , particularly , 6-gingerol and 6-shogaol targets several cellular molecules that contribute to tumorigenesis , cell survival , cell proliferation , invasion , and angiogenesis . 6-gingerol modulates nf-b , stat3 , rb , mapk , pi3k , akt , erk , ciap1 , cyclin a , cdk , cathepsin d , and caspase-3/7 . similarly , shogaol targets nf-b , stat3 , mapk , pi3k / akt ca signals , cox-2 , cyclin d1 , survivin , ciap-1 , xiap , bcl-2 , mmp-9 , caspase activation , er stress , and eif2. besides these , asian ginger component zerumbone modulates nf-b , p53 vegf , p21 , and cxcr4 expression . thus these molecular targets of ginger components indicate that it may have the potential for preventing and treating the gi cancer . although the medicinal properties of ginger have been known for thousands of years , a significant number of in vitro , in vivo , and epidemiological studies further provide substantial evidence that ginger and its active compounds are effective against wide variety of human diseases including gi cancer . ginger has been found to be effective against various gi cancers such as gastric cancer , pancreatic cancer , liver cancer , colorectal cancer , and cholangiocarcinoma . however , its anticancer effects on other gi cancers like duodenal , esophageal , anal , gi carcinoid tumor and pancreatic islet cell cancer have yet not been established . ginger and its polyphenols have been shown to target multiple signaling molecules that provide a basis for its use against multifactorial human diseases . moreover , most of the known activities of ginger components are based only on in vitro and in vivo studies , except for a few clinical studies in human subjects . therefore , more extensive and well - controlled human studies are required to demonstrate its efficacy as an anticancer agent , as it is a safe and cost - effective alternative .

gastrointestinal ( gi ) cancer , a cancer of different organs of the digestive system , is one of the most common cancers around the world . the incidence and death rate of some of these cancers are very high . although a large variety of chemotherapeutic agents have been introduced since the last few decades to combat gi cancer , most of them are very expensive and have side effects . therefore , the compounds derived from natural sources , which are considered to be safe and cost effective , are needed . ginger ( zingiber officinale ) is one of the most widely used natural products consumed as a spice and medicine for treating nausea , dysentery , heartburn , flatulence , diarrhea , loss of appetite , infections , cough , and bronchitis . experimental studies showed that ginger and its active components including 6-gingerol and 6-shogaol exert anticancer activities against gi cancer . the anticancer activity of ginger is attributed to its ability to modulate several signaling molecules like nf-b , stat3 , mapk , pi3k , erk1/2 , akt , tnf- , cox-2 , cyclin d1 , cdk , mmp-9 , survivin , ciap-1 , xiap , bcl-2 , caspases , and other cell growth regulatory proteins . in this review , the evidences for the chemopreventive and chemotherapeutic potential of ginger extract and its active components using in vitro , animal models , and patients have been described .

You are an expert at summarizing long articles. Proceed to summarize the following text: multiple sclerosis ( ms ) is the most common disabling neurological condition for young adults and adolescents in the united states . approximately 400,000 americans have ms , and every week about 200 people are diagnosed with the disease . while the results of the existing burden - of - illness studies conducted for ms in the united states vary according to the data sources used , they all report substantial economic impacts of ms , both to the individual and to the nation . the cost of each ms relapse has been reported to be approximately $ 12,870 . the average cost of ms for the individual patient , each year , is anywhere from $ 12,879 ( 2004 usd ) to $ 34,000 ( 1994 usd ) . these figures translate to a national cost of $ 5.2 billion ( $ 12,879 400,000 americans diagnosed with ms ) to $ 6.8 billion ( based on prevalence figures used by the authors of , annually . while ms is incurable , food and drug administration- ( fda- ) approved disease - modifying therapies ( dmts ) have been shown to reduce the rate of relapse and to slow disease progression [ 7 , 8 ] lack of medication adherence has been shown to be associated with increased patient morbidity , poorer quality of life , and increased financial strain on health care institutions . in addition , research has also shown that adherence is generally suboptimal among patients with ms [ 1013 ] . one factor that has been shown to negatively impact adherence among patients with ms is the presence of comorbid depression [ 10 , 13 ] . this factor may affect a large portion of the ms population , since depression is common among individuals with ms . research has shown that up to one - half of all ms patients [ 14 , 15 ] have comorbid depression , and that the prevalence of this comorbidity is three - times the rate of major depression and psychiatric comorbidity in community - based samples and greater than the rate of depression among patients with other neurological disorders . given the potential impact of depression on ms adherence as well as the relatively large prevalence of this comorbidity , this analysis was designed to quantify the impact of comorbid depression and antidepressant therapy on adherence to disease - modifying therapy ( dmt ) for ms . given the previous literature reporting a connection between mood disorders and adherence among patients with ms , we hypothesized that a diagnosis of comorbid depression would have a negative impact on adherence . in addition , we examined the impact of receipt of antidepressant therapy on adherence to ms adherence . in so doing , the analysis quantifies the association between comorbid depression , receipt of antidepressants , and adherence to ms therapy . the medstat marketscan commercial claims and encounters ( ccae ) and medicare ( mdcr ) databases provided the data for these analyses , which focused exclusively on data from january 1 , 2004 through march 25 , 2009 . these retrospective insurance claims databases include private sector health data from approximately 100 payers and contain data on clinical utilization , expenditures , and enrollment across inpatient , outpatient , prescription drug , and carve - out services . the deidentified databases are fully health insurance portability and accountability act ( hipaa ) compliant and link paid claims and encounter data to detailed patient information across sites and types of providers over time . to be considered for inclusion in the study , patients had to have received at least one diagnosis of ms ( icd-9-cm code of 340.xx ) and a disease modifying therapy ( dmt ) , with the first such receipt in the date window identified as the index date and the initial dmt received identified as the intent - to - treat ( itt ) medication . patients were excluded if they were diagnosed with pregnancy ( icd-9-cm code of 630.xx-676.xx , v22.2x , or v22.3x ) over the time period from 6 months prior to the index date ( i.e. , the pre - period ) through 12 months after index date ( i.e. , the postperiod ) . finally , patients were required to have continuous insurance coverage from the start of the pre - period through the end of the post - period . given the above cohort of individuals , the group was then subdivided into patients who had neither a diagnosis of depression nor the receipt of an antidepressant in the pre - period ( i.e. , ms only ) and those who were identified with comorbid depression ( i.e. , ms & depression ) . to be identified as having depression in the 6 month pre - period , patients were required to receive 2 or more outpatient or 1 or more inpatient diagnoses of depression ( icd-9-cm of 296.2x , 296.3x , or 311.xx ) , or 1 or more diagnoses of depression and 1 or more filled prescriptions for an antidepressant . for patients who did not receive an antidepressant , the requirement of one inpatient diagnosis or two outpatient diagnoses of depression was utilized to insure that a patient was diagnosed with depression and not simply screened for depression . furthermore , such an algorithm is commonly used to identify diagnoses in retrospective databases [ 17 , 18 ] . there were 4,479 individuals diagnosed with ms who had no evidence of depression ( ms only ) and 448 individuals identified as having ms and comorbid depression ( ms & depression ) . of the 448 individuals with ms and depression , 379 individuals received at least one prescription for an antidepressant . one group consisted of a matched group of patients with ms only to those with ms and depression , where patients were matched 1 : 1 without replacement based upon age , sex , region of residence , year of index date , and intent - to - treat medication . this matching resulted in a successful match rate of 97% and a final sample of 876 individuals : 436 individuals with ms and depression and 436 individuals with ms only . in addition to examining patients with ms only to those with ms and depression , we also examined adherence by comparing patients who were diagnosed with depression but did not receive an antidepressant ( n = 59 ) to those diagnosed with depression who did receive an antidepressant ( n = 359 ) . these two groups were matched 1 : 1 without replacement using the same factors used to match the ms only group to the ms & depression group . this process resulted in a final sample of 76 individuals : 38 individuals with a diagnosis of depression and no receipt of an antidepressant and 38 individuals who were both diagnosed with depression and filled at least one prescription for an antidepressant . the third group compared patients who received an antidepressant based upon adherence to treatment guidelines for use of antidepressants . specifically , patients were divided based upon receipt of at least a 6-month supply of antidepressants . again , the two cohorts were matched 1 : 1 without replacement , with a final sample of 142 individuals : 71 treated according to guidelines , and 71 who received less than 6 months of antidepressants . while adherence generally measures the extent to which a patient acts in accordance with the prescribed interval and dose of a dosing regimen , such information is not typically available in a retrospective claims database . as such , adherence is ... operationalized in retrospective assessments as the number of doses dispensed in relation to the dispensing period , often called the medication possession ratio ( mpr ) . this variable is measured as the percentage of days the itt medication was available to the patient based on prescription fill dates over the 1-year post - period , and is a common proxy for adherence when examining retrospective data [ 6 , 21 , 22 ] . as a test of the robustness of results , we also considered an alternative proxy for adherence . specifically , for each patient the variable proportion of days covered ( pdc ) was also constructed . the pdc , like the mpr , is a measure of the percentage of days a person received their itt drug over the year after index date . however , in contrast to the mpr , the pdc does not allow for prescriptions to overlap . as a result , the pdc , unlike the mpr , will always have an upper bound of 1 . the results reported here are not sensitive to this alternative specification and hence , results where pdc was used as the dependent variable were not reported . it should be noted , however , that neither the mpr nor pdc can measure whether an individual took a prescription once filled , whether an individual filled a prescription that was written by their physician , or whether the individual stopped their itt medication on or against physician advice . multivariate regressions were used to examine the impact of comorbid depression as well as medical treatment for depression on the likelihood of a patient being adherent to their ms itt dmt . specifically , ordinary least squares regressions were used to examine the impact of depression on mpr when mpr was measured as a continuous variables , while logistic models were used to examine the association of depression on the probability of achieving an mpr threshold of at least 80% [ 24 , 25 ] . in multivariate models it was hypothesized that , in addition to the factors that groups were matched on ( age , sex , region of residence , itt dmt therapy , and year of index date ) , other patient characteristics might also affect adherence . specifically , these analyses also examined the association between patient insurance status , characteristics of itt medication , patient general health , and patient disability level and adherence to itt dmt . characteristics of the itt medication that were examined were the amount of copayment the individual was responsible for as well as whether the itt medication was delivered via mail order . it was hypothesized that patients required to make a copayment for their medication may be less adherent to their medication regimen while mail order delivery may be associated with ease of use , and therefore may be associated with improved adherence . patient general health status was proxied by the charlson comorbidity index ( cci ) [ 26 , 27 ] . this measure , which is well validated as an algorithm for predicting hospital mortality and is often used in retrospective database analyses , is constructed of a weighted average based upon the receipt of diagnostic codes associated with 17 medical conditions . examples of conditions included in the cci include renal disease , myocardial infarction , malignancy , liver disease , cerebrovascular disease , congestive heart failure , dementia , and diabetes . finally , patient level of disability was proxied by the presence of musculoskeletal or medical disabilities . these disabilities were proxied by examining the presence of diagnoses for secondary conditions associated with muculoskeletal or medical disabilities , and prior research has shown that these proxies are associated with both the presence and severity of disabilities . as expected , in all cases , groups were identical in terms of the matching variables age , sex , region of residence , itt dmt , and year of index date . when comparing the ms only group to patients with ms and depression ( table 1 ) , results revealed that patients diagnosed with comorbid depression were significantly less likely to be insured via point - of - service insurance ( 13.30% versus 22.71% ; p < 0.01 ) , but significantly more likely to be insured via a preferred provider organization ( 51.83% versus 43.81% ; p = 0.02 ) or to have other insurance ( 4.36% versus 1.83% ; p = 0.03 ) . in addition , patients with comorbid depression were less likely to have a copayment associated with their index itt medication prescription ( 77.98% versus 84.86% ; p = 0.01 ) . comparing patients with ms only to those with ms and depression revealed significant differences in both general health and functional limitations between the two groups , with patients with comorbid depression generally in poorer health . for example , patients diagnosed with comorbid depression were less likely to have a charlson score of 0 ( 62.18% versus 75.92% ; p < 0.01 ) and more likely to have a charlson score of 1 - 2 ( 30.28% versus 21.33% ; p < 0.01 ) or 3 or more ( 7.57% versus 2.75% ; p < 0.01 ) . similarly , patients with comorbid depression were significantly more likely to be diagnosed with a musculoskeletal limitation ( 60.09% versus 41.51% ; p < 0.01 ) or medical limitation ( 48.17% versus 31.42% ; p < 0.01 ) . in contrast to the comparison of patients with ms only to those with ms and depression , comparisons between patients with ms and comorbid depression treated and untreated with antidepressants revealed few differences . for example , table 2 compared patients diagnosed with depression who did not receive an antidepressant to those patients who were both diagnosed with depression and received at least one prescription for an antidepressant . there were no statistically significant differences found among these two groups when comparing insurance status , copayment or mail order status , cci , or disability proxies ( table 2 ) . similarly , comparing patients who received at least 6 months of an antidepressant to individuals who received less than 6 months of an antidepressant ( table 3 ) revealed few differences between the two groups . table 4 shows the results of the ordinary least squares regression models that examine the association between comorbid depression and patient adherence to itt dmt for ms . comparing patients with ms only to those with ms and depression , results indicate that , after controlling for patient insurance type , characteristics of initial dmt dispensed , patient general health , and functional limitations , patients with comorbid depression had a 10% lower mpr score than those without comorbid depression ( coefficient = 0.10 ; p < 0.01 ) . results also reveal that patients with health - maintenance insurance , compared to those with a preferred provider organization had significantly lower medication adherence ( coefficient = 0.10 ; p = 0.02 ) while patients who had a copayment associated with their itt dmt had significantly higher medication adherence ( coefficient = 0.06 ; p = 0.05 ) . comparing patients diagnosed with depression but untreated to those both diagnosed and treated with an antidepressant revealed no significant association between treatment for depression with antidepressants and patient adherence to their ms therapy ( coefficient = 0.07 ; p = 0.52 ) . however , patients treated with an antidepressant for at least 6 months compared to those treated for less than 6 months have , on average , a 12-point higher mpr ( coefficient = 0.12 ; p = 0.05 ) after controlling for insurance type , characteristics of initial dmt dispensed , and patient general health and functional limitation . in addition to examining the impact of depression on mpr levels , figure 2 examines how comorbid depression affects the probability of achieving a threshold of at least 80% . these results are generally consistent with the results from the ordinary least squares regression which examine mpr as a continuous variable . specifically , results from these multivariate logistic models indicate that patients who were depressed ( based upon either diagnosis or diagnosis and receipt of antidepressant ) were 45% less likely to achieve an mpr threshold of 80% ( odds ratio ( or ) 0.55 ; 95% confidence interval ( ci ) 0.420.74 ) . an examination of the subset of patients with both ms and depression revealed that those treated with an antidepressant , irrespective of length of treatment , had no significant difference in the likelihood of achieving an mpr threshold of 80% ( or = 1.32 ; 95% ci 0.503.48 ) . however , those treated with an antidepressant for at least 6 months were twice as likely to reach an mpr threshold of 80% with their dmt , compared to those treated with an antidepressant for less than 6 months ( or = 2.17 ; 95% ci 1.074.39 ) . as a test of the robustness of the results , alternative specifications were also examined . first , we constructed an alternative model that allowed for patient age , sex , region of residence , and itt medication to be explicitly included in the multivariate analyses . second , as discussed above , adherence was also proxied by the proportion of days covered . third , to examine the impact of the relatively small sample when comparing those patients diagnosed with depression but untreated to those diagnosed with depression who received an antidepressant , the analysis also examined this subgroup without the reduction of sample size that is the result of matching the two cohorts ; none of these modifications resulted in any significant changes in the results reported . focused on a population consisting entirely of patients with ms , this analysis was designed to determine the impact of comorbid depression on adherence to dmt . this study also sought to determine the impact of antidepressant therapy on adherence to dmt among patients with ms and comorbid depression . first , patients diagnosed with comorbid depression were sicker than those without comorbid depression , as indicated by their likelihood of a higher score on the charlson comorbidity index ( see table 1 ) , as well as their greater likelihood of having a musculoskeletal limitation ( 60.09% versus 41.51% ; p < 0.01 ) or any medical limitation ( 48.17% versus 31.42% ; p < 0.01 ) . this association between comorbid depression and a larger burden of illness is consistent with research on other disease states , research which has shown that patients with diabetes and comorbid depression have more complications relative to diabetic patients without depression and that heart disease patients with comorbid depression have greater morbidity and mortality relative to their counterparts without depression [ 3137 ] . second , patients with ms and comorbid depression had , on average , a 10-point lower mpr and were approximately half ( 45% ) as likely to reach a threshold mpr level of 80% relative to the matched cohort with ms without depression . the strong association between depression and difficulty with adherence was expected and was consistent with the findings of earlier research conducted among patients with ms [ 10 , 13 ] . it also was consistent with research showing the negative effect of comorbid depression on adherence to therapy for other diseases , including hypertension , diabetes [ 10 , 11 ] , and heart disease [ 39 , 40 ] . while previous research among patients with ms has shown comorbid depression to be associated with adherence difficulties [ 10 , 13 ] , our research expands the literature by quantifying the adherence gap between those ms patients with comorbid depression compared to those without depression . third , results from this analysis revealed no significant difference in adherence to dmt therapy when comparing patients diagnosed with depression that were not treated with an antidepressant to those both diagnosed and treated for depression . however , among patients with comorbid depression , those who received at least a 6-month supply of antidepressants had , on average , a 10-point higher mpr and were more than twice as likely to reach an mpr threshold of 80% relative to those who filled their antidepressant medication prescription for less than a 6-month period . significantly , in our study , merely having a prescription for an antidepressant had no significant impact on dmt adherence . instead , the positive impact of antidepressant therapy on dmt adherence was observed only among patients whose antidepressant therapy extended for at least 6 months . this finding supports previous research conducted among patients diagnosed with diabetes , which showed that antidepressant therapy improved adherence to diabetes treatment and medical outcomes . however , caution must be taken when interpreting this finding since results are also consistent with the hypothesis that patients who are adherent to their antidepressant therapy are generally more compliant at taking their medications and hence , more likely to be adherent to their dmt as well . as with any research , the findings presented here should be interpreted within the context of the limitations of the study design . first , this analysis was conducted using an administrative claims database and included only patients with medical and outpatient prescription drug benefit coverage . second , it is less rigorous to rely upon diagnostic codes rather than formal diagnostic assessment for identifying patients or for measuring patient general health and functional limitations . for example , our reliance on diagnostic claims and the criteria utilized for identifying patients with depression resulted in approximately 6% of our ms cohort with comorbid depression while previous research has shown that up to 50% of ms patients experience comorbid depression [ 14 , 15 ] . such measures are unable to identify actual drug - taking behavior or patient adherence to filling written prescriptions . fourth , the database was unable to capture other information , such as patient personality type , caregiver support , and type of ms , that may also impact outcomes . finally , this study focuses on a subset of individuals who were diagnosed with depression prior to receipt of a dmt for ms . the results , therefore , may not apply to individuals who are diagnosed with depression subsequent to initiation on treatment for ms . in conclusion , this study indicates that those with ms and comorbid depression are sicker and approximately only half as likely to be adherent to their disease - modifying therapy relative to patients with ms without comorbid depression . this analysis also shows were no significant difference in dmt adherence when comparing patients diagnosed with depression but not treated with an antidepressant to those both diagnosed and treated for depression . however , those with ms and comorbid depression who take antidepressants for at least 6 months are more than twice as likely to be adherent to their dmt relative to those with ms and comorbid depression who do not remain on antidepressant therapy for at least 6 months . future work should focus on examining these results with alternative data sources and improving our understanding of the relationship between adherence to antidepressant therapy and adherence to dmt .

objective . examine the impact of comorbid depression on adherence to disease - modifying therapy ( dmt ) for multiple sclerosis ( ms ) . methods . a retrospective database was used to identify patients with ms treated with a dmt . patients with ms and comorbid depression were matched to patients with ms only . adherence to dmt was proxied by the medication possession ratio ( mpr ) and multivariate regressions were used to examine the association between comorbid depression and adherence to dmt . results . patients with comorbid depression had a 10 point lower mpr ( p < 0.01 ) and were less likely to achieve a mpr of at least 80% ( odds ratio ( or ) = 0.55 ; 95% confidence interval ( ci ) 0.420.74 ) than those without depression . while treatment with an antidepressant generally had no significant impact on the likelihood of achieving an mpr threshold of 80% ( or = 1.32 ; 95% ci 0.503.48 ) , adherence to antidepressant therapy guidelines were associated with improved adherence to dmt therapy . conclusions . ms patients with comorbid depression were approximately half as likely to be adherent to their dmt relative to patients with ms without depression . although treatment with antidepressant therapy generally did not improve the likelihood of adherence , treatment with antidepressants for at least 6 months was associated with better adherence to dmt .

You are an expert at summarizing long articles. Proceed to summarize the following text: nevoid basal cell carcinoma syndrome ( nbcss ) , also known as basal cell nevus syndrome ( bcns ) or gorlin syndrome1 , is autosomal dominantly inherited and related to chromosome 9q22.3-q31 , with various clinical appearances2 . basal cell carcinomas of the skin or basal cell nevi , multiple keratocystic odontogenic tumors ( kcots ) in the jaw , rib and vertebral anomalies , and calcification of the skull are the major symptoms of nbccs and minor symptoms , such as frontal bone and parietal bone protrusion , hypertelorism , cleft lip , and cleft palate , are also occasionally seen3 . based on these clinical and radiographic symptoms , evans et al.4 reported that diagnosis of nbccs can be made when two out of five major criteria , or one major and two out of six minor criteria , are met . major criteria include ( 1 ) basal cell carcinoma , ( 2 ) kcot , ( 3 ) palmar or plantar pits , ( 4 ) ectopic calcification , and ( 5 ) family history of nbccs . minor criteria include ( 1 ) skeletal anomaly , ( 2 ) macrocephaly , ( 3 ) cardiac or ovarian fibroma , ( 4 ) medulloblastoma , ( 5 ) lymphomesenteric cyst , and ( 6 ) congenital malformation . this case report presents a 14-year - old female patient with a chief complaint of a cyst found in the maxilla and mandible . the patient was diagnosed with nbccs , and following treatment of marsupialization and enucleation , the clinical results were satisfactory . a 14-year - old female patient was referred with a chief complaint of a cyst in the maxillary sinus and mandible . the eruption - delayed right mandibular second molar had partially erupted and showed a negative response for electric pulp test . a well - defined , translucent , cystic lesion in the left maxillary sinus , as well as a cyst from the right mandibular second molar to the right mandibular ramus , was seen in the panoramic radiograph.(fig . 1 ) after a biopsy of the maxillary and mandibular cysts and the insertion of a foley catheter for decompression , an impression was taken , and an individual obturator was fabricated . 3 ) calcification of the falx cerebri was observed in the skull pa and water 's radiograph . based on the criteria of evans et al.4 , the patient was diagnosed with nbccs since 2 major criteria and 2 minor criteria were observed . the patient washed the lesion area by herself using saline twice a day and was seen for follow - up appointments every 2 months . after 7 months , the size of the right mandibular ramus cyst decreased by 46% compared to its initial examination , based on the panoramic radiograph.(fig . 6 ) computed tomography scans also showed a decrease in the size of the left maxillary sinus and right mandibular ramus cysts . based on these data , a decision was made that the lesion would no longer decrease in size , therefore a cyst enucleation was performed under general anesthesia . after 4 years of follow - up , no recurrence of the cyst in the right mandibular ramus was observed . two years after the initial examination , a new cystic lesion was found in the left premolar area . a cyst enucleation was performed under local anesthesia , and the cyst was diagnosed as a kcot based on the biopsy results . additionally , a recurrence of the cyst in the left maxillary sinus was found in the radiographic examination 2 years after the initial operation . a cyst enucleation was performed under general anesthesia , and the operation site is being checked in follow - up appointments every 6 months.(fig . since jarisch first described the many symptoms of nbccs in 1894 , gorlin and goltz5 grouped these symptoms into a single syndrome in 1960 and reported cyst in the jaw , skeletal anomaly , and multiple basal cell nevus as the three main symptoms . in 1993 , evans et al.4 suggested 5 major criteria and 6 minor criteria for the diagnosis of nbccs . if the patient satisfies two major criteria , or one major and two minor criteria , the patient should be diagnosed with nbccs . basal cell carcinoma is seen in 50% to 97% of nbccs patients and shows different incidence rates between races of 80% in caucasians8 , 38% in african - americans9 , and 15.2% in koreans10 . basal cell carcinoma can occur anywhere on the skin but is mainly found in the chest and cervicofacial areas due to exposure to sunlight11 . it may occur before puberty but mainly occurs between puberty and the age of 352 . it has been reported to sometimes change to an invasive lesion after puberty2 . in the current case , the patient was diagnosed with nbccs at the age of 14 and received periodic dermatological examinations over the next 4 years ( up to the current date ) , but no basal cell carcinoma was observed . rib anomalies , such as bifid rib , costal agenesis , and costal fusion , are common in nbccs due to skeletal anomalies , and scoliosis and polydactylism are also seen5 . in the case of rib anomalies , such as in this case , central nervous system disorders , such as mental retardation , congenital hydrocephalus , and rarely , epilepsy , have also been reported12 . also , hypertelorism , calcification of the ovaries , fibroma , cleft palate , and ophthalmic anomalies , such as strabismus and glaucoma , have been reported4 . kcots are found in 65% to 100% of nbccs patients and occur frequently in patients in their teens and twenties13 . this symptom occurs earlier than other symptoms of nbccs , so it serves as an opportunity to diagnosis nbccs , such as in this case . the postoperative recurrence rate of kcots in nbccs is 30% to 60%15 , which is higher than that of patients with only kcots . this is because of its genetic trait that causes new cysts to occur in basal cell layers . kcot occurs in multiple and the size of the epithelial cells is smaller and pseudo - benign cysts are more common16 . in this case , the kcot in the left maxillary sinus relapsed during follow - up , and a new kcot was found in the left maxillary premolar area during treatment . in the case of large cysts , size reduction through marsupialization and decompression followed by enucleation is helpful for the complete removal of the cyst and prevention of recurrence2 . because of the high recurrence rate of multiple kcots in the jaws of nbccs patients , early diagnosis , as well as clinical and radiographic follow - up , is necessary17 . since other medical problems exist with nbccs , in addition to the recurrence of kcots , multiple treatments by experts from other fields is required . also , genetic examination in terms of family history and follow - up is required , if possible .

nevoid basal cell carcinoma syndrome ( nbccs ) , also known as gorlin syndrome , is characterized by various embryological deformities and carcinoma formation . it is caused by ptchi gene mutations and is autosomal dominantly inherited . some of the main symptoms of nbccs are multiple basal cell carcinomas , multiple keratocystic odontogenic tumors ( kcots ) of the mandible , hyperkeratosis of the palmar and plantar , skeletal deformity , calcification of the falx cerebri , and facial defomity . recurrent kcot is the main symptom of nbccs and is present in approximately 90% of patients . in nbccs , kcots typically occur in multiples . kcots can be detected in patients under the age of 10 , and new and recurring cysts develop until approximately the age of 30 . the postoperation recurrence rate is approximately 60% . this case report presents a 14-year - old female patient with a chief complaint of a cyst found in the maxilla and mandible . the patient was diagnosed with nbccs , and following treatment of marsupialization and enucleation , the clinical results were satisfactory .

You are an expert at summarizing long articles. Proceed to summarize the following text: cases of more than 6,000 gas resected by endoscopy or surgery on file at the samsung medical center were examined between march 2008 and july 2010 . among the files examined , we identified only three cases of ga - fg characterized by well differentiated columnar cells mimicking fundic gland cells , notably chief cells . immunohistochemical staining of mucin ( muc ) 2 , muc5ac , muc6 , and cd10 was performed in three ga - fg cases using the bond - max ( leica microsystems , wetzlar , germany ) . paraffinized sections were incubated with the following primary monoclonal antibodies : anti - muc2 ( 1:200 , novocastra , newcastle , uk ) , anti - muc5ac ( 1:200 , novocastra ) , anti - muc6 ( 1:200 , novocastra ) , and anti - cd10 ( 1:100 , novocastra ) . pepsinogen - i and h / k - atpase were evaluated by immunohistochemistry performed at the department of human pathology , juntendo university school of medicine , tokyo , japan as described by ueyama et al.12 the expression of muc2 , muc5ac , muc6 , cd10 , pepsinogen - i , and h / k - atpase was evaluated as either positive or negative . staining was defined as positive when the percentage of positive cells was greater than 20% . they underwent endoscopic submucosal dissection ( esd ) , subtotal gastrectomy , and subtotal gastrectomy after esd . the lesions were located in the lower , upper , and middle third of the stomach . the tumors were small , with a diameter of 1.2 , 3.1 , and 3.6 cm . two cases had lesions that invaded the submucosal layer , and one case had lesions confined to the mucosa . lymph node metastasis was assessed in two of the three surgically resected cases and the result was negative ; it could not be assessed in one case due to esd . none of the patients died or showed signs of disease recurrence during the follow - up period . samples from all three cases were composed mainly of well differentiated adenocarcinoma with columnar cells mimicking fundic gland cells ( fig . although cytologic atypia was minimal , the atypical glands were variable in size and shape with anastomosing and endless glands . the tumor cells had a monomorphous appearance with centrally placed round and mildly atypical small nuclei . the cytoplasm of the tumor cells was pale gray to blue and basophilic , and resembled that of chief cells . at higher magnification , the nuclei were monotonous and slightly larger than those of normal fundic gland cells , and frequently contained small but prominent nucleoli . in two cases , tumor cells with coarse granular eosinophilic and round all three cases revealed only slight desmoplastic reaction . in the background mucosa of the tumor , intestinal metaplasia was observed in two cases and chronic gastritis was observed in one case . all three cases were positive for muc5ac , muc6 , pepsinogen - i and negative for muc2 and cd10 ( fig . 2 ) . unfortunately , all three cases showed non - specific staining for h / k atpase , which suggested that the staining results for this parietal cell differentiation marker were not reliable . the three cases in this study were of gastric mucin phenotype ( muc5ac+/muc6+/muc2-/cd10- ) with chief cell differentiation ( pepsinogen - i+ ) . cases of more than 6,000 gas resected by endoscopy or surgery on file at the samsung medical center were examined between march 2008 and july 2010 . among the files examined , we identified only three cases of ga - fg characterized by well differentiated columnar cells mimicking fundic gland cells , notably chief cells . immunohistochemical staining of mucin ( muc ) 2 , muc5ac , muc6 , and cd10 was performed in three ga - fg cases using the bond - max ( leica microsystems , wetzlar , germany ) . paraffinized sections were incubated with the following primary monoclonal antibodies : anti - muc2 ( 1:200 , novocastra , newcastle , uk ) , anti - muc5ac ( 1:200 , novocastra ) , anti - muc6 ( 1:200 , novocastra ) , and anti - cd10 ( 1:100 , novocastra ) . pepsinogen - i and h / k - atpase were evaluated by immunohistochemistry performed at the department of human pathology , juntendo university school of medicine , tokyo , japan as described by ueyama et al.12 the expression of muc2 , muc5ac , muc6 , cd10 , pepsinogen - i , and h / k - atpase was evaluated as either positive or negative . staining was defined as positive when the percentage of positive cells was greater than 20% . they underwent endoscopic submucosal dissection ( esd ) , subtotal gastrectomy , and subtotal gastrectomy after esd . the lesions were located in the lower , upper , and middle third of the stomach . the tumors were small , with a diameter of 1.2 , 3.1 , and 3.6 cm . two cases had lesions that invaded the submucosal layer , and one case had lesions confined to the mucosa . lymph node metastasis was assessed in two of the three surgically resected cases and the result was negative ; it could not be assessed in one case due to esd . none of the patients died or showed signs of disease recurrence during the follow - up period . samples from all three cases were composed mainly of well differentiated adenocarcinoma with columnar cells mimicking fundic gland cells ( fig . although cytologic atypia was minimal , the atypical glands were variable in size and shape with anastomosing and endless glands . the tumor cells had a monomorphous appearance with centrally placed round and mildly atypical small nuclei . the cytoplasm of the tumor cells was pale gray to blue and basophilic , and resembled that of chief cells . at higher magnification , the nuclei were monotonous and slightly larger than those of normal fundic gland cells , and frequently contained small but prominent nucleoli . in two cases , tumor cells with coarse granular eosinophilic and round all three cases revealed only slight desmoplastic reaction . in the background mucosa of the tumor , intestinal metaplasia was observed in two cases and chronic gastritis was observed in one case . all three cases were positive for muc5ac , muc6 , pepsinogen - i and negative for muc2 and cd10 ( fig . 2 ) . unfortunately , all three cases showed non - specific staining for h / k atpase , which suggested that the staining results for this parietal cell differentiation marker were not reliable . the three cases in this study were of gastric mucin phenotype ( muc5ac+/muc6+/muc2-/cd10- ) with chief cell differentiation ( pepsinogen - i+ ) . however , it has distinct clinicopathological characteristics , especially in terms of tumor location , histologic features , phenotypic expression , and low - grade malignancy.12 histologically , ga - fg is well - differentiated adenocarcinoma mainly composed of cells resembling chief cells and is classified into chief cell predominant type , parietal cell predominant type , and mixed type . ueyama et al.12 first reported 10 cases of ga - fg with chief cell differentiation , some of which revealed only focal positivity of h / k atpase . in the present study , we describe three cases of ga - fg among koreans for the first time , with clinicopathologic features , cell differentiation , and biologic behaviors . in the previous study , ga - fg typically showed expression of pepsinogen - i and h / k atpase.12 there are two immunologically distinct types of pepsinogen . pepsinogen - i is produced only by chief and mucus neck cells in the fundic glands , whereas pepsinogen - ii is produced by the aforementioned cells , the glands in the cardia , and the pyloric glands in the antrum.13,14 pepsinogen - i expression was observed in all three cases , supporting differentiation into chief cells , which are a component of the fundic gland . this enzyme is mainly located near cell surface membranes and in the membranes of intracytoplasmic canaliculi . therefore , h / k atpase is considered a marker for parietal cell differentiation.8 in the present study , tumor cells were negative for h / k atpase . however , since an antibody against h / k atpase has not yet been commercialized , the staining was performed manually with an antibody produced by the ueyama laboratory . because of non - specific staining with this antibody , results from the h / k atpase stain presented here are not reliable . in this study , as tumor cells resembled parietal cells upon hematoxylin and eosin staining , we concluded that parietal cell differentiation also occurred focally . however , as most tumors were composed mainly of chief cells , and there were only a few scattered parietal cells , our cases were classified as ga - fg with chief cell differentiation type , and these findings are consistent with the previously reported 10 cases by ueyama et al.12 for ga - fg , differential diagnoses include fundic gland polyp , dysplasia in fundic gland polyp , carcinoid tumor , and glandular cystic profunda . although they are composed of fundic gland cells , glandular structures and nuclear features can help to rule out other tumors.15,16 in our cases , additional immunohistochemical staining for chromogranin and synaptophysin was negative and could help confirm the diagnosis . in the present case series , all three tumors were small in size and were discovered in the early stages . neither lymphatic nor venous invasion was identified in any of the three cases . the previously reported 10 ga - fg cases have been said to have a favorable prognosis.12 similarly , all three of the cases in the present study were shown to have early gastric carcinoma and therefore the prognosis for these patients should also be good . however , further investigation on the prognosis of this group of tumors is needed . it is likely that the molecular pathway of ga - fg may be different from that of conventional ga . however , further research will be needed to better understand the molecular mechanisms underlying ga - fg . in conclusion , ga - fg is very rare and has distinct characteristics that separate it from usual ga by their unique histologic findings , mucin phenotypes , and early stage . to our knowledge

recently , fundic gland type gastric adenocarcinoma ( ga - fg ) has been reported as a new entity . this report describes ga - fg among koreans for the first time . from march 2008 to july 2010 we identified only three cases of ga - fg out of over 6,000 gas resected by endoscopy or surgery . cell differentiation by mucin proteins , pepsinogen - i , and h+/k+-atpase was evaluated . all three cases were male patients and diagnosed as early stage ga . histologically , ga - fgs were well - differentiated adenocarcinoma with pale gray - blue , basophilic columnar or cuboidal cells and mildly enlarged nuclei , resembling chief cells . all three cases were positive for pepsinogen - i and were classified as gastric mucin phenotype . among three histologic subtypes of ga - fg , since tumors were mainly composed of chief cells , our three cases were classified as chief cell predominant type . in conclusion , ga - fg is very rare among koreans and pepsinogen - i and muc6 expression are typical immunohistochemical findings in ga - fg suggesting differentiation toward fundic glands .

You are an expert at summarizing long articles. Proceed to summarize the following text: schistosomiasis has afflicted humans for thousands of years and is now the second most socioeconomically devastating parasitic disease worldwide , affecting over 240 million people in 77 countries on 5 continents and killing an estimated 300,000 people annually in sub - saharan africa alone , . the three main species of schistosoma ( digenetic blood trematode flatworms ) infecting humans are schistosoma haematobium , schistosoma mansoni , and schistosoma japonicum . schistosoma mansoni and s. haematobium are endemic across much of africa and the middle east , often in overlapping geographic distributions . two other species , schistosoma mekongi and schistosoma intercalatum , are more geographically restricted with s. mekongi found very focally in southeast asia and s. intercalatum found mainly in central west africa , . infection by schistosomes requires contact with freshwater where mobile larval forms emerge from intermediate host snails and penetrate the skin , sometimes provoking an urticarial rash lasting several days . adult worms migrate to the venous plexuses of specific host tissues , where they form mating pairs and copulate throughout their 3- to 5-year lifespan , laying eggs to be eliminated in either feces or urine ( fig . 1 ) . the different species of schistosoma show some correlation with specific tissue types , which in turn correspond to the mode of egg elimination . schistosoma japonicum and s. mansoni show preference for the mesenteric venules of the bowel / rectum , while s. haematobium shows preference for the venous plexus of the bladder , , . much of the pathology of schistosomiasis results from inflammatory reactions to the eggs and resulting damage of the surrounding organs . hence , the tissue preferences of specific schistosoma species lead in turn to some correlations between specific species and the incidence of particular organ injury . for instance , the pathology of s. mansoni and s. japonicum includes hepatic perisinusoidal egg granulomas / symmers ' pipe stem periportal fibrosis , portal hypertension , as well as katayama fever . in contrast , the pathology of s. haematobium revolves around the urinary tract with frequent hematuria , bladder / lower ureter scarring , and calcification with resulting renal parenchymal damage and kidney failure as well as an association with squamous cell carcinoma of the bladder , , . neuroschistosomiasis results when eggs , instead of being eliminated in feces or urine , spread to the central nervous system and induce the formation of granulomas . involvement of the brain ( cerebral / encephalic schistosomiasis or cerebral granulomatous disease ) often leads to seizures , whereas involvement of the spinal cord ( spinal cord schistosomiasis or schistosomal myeloradiculopathy ) can cause cord compression resulting in paralysis . similar to the organ distribution described above , different schistosoma species have prevalence for affecting either the brain or spinal cord . schistosoma japonicum primarily involves the brain , while s. mansoni and s. haematobium primarily affect the spinal cord . however , occasional cases of cerebral schistosomiasis due to s. mansoni continue to be reported , and it is possible that its frequency of cerebral involvement may be underreported , , , . in areas where s. haematobium is endemic , involvement of the cns is thought to be most frequently due to embolization of eggs , but some cases of adult schistosomes traveling to the cns vasculature have been reported . symptoms can present soon after infection in the case of acute schistosomal encephalopathy , but delayed reactions for months and sometimes for years have been reported in cerebral schistosomiasis , , . the patient is a previously healthy 25-year - old female native of massachusetts , u.s . , who presented to the brigham and women 's hospital emergency department after the first seizure in her life . she had been feeling fatigued on the train that morning , and her symptoms worsened over the day . a coworker had her sit down , at which point she had difficulty answering questions . clonic seizure , which lasted for 3 min ( without incontinence ) , followed by 30 min of more pronounced fatigue and confusion . in the emergency department , she was fully alert and oriented , followed all commands without difficulty , and had fluent speech . concentration , attention , and memory were intact , as was her ability to read , name , and analyze a picture . her headaches , which began in childhood , are infrequent and occur only once or twice per year . she also had a tick bite prior to her current course , though she had no subsequent rash and had a negative lyme titer . in her family , she has a maternal uncle with epilepsy ( unknown type ) , a maternal aunt with migraines , and a mother with cardiac arrhythmias . she is a vegetarian and does not smoke , drink , or use illicit drugs . she has traveled to england twice and lived in ghana for one semester of college , four years prior to the onset of symptoms . during that trip , she lived mainly in the university town of legon , 12 km northeast of the capital city of accra , and she reported swimming once during the trip in a freshwater river that runs parallel to the ocean , east of the capital city . she recalled no particular symptoms during her stay , apart from one episode of dysuria that lasted less than a day . in the last 4 years , she has been perfectly well until this episode . she was subsequently followed in the clinic at weekly intervals and experienced an episode of altered consciousness ( possibly a partial seizure ) prior to the 4th visit . peripheral blood showed no abnormal findings : wbc : 9.3 , hgb : 12.9 , hct : 39.8 , plt : 226 ( poly : 58 , band : 0 , lymph : 31 , mono : 7 , eos : 2 , and baso : 0 ) . likewise , serum chemistries were within normal ranges : glucose : 91 , bun : 6 , creatinine : 0.64 , sodium : 140 , potassium : 3.8 , chloride : 100 , total co2 : 26 , alkaline phosphatase : 54 , alt : 11 , ast : 17 , total bilirubin : 0.2 , total protein : 7.5 , albumin : 4.6 , calcium : 9.4 , and magnesium : 1.9 . a lumbar puncture was performed , and csf showed no abnormal findings : glucose : 55 , protein : 19 , wbc : 2 ( 91% lymphocytes ) , and rbc : 0 . likewise , rheumatologic labs were within normal ranges : crp : 0.6 , mpo : 0 , pr3 : 4 , and ana and anca : negative . she was started on the antiepileptic drug levetiracetam to prevent further seizures . electroencephalography ( eeg ) showed good organization at rest , but occasional abnormal left temporal theta slowing was noted , maximal at t3 . brain mri imaging showed areas of abnormal t2 and flair signal at the medial and lateral aspects of the anterior left temporal and right posterior temporal parietal lobes ( with the left more affected than the right ) , as well as a similar small area of abnormality of the right cerebellum ( figs . after contrast administration , all these areas showed mottled nodular linear enhancement without significant mass effect ( figs . likewise , there was no asymmetric hippocampal volume loss or gray matter heterotopia , and ventricles were normal in size . possible etiologies of these imaging findings could include a spectrum of vasculitides , lymphomatoid granulomatosis , infection , and , less likely , granulomatous disease or tumor . additional functional mri ( fmri ) brain mapping was performed for presurgical planning and showed findings consistent with left - sided language lateralization but also showed the functional language regions to be apart from the areas of left temporal lobe signal abnormality . an image - guided left temporal craniotomy for open biopsy of the area of signal abnormality was performed . upon inspection , the surface of the brain was abnormal with some speckled appearance and some increased vascularity . a 0.5-cm biopsy was taken from the anterior / inferior left temporal lobe and appeared grossly abnormal with areas of possible necrosis . initial intraoperative consultation with frozen section / smear evaluation showed collections of histiocytes concerning for granulomas , vascular involvement , and necrosis suspicious for an infectious process ( figs . subsequent evaluation of paraffin - embedded permanent sections showed brain tissue with extensive granuloma formation and dense mixed inflammatory infiltrates comprised of eosinophils , plasma cells , histiocytes , and lymphocytes ( figs . b ) . review of multiple tissue sections revealed refractile shell fragments at the center of each granuloma with occasional intact shells showing the pathognomonic acentric spine shape of s. mansoni ( fig . serum elisa and antibody immunoblots performed at the center for disease control and prevention ( cdc ) confirmed exposure to s. mansoni and showed lack of exposure to s. haematobium , the other most prevalent schistosome species in ghana . the s. mansoni ab fast - elisa produced a score of 100 ( positive score considered > 10 ; 99% sensitivity for s. mansoni ; 90% sensitivity for s. haematobium ; 95% specificity for schistosomal infection ) . the s. mansoni ab immunoblot was positive , while the s. haematobium ab immunoblot was negative . hence , the patient was diagnosed with cerebral schistosomiasis ( neuroschistosomiasis ) due to s. mansoni . the patient was started on dexamethasone to control inflammation and received praziquantel ( 2 doses ) immediately after the histologic diagnosis in order to kill any remaining adult schistosomes . the steroids were tapered over one month , at which point she received another course of praziquantel ( 2 doses ) . subsequent serum analysis showed no eosinophilia , and stools continue to be negative for ova . cerebral ( encephalic ) schistosomiasis was first described by yamagiwa , a student of rudolf virchow , in 1889 . it is most often associated with s. japonicum infection in east asia , where that species is most prevalent , and has only occasionally been reported to be caused by s. mansoni or s. haematobium . in contrast , both s. mansoni and s. haematobium , but not s. japonicum , are endemic to ghana , the likely source of infection for the current case . hence , this presentation of cerebral schistosomiasis due to s. mansoni four years after a single known exposure is an atypical presentation . cerebral schistosomiasis can present with variable clinical and imaging characteristics that can overlap with that of epilepsy , brain tumors , vasculitis , stroke , granulomatous disease , and other disorders . electroencephalogram can help localize the disease in some cases but can also be normal in some patients , . the lesions of neuroschistosomiasis can occur in both the cerebral hemispheres and cerebellum / brain stem . on postcontrast mri , the lesions can appear as a large mass comprising multiple intensely enhancing nodules or as a central linear enhancement surrounded by multiple enhancing punctate nodules sometimes appearing arborized . occasionally , they have also been reported to appear as nonenhancing irregular finger - like areas of abnormal signal consistent with increased edema , , . however , the imaging characteristics of cerebral schistosomiasis due to s. mansoni , as in the current case , are not well described because of its comparable rarity . in the current case as well as in three other reported cases of cerebral schistosomiasis due to s. mansoni , the imaging does appear to show a similar pattern of enhancing punctate nodules clustered irregularly around some linear enhancement , with surrounding edema . thus , this imaging pattern may be generally applicable to cerebral schistosomiasis due to both s. mansoni and s. japonicum , . direct pathologic evaluation of the involved tissue , as in the current case , is still the gold standard for diagnosis . observation of the spine placement on the egg shell ( lateral for s. mansoni , midline for s. haematobium , and absent for s. japonicum ) is pathognomonic for each species . however , a combination of the serum indirect hemagglutination ( iha ) test and enzyme - linked immunosorbent assay ( elisa ) shows high sensitivity and specificity for s. mansoni , and both are often used in addition to histologic evaluation to confirm the species diagnosis , especially if intact eggs are not identified on histologic sections , . other tests such as evaluation of stool and urine for ova can be very useful if positive but are often negative . overall , as in our case , a combination of these diagnostic approaches is required . schistosomiasis pathology is driven by host inflammatory response to the eggs and hence correlates with where the eggs are deposited . schistosoma mansoni and s. japonicum can cause katayama fever , hepatic perisinusoidal egg granulomas , and periportal fibrosis and portal hypertension , whereas s. haematobium is more frequently associated with hematuria and bladder wall scarring , . moreover , specific schistosome species are associated with the development of specific cancers , such as the correlation between s. haematobium infection and the development of squamous cell carcinoma of the bladder . in areas where s. haematobium is endemic , squamous cell carcinoma of the bladder is the leading form of cancer in the population . other studies have likewise suggested links between s. japonicum and hepatocellular carcinoma and between s. mansoni and colorectal adenocarcinoma , although more evidence is needed . treatment of schistosomiasis consists of antischistosomal therapy ( i.e. , praziquantel ) plus corticosteroids to control the inflammation . some cases involving the posterior fossa with resulting mass effect may also require treatment with surgical resection . while the current patient showed involvement of both the cerebral cortex and cerebellum , there was no significant mass effect , and the patient was treated successfully with medical therapy after the diagnostic biopsy . anticonvulsants are frequently needed for a period of time , but studies suggest that long - term antiepileptic therapy is not required in most cases of cerebral schistosomiasis . unfortunately , neuroschistosomiasis can sometimes result in significant postexposure chronic sequelae including medically refractory epilepsy that may require surgical treatment in the case of cerebral schistosomiasis and paralysis in the case of spinal cord schistosomiasis , . the worst outcomes have been seen in spinal cord schistosomiasis where some studies have reported that only 15% of treated patients experience a complete recovery , while other studies have shown that early aggressive treatment can lead to full recovery in up to 65% of patients , . of note , other schistosome species are found indigenously in the u.s . but die after penetrating human skin , giving rise to a similar initial allergic condition called swimmer 's itch , or cercarial dermatitis , but not progressing to the other manifestations of the disease . the primary hosts for these other species are instead water fowl ( austrobilharzia variglandis , microbilharzia sp . , trichobilharzia ocellata , trichobilharzia physella , trichobilharzia stagnicolae ) and rodents ( schistosomatium douthitti ) . because the specific snail species required as intermediate hosts for s. japonicum , s. mansoni , and s. haematobium are not present in the united states , the transmission of these organisms in the united states waterways is currently unlikely . in summary , we describe the atypical combination of cerebral schistosomiasis due to s. mansoni , after a prolonged four - year interval , from apparently a single exposure . the imaging characteristics of irregular nodular enhancement seen in this case mirror those reported in the much more frequent cerebral schistosomiasis due to s. japonicum and support previous suggestions that these imaging findings are applicable to cerebral schistosomiasis caused by both species . the clinical manifestations of cerebral schistosomiasis are variable and can overlap with that of epilepsy , brain tumors , vasculitis , and stroke . hence , a combination of history , imaging data , laboratory findings , and pathologic analysis is critical for diagnosis .

schistosomiasis is the second most socioeconomically devastating parasitic disease worldwide , affecting over 240 million people in 77 countries on 5 continents and killing 300,000 people annually in sub - saharan africa alone . neuroschistosomiasis is caused by granuloma formation around eggs that lodge in the cns , with schistosoma mansoni and schistosoma haematobium usually affecting the spinal cord and schistosoma japonicum causing most reported cerebral disease . we report a case of a previously healthy 25-year - old woman native to the united states who presented with a single generalized tonic clonic seizure without other neurologic symptoms four years after spending a semester in ghana where she went swimming once in a river . brain mri showed areas of signal abnormality and mottled nodular linear enhancement in the left temporal and right posterior temporal / parietal lobes and right cerebellum without mass effect . a biopsy of the left temporal lesion showed prominent granulomas with dense mixed inflammatory infiltrates composed of eosinophils , plasma cells , and lymphocytes surrounding refractile egg shells containing characteristic embryonal cells and von lichtenberg 's envelope and displaying the pathognomonic spine shape of s. mansoni . serum elisa and antibody immunoblots confirmed exposure to s. mansoni . in summary , we describe the atypical combination of cerebral schistosomiasis due to s. mansoni , after a prolonged interval of four years , from a single known exposure .

You are an expert at summarizing long articles. Proceed to summarize the following text: monoamniotic twinning is a rare complication , occurring in less than 1% of monozygosity and is associated with a significant mortality rate [ 1 , 2 ] . the most common cause of perinatal mortality in monoamniotic twins has been reported to be cord entanglement [ 1 , 2 ] . cord entanglement has been reported in up to 70% of monoamniotic twins with 50% or more of deaths attributed to this complication . recently , some cases of disruption of the dividing membrane in monochorionic diamniotic twin gestation as pseudomonoamniotic twin gestation [ 413 ] . in some previous reports , pseudomonoamniotic twin gestation sometimes has been also observed to be complicated by umbilical cord entanglement . in addition , some cases of monochorionic diamniotic twin pregnancy complicated by spontaneous antepartum rupture of the intertwin - dividing membrane ( and umbilical cord entanglement ) without any perinatal episodes have been reported [ 12 , 13 ] ; however , there have been few investigations comparing the perinatal outcomes in pseudomonoamniotic twins with those in true monoamniotic twins . we retrospectively evaluated a series of 18 monoamniotic and 7 pseudomonoamniotic twin gestations managed after 20 weeks ' gestation at our hospital ( these contain the cases we reported previously [ 68 , 14 ] ) . the diagnosis of monoamnionicity and pseudomonoamnionicity was determined on the basis of ultrasound features and it was confirmed by clinical presentations at delivery , such as the presence of disruption of the dividing membrane and histological examination of the placenta . the histology of the placenta and umbilical cord entanglement were examined at the time of delivery . cases of congenital anomalies such as anencephaly and acardiac twins were excluded . in addition , the pregnancies were excluded , if fetal demise at least one twin at < 20 weeks ' gestation was diagnosed . the gestational age of the pregnancies was established by ultrasonographic examination of the fetal crown - rump length at 811 weeks ' gestation . in our hospitals , elective cesarean at preterm for ( true and pseudo- ) monoamniotic twin gestations as previously reported [ 15 , 16 ] was not performed without maternal request , if fetuses were well and the patient had no maternal complications . in monoamniotic twin gestations , twin - twin transfusion syndrome ( ttts ) was diagnosed with the clinical presentations , such as cardiac dysfunction , discordance in bladder size , and/or polyhydramnios . cases and controls were compared by the or fisher 's exact test for categorical variables . differences with p table 1 shows the summary of perinatal findings in the 18 ( true ) monoamniotic twin gestations . the incidence of perinatal loss per total number of neonates was 33% ( 12/36 ) . four cases ( 22% ) resulted in double death , while 4 ( 22% ) cases resulted in single death . the incidence of cerebral injury per total number of lived neonates was 13% ( 3/24 ) . based on the clinical presentations , 2 cases ( 11% : cases 4 and 9 ) were suggested to be complicated by ttts . table 2 shows the summary of perinatal findings in the 7 pseudomonoamniotic twin gestations . in 3 cases of these ( 43% ) , the disruption of the dividing membrane was associated with the therapies ( amniocentesis and fetoscopic laser photocoagulation ) for ttts . as our impression , at the deliveries the area of the perforated portions of dividing membranes seemed to be large enough to lead to umbilical cord entanglement . of 4 cases with spontaneous membrane rupture , 2 mothers ( cases 5 and 7 ) felt the amniotic fluid flow due to membrane rupture of the second twin before labor . the incidence of perinatal loss per total number of neonates was 21% ( 3/14 ) . one case ( 14% ) resulted in double death , while 1 ( 14% ) case resulted in single death during the second trimester . there were no significant differences in the incidence of neonatal death or umbilical cord entanglement between the monoamniotic and pseudomonoamniotic twin gestations ( p = 0.94 and 0.36 ) . thirteen of 15 perinatal losses ( 87% ) were occurred before 32 weeks of gestation . to date , some possible mechanisms leading to antepartum rupture of the intertwin - dividing membrane except artificial septostomy , such as amniocentesis and fetoscopic laser photocoagulation , have been proposed , such as infection ( chorioamnionitis ) , developmental disturbance , trauma or physical rupture by fetuses , and intrauterine sling formation . in addition , some cases of spontaneous antepartum rupture , in which the exact cause of rupture of membrane can not be well determined , have been reported . in our 7 cases of pseudomonoamniotic twin gestations , we know that the sample size of this study is very small ; however , the current results may indicate that the perinatal outcomes of pseudomonoamniotic twin gestations do not differ from those of true monoamniotic twin gestations . based on the results , the incidence of umbilical cord entanglement , which is the most critical concern in twin gestations , in monoamniotic twins seemed to be similar to that in pseudomonoamniotic twins . as our impression , the area of the perforated portions of dividing membranes seemed to be large enough to lead to umbilical cord entanglement . in addition , there was no significant difference in perinatal loss between the monoamniotic and pseudomonoamniotic twins . therefore , the same serious management may be needed for pseudomonoamniotic twin gestations as for monoamniotic twin gestations . in this study , the total incidence of perinatal death in monoamniotic and pseudomonoamniotic twin gestations seemed to be high as previously reported [ 1 , 2 ] ; however , 87% of perinatal losses were occurred before 32 weeks of gestation , and there was no occurrence of new perinatal deaths after 34 weeks of gestation . in some literatures , the recommended timing of delivery range to prevent sudden intrauterine fetal death has been reported to be between 32 and 34 weeks [ 1 , 15 , 16 ] . however , the current result may support the other articles that the incidence of fetal death after 32 weeks is not high in monoamniotic twins [ 17 , 18 ] , which is suggesting that prophylactic preterm delivery may not be indicated in all monoamniotic twin gestations . therefore , a further large study may be needed concerning the appropriate timing of delivery for monoamniotic and pseudomonoamniotic twins .

we retrospectively evaluated a series of 18 monoamniotic and 7 pseudomonoamniotic ( secondary to rupture in the membrane dividing monochorionic diamniotic twins ) twin gestations managed after 20 weeks ' gestation . there were no significant differences in the incidence of neonatal death or umbilical cord entanglement between the monoamniotic and pseudomonoamniotic twin gestations ( 33 versus 21% , p = 0.94 and 72 versus 43% , p = 0.36 ) . therefore , the same serious management may be needed for pseudomonoamniotic twin gestations as for monoamniotic twin gestations .

You are an expert at summarizing long articles. Proceed to summarize the following text: as a rare subtype of aggressive ossifying fibroma , psammomatoid ossifying fibroma ( pof ) , also termed juvenile ossifying fibroma , is a benign fibro - osseous lesion predominantly affecting the paranasal sinuses and orbits of children and young adults ( 1 ) . histopathology reveals a densely cellular fibrous stroma interspersed with numerous small , spherical ossicles or psammoma bodies . it is locally aggressive , with a high risk of relapse if not completely resected . a 39-year - old male presented with a 30 year history of progressive right eye proptosis and decreasing vision without any obvious pain . the tumor had resulted in right craniofacial deformity , as well as right lateral displacement of the eye ball ( fig . also , the expansile mass had caused partial airway obstruction of the nasal cavity , nasopharynx and oropharynx , accompanying incomplete eyelid closure and restrictive movement of the right eye . computed tomography ( ct ) scans revealed a well demarcated , ground - glass opacity expansive lesion extending into the right frontal , maxillary , orbit and paranasal sinuses , with the volume of 9.49.810.5 cm ( fig . in addition , pre - operative tracheotomy and external carotid artery embolization was utilized to relieve dyspnea and reduce tumor vascularity . following the removal of the tumor , the bony anterior skull base remained paper - thin . gelatin sponge and tela iodoform was placed in the cavity and removed after 6 days . the histopathology of the specimen revealed gray - white and gray - red soft tissue , and bone fragments were 17166 cm in aggregate ( fig . microscopic examination revealed that the tumor with necrotic lesions consisted of dense fibroblastic stroma with interspersed areas of ossification and resembling psammoma bodies ( fig . the patient was free from symptoms and exhibited partial regression of the right eye proptosis . ct scans revealed no recurrence in the area of nasal cavity , nasopharynx and paranasal sinuses . benign fibro - osseous craniofacial lesions include fibrous dysplasia , ossifying fibroma and cemento - osseous dysplasia . ossifying fibroma is divided into conventional ossifying fibroma and juvenile ossifying fibroma . according to the 2005 world health organization classification of odontogenic tumors , juvenile ossifying fibroma is further divided into juvenile pof and juvenile trabecular ossifying fibroma ( 2 ) . due to the similarity of certain histopathological features , accurate diagnosis depends on the clinical , radiological and histological features . pof is a rare subtype of aggressive ossifying fibroma and the etiology of pof remains unclear . pof is distinct from other lesions on the basis of its site , clinical behavior , histopathological features and age of occurrence . pof occurs more commonly in children and young adults , although it has also been reported in patients ranging in ages between 3 months and 72 years ( 3 ) . pof typically affects regions , including the maxilla bone , paranasal sinuses , orbits and the fronto - ethmoidal complex . by contrast juvenile trabecular ossifying fibroma commonly affects patients younger than those affected by pof , and usually arises in the maxilla or mandible with rapid growth ( 4 ) . clinical manifestations of pof include proptosis , lateral displacement of the eye ball , decreasing vision with progressive blindness and progressive craniofacial deformity . local expansion of the lesion may extend into adjacent structures , including the paranasal sinuses , nasal cavity , nasopharynx , palate and cranial cavity . radiologically , ct scans of the pof revealed an expansile mass and radiolucent lesion , which is well - circumscribed by a thick bony shell with a multiloculated internal appearance and a content of varying density . sometimes the lesion has a ground - glass appearance and a variable quantity of internal calcifications , as observed in the present case . in addition , magnetic resonance imaging reveals a mass with a thick outer shell and assists with delineating the extent of the mass . the radiography makes it possible to distinguish pof from other fibro - osseous lesions , including fibrous dysplasia , since fibrous dysplasia is less demarcated and poorly circumscribed by a fibrous capsule ( 5 ) . histologically , the characteristic of pof is the presence of numerous small , spherical ossicles or psammoma bodies that are embedded in a densely cellular fibrous stroma ( 6 ) . the lesion is well - circumscribed and interspersed with osteoblastic rimming of trabeculae and a large quantity of vascularized fibrous stroma . certain previous studies have reported concurrent aneurysmal bone cyst formation with pof ( 7 ) . by contrast , fibrous dysplasia is poorly delineated , with irregular trabeculae of woven bone or ovoid calcifications without lamellar bone and osteoblastic rimming of the trabeculae . juvenile trabecular ossifying fibroma contains osteoid matrix surrounded by trabeculae of fibrillary osteoid and woven bone . the predominant treatment for pof is complete surgical excision of the tumor , and partial or incomplete removal leads to recurrence ( 8) . pof is locally aggressive and potentially extends into adjacent vital structures . in the present case , an open surgical approach was employed to resect the tumor as it affords visibility of integrate tumor thereby allowing complete removal . also , the specimen for pathology is commonly fragmented , making it impossible to evaluate surgical margins appropriately . the successful surgical excision requires multidisciplinary co - operation , involving neurosurgeons , ophthalmologists and otolaryngologists . in the present case , the prognosis of the patient was considered good without malignant degeneration and metastases , which was evidenced by post - operative radiological examination indicating complete removal of the tumor .

the psammomatoid ossifying fibroma ( pof ) is a rare and benign fibro - osseous lesion predominantly affecting the paranasal sinuses and orbits of children and young adults . the diagnosis and management of the lesion remains challenging . the present study reported a rare case of a large pof in a 39-year - old male patient . the patient had a 30 year history of a slowly growing tumor and this had resulted in right craniofacial deformity , as well as right lateral displacement of the eye ball . due to the large tumor size , surgical removal of the lesion was the predominant treatment . at 5 months after complete surgical resection , the patient was free from any symptoms . the radiological and histological findings , as well as the surgical management , were presented and the relevant literature was reviewed .

You are an expert at summarizing long articles. Proceed to summarize the following text: ethical concerns limit laboratory studies on living subjects , and advanced digital imaging technology has opened up new alternative possibilities in dentistry . the computational simulation method takes a more important position in both clinical and therapeutic applications in the dental industry . usage of virtual models offers an alternative method of investigation , and costs can also be reduced for in vivo and in vitro experiments . in dental research , ct scanning is the most frequently used high resolution imaging technology . to conduct ct scans , the targeted object needs to be exposed to a certain amount of ionizing radiation in which the absorbed radiation is detected and imaged later on . a series of sliced 2d images , depicting a density map of the scanned object , can be obtained . the development of ct technology has been used to study and quantify the morphology of bone [ 2 , 3 ] , to nondestructively evaluate porous biomaterials , and to investigate the architecture of scaffolds [ 5 , 6 ] . the offering of reasonably high resolution is the main reason for using ct as imaging technology in the field of hard tissue engineering . contrast segmentation is a technique used for tissue differentiation , in which the grayscale of the layered contour images is determined by the tissue density . living tissues involve complex shapes , for example , teeth and mandibles that are possible to be digitized using ct scanned images to allow accurate measurement of small changes of irregularities . ulusoy and darendeliler have evaluated the effects on the stress distribution with different types of class ii activators using a mandible fe model constructed using ct - scanned images . have digitized the mandibles of patients of different ages using ct - scanned images , and performed analyses with the simulation of supra normal chewing forces . gao and chae have proposed a tooth segmentation method to visualize a tooth from ct images so as to provide assistance for dentists performing orthodontic surgery and treatment . with the availability of the advanced imaging technology , have constructed a 3d premolar model through digitizing a plaster tooth model with manual operations of the literature data related to the volume of dentin and enamel . have attempted to build up a model of maxilla with two molars from a living object and to investigate the distribution of stress under occlusal forces , in which the molar parts are assigned with uniform mechanical properties . ichim et al . have modeled the fracture behavior of a restoration using a 2d fe model constructed using ct - scanned images with the consideration of internal tooth structure . magne has demonstrated the usage of boolean operations to build up a 3d tooth model with desired restoration morphologies using ct images . in contrast , lin et al . [ 14 , 15 ] have used a 3d tooth model constructed manually , according to the literature data describing the morphology of teeth , to determine the relative contribution of changes in cavity dimensions and various factors on the biomechanical response of a restoration during oral temperature changes . in 2010 , li et al . constructed a 2d fe model from scanned images for optimizing the shape of the restoration cavity . have used scanned images to construct a 2d fe model for the simulation of debonding and fracture of a restored tooth . understanding how mastication loading is spread over a restored tooth is crucial to both clinical practitioners and material scientists . miura et al . have stated that periodontal tissue , such as in the mandible , which constrains the location of the tooth , plays an important role for failure prediction in dental research . the aim of the present study is to develop a computational method for the stress analysis of a restored tooth so that experimental effort can be minimized . the objectives of this study therefore are to develop a method to create a 3d fe assembly model for a restored tooth and its corresponding mandible based on ct images ; and to conduct stress analysis of the restored tooth using the 3d fe model established . in this study , the tooth model is a triphasic one , consisting of enamel , dentin , and pulp phases , which gives rise to a more realistic simulation to estimate the stress distribution of the tooth and the restoration . moreover , the proposed method offers a computational scheme assisting dentists to design a more effective tooth repair strategy . in this study , a 3d fe model of a restored tooth with a mandible is created from ct - scanned images following the five stages shown in figure 1 . the first stage is to extract the 3d raw data representing the designated tissues in the format of a point cloud from 2d scanned images . the second stage aims to create surface models of the enamel , dentin , pulp , and mandible using tiny triangular facets based on the extracted point cloud data . the purpose of the third stage is to represent the surface models using tiny facets to bigger quadrilateral patches , which facilitates performing modifications on the generated model in the next stage . the fourth stage aims to transform the surface models into a solid assembly model comprising a tooth and a mandible submodel . in addition , a class ii mesioocclusal ( mo ) restoration structure has been incorporated into the tooth sub - model using the cad tools . the last stage aims to build up the fe model based on the solid assembly model and undertake computational analysis of the stress distribution on a restored tooth under mastication loading . this procedure is to align the discrete 2d scanned images into one 3d coordinate system . in addition , it is aimed at extracting the geometric data of the designated tissues from the processed images and storing them in a point cloud format . in this study , the primary input is the ct scan images . a ct scanner , bright speed ct 99 ( ge medical system ) , the voltage used was 120 kv , and the current was 300 ma . the slice thickness was 1.25 mm and the pitch ratio was 0.875 : 1 . the scan option was 0.8 s , and a total of 180 images were obtained in 60 s. the sets of anatomical images acquired from different 2d perspectives ( i.e. , top , front , and side ) were stored in the dicom format . the sliced images in the top view were organized in sequence and some are shown in figure 2 . the organized images are then imported into the software package , mimics , version 10.01 , materialise , leuven , belgium , to perform the orientation registration process . the process involves the assignment of orientation parameters , top ( t ) , bottom ( b ) , left ( l ) , right ( r ) , anterior ( a ) , and posterior ( p ) , to each anatomical image ( figure 3 ) . in addition , the separation distance for each consecutive scanned image was also specified . in this study , each 2d image slice can be regarded as a pixel map of the radiation attenuation tissue coefficient . hu is a normalized unit whereby water has a value of 0 while air has a value of 1024 . the classification process aims at identifying the hu value describing the targeted tissue in each scanned image , while segmentation is a process of identifying the hu value representing the inner and outer surface boundaries of the tissue . to do so , a profile line was firstly constructed on a scanned image . the upper and lower limits in terms of hu values describing the designated tissues were determined from the profile map . figure 4 shows a slice of a scanned image and the corresponding variations of hu along the profile line . through the classification and segmentation functions of mimics , the geometric data of the desired anatomical tissue can be preliminary extracted . to extract the geometric data for the mandible , dentin , and pulp , an hu value within the range of 1762176 has been used while figure 5 presents the preliminary geometric descriptions , in which the descriptions are transformed and presented in point cloud format . the purpose of this procedure is to generate surface models of the designated tissues , which are free from imperfections , from the point cloud data through filtration , smoothing , refining , and repairing processes . at first , the point cloud data acquired from the previous procedure underwent a polygon / facet creation process , and the software package , rhino , version 3.0 , rhinoceros , seattle , usa , was employed . surface models were then created as shown in figure 6 . since the classification and segmentation processes ( conducted in the previous procedure ) are performed throughout the whole set of anatomic images , surfaces of nondesignated parts having similar hu description values were also generated . irrelevant facets and noisy points are inevitably formed which could hinder the conversion to the solid model later on . therefore , a filtering process was undertaken to erase the non - designated / unwanted parts as well as the noisy points and irrelevant facets . the filtration process was performed with the aid of the embedded clustering function from rhinoceros . as demonstrated in figure 7 , the surface contour of the mandible was extracted and separated from the noisy points and irrelevant facets . similarly , the surface contours of enamel , dentin , and pulp were also extracted and filtered . surface refinement and smoothing processes were then performed using the software package , copycad , delcam , taipei city , taiwan . surface refinement involves the detection and deduction of sharp facet triangles and self - intersecting facet triangles . such action can minimize the chance of error in creating the mesh model in the later procedure . a surface smoothing process was then carried out , which performs a similar operation through the action of modifications rather than deductions . this process involves the definition of a smooth factor ( sf ) value ( a real number ranging from 0 to 1 ) and an iterative parameter ( ip ) . in this study , surface repairing was also performed in this procedure , dealing with repairing imperfections , such as small holes and big cavities , in the designated surfaces . such process was carried out through one of the three schemes , shown in figure 8 , based on the selection criteria . this procedure is important in constructing a closed - surface model which is a must condition for the solid model construction process in the later procedure . this procedure aims to represent the facet surfaces of the designated tissues using the non - uniform rational basis spline ( nurbs ) mathematical model . nurbs representing surfaces allows better performance in designing and creating restorations using cad tools in the next stage . patch sketching , patch refining , and grid generation are the three processes involved in converting the facet surfaces into nurbs representing surfaces . after the three processes , the morphology of the imported surface models can be kept but is represented using quadrilateral patches . figure 9 illustrates the processes involved in creating the nurbs representing surfaces of dentin and mandible . this was done using the software package , geomagic studio , version 10 , geomagic , morrisville , usa . this procedure is aimed at transforming the nurbs surface model into a solid model . using the cad tools , a conceptual research idea can be substantiated virtually and established interactively according to the freeform geometry of living tissues . in this study , a class ii mo restoration structure has been incorporated virtually into a tooth model . firstly , the imported nurbs surface models of the mandible and tooth underwent a geometric diagnosis process using the cad software package , solidworks office premium , version 2007 , solidworks , ma , usa . if a model is detected in an opened state , it needs to be reworked from the tissue surfaces construction procedure , where the surface repairing process can be performed . if a model is identified to be in a closed state , a solid model can be generated directly . facilitated with the cad tools , boolean operations were performed for the construction of a restored tooth . figure 10 demonstrates the boolean subtraction process for creating a restoration cavity on the tooth model . additionally , the boolean union process was executed to trim off and customize the class ii mo restoration model according to the geometry of a tooth surface with dimensions given by yaman et al . . in addition , to simulate the mastication process , a ball with a diameter of 6 mm was constructed to apply occlusal loading to the tooth model . the desired assembly model with a restored tooth and a mandible submodels was then prepared . this procedure aims to further develop the assembly solid model from the previous procedure to a fe model and involves the definition of the loading and boundary conditions , as well as meshing the model using finite elements . after assigning material properties to different phases of the model , analysis is undertaken to predict the stress distribution of a restored tooth under mastication loading . as shown in figure 11 , the assembly model of a mandible with a restored tooth was meshed using 3d tetrahedral solid elements ( c3d4 ) . this was done using the cae software package , abaqus , version 6.8 , dassault systmes , simulia , china . to simulate the mastication loading , a spherical morsel with diameter of 6 mm was used having impact velocity of 0.03 mm s exerted on the restoration [ 15 , 20 ] . simplified boundary conditions were applied , and the base of the mandible model was fixed . the material properties for the morsel , restoration , enamel , dentin , pulp , and mandible phases of the model were assigned as stated in table 1 . to construct the tissue surfaces , there involves the definition of sf and ip values . if the local geometry is important , the value of the sf will be set to a small value , which indicates that the corresponding smoothing action is limited . if a large value of sf ( close to 1 ) is set , the position of the nodes of the facet triangle sets would be rearranged and the newly assigned position is mainly determined by the position of the other points of the facet triangles in the neighborhood . the number of cycles for smoothing depends on the defined ip . if too many cycles of smoothing are performed , the imported 3d object would be turned into a sphere - like object . suitable iteration cycles can maintain the morphology of the part of interest while reducing computational loading when carrying out simulation analysis . budyn and hoc ( 2007 ) stated that damage cracks can be initiated perpendicularly to the maximum principal stress direction , so the maximum principal stress of the model has been computed . figure 12 presents the stress contours in the restoration and tooth phases under the simulated mastication loading . concerning the restoration phase , most of the loading was sustained at the surface having direct contact with the morsel and in the marginal region of the interface between the restoration and the tooth phases . regarding the tooth phase , concentrations of stress the principal direction of the element having the highest maximum principal stress value is also shown in the figure , which highlights the possible direction for the onset of damage . the predicted stress distribution can provide the important information to formulate a tooth repair strategy avoiding the failure of dental restoration before conducting actual repairs . in this study , a viable alternative method involving the application of commercially available software packages has been used to create a 3d fe solid assembly model based on 2d ct images . computational analysis of the stress distribution on a restored tooth under mastication loading has also been conducted . with appropriate modifications , the generated assembly model can be extended for further computational investigations of various classes of restorations and cavity designs .

a computational method has been developed for stress analysis of a restored tooth so that experimental effort can be minimized . the objectives of this study include ( i ) developing a method to create a 3d fe assembly model for a restored tooth based on ct images and ( ii ) conducting stress analysis of the restored tooth using the 3d fe model established . to build up a solid computational model of a tooth , a method has been proposed to construct a 3d model from 2d ct - scanned images . facilitated with cad tools , the 3d tooth model has been virtually incorporated with a class ii mo restoration . the tooth model is triphasic , including the enamel , dentin , and pulp phases . to mimic the natural constraint on the movement of the tooth model , its corresponding mandible model has also been generated . the relative high maximum principal stress values were computed at the surface under loading and in the marginal region of the interface between the restoration and the tooth phases .

You are an expert at summarizing long articles. Proceed to summarize the following text: a 7-year - old female presented complaining of intermittent diplopia and blurred vision for 2 months . 1 ) . however , variable degrees ( 10 to 30 prism diopters [ pd ] ) of esodeviation and miotic pupils were evident only at near fixation ( fig . her esodeviation did not change with the addition of + 3.0 diopters ( d ) lenses . however , cycloplegic refraction revealed that both eyes were nearly emmetropic ( + 0.5 d ) . the patient also complained of frequent headaches and abdominal pain ; the results of all physical and neurological examinations were normal , including a brain magnetic resonance imaging with contrast . the patient was diagnosed with convergence spasms and was referred to the psychiatry department for her somatic complaints . plus lenses ( + 1.5 d ) for reading were prescribed for atropinization of her eyes . one month after prescribing atropine eyedrops and reading glasses , the patient 's best corrected visual acuity increased to 20/20 . she continued to complain of intermittent diplopia , but the frequency and duration were decreased . however , the patient 's mother did not bring her daughter to the psychiatric department ; the patient was again referred to the department of psychiatry . during a mental status examination at the department of psychiatry , the patient was given a psychiatric diagnosis of childhood emotional disorder owing to an emotionally unavailable mother suffering from major depressive disorder . ( antidepressants , selective serotonin reuptake inhibitor [ ssri ] ) and diazepam 2 mg p.o . ( anxiolytics , benzodiazepine ) for the patient . additionally , escitalopram 10 mg p.o . one month after initiation of the antipsychotic medications , the patient 's esodeviation at near fixation was resolved and all somatic complaints had ceased ( fig . the patient 's visual acuity was 20/20 without glasses and her refraction was nearly emmetropic ( + 0.5 d ) . as such , successful cessation of the atropinization of the patient 's eyes was achieved after only 2 months . after the patient and her mother finished 6 months of the antipsychotic medication regimen , no symptoms were evident of either convergence spasms or any other somatic disorders . most convergence spasm cases are caused by a functional disorder , such as hysteria or neurosis . . emotional instability may result in a variety of ocular manifestations besides convergence spasms , such as blurred vision , monocular diplopia , tunnel vision , blepharospasm , and nystagmus . emotional instability should be considered as a possible cause when patients present with these symptoms . if no signs of emotional problems are present , a thorough neurological work - up is recommended . there are several organic causes of convergence spasms , including encephalitis , tabes , labyrinthine fistulas , arnold chiari malformation , posterior fossa neurofibroma , trauma , and pituitary adenoma . some authors have reported positive outcomes from supportive psychotherapy and amytal interviews . however , the conventional therapy for convergence spasms consists of atropinization of the eyes and the prescription of plus lenses for near vision . it is useful to produce cycloplegia in an attempt to break the cycle of sustained maximal convergence and accommodative spasm . dilated pupils can lead to photophobia and blurred vision with near fixation and the wearing of reading glasses can cause discomfort . other adverse events may include allergic conjunctivitis and , rarely , fever and aggravation of asthma . in the present case , the successful cessation of the atropinization of the patient 's eyes was achieved only one month after the patient and her mother initiated antipsychotic medications . of course these events may occur early in treatment with a high dose ( > 100 mg ) of the drug or following the addition of drugs that inhibit the metabolism of ssris . in addition , some patients also experience ataxia ( < 2% ) and dizziness ( < 1% ) with benzodiazepines . however , most benzodiazepines , especially low potency benzodiazepines like diazepam , are generally well tolerated . the low dose and low potency of the antipsychotic medications given to the present patient did not elicit any of these side effects . we report a case of early resolution of convergence spasms after the addition of antipsychotic medications . additional treatment for childhood emotional disorder , which was the indirect cause of the patient 's convergence spasms , reduced the required duration of atropinization of the eyes from one year to 2 months . we recommend active referral and collaboration with psychiatrists when treating patients whose disease may be functional in origin .

we report a case of early resolution of convergence spasms following the addition of antipsychotic medications and present it as a possible alternative to the conventional treatment for convergence spasms . the cessation of atropinization of the eyes and the use of reading glasses was achieved after only 2 months following the initiation of antipsychotic medications for childhood emotional disorder .

You are an expert at summarizing long articles. Proceed to summarize the following text: the overriding need for professional proficiency across a wide range of careers has resulted in the need for university s to plan and provide education and training which is tailored to the diverse needs of each profession . within nurse education specifically , in order to gain the skills required to work as a registered nurse in the hospital , teaching and learning needs to take place in contextually relevant faculties , which facilitate development of the required skills and the self esteem of the learner . an important factor , influential to the development of the students self esteem , is the role of the academic teacher or facilitator . in recent years many studies have explored the concept of self - esteem , which is considered to be an extremely abstract concept with different perspectives . sometimes self - esteem is used to refer to a personality variable that represents the way in which people generally fell about themselves . but sometimes it is used to the way people evaluate their various abilities and attributes . for example , a person who doubts his ability in school may be said to have low academic self - esteem . in the various theoretical perspectives on self - esteem , for instance , from the socio - cultural perspective , self - esteem is an attitude that the person has about her or himself , whilst from a behavioral perspective self - esteem means a construct or an acquired quality . meanwhile , from a humanistic perspective , self - esteem refers to an individual s skill to live , respect and accept his view of himself . nursing is a profession with a particular body of knowledge which is drawn from the social , behavioral and physical sciences . considering the importance of the concept of self - esteem in relation to academic study and specifically within the unique context of nursing education ; and also the fact that different paradigms have somehow defined self - esteem , a question arises : what are the aspects and characteristics of the concept of self - esteem for nursing students ? most studies within the literature acknowledged the existence of low levels of self - esteem within nursing students . having knowledge of nursing students levels of understanding about the nature of self - esteem would enable academics to plan and implement practical steps to help student nurses improve their self - esteem . for this , it is essential to explore the concept of self - esteem and identify factors which limit or enable development of this concept in nursing students , in order to plan enabling strategies which may facilitate increased self - esteem in this group . the literature revealed no studies undertaken around the meaning of the concept of self - esteem in nursing students . in a previous study , the effect of social values and cultural variations on self - esteem revealed further dimensions of the construct . in this study self esteem focused on the context of individualistic ( mostly western ) and collectivistic ( mostly eastern ) cultures . at the other hand , the western culture tends to give more importance to the independence , uniqueness and individuality of the person whereas , the eastern culture focuses more on collectivism , dependence , and compliance . therefore , it seems necessary to explore the concept of self - esteem in cultural contexts to emphasize its various manifestations in the specific cultural context of nursing education . we could not found any special study in this regard in iran . with regard to the need to explore the concept of self - esteem in nursing students and the impact of culture on their understanding of this concept , the specific aim of this study was to investigate nursing students understanding of the concept of self - esteem this qualitative study was based on a content analysis approach . in - depth one to one interviews utilized to gather data about nursing students experiences . in this study , a purposive sample of 14 participants ( nursing students ) was recruited from tabriz and maragheh faculty of nursing and midwifery , and islamic azad university ( tabriz and bonab branch ) . the semi - structured interviews were conducted either in the researcher s offices within the faculty . however , participants were informed that they could change the interview 's location and time if they wished . interviews began with general questions such as may i ask you to speak about your experiences of nursing students self - esteem or how do you feel about yourself as a nursing student . as the interview progressed more detailed questions were asked such as : can you give an example ? the process of data analysis was based on conventional content analysis as proposed by wildemuth in 2009 . in this method the first step is to prepare the data to make sure all the data is transformed into written text before analysis . then in the second step , the unit of analysis needs to be classified during content analysis . usually , coding schemes can be developed both inductively and deductively , after the code is developed , the coding scheme is applied on a sample of text to check whether there are any clarity and consistency problems of the coding scheme . if there is no problem , then all the text can be coded by this method . before conclusions are drawn from the coded data , the coding consistency needs the last step is to report the methods and findings . according to this method , each interview was listened and was transcribed verbatim . following review , meaningful texts , words , sentences , and paragraphs were considered as semantic units and according to their connotation , reached the level of abstraction and conceptualization . data were coded , and all codes were compared in terms of similarities and differences and then classified into more abstract categories with specific labels . the coding and classification of data into categories and subcategories was discussed among the researchers continuously until they reached consensus on classification . data collection continued so until data saturation occurred in categories in relation to the process of data coding . at the end of the last three interviews , the researchers were confident that new ideas , concepts and categories of data would not be obtained . to enhance the rigor of our findings , several strategies were employed , including participants being asked to verify the themes that emerged following each step of data analysis . member checking and external control were both utilized to verify the accuracy and credibility of the data analysis process . data credibility was established by two experts in qualitative nursing research and peer reviewers . the researchers developed an audit trail , which is a systematic collection of materials and documentation reviewed by an independent auditor to confirm and approve the process . ethical approval was achieved from the ethical committee of tabriz university of medical science ( ethics code : 5/4/7617 ) . the ethical considerations of the study were as followings : informed consent ; right to withdrawal from the study ; confidentiality and anonymity and permission to audio recording of the interview . therefore , prior to the study , participants were informed about the aim of the study ; it was mentioned that they could withdraw from the study at any time ; then informed consent was obtained . to protect the privacy , confidentiality , and the identity of the participants , interviews were conducted only with the participation of the interviewer and the interviewee . demographic variables of nursing students who participated in this study are shown in table 2 . the results revealed that from the nursing students perspective ( n=14 ) , self - esteem referred to the value they gave to being a nursing student . from the findings , three main themes emerged and related to enthusiasm about being a nursing student , socialization into the profession , and sense of worthy related to perceived professionalism level ( table 2 ) . sense of worthy related to perceived professionalism level the findings revealed that if a student views nursing as a profession rather than simply a job and believed that they were in possession of the requisite traits to undertake that profession ( traits such accountability and the use of critical thinking ; ethics ; prestige ; professional knowledge and skills and professional independence ) , they would subsequently feel more worthy as education in nursing field . the following quotes from participants illustrate how they wanted to develop deeper understanding in order to better serve the profession as a whole : we would become more proud of being a nurse as we attended more specialized units ( p1 ) i want to know the reason for each procedures i m performing ( p2 ) sense of being worthy is determined through the feeling of power , usefulness , and a sense of spirituality and holiness . a student said : nursing student 's self - esteem means the feeling of power . ( p6 ) another participant said : the spiritual value of nurses is very high ... ( p11 ) the feeling of being important is somehow associated with the sense of superiority over other professions . if a student feels that her or his profession is not inferior to other professions , she or he will try to express her or himself . according to one of the participants : self - esteem means that a nursing student shall respect her or himself , should not underestimate her or himself , should not withdraw her or himself and should show her or his presence . socialization into the profession findings showed that nursing students felt socialized into the profession when they were able to see beyond the role - related limbo and accepted nursing as their future professional role . in other words , they perceived nursing as a part of their future identity , as the following quote exemplifies : i once asked someone who loved nursing why she loved it , and he told me because it had become a part of his identity . ( p2 ) another student said : i thought to myself , now that i m admitted in nursing and i do nt like it much , i do nt need to tell my friends or other people that i do nt like being a nurse because it will become a part of my identity . ( p3 ) behaviors representative of role tolerance and the permanent state of confusion and fear of the future can be seen in those who remain in a state of role - related limbo . a student who is in role - related limbo constantly envies the students from other disciplines and , in fact , merely tolerates their current role as a nursing student . regarding the role tolerance , a participant said : ... my friend who had low self - esteem was always saying i wish to get this course over with to be able to get on with my business ... . ( p4 ) regarding the state of confusion , a participant said : " sometimes i would think of studying medicine , but sometimes it would think to myself that no , it would be better to study nursing or according to the results , coping with roles is a characteristic of the students who have higher levels of self - esteem . to cope with roles means that there is acceptance the restrictions of the respective profession , but also hope of progress within it . regarding the acceptance of the profession s restrictions , a student said : i chose the nursing profession disregarding the positive or negative views of society.(p11 ) regarding the hope of professional progression within the profession , a participant said : i believe that one can be successful in the nursing profession too.(p1 ) theme 3 . enthusiasm about being a nursing student having pride in being a nurse was one of the major indicators of high esteem among the students . however , in relation to appreciation of one s self as a nursing student , opinions ranged from dislike of the profession to being proud of it . as one student put it : " i am a nurse , and i am proud of it . they enjoy and take pride in being introduced in public as a nurse . for them , the duties or tasks of the profession are not viewed a burden they will undertake eagerly . however , not all students felt this way , as this quote illustrated : changing the bed sheets was so unfavorable for me that i wished to finish the training hours soon ... ( p5 ) in contrast , another student stated : self - esteem of students means that they perform the tasks assigned to them fully from deep in the heart.(p9 ) regarding the characteristic of interest , a student said : well , self - esteem means a good feeling which a nursing student can have towards his or her major yes i have this feeling.(p11 ) concerning the joy of learning , another student said : the types of nursing lessons are in a way that i have a pleasant feeling while studying them ( p3 ) about the joy of being recognized as a student nurse , other student said : i do nt still like to wear the label now ( p7 ) on the contrary , another student said : i want to say that i am a nurse , and i am not anything else [ other professions related to medical sciences ] ( p11 ) this study focused on the exploration of nursing students understanding of self - esteem as it applied to them , through expressing their experiences . the findings suggested that nursing students ' self - esteem consisted of three main themes : sense of worthy related to perceived professionalism level ; socialization into the profession and enthusiasm about being a nursing student . it seems that , the concept of organizational self - esteem , similar to the nursing students understanding of self - esteem , emphasized a certain aspect of self - esteem . this concept of organizational self - esteem is based on cooper smith s definition of self-esteem.cooper smith defines self - esteem as the extent to which the person believes in her or his capability , successfulness and worthiness . organization based self - esteem is regarded as the level to which an employee considers him or herself as a competent , valuable and significant member of that organization . professional self - esteem is a multifaceted notion that determines the personal qualities of a profession and its effectiveness in specific working environments . in fact , professionalism not only involves the mental , emotional and psychological features of an individual but also their efficacy and practicability in her or his professional life . based on the researchers of this study , the meaning or the sense of professional self - esteem is no different from determining the characteristics and specific aspects of the concept of self - esteem in a range of similar vocational professions ( such as nursing , teaching , medicine , etc . ) . thus , socialization in the nursing profession is one of the aspects of the concept of self - esteem among nursing students or their professional self - esteem . mruk , provided a phenomenological theory of self - esteem including the interaction between two basic components of self - esteem , competence and worthiness . according to mruk , competence as a functional aspect of self - esteem is related to the skillfulness of an individual and worthiness refers to an individual 's effective evaluation about his abilities . he further discussed that competence is the behavioral component of self - esteem that is related to aspirations and successes which are easily observable . it seems that the becoming professional is consistent with the competence aspect of self - esteem as proposed by mruk . meanwhile , the sense of being worthy , such as the sense of importance and the sense of power , is consistent with the worthiness aspect of this theory . understanding the feeling of worthiness has long been one of the characteristics of self - esteem . another aspect of students ' self - esteem is related to the level of their socialization into the profession . professional socialization refers to a process in which novices enter the arena and develop into competent professional staff.with respect to the results of another study , learning , interaction , development and adaptation are four critical attributes of professional socialization . following professional socialization , a sense of belonging and in fact , the professional identity of nursing is formed when its members ( nurses ) believe and see themselves as a nurse.in the work context acting out a role creates a specific sense of professional identity with that role . the process that leads to the perception of unity with the job ( role ) is referred to as identification . according to jansen et al . , role membership and performance have consequences for self - esteem in identity theory.some studies have also stressed that professional socialization is effective in the improvement of professional self - esteem of nurses.it seems that , the more a nursing student is able to accept the role of the nurse as a part of his or her identity , the more enthusiasm they exhibit for being a nurse ; and this is indicative of a vertical relationship between the two mentioned aspects . regarding the theme of enthusiasm for being a nursing student and the inner sense of being proud of nursing and enjoying this profession , it must be stated that the characteristics of this aspect of self - esteem often have an emotional aspect and are not clearly manifest . about loving herself or himself as a nurse , it should be stated that , if we did not already like ourselves we would not care whether or not we felt good about ourselves . studies have indicated that individuals with high self - esteem show greater levels happiness and have less incidence of depression compared to those with low self - esteem and individuals with a good sense about themselves take pride in their work and derive satisfaction from their endeavors . according to the findings of this study , if the nursing student is proud of being a nurse , they will enjoy studying the courses , communicating with colleagues , and performing the tasks ; and in general will enjoy her or his career . as a consequence , this will be evident in his or her feelings and behaviors . the results of this study revealed that the nursing students self - esteem is influenced greatly by their professionalization and socialization . because of the length of time students are under the guidance and supervision of academic institutes and academic staff , cognizance needs to be given to factors that will facilitate the development of higher levels of self - esteem amongst nursing students during curriculum development . furthermore , the concept of self - esteem is affected by different cultural influences and contexts . this study was conducted in northwest of iran , therefore findings will be context specific . it is recommended that similar studies be conducted in other countries . this article was part of a phd dissertation approved by the research deputy of tabriz university of medical sciences with the ethics code : 5/4/7617 . our sincere appreciation goes to tabriz university of medical sciences for their financial support and to all the students who participated in this research .

introduction : the concept of self - esteem has several definitions in different paradigms . nursing has a unique and combined paradigm ; therefore it is necessary to explore nursing students understanding of the concept of self - esteem . the present study aimed to discover the extent and characteristics of the concept of self - esteem from the perspective of iranian nursing students through a qualitative approach . methods : this study was conducted using the conventional content analysis method with the participation of 14 nursing students . purposive sampling was used to recruit participants and data were collected through in - depth semi - structured interviews and analyzed simultaneously . results : study findings showed that the nursing students self - esteem is related to the sense of worthy they perceived as being a nursing student . nursing students self - esteem was determined through sense of worthy related to their perceived professionalism level , socialization into the profession , and enthusing of them about being a nursing student . conclusion : if a nursing student was proud of her or his nursing role , then he or she would enjoy the nursing course and all that entailed ; such as communication with colleagues , performing the tasks and , generally her or his career .

You are an expert at summarizing long articles. Proceed to summarize the following text: knee osteoarthritis ( knee oa ) is a multifactorial disease caused by aging , obesity , certain genetic factors , mechanical load , etc . in japan , it is estimated that approximately 50% of the population over 50 years of age have oa . knee and joint disease , including knee oa , is the first largest cause of need for assistance in the elderly and the fourth largest cause of need for care1 . although deformation of the knee accelerates with age , knee oa patients without severe disease do not seek medical help because the activities of daily living ( adl ) would have not been overly compromised ; however this eventually leads to worsening of the condition2 . several studies on various aspects of knee oa have been reported , including its cause , therapy , and prevention . according to the 2014 non - surgical treatment guidelines by the osteoarthritis research society international3 , exercise on land , and in water , weight management , self - management , patient education , and muscle strengthening exercises are core elements of treatment . therefore , in many countries , including japan , the establishment of methods for the prevention and treatment of knee oa is urgently needed with an increasing role for physical therapists as exercise specialists . the knee joint muscles , particularly weakening of the knee extensors and flexors , are reportedly involved in the development of knee oa4 . recently , the hip muscles , which are involved in frontal and horizontal plane alignment of the lower extremities , have also been reported to be involved in the development of knee oa5 . in addition , a relationship between knee joint muscle strengths and physical activity has been reported6 ; therefore , there is little doubt that lower limb muscle strength is very important in terms of both prevention and treatment of knee oa . on the other hand , if there is joint laxity , involving the bone and ligaments , muscles , and joint capsule , with joint movement beyond a certain range of motion , joint disruption will be marked . joint laxity is considered to be a developmental factor in sports injuries7 , 8 . furthermore , knee - joint instability ( e.g. , chronic syndromes after anterior ligament injuries ) could precede knee oa9 , 10 . therefore , consideration of knee - joint laxity and structural instability from the viewpoint of knee oa prevention is crucial . as described above , both of muscle strength and knee - joint laxity in lower extremities however , when muscle strength and laxity overlap , the effects on knee deformation remain unclear . this study examined the associations between knee muscle strength , knee bone malalignment , and knee - joint laxity ; with oa from the viewpoint of knee oa prevention , in the community - dwelling elderly . the subjects consisted of 90 healthy elderly persons ( 22 males , 68 females ; mean age sd : 72.5 5.13 years ) , who had no disease or pain that would make participation in this study difficult . knee extensor and knee flexor muscle forces , knee - joint laxity , and alignment of the femorotibial angle ( fta ) were evaluated for each participant . therefore , a total of 90 legs was evaluated . in order to evaluate knee - joint malalignment , the kellgren - lawrence grading classification based on x - ray imaging11 and pathology using mri ( magnetic resonance imaging)12 are commonly used . however , it has been reported that abnormal findings on simple x - ray and mri examinations may not necessarily match subjective pain and clinical symptoms13 . in this study , all measurements were taken at a regional community center rather than at a medical venue ; therefore the following method for simple knee - joint malalignment assessment was used . the angle between the two lines combined with the anterior superior iliac spine , the center of the patellar , and the center of the angle joint in a single barefoot standing position [ modified fta ( mfta ) ] was measured ( fig . the angle between the two lines combined with the anterior superior iliac spine , the center of the patellar , and the center of the angle joint ) . all subjects could stand on their one - leg by oneself and during being measured they were using their forefinger for support , and for all legs , the mfta values were higher than 170. in the previous study14 , 15 , it was reported that the range of fta 174 to 177 in japanese subjects , so in this study , legs with mfta values higher than 175 were classified as deformed knee joints ( i.e. , malalignment possible ) . to evaluate knee - joint laxity , the range of motion of knee extension was measured according to carter et al.16 , and overextended knees were classified as loosening of the knee joint ( i.e. , laxity possible ) . knee extensor and flexor muscle force was measured as isometric maximal force using a hand - held dynamometer ( tasf-1 , anima corporation , japan ) . during muscle force measurement , all participants were seated on chairs with hip and knee joints flexed at 90 and lower legs secured by a belt ( fig . 2.measurement of muscular forces(lt : knee extensor muscles , rt : knee flexor muscles)the forces were measured as isometric maximal force using a hand - held dynamometer ( tasf-1 , anima corporation , japan ) with seated on a chair with hip and knee joints flexed at 90 and lower legs secured by a belt . ) . the angle between the two lines combined with the anterior superior iliac spine , the center of the patellar , and the center of the angle joint measurement of muscular forces ( lt : knee extensor muscles , rt : knee flexor muscles ) the forces were measured as isometric maximal force using a hand - held dynamometer ( tasf-1 , anima corporation , japan ) with seated on a chair with hip and knee joints flexed at 90 and lower legs secured by a belt . all legs were classified into 4 groups : ( a ) no malalignment , no laxity ; ( b ) no malalignment , laxity possible ; ( c ) malalignment possible , laxity possible ; and ( d ) malalignment possible , no laxity . kruskal - wallis rank sum data was used for knee extensor comparison and one - way analysis of variance ( anova ) for knee flexor comparison . the significance level was set at 5% and all statistical processing was performed using spss ver.21 for windows . and in order to compare the balance of the both muscles , the knee flexor muscle strength / knee extensor muscle strength ratio , just like the hamstring / quadriceps ratio ( h / q ratio ) , was calculated and used as a material for consideration . as an ethical consideration , all subjects were informed of the purpose and procedure of the study , and provided written informed consent before participation . group a included 25 knees ( 6 males and 19 females , height : 153.8 5.68 cm , weight : 51.2 10.08 kg ) , group b included 25 knees ( 6 males and 19 females , height : 153.4 4.75 cm , weight : 54.3 8.75 kg ) , group c included 15 knees ( 3 males and 12 females , height : 155.1 6.28 cm , weight : 52.2 7.28 kg ) , and group d included 25 knees ( 7 males and 18 females , height : 153.3 8.83 cm , weight : 53.6 7.31 kg ) . among each group knee extensor muscle force was higher in group b than in groups c and d ( a : 1.59 0.78 nm / kg , b : 1.64 0.66 nm / kg , c : 1.27 0.44 nm / kg , and d : 1.33 0.65 nm / kg ) . knee flexor muscle force was higher in group a compared to groups b , c , and d , with a significant difference between groups a and c ( a : 1.03 0.35 nm / kg , b : 0.86 0.36 nm / kg , c : 0.63 0.27 nm / kg , d : 0.81 0.42 nm / kg ) . no significant difference in knee extensor muscle force among the four groups was observed ( p=0.171 ) . however , when each group was compared , although there was no significant difference , several low values were observed in groups c and d compared to groups a and b. for knee flexor muscle force , a significant difference was observed among the four groups ( p=0.012 ) and a significant difference between groups a and c ( p<0.01 ) was observed on multiple comparison . the results of calculated knee flexor muscle strength / knee extensor muscle strength ratio in each group was below ; group a was 65% , group b was 52% , group c was 50% , and group d was 60% . in this study , the presence of knee - joint malalignment and laxity were measured and classified in the four groups and knee flexor and extensor muscle strengths among the groups were compared . as a result , a significant reduction in knee flexor muscle strength in group c compared to group a was confirmed , which suggests that the knee flexor muscles are also very much involved in the development of knee oa . no significant difference in knee extensor muscle force was observed among the four groups ; however , the groups with malalignment tended to have lower values . screw home movement ( shm)17 is thought to be a possible reason . in order to extend the knee joint smoothly its function is to stabilize the knee joint by a rotation movement and lack of this movement is believed to influence adl adversely . it is thought that there is some abnormal knee extension with malalignment of the knee joint and that knee extensor muscle strength is reduced in unstable knee states . regarding the knee flexors , a significant difference was observed between group a ( 10.2 3.44 kg ) and group c ( 6.2 2.64 kg ) . although weakness of the quadriceps has been frequently to be a cause of deformation , this result raises the possibility of conflict between the hamstrings and the quadriceps muscles . because biceps femoris is a two - joint muscle , weakness of the knee flexor may also affect the pelvis and trunk . for example , weakness caused by pelvis posterior tilting and displacement of the femur in external rotation may result in varus positioning of the knee joint . the observed difference between groups a and c may be due to a vicious kinetic chain of overload on the knee joint , leading to difficulties with hamstrings contraction . and from the perspective of the knee flexor muscle strength / knee extensor muscle strength ratio , compared to 65% in group a while a h / q ratio of 6070% has been reported to be ideal for balance18 , 19 , decrease was seen in group c. in group a , it can be seen that the knee flexors are able to take advantage of the well - balanced knee extensors at 65% ; however , in group c , the knee flexors successfully used antagonistic muscles to the knee extensors , which potentially brought about a significant drop in muscle force . in order to prevent knee - joint deformation by direct transmission of external forces , knee extensors and surrounding muscles play a role in stability of shock absorption to the knee joint by working cooperatively with muscles such as the knee flexors . therefore , it is necessary to take into account the balance between the knee flexors and extensors . compared to the results of group b and d , there was no significant difference , but it might be possible that knee extensor muscle force of group d was weak and knee flexor muscle force of group b and d was weak . from the results of this study , those with a mixed of laxity and malalignment of the knee joint might have the weak knee flexor muscle force , but additionally , it was thought to be possible that laxity would be related to the knee flexor muscle force and malalignment would be involved to both of the knee extensor muscle and flexor muscle forces . it is necessary in the future to further study what kind of influence the laxity and malalignment would bring to the knee joint muscles . as a limitation of the present study , it was unclear if the original mfta in this study correctly measure the presence or absence of deformation ; therefore , its association with oa can not be mentioned in detail . furthermore , knee - joint laxity and muscle strength were only measured in the sagittal plane , and for the knee oa variant in the frontal plane , it is necessary to capture frontal plane laxity . as mentioned above , the hip muscles are also involved in horizontal plane alignment of the lower extremities5 , and low lateral stability has been reported in people who easily20 . in the future , it will also be necessary to consider laxity and muscle strength of the lateral side .

[ purpose ] from the viewpoint of prevention of knee osteoarthritis , the aim of this study was to verify how muscle strength and joint laxity are related to knee osteoarthritis . [ subjects and methods ] the study subjects consisted of 90 community - dwelling elderly people aged more than 60 years ( 22 males , 68 females ) . femorotibial angle alignment , knee joint laxity , knee extensors and flexor muscle strengths were measured in all subjects . in addition , the subjects were divided into four groups based on the presence of laxity and knee joint deformation , and the muscle strength values were compared . [ results ] there was no significant difference in knee extensor muscle strength among the four groups . however , there was significant weakness of the knee flexor muscle in the group with deformation and laxity was compared with the group without deformation and laxity . [ conclusion ] decreased knee flexor muscle strengths may be involved in knee joint deformation . the importance of muscle strength balance was also considered .

You are an expert at summarizing long articles. Proceed to summarize the following text: virtual glaucoma clinics allow rapid and reliable patient assessment,14 with data collected by nursing and non - medical staff reviewed virtually by a senior ophthalmologist . however , with rapid throughput and loss of chair - time with an ophthalmologist it is important to confirm that patients remain satisfied with this aspect of service delivery and that patient education remains adequate to provide knowledge and awareness sufficient to maintain concordance with therapy and follow - up . the purpose of this study is to investigate non - inferiority of a new virtual clinic format by comparing experiences of patients managed via this pathway with a control group reviewed via the standard clinic , and to compare patients understanding of their condition and management . clinical data obtained by an internally accredited ophthalmic nurse practitioner is reviewed virtually by a consultant ophthalmologist making the clinical decision . data comprises of standardized history and slit lamp examination , intraocular pressure ( iop ) , optic disc imaging ( heidelberg retina tomograph [ heidelberg engineering , heidelberg , germany ] , and/or kowa non - mydriatic 3d [ kowa medical , hamamatsu , japan ] ) and humphrey 24 - 2 visual fields ( carl zeiss meditec ag , jena , germany ) . this model of care is applicable to all newly referred patients and for follow - up patients for whom a virtual clinic review had previously been requested or who needed to have their next clinic appointment details specified eg , need for resetting of a previous date due to iop not in target range , possible progression of visual field or optic disc parameters . the clinical competencies of the non - medical staff regarding slit lamp examination of the eye , measurement of iop , interpretation of visual fields , and clinical decision making had previously been confirmed as part of the institutional accreditation process . this is based on the same scheme of assessment as for medical ophthalmic trainees using the portfolio system of the royal college of ophthalmologists . all 135 patients reviewed via the virtual clinic from april to august 2013 were identified prospectively for this study and recorded in a database . they were sent general and patient satisfaction questionnaires ( modified quality of care through the patient s eyes quote questionnaire , nijkamp et al)5,6 by post in september 2013 . for the control group 100 patients attending standard glaucoma clinics in october 2013 were given questionnaires when they attended the clinic . the patients were selected on the basis of being consecutive attenders at the actual clinic and consecutive patients presented via their clinic notes to the consultant ( ma ) undertaking the virtual clinic review . data were obtained for demographics , understanding of glaucoma , their own condition and its management , together with their satisfaction with their experience ( modified quote questionnaire),5 and quality of information received . the demographics of the standard and virtual clinic patients ( table 1 ) were comparable other than the proportion of new to follow - up patients ( 0.14 versus 0.34 , respectively , p,0.01 ) . the questionnaire results were analyzed by looking at the analysis of variance ( anova ) using spss statistics ( ibm corporation , armonk , ny , us ) . patients scored their satisfaction from 1 ( very dissatisfied ) to 5 ( very satisfied ) for a series of questions . the overall mean satisfaction score for all questions combined was 4.6 and 4.5 for the standard clinic and virtual clinic respectively and there was no evidence to suggest that patients reviewed via the virtual clinic felt disadvantaged compared to those consulting with a doctor face to face . patients were asked questions about their diagnosis and treatment and their answers were compared with the doctors recorded diagnosis and treatment to assess individuals understanding of their own condition ( figure 1 ) . understanding was high in the virtual clinic group , with 95% of patients correctly identifying their diagnosis as glaucoma , 83% as ocular hypertension , and 78% as glaucoma suspects . this is particularly reassuring when considering one third of these were new patients and had not consulted face to face with a doctor . no inferiority was demonstrated in knowledge between virtual and standard clinic patients despite this higher proportion of new patients in the virtual clinic group for whom there may be increased diagnostic uncertainty and fewer opportunities to receive information and ask questions . the study identified nine patients who had been started on treatment via the virtual clinic . this new treatment is issued via a treatment recommendation form sent to the patient to take to their general practitioner to alter their prescribing record . they are informed about this process at their initial appointment when their data are collected , receive a telephone call by the glaucoma nurse practitioner to discuss it , and are brought back to clinic for early review . three patients were identified as requiring trabeculectomy surgery and attended the clinic to confirm and discuss this . patients knowledge about glaucoma and self - perceived understanding were analyzed comparing the responses to each question for new versus follow up patients , whether they had received an information leaflet or not , and whether they had received a clinic report or not using anova . patients were asked to grade their understanding of glaucoma , their personal diagnosis , and their treatment ( what it does and how to use it ) from 5 ( strongly agree ) to 1 ( strongly disagree ) to gauge their confidence in their knowledge . self - perceived understanding was high across the groups with modal scores of 4 out of 5 for understanding of glaucoma and their diagnosis for both the standard and virtual clinic groups , and 5 out of 5 for understanding of their treatment and no evidence was found of inferiority ( p>0.05 ) . the use of written information is proposed as a key factor in improving patient understanding and information retention , and virtual clinic patients who received a leaflet felt they understood what their drops did better than those who did not ( p=0.04 ) . there was insufficient evidence to support a difference between new and follow - up patients or those who had received a clinic report or not . did you know ? questions in a simple yes or no format to assess their knowledge about glaucoma in general ( figure 2 ) . follow - up patients reviewed in the virtual clinic knew more about glaucoma than new patients ( p=0.02 ) reflecting the importance of repeating information to improve understanding and retention of information . the increased proportion of follow - up to new patients in the standard clinic versus the virtual clinic was thus a confounding factor in the comparison between the clinic and virtual groups but overall there was no evidence of a significant difference in knowledge . there was insufficient evidence to support a difference between those who had received an information leaflet or not or those who had received a clinic report or not . this leaflet was written by the lead glaucoma consultant ( ma ) and approved for patient - suitable language and use by the institution s editorial board . however , two thirds of standard clinic patients and one third of virtual clinic patients did not recall receiving one ( in some cases contrary to documented issuing ) . there is therefore some scope for improvement in the giving of written information and efforts are made to keep the clinics well stocked with leaflets and give regular reminders to medical and non - medical staff to give them to patients . new patients and patients seen by the nurse practitioners were more likely to have received a leaflet . there was insufficient evidence in this study to support the hypothesis that those who received information leaflets had better knowledge than those who did not , though there was evidence that patients did feel they understood what their treatment did better if they had received a leaflet as discussed above . forty percent of standard clinic and 40% of virtual clinic patients said they had sought further information about glaucoma . fifty - six percent of patients had personal access to the internet and 28% had access via a relative or friend . however , only 26% of those with personal access had searched for information about glaucoma online . the international glaucoma association website is recommended in our information leaflet and clinic outcome report but few patients had visited it ( figure 3 ) . virtual clinic patients are sent a standard written report from the consultant following the virtual review of their results . ninety - five percent of virtual and clinic patients who received and read the report said they understood it and 88% felt it was helpful . one percent of virtual clinic patients and 17% of standard clinic patients said they would object to receiving a prescription for a new eye drop through the post . patients are telephoned by the nurse practitioner to initiate a new treatment in addition to the written report and prescription as a result . satisfaction was high regardless of whether they were reviewed via the virtual or standard clinic . patients understanding of their diagnosis and treatment was high across both groups and self - perceived understanding of glaucoma , their own condition , and treatment is high . the majority of patients know that glaucoma affects the optic nerve , is often caused by high iop and with treatment vision usually remains good . the nuances of normal tension glaucoma , ocular - hypertension and glaucoma suspects were less well understood but felt to be less important to patients and their likely concordance with management . the acceptance of a model of care , whilst important from the point of view of patient experience , can not of itself guarantee any particular level of concordance with care or adherence to treatment . no evidence was found to support a hypothesis that patients reviewed virtually rather than in person by a doctor feel they receive an inferior quality service . it would be useful to know the converse , that patients seen in person would feel equally well supported if they had the ophthalmologist input to their care via a virtual clinic evaluation . a spanish study by blzquez et al7 reported high levels of patient satisfaction with a telemedicine glaucoma screening program among an at - risk population but this is the first study we are aware of that looks at the satisfaction of patients reviewed virtually who have already been referred into the hospital eye care setting compared to the traditional standard clinic format . the similar levels of satisfaction and understanding between the standard and virtual clinic patients despite the significantly higher proportion of new patients in the virtual clinic group suggests that this model of care is acceptable for both new and follow - up patients . the study groups did not include sufficient numbers of patients with advanced glaucoma as to be able to allow for specific conclusions to be drawn as to the more complex therapeutic decision making and therefore communication requirements for such patients . nevertheless , the additional clinic capacity gained by use of virtual clinic working for less demanding individuals would allow more time for those with greater needs . the need for iop lowering surgery is invariably based on the levels of recorded iop compared with target at maximum tolerated medical therapy and the progression of any visual field defect . the tolerability of medical therapy is able to be assessed by a non - medical practitioner . iop ( by an accredited practitioner ) and visual fields data ( with progression software ) were available in the virtual clinic data . it is of course important to regularly confirm the diagnostic , management , and communications competencies of all clinical staff , both medical and from professions allied to medicine via schemes for continuing education and appraisal to maintain a high quality service . patients value written information in the form of information leaflets and clinic reports and work needs to be done to improve the proportion who receive these ; they remain the main source of additional information for patients . all patients attending the glaucoma clinic , whether they have been seen by a member of the medical staff or a practitioner from a profession allied to medicine and whether or not their clinical data are scheduled for virtual clinic review have access to additional support and information from the on - site eye clinic liaison officer . our future work will address the contributions made to satisfaction and awareness by combinations of ophthalmologist , nurse , and eye clinic liaison officer input . virtual clinic models help optimize the use of resources to help address the large over - demand on hospital eye services . a recent large retrospective study by wright and diamond4 highlighted this need and showed the benefits to safety and efficiency from having specialist supervision of decisions made by optometrists about glaucoma patients care . our model utilizes non - ophthalmologists for data collection and education of patients but not in the decision making . further studies looking at cost - benefit analysis and optimizing the care pathway are needed to find the overall best model of care . whilst our study supports the comparability of virtual clinic enhancement of non - medical practitioner clinics with standard clinics with respect to understanding of their condition and overall experience , there remains considerable room for improvement in significant numbers of patients in each study group . the virtual clinic model allows a substantial proportion of glaucoma pathway patients to be seen by non - medical staff and yet be supervised by a glaucoma specialist . this allows rapid throughput to address the increasing demands on our service and allows doctors time to be prioritized to the most complex patients and those at greatest risk of progression . the results of this survey shows that patients seen in this way receive adequate information and education about their condition , which we feel is important to help maintain appreciation of the value of attending follow - up appointments and concordance with management . patients are accepting of this type of care and report high levels of satisfaction with the nurse - led clinic experience .

purposevirtual glaucoma clinics allow rapid , reliable patient assessment but the service should be acceptable to patients and concordance with treatment needs to be maintained with adequate patient education . this study compares experiences and understanding of patients reviewed via the virtual clinic versus the standard clinic by way of an extended patient satisfaction questionnaire ( psq).patients and methodsone hundred psqs were given to consecutive patients attending glaucoma clinics in october 2013 . all 135 patients reviewed via the virtual clinic from april 2013 until august 2013 were sent postal psqs in september 2013 . data were obtained for demographics , understanding of glaucoma , their condition , satisfaction with their experience , and quality of information . responses were analyzed in conjunction with the clinical records.resultseighty-five percent of clinic patients and 63% of virtual clinic patients responded to the psq . the mean satisfaction score was over 4.3/5 in all areas surveyed . virtual clinic patients understanding of their condition was very good , with 95% correctly identifying their diagnosis as glaucoma , 83% as ocular hypertension and 78% as suspects . there was no evidence to support inferior knowledge or self - perceived understanding compared to standard clinic patients . follow - up patients knew more about glaucoma than new patients . over 95% of patients found our information leaflet useful . forty percent of patients sought additional information but less than 20% used the internet for this.conclusiona substantial proportion of glaucoma pathway patients may be seen by non - medical staff supervised by glaucoma specialists via virtual clinics . patients are accepting of this format , reporting high levels of satisfaction and non - inferior knowledge to those seen in standard clinics .

You are an expert at summarizing long articles. Proceed to summarize the following text: inflammatory bowel diseases ( ibds ) , which include crohn s disease ( cd ) and ulcerative colitis ( uc ) , are chronic immune - mediated , inflammatory diseases of the digestive tract characterized by abdominal pain , rectal bleeding , diarrhea , and fatigue.1 in some cases , extraintestinal symptoms such as eye or skin inflammation and joint pain are present.2 perianal fistulas occur in ~30% of ibd patients and may be a considerable source of distress.3 incidence and prevalence rates of ibd are increasing globally.4 treatment options for ibd include oral and injectable medications and intravenous infusions , often used in combination to induce remission as defined by symptoms , endoscopic appearance , and biomarkers.1 surgical interventions are common , with the cumulative risk for surgery 7 years after diagnosis being 29% for cd and 13% for uc.5,6 the physical , psychological , social , and financial ramifications of ibd are substantial , and the understanding of the role of illness stigma in these effects is minimal . psychosocial functioning including reduced health - related quality of life,710 increased depression and anxiety,1116 and relational17,18 and social issues19 are common . these impacts can be due to the illness itself or side effects from some ibd medications ( eg , corticosteroids ) or surgery.20,21 social withdrawals,22 feelings of being different from others,2325 and degradations in body image23,26 have all been reported . psychosocial impacts of ibd result in poorer patient reported outcomes including increased health care utilization,27,28 reduced treatment adherence,29,30 and increased disease activity.3133 financially , people living with ibd pay ~3,000 to 6,000 usd more annually for health care costs than those without ibd.34 aggregate annual estimates of total direct health care costs for ibd range from 500 million usd ( uc ) to 2.3 billion usd ( cd).35 indirect costs from lost productivity and similar issues related to ibd are also in billions of dollars.3537 poor ibd self - management contributes to increased financial burdens , and improving illness self - management via improvements in ibd - related self - efficacy , streamlining communication between physician and patient , and increasing patient buy - in to treatments all demonstrate improvement in patient outcomes.3841 while stigma has not been directly studied in relation to ibd self - management , it is associated with decreases in self - esteem and self - efficacy42 suggesting that stigma may be associated with poorer disease management . chronic illness stigmatization , most notably characterized in mental health4345 and hiv / aids4648 research , is a common and global social issue.49 while the majority of research in this area is in the aforementioned conditions , other chronic illnesses such as cancers,5052 hepatitis c,5355 epilepsy,5658 leprosy,5961 and obesity6265 have well - documented stigmatization . illness stigma has a myriad of public health implications including limiting access to medical care , increasing treatment nonadherence , increased psychological distress , decreased self - esteem and self - efficacy , and increased illness symptoms.6673 the construct of stigma has evolved since erving goffman s seminal work defining stigma as a state of spoiled identity brought on being deeply discredited and socially rejected for having a particular trait.74 in 2001 , link and phelan75 expanded the stigma model to include a convergence of labeling , prevailing cultural beliefs , disconnection of the stigmatized from others , and loss of social status combined with discrimination experiences . research into stigma remains steady , with several hundred studies being published per year over the past decade . prevailing stigma theory delineates stigma into three domains : perceived or felt stigma , where the individuals sense that others hold negative attitudes or beliefs toward them or their condition ; enacted stigma , or actual discriminatory experiences ; internalized or self - stigma , or belief by the stigmatized individuals that negative attitudes or stereotypes about their condition are true and apply to them.76 a fourth and adaptive domain , stigma resistance , has been captured via research utilizing the internalized stigma scale for mental illness by boyd et al.77 in any particular individual , one to all four of these stigma domains may be at play , and the relationships between each and patient outcomes are well documented.49,70,7881 jones et al82 identified six traits of a condition or trait that lend it to stigmatization : concealability , variability in course , aesthetic qualities , disruptiveness , origin , and perceived threat . of these , the severity of the illness and a perception that the condition was caused by behavior of its bearer are most likely to predict stigmatization.83 based on these parameters , combined with the social taboo related to bowel symptoms in most cultures , ibd is susceptible to illness - related stigma . the severity of ibd varies by patient , but as a whole ibd is considered a serious illness with complex medical regimens to keep inflammation and symptoms in a state of remission , including the use of intravenous infusions ( eg , infliximab and vedolizumab ) . while the etiology of ibd is better understood today as an immune - mediated disease , historically ibd was viewed as a psychosomatic illness with personality traits that made an individual susceptible to its occurrence . the notion that a person could develop cd due to obsessional behavior lends it to stigmatization.84 today , multiple triggers of disease onset and/or activity are identified including infection , antibiotic use , smoking , low mood , nonsteroidal anti - inflammatory drug use , and stress.85 perceived stress , negative mood , and stressful life events are often associated with ibd flares.85 identifying psychological reasons for disease activity is important , yet brings with it the potential for others to view ibd symptoms as under the person s control due to a lack of ability to manage his or her psychological state or stress levels . initial inquiries into stigmatization of gastrointestinal illness occurred with the irritable bowel syndrome ( ibs ) . stigma studies in ibs find that a significant percentage of patients report some illness stigmatization.86 however , differences in the etiology between ibs and ibd ( ie , functional vs organic ) lend themselves to potential differences in stigmatization.87 some patients with ibd are also diagnosed with ibs when their cd or uc is considered to be in remission via physiological markers yet the patient continues to exhibit symptoms.88 unfortunately , to date , no studies exist evaluating stigma experiences in ibd patients diagnosed with ibs . to date , , we evaluate the three primary stigma domains and the relationship of each to patient outcomes , disease management , and course . a literature search of studies published in english between 1985 and july 2015 was performed via the online databases pubmed , psycinfo , and google scholar . the 1985 cutoff was selected based on the seminal jones et al study which better defines stigma as it relates to chronic medical illness.82 the following keyword combinations were used : 1 ) inflammatory bowel disease , crohn s disease , ulcerative colitis combined using the and operator with 2 ) stigma , stigmatized , stigmatization , discrimination , prejudice , stereotype , shame , bullying , blame , and teasing ( eg , crohn s disease and stigmatization ) . article titles and abstracts were screened for relevance and full - text articles retrieved for a more detailed review . articles identified via the database searches were reviewed by the authors for relevance to the stigma construct and those not specifically addressing stigma were removed from the final review . the preferred reporting items for systematic reviews and meta - analyses flow diagram for the literature search is outlined in figure 1 . the majority was published in the usa and evaluate perceived stigma ( 15 studies ) . four studies evaluate internalized stigma , five evaluate enacted stigma , and two evaluate more than one stigma domain . adult and child / adolescent studies of stigma were included . specific measures of health - related stigma are abundant and summarized elsewhere.89 the findings are organized by the three stigma domains ( table 1 ) . the most widely studied of the stigma domains in ibd is perceived or felt stigma , with 84% of participants in a recent study reporting some perceived stigma.42 several studies report persons living with ibd having concerns about how others see them,25,26,90 feeling different than others,26 feeling shame,91 and feeling discredited , including by medical providers.26,87 for example , hospitalized patients requiring pain management report being labeled as a difficult patient , needy , that they can not tolerate pain properly , or are inappropriately seeking narcotic painkillers ( ie , drug - seeking patients).92 fatigue is a commonly reported ibd symptom and patients report significant social impact with little understanding from their medical providers.93 a follow - up inquiry by the same author with health care providers found that considerable frustration and difficulty in understanding ibd - related fatigue was common,94 indicating a significant disconnect between providers and patients . older patients , especially women and patients with uc , tend to report greater disease felt stigma as do patients with lower educational backgrounds.95,96 stigma perceptions appear to be stable whether the disease is active or in remission and do not appear to vary between uc and cd.23 as ibd is a concealable illness , the issue of disclosure is a salient concern for many patients . individuals living with concealable conditions may opt to pass as someone without a chronic illness or cover by downplaying the severity of its symptoms.97,98 most often , persons living with ibd report nondisclosure due to embarrassment related to its symptoms.98 fears of the threat of incontinence , bowel sounds , or urgency while in public can have significant negative impacts on patients social interactions , often leading to withdrawal and isolation as to protect themselves from potential shame.26,90 passing can be challenging , especially when the patient must use the toilet multiple times per day,98 so covering is more often employed especially to safe others . guilt about being a burden to others and stoicism may also contribute to nondisclosure.26,99 concealment is often associated with reduced communication , interactions , and transactions with others thereby increasing feelings of isolation and depression . disclosure can yield positive results , providing a sense of relief from the stress of keeping ibd hidden and mitigating the effects of stigma.99 as can be expected , experiences with ibd disclosure vary considerably . some patients report being very open about their condition while others may tend to keep it hidden except with family and close friends.99 disclosure in employment settings comes with its own unique challenges.100 racial differences exist , with caucasians more likely than african - americans to disclose their ibd status to their employer or fellow employees.101 the reactions in occupational settings are mixed . a 1992 study of patients with cd found that 37% of patients currently employed felt their employer did not need to know about their ibd and 30% were in favor of active concealment . additionally , 24% felt ibd had limited their employment prospects including avoiding seeking a promotion or being denied promotion because of their illness.102 conversely , a 1988 study found the majority of participants reported high workplace disclosure ( 81% ) , and that 80% of coworkers and 77% of employers had been generally helpful.103 these significantly different findings on employer attitudes may be related to a wide variability in employment culture as a whole , geographic differences in health - related stigma , or the level of familiarity that surveyed employers had with ibd . it highlights that ibd patient experiences with perceptions of negative attitudes from employers will likely vary widely , highlighting the importance of inquiring about each individual s experience in a clinical setting . academic and school settings also present challenges for people living with ibd . in one study , 50% of children reported that their teachers were unsympathetic toward their illness.104 another study found that 21% of college - aged students found lecturers to be indifferent and 8% found them to be hostile toward their disease.102 perceived stigma in ibd patients is associated with several outcomes including increases in psychological distress,42,105 decreases in health - related quality of life , reduced medication adherence , and decreased self - esteem and self - efficacy.42 patients who perceive poor social support prior to surgery report poorer quality of life after the procedure.106 if the surgical intervention results in an ostomy , quality of life may improve in some patients in that they feel more in control of their illness107 while others may experience an increase in both perceived and internalized stigma.108 simply perceiving that others hold these negative attitudes is sufficient to degrade patient well - being . whether or not the individual internalizes the stigma can lead to even greater distress , and thus , is an important line of inquiry in stigma research . internalized or self - stigma may be related to the poorest outcomes of the three stigma domains in that patients apply negative attitudes and stereotypes to themselves rather than rejecting them as false . internalized stigma includes alienation , stereotype endorsement , discrimination experiences , and social withdrawal.77 patients with ibd report feeling damaged,26 especially as it relates to physical changes from the disease or its treatments ( eg , weight loss or gain , stunted growth , and skin rashes ) . self - blame regarding the onset of ibd or the presence of its symptoms postdiagnosis is associated with poorer adjustment to the illness.109 the presence of an ostomy can contribute to self - stigma in some cases,110,111 while in others it produces positive results including feelings of satisfaction with their illness management.112 one study specifically evaluates internalized stigma and stigma resistance in ibd.113 overall , 33% of people living with ibd report internalized stigma with alienation and social withdrawal being the most common . in general , ibd patients report mild levels of internalized stigma while a larger majority report stigma resistance attitudes and behaviors suggesting that while ibd patients perceive others hold stigmatizing views , they tend to not incorporate them into their sense of self . levels of internalized stigma are associated with lower educational levels , residing in an urban setting , and having extraintestinal symptoms . unlike stigma perception , patients who identified themselves as in remission reported less internalized stigma and greater use of stigma resistance behaviors . internalized stigma in ibd patients predicts reduced health - related quality of life , poorer self - esteem and self - efficacy , and increased psychological distress . patients report many people simply do not understand ibd , which may cause some to accuse persons with ibd of exaggerating their condition for secondary gain.26 in 1992 , mayberry found that 50% of cd patients compared to 24% of matched healthy controls had significant trouble finding work and long - term unemployment exceeding 6 weeks.102 mayberry115 evaluated employer attitudes and practices toward people living with cd . only two out of 35 companies would reject candidates because of ibd . however , 33 of 35 would rely on preemployment medical examinations to make hiring decisions and 8% said ibd would negatively impact promotion consideration . sixty percent would support employee experiencing a relapse by providing a lighter work period and 16% would pay for private care ; 30% would not extend paid leave time for outpatient appointments . due to the dearth of studies on enacted stigma in ibd patients , additional research is important to close the gaps in the understanding of how common enacted stigma is , what the more common sources of discrimination are , and how enacted stigma influences outcomes . based on the results of this review , ibd is susceptible to stigma because of its concealability , embarrassing symptoms , and historical view of ibd being a psychosomatic condition . the most commonly studied type of stigma is perceived stigma , evident in 17 studies and demonstrating that the majority of ibd patients perceive stigma from their peers , significant others , colleagues , and physicians.42 perceived stigma is the easiest construct to identify , but may have less to do with outcomes than deeper levels of stigma such as internalized or enacted . for example , patients who perceive stigma but do not internalize it may utilize coping strategies that would be found in any stigma - reducing intervention technique ( eg , cognitive reframing ) . future research could probably shift away from perceived stigma at this point and focus on other forms . internalized stigma , or the incorporation of stigmatizing beliefs and attitudes into one s sense of self , is potentially the most detrimental to ibd outcomes because it results in declines across physical and psychological functioning more than perceived stigma . in other disease groups , similar findings are noted.77 as ibd requires substantial self - management to maintain remission , adhere to medications , follow disease surveillance protocols ( eg , colonoscopy and regular laboratory testing ) , vaccination , and other health guidelines , stigma could potentially interfere with self - care . internalized stigma may be the most modifiable form of stigma through cognitive and behavioral therapies , if it is detected early and remediated . considerably less is known about enacted stigma in ibd and is an important area for future research . enacted stigma evaluated in other conditions demonstrates that it is a very important aspect of public health and health systems.44,116,117 whether it is subtle weeding out of an employee who is chronically ill or more direct ( eg , refusing to allow an ibd patient to use the restroom ) , enacted stigma requires a comprehensive intervention . measurement of stigma and related factors is critical to proper detection and potential intervention unfortunately , the construct itself , when present , makes it hard to measure . one tool specific to ibd is the perceived stigma scale for ibd , adapted from the perceived stigma scale for ibs,86 which allows for quick assessment of stigma perceptions among ibd patients during routine visits . however , as we saw earlier , poor quality of life , poor treatment adherence , or low disease knowledge may also point to stigmatizing beliefs about ibd and when present , the provider should query for perceived stigma . regardless , it is important for health care providers to ask patients about the social implications of their disease so that they may be referred to appropriate resources , including clinical health psychologists , to help mitigate the potential impacts of stigma on patient outcomes . the development of stigma interventions has occurred for other chronic conditions,46,118121 and while their efficacy in reducing stigma is mixed , these interventions have merit . the rand corporation and the american psychological association have described theoretically - based multicomponent approaches to reducing stigma in mental illness which could be applicable to ibd.122 these include training interventions for health professionals and the general public , which provide information on the causes of the disease ( not stress or diet , but an immune - inflammatory reaction ) , treatments ( infusions , surgeries , and ostomies ) , and experiences of people living with the disease ( people with cd and ostomies can be athletes , like matt light , david garrard , and kevin dineen ) . educational interventions seem to hold the longest staying power when they are enhanced with a direct interpersonal contact strategy ( having a guest speaker with uc or a panel discussion between ibd patients from different backgrounds).123 finally , mass media campaigns can deliver similar antistigma , educational messages although the impact of these is hard to evaluate . patient advocacy groups have already emerged to help destigmatize ibd ( eg , the great bowel movement , www.thegreatbowelmovement.org ) and research into their benefit could be an important next step .

chronic illness stigma is a global public health issue . most widely studied in hiv / aids and mental illness , stigmatization of patients living with inflammatory bowel disease ( ibd ) , chronic autoimmune conditions affecting the digestive tract , has garnered increasing attention in recent years . in this paper , we systematically review the scientific literature on stigma as it relates to ibd across its three domains : perception , internalization , and discrimination experiences . we aim to document the current state of research , identify gaps in our knowledge , recognize unique challenges that ibd patients may face as they relate to stigmatization , and offer suggestions for future research directions . based on the current review , patients living with ibd may encounter stigmatization and this may , in turn , impact several patient outcomes including quality of life , psychological functioning , and treatment adherence . significant gaps exist related to the understanding of ibd stigma , providing opportunity for future studies to address this important public health issue .

You are an expert at summarizing long articles. Proceed to summarize the following text: emphysematous gastritis is an extremely rare condition in which gas accumulates in the stomach lining secondary to infection with gas - producing organisms . it is often associated with high mortality , and surgical intervention is usually avoided unless uncontrollable sepsis persists or patient develops gastric perforation . we present the case of a 16 year old female with viral myocarditis and cardiogenic shock that was transferred to our hospital on extracorporeal membrane oxygenation and developed emphysematous gastritis that resolved with nonoperative management . the patient is a 16 year old female , otherwise healthy , who presented to an outside hospital with a one week history of fever , chest and back pain . on initial workup , she was found to have st elevation in all leads with troponin of 98 ng / l . soon after , she became hemodynamically unstable , in cardiogenic shock and respiratory failure requiring intubation and vasopressors . lidocaine was administered and patient s rhythm was brought back . however , she continued to deteriorate and it was decided to place her on venoarterial extracorporeal membrane oxygenation ( va - ecmo ) via right internal jugular vein into her right femoral vein and femoral artery . our hospital was consulted for possible bridge to recovery and transplant evaluation . on arrival to our hospital her mean blood pressure was 77 mmhg with no systolic or diastolic component with warm and pulseless extremities . her initial labs revealed hemoglobin and hematocrit of 11 g / dl and 33% , white count of 10.4 10(9)/l , platelets 89 10(9)/l , creatinine 1.2 mg / dl and bilirubin 1.1 mg / dl . like soft tissue echoes in the left ventricle extending upto the aortic valve consistent with thrombotic stasis . initial computed tomography ( ct ) of chest , abdomen and pelvis had extensive consolidation in the lower lobes with small bilateral pleural effusions and pericardial effusions , with moderate ascites in abdomen and pelvis , edematous gallbladder , and no evidence of bowel obstruction . after patient was evaluated and listed for heart transplantation , she was taken to the operating room for placement of thoratec biventricular assist device ( bi - vad ) . once the bi - vad was allowed to take over the circulation , patient became hypoxic with weaning off cardiopulmonary bypass , and the decision was made to place the patient on veno - venous ecmo ( vv - ecmo ) . the right femoral vein cannula was used as the inflow , and the right internal jugular cannula was used as the outflow for the ecmo circuit . additional studies on the myocardium involving polymerase chain reaction and in - situ hybridization showed active replication of coxsackie b3 virus . few days later , patients urine output continued to decline with increase in creatinine upto 2.6 mg / dl . she was diagnosed with acute kidney injury secondary to her critically ill state by nephrology and they recommended continuous renal replacement therapy . she developed hemorrhagic pulmonary edema and after bronchoscopy she was found to be positive for escherichia coli . the next day patient was found to have massive abdominal distention with liquid non - bloody stools . 1 ) as well as small bowel measuring up to 5 cm in caliber , finding consistent with small bowel obstruction / ileus . a ct of abdomen and pelvis showed stomach to be diffusely edematous , thick - walled , containing intramural gas collections , consistent with emphysematous gastritis ( fig . 2 ) . small bowel was found to have thickened valvulae conniventes but appeared to perfusing normally . a subsequent echocardiogram demonstrated good pulsatile lvad inflow with a velocity of 2.23 m / s and outflow with a velocity of 2.4 m / s . rvad inflow had a velocity of 1.6 m / s with outflow of 1.2 m / s . patient was kept npo , on nasogastric tube decompression , on broad spectrum antibiotics , including vancomycin , meropenem and fluconcazole ; and aggressive resuscitation involving multiple vasopressors was continued . two weeks later , patient was found to have complete resolution of emphysematous gastritis with return of stomach wall thickness to normal [ fig . 3 ] . normal caliber loops of small and large bowel were found with easy transit of oral contrast into the colon . however , patient continued to be in progressive respiratory failure requiring ecmo support for which she underwent right mini thoracotomy and open lung biopsy . pathology revealed hemorrhagic diffuse acute lung injury with features most consistent with hemorrhagic diffuse alveolar damage . additional stains were performed on the specimen to rule out viral cause , all of which were negative . patient continued to be in multisystem organ failure with persistent elevation in liver function tests involving alt of 329 iu , ast of 692 iu , alkphos of 362 iu and total bilirubin of 30.2 mg / dl . patient underwent a repeat viral serology screen at which point she had a positive cmv serology of greater than 60 and pcr which confirmed the presence of disseminated cmv for which ganciclovir was started . pathology revealed severe hepatocanalicular and cholangiolar cholestasis with centrilobular feathery degeneration and focal central lobular hepatocyte dropout , consistent with nonobstructive cholestatic process . patient continued to deteriorate hemodynamically with increasing norepinephrine requirements as high as 24 mcg / min . due to the patient 's now hypercapnic and hypoxic respiratory failure , oliguric renal failure , shock liver , biventricular systolic failureon biventricular assist devices , with persistent e. coli pneumonia , cmv viremia , coxsackie b myocarditis , the patient was not a candidate for heart / lung transplant or ecmo at this point . it usually presents with abdominal pain , nausea , emesis and florid septic shock , with a mortality rate of 5561% [ 23 ] . diagnosis is usually made based on a ct scan which typically shows gastric wall thickening and intramural gas [ 45 ] . the gas pattern is more prominent around the fundus and the greater curvature as described before . several etiologies have been reported such as vessel occlusion , gastric infarction or gastric volvulus . however , rarely , it has also been associated with nasogastric tube placement , persistent emesis , severe gastroenteritis , especially following chemotherapy or related to gastric ulcer disease . gastric pneumatosis may also occur after caustic ingestion , excessive ingestion of carbonated beverages , iatrogenis injury or sometime even idiopathic . there are a number of predisposing factors that have been identified : immunosuppression including diabetes , malignancy , alcohol , medication abuse ( especially non - steroidal anti - inflammatory drugs ) , post abdominal / pelvic surgery and corrosive ingestion [ 710 ] . usually causative organisms can include gram positive cocci , gram negative rod ( e. coli ) and sometimes even fungi ( candida albicans ) . however , there has been no association reported in the literature with viral dissemination , either coxsackie virus or cmv . it is difficult to ascertain viral organisms playing a direct role as they are not gas forming . however , in the setting of extreme ill state with relative immunosuppression , it may be reasonable to assume , that this lead to concomitant bacterial invasion of the gastric lining . furthermore , our patient did not have a nasogastric tube inserted before the event and nor did she have an infectious diarrhea . she began to have liquid non - bloody stools when she developed abdominal distention but stool studies did not reveal any organism . it may be possible that she harboured an ulcer but resolution of the findings with just nonoperative management does not favour that . in one of the series , on further analysis , there was no significant difference observed in patients that survived and those that did not . even though , it is considered a hallmark sign of pneumatosis , whether small bowel , colonic or even stomach related , the absence of portal gas does not rule it out and caution another possibility is the relative low - flow state that was present in our patient . even though , the patient was supported using va - ecmo and was transitioned to bi - vad , the ongoing sepsis proved it extremely difficult to maintain adequate flows to achieve good perfusion . this could have potentially lead to bacterial translocation of the gastrointestinal tract that resulted in emphysematous gastritis . why this would affect the stomach more so than small or large bowel , is unclear . it is also interesting that despite her worsening overall hemodynamic instability , her gastric emphysema did get better and eventually resolved . one could argue that even with her low flow state , the appropriate use of antibiotics along with bowel rest gave her gastric mucosa enough time to recover and avoid a perforated viscus . to our knowledge , there has been no reported case of such a condition in patient with ecmo . with increasing use of this technology , it is only possible that we may see more of this in the future . management of emphysematous gastritis usually revolves around supportive care , broad spectrum antibiotics and bowel rest . the mortality due to surgical intervention can be as high as 21% and usually reserved for cases with refractory medical management , uncontrollable sepsis , or perforated viscus . our patients gastritis resolved with non - operative management , albeit , she succumbed to multiorgan failure due to other causes . if diagnosed early , it can be managed with supportive care with surgery reserved for refractory cases . we believe our patient is a unique case of a veno - arterial ecmo causing emphysematous gastritis .

highlightsemphysematous gastritis is a rare , potentially fatal condition with a mortality rate of 5561%.predisposing factors include : immunosuppression , malignancy , alcohol , medication abuse ( especially non - steroidal anti - inflammatory drugs ) , post abdominal / pelvic surgery and corrosive ingestion.management of emphysematous gastritis usually revolves around supportive care , broad spectrum antibiotics and bowel rest.mortality as a result of surgical intervention is as high as 21% .

You are an expert at summarizing long articles. Proceed to summarize the following text: malaria is an infectious disease of humans and other animals caused by plasmodium parasites . according to the latest who estimates , there were about 198 million cases of malaria in 2013 ( with an uncertainty range of 124 million to 283 million ) and an estimated 584 000 deaths ( with an uncertainty range of 367 000 to 755 000 ) in the world . malaria mortality rates have fallen by 47% globally since 2000 and by 54% in the who african region . the vast majority of deaths in sub - saharan regions are caused by p. falciparum , while p. vivax , p. ovale , p. malariae , and p. knowlesi cause generally milder form of malaria which other than p. knowlesi is rarely fatal [ 1 , 3 ] . p. vivax is responsible for most malaria cases in asia and latin america but it is almost absent from most of central africa due to the absence of duffy antigen , the receptor which p. vivax uses to invade human erythrocytes . in eastern and southern africa , p. vivax represents around 10% to 40% of malaria cases but < 1% of cases in western and central africa [ 4 , 5 ] . in sudan until recently the majority of malaria cases were caused by p. falciparum . p. vivax is relatively rare ; 95% of cases are caused by p. falciparum and the other 5% are caused by p. vivax . however , in recent years many clinicians observed recurrent relapses of malaria infections in different areas in sudan suggesting perhaps a higher than expected transmission of non - falciparum malaria parasites ( most likely p. vivax since it is the second most important malaria parasite species in sudan ) . the objective of this study was to document the suggested rise in the proportion of p. vivax infections among suspected malaria cases in white nile state in sudan . the study was approved by the ethical committee of the institute of endemic diseases , university of khartoum . this study was a cross - sectional study carried out in the white nile area which is one of the central sudan states , figure 1 . it lies between latitudes 33 and 30 - 31 north and longitude 13 and 3012 east , occupying an area of around 675000 km , with population of 1.675 million . the study was conducted in aljabalain area , 80 km south of rabak town , the capital of white nile state . the area is considered mesoendemic for malaria ; transmission follows mainly the rainy season ( july to october ) . four hundred suspected malaria cases based on patient 's symptoms ( fever , headache , sweating , nausea , and vomiting ) and signs ( pyrexia , pallor ) were chosen randomly from aljabalain hospital and aljabalain military hospital aged > 1 year old regardless of gender . all suspected malaria cases were treated with a standard regimen ( artemisinin based combination therapy ) by the local malaria control program according to the sudanese malaria treatment guidelines in sudan national malaria control program ( nmcp ) , and the national protocol for treatment of malaria ( federal ministry of health , khartoum , sudan , 2013 , unpublished ) . both thick and thin blood films were used , fields were read at least twice , and the procedure was followed according to quality control guidelines of who . the pcr was performed at the institute of endemic diseases , university of khartoum , with quality control in place ( both positive and negative control were used ) . a fragment of the plasmodial 18s rrna gene was amplified by pcr and species identification was performed with species - specific oligoprobes using the following primers : for p. falciparum , rplu5 : 5 cttgttgttgccttaaacttc-3 , rplu6 : 5-ttaaaattgttgcattaaaacg-3 ; for p. vivax , rviv1 : 5-cgcttctagcttaaccacataactgatac-3 , rviv2 : 5-acttccaagccgaag caaaga aag tcc tta-3 , as described previously . data were analyzed using spss ( statistical package for the social sciences ) version twentieth software . in our study , both males and females are affected by malaria ; however more females were represented in aljabalain hospital ( 64.4% ) and more males were represented from aljabalain military hospital ( 64% ) . the average haemoglobin level in all patients from the two study sites was 11.9 g / dl . the prevalence of anaemia among malaria patients was high , more than two - thirds in both study sites . the majority of malaria cases ( more than 90% ) had low parasite level ( 500 parasite/l of blood ) , table 1 . in both study sites , microscopy results showed that 30 ( 15% ) and 50 ( 25% ) of malaria infections in aljabalain hospital and aljabalain military hospital were caused by p. vivax . the results were even higher with pcr ( figure 2 ) ; 66 ( 33% ) and 80 ( 40% ) of samples from aljabalain hospital and aljabalain military hospital were positive for p. vivax , respectively . mixed infections ( p. falciparum + p. vivax ) were detected in 2.25% of samples in average from both study areas , table 2 . this study was carried out in an area characterized by seasonal and unstable malaria transmission . the most remarkable result in this study was the unexpected high proportion ( about 40% by pcr ) of p. vivax infections among suspected malaria cases , eight times more than that previously reported in sudan . this change in pattern is most likely due to the recent varied composition of the community resulting from several migrations of people from several asian and african countries to work at petroleum and new sugar companies in white nile area especially from ethiopia where high prevalence of p. vivax infection ( 31% ) among malaria cases was found . another suggested explanation for the emergence of p. vivax is parasite 's development of alternative mechanisms to invade human erythrocytes other than the duffy antigen . this is a plausible explanation since p. vivax infection of duffy negative genotype was reported previously in many african countries [ 816 ] . this is the first study of its kind to document the significant rise in malaria p. vivax transmission in sudan . and it has important health policy implications since p. vivax infection requires eradication of liver stages with primaquine due to presence of dormant hypnozoites within hepatocytes [ 17 , 18 ] . recent data showed that p. vivax infection is becoming more severe especially in children , and further studies are required to understand the exact causes of this pattern . the sampled population ( four hundred cases ) of this study was selected based on their highly suspected symptoms of malaria and positive blood film microscopy done in hospitals ' laboratories . this obvious result of malaria overdiagnosis by a factor of two is probably due to lack of training in general hospitals , low quality control microscopy , and high work load . the same result was previously found in tanzania where malaria was overdiagnosed by a factor of five [ 20 , 21 ] . pcr diagnosis for malaria is accurate especially for differentiating between plasmodia species , but it is expensive and needs well - trained personnel . in this study quality control microscopy allowed for 20% of plasmodium this may be due to difficulty in differentiation between species based on a single ring form especially for untrained personnel . in this study more than 90% of slides had low parasite density ( 500 parasite/l ) ; this also makes differentiation between plasmodia species very difficult . our study confirmed the observed high percentage of p. vivax infections in white nile area , central sudan . this result has important implications for the malaria control and necessitates modification of current guidelines for the treatment of malaria in sudan .

plasmodium falciparum is a predominant malaria species that infects humans in the african continent . a recent who report estimated 95% and 5% of p. falciparum and p. vivax malaria cases , respectively , in sudan . however many laboratory reports from different areas in sudan indicated otherwise . in order to verify , we selected four hundred suspected malaria cases from aljabalain area located in the white nile state , central sudan , and diagnosed them with quality insured microscopy and species - specific nested pcr . our results indicated that the proportion of p. vivax infections among suspected malaria cases was high . we found that on average 20% and 36.5% of malaria infections in both study areas were caused by p. vivax using both microscopy and pcr , respectively . this change in pattern is likely due to the recent demographic changes and high rate of immigration from neighbouring countries in the recent years . this is the first extensive clinical study of its kind that shows rising trend in p. vivax malaria cases in white nile area , sudan .

You are an expert at summarizing long articles. Proceed to summarize the following text: a 67-year - old woman with hypertension presented with acute left hemichorea involving the tongue , face , arm , and leg for the previous 3 days . she suddenly noticed the intermittent left orofacial and lingual dyskinesia with dysarthria , which occurred only when the patient tried to speak . she had no history of convulsive disease , orthostatic hypotension , diabetes mellitus , or parkinsonism . neurological examination revealed repetitive , involuntary , irregular , purposeless , and non - rhythmic movements of the left tongue , face , arm , and leg . neuropsychologic tests did not reveal bucco - linguo - facial apraxia , sensory extinction , and unilateral spatial neglect . blood tests including glucose , glycosylated hemoglobin a1c , thyroid and parathyroid function test , antistreptolysin o , rheumatoid factor , lupus anticoagulant , antiphospholipid antibody , antinuclear antibody , antineutrophil cytoplasmic antibody , anti - ro / la antibody , and peripheral blood morphology were unremarkable . 24-hour holter monitoring revealed normal sinus rhythm and an echocardiogram showed no source of embolus . an electroencephalogram displayed continuous slowing in the right hemisphere suggestive of underlying cerebral dysfunction , but no epileptiform discharge was present . diffusion weighted mr images revealed acute small infarctions in primarily the right border zone between the anterior and middle cerebral artery ( figure 1 ) . on perfusion mr scan , impaired cerebral blood flow and delayed mean transit time and time to peak were observed on the subcortical area around the infarcted lesions and no definite evidence of hemodynamic insufficiency was found in the basal ganglia ( figure 2a ) . cerebral angiogram confirmed 90% stenosis with atherosclerotic ulcer in the right internal carotid artery ( figure 3a ) . the left internal carotid artery was mildly stenotic , and the intracranial arteries seemed unremarkable . endovascular stent angioplasty was performed on the 16th day after symptom onset to treat the right carotid artery stenosis based on the presence of significant right hemispheric hypoperfusion without a large infarction ( figure 3b ) . a 9 30 mm self - expanding close - cell type wallstent ( boston scientific , natick , ma , usa ) was deployed across the lesion with the proximal end in the distal common carotid artery . after stent delivery , post - deployment inflations were performed using a 6 20 mm aviator angioplasty balloon ( cordis , miami , fl , usa ) due to significant underlying stenosis . post - stenting perfusion mri demonstrated improvement in the cerebral blood flow in the right hemisphere ( figure 2b ) . her hemichorea gradually improved over the next few weeks along with normalization of perfusion after carotid artery stenting . at four month follow - up we report an unusual case of hemichorea caused by internal carotid artery stenosis , which was reversed by reperfusion of the watershed territory through carotid angioplasty and stent placement . hyperkinetic movement disorders are uncommon in acute stroke , with a prevalence of 1% and an estimated incidence of 0.08% per year.3 hemichorea is a very rare presentation of carotid occlusive disease to cause hemodynamic compromise in watershed territories . in searching the literature , we have found several reports of acute hemichorea or hemiballism associated with carotid artery occlusive disease.49 however , these hyperkinetic movement disorders seem to be related to ischemic lesions in the basal ganglia or subthalamic nucleus in the majority of patients . there were few published cases examining the perfusion state of patients with hemichorea with no radiologic evidence of basal ganglia infarction . subcortical white matter lesions also have been described , but the evidence of abnormalities of the basal ganglia could not be completely ruled out.5,810 in three reported series,5,8,9 cerebral angiography or perfusion studies demonstrated striatal hypoperfusion5,8 and chorea subsided after carotid artery stenting8 or carotid endarterectomy,9 which supported functional changes in basal ganglia . however , the interruption of corticostriate fibers was rarely considered to be the cause of hemichorea due to lesions outside the basal ganglia.10 the anatomic basis of hemichorea seems to be nonspecific for any topographical location . hemichorea can be found in lesions involving the caudate nucleus , putamen , thalamus , subthalamus , and subcortical white matter , which are located in the cortico - striato - pallido - thalamo - cortical feedback loop.5,1114 in the present case , diffusion mri showed infarcts in the anterior watershed region in which carotid stenosis may lead to the most severe reduction of cerebral blood flow . on perfusion mr studies , hemodynamic insufficiency was observed on the subcortical region sparing the basal ganglia , which supports the finding that the subcortical lesion interferes with neural connections between the basal ganglia and the cerebral cortex in the motor pathway without direct involvement of the basal ganglia . mr perfusion study has been a measure to identify potentially salvageable ischemic penumbra at risk progressing to infarction . it can also provide additional morphological information . furthermore , mri is more readily available and less time consuming compared to spect . prognosis seems to be favorable in hemichorea associated with subcortical white matter lesions , which may be caused by the functional disconnection rather than actual destruction of the basal ganglia - thalamo - cortical motor circuit.15 the involuntary movements in our patient disappeared along with an improvement in perfusion in subcortical region after carotid artery stenting . impaired cerebral blood flow in critical watershed territories may be an important contributing factor in hemichorea associated with carotid stenosis . recognition of this unusual form of carotid stenosis is crucial , since early diagnosis and appropriate treatment will reverse this deficit and reduce significantly the likelihood of a disabling stroke . conservative treatments such as administration of antiepileptic agents or haloperidol may not be effective.16 revascularization procedures such as carotid artery stenting may be helpful , which eliminate the source of emboli and the stenosis causing the insufficient circulations in the watershed areas . in summary , our patient had hemichorea caused by the ischemic state in the subcortical border zone due to severe carotid occlusive disease . this is derived from 1 ) the occurrence of severe carotid stenosis , affecting primarily the border zone between the anterior and middle cerebral artery distributions , 2 ) impaired cerebral blood flow on the subcortical area around the infarcted lesions on perfusion studies , and 3 ) complete resolution of hyperkinetic movements following correction of hemodynamic insufficiency by carotid stenting with angioplasty . this report may be helpful for the management of involuntary movements in patients with regional cerebral hemodynamic insufficiency . further studies using perfusion images are necessary to clarify the pathogenic mechanism and anatomic basis of hemichorea associated with ischemic cerebrovascular disease .

involuntary movement associated with deep watershed ischemic lesions has been rarely reported . a 67-year - old woman presented with acute hemichorea on the left side . magnetic resonance imaging showed acute infarcts in the anterior border zone . on perfusion studies , impaired cerebral blood flow was observed on the subcortical region sparing the basal ganglia . cerebral angiogram confirmed severe stenosis in the right internal carotid artery . her hemichorea gradually improved along with normalization of perfusion after carotid artery stenting with angioplasty . we suggest that impaired cerebral blood flow in critical watershed territories may be an important contributing factor in hemichorea associated with carotid occlusive disease .

You are an expert at summarizing long articles. Proceed to summarize the following text: dementia involves irreversible damage to the brain , making preventative efforts for dementia exceedingly important . factors such as smoking status , diet , physical activity ( pa ) , and body mass index ( bmi ) have all received attention because of their relationships with dementia risk among elderly people . pa in particular has received attention because it can help suppress cognitive functional decline and reduce the risk of dementia in the elderly . in a previous systematic review , a longitudinal study revealed that the risk of cognitive decline among individuals with high pa was low1 . furthermore , among men , dik et al . reported a positive correlation between level of pa between the ages of 15 and 25 years and information processing speed in old age2 . this fact supports the link between pa and cognitive functions , and further suggests that early - stage pa might help delay cognitive functional decline later in life . thus , from a preventive point of view , it appears that interventions and countermeasures must begin earlier on in life . however , very little research has been conducted on the relationship between executive function and pa among young adults , and none of them were neuroimaging studies or examined the factors related to these variables . one study investigated the association between pa and cognitive function among young to middle - aged adults [ 1850 years ] , the results of which supported the positive effect of pa on cognitive function3 . however , the pa considered in these reports were estimated via a questionnaire , rather than detailed objective measurements . furthermore , these studies used a variety of cognitive function tests as outcome measures . the purpose of this study was to examine which factors including dementia risks for older adults , pa , intelligence quotient ( iq ) and past activity influence cognitive function in young adults . additionally , we carried out a comparative study of individuals with differing pa levels , examining how their brain activities during cognitive tasks differ , based on evidence that pa influences cognitive function . forty healthy subjects participated voluntarily in this study ( all right - handed , 20.4 1.1 years , 15 females , 25 males ) . we obtained written informed consent from all subjects after giving them a complete description of the study before each data collection session . all subjects had normal or corrected - to - normal vision , normal color vision , and were native japanese speakers . none of the subjects had a history of neurological , major medical , or psychiatric disorders , and none were taking any medication at the time of measurement . this study was approved by the ethics committee of the international university of health and welfare ( approval no . a variety of demographic variables were measured , including age , gender , bmi , education , average sleep time and lifestyle factors were obtained for all subjects using a questionnaire . the lifestyle factors assessed included history of playing sports ( including type of sport played , duration , and competitive level ) , time spent exercising in a week , medical history , smoking and drinking history , playing leisure activities , presence or absence of a family history of dementia , self - efficacy for exercise4 . to assess intelligence , we utilized the wechsler adult intelligence scale , 3rd edition5 ( wais - iii ) . specifically , we calculated the full - scale iq ( fiq ) , verbal iq ( viq ) , and performance iq ( piq ) . pa was measured using a uniaxial accelerometer ( lifecorder plus ; suzuken co. ltd . , nagoya , japan ) . specifically , the accelerometer was used to measure number of steps per day , activity energy expenditure , and total energy expenditure . the accelerometer was attached to subjects waists and pa was measured continuously over one week . during this period , subjects were asked to keep the accelerometer on their person at all times except for when bathing or sleeping . the cognitive function score was calculated based on the performance times of the two forms of the trail making test [ tmt - a and tmt - b ] and that of the stroop task . this stoop task was administered in the form of an experimental session comprising 30 trials ( 15 neutral trials and 15 incongruent trials ) in random order with an inter - stimulus interval of 26 sec . words remained on the screen until participants gave a response , with a maximum possible response time of 2 sec . measurement was performed after three times in order to give subjects a chance to practice the task . participants were asked to respond by pressing a button in the index finger , and we measured the time it took for them to press the button from the point of stimulus onset . a reaction time measurement device was used to detect electrical signals that were emitted at the start of each trial . the stroop task response set was measured from time to time signals as the basis for answering challenge subjects . additionally , this electrical signal was used to synchronize the reaction time measuring device with the near - infrared spectroscopy ( nirs ) instrument . because the contrast between incongruent and neutral conditions yields the most appropriate measure for stroop interference6 , the stroop interference time was calculated by subtracting the reaction time of the neutral trial from that of the incongruent trial , as per previous studies7 , 8 . in order to evaluate cognitive ability , we calculated a cognitive function score by averaging the z - scores of each cognitive function test ( equation 1 ) . participants were then divided into two cognitive function score groups according to whether their score was higher or lower than the mean score . equation 1 . calculation of cognitive function scores power output ( score ) from the spreadsheet excel software ; where z [ tmt - a]=z - score of tmt - a performance time , z [ tmt - b]=z - score of tmt - b performance time , z [ st]=z - score of stroop interference time . cognitive function score={z[tmt - a ] + z[tmt - b ] + z[st]}/ 3 brain activity in the areas corresponding to executive function was assessed in terms of blood flow during the stroop test via nirs . the nirs was performed using the etg-4000 optical tomography system ( hitachi medical corp . , we focused on the left dorsolateral prefrontal cortex ( dlpfc ; ft7 ) , as this area has been reported to be active among young people taking the stroop test . according to the international 10/10 system an expanded version of the international 10/20 system32 transmitting and receiving optical probes were placed in a grid pattern at 3-cm intervals , with fpz and ft7 as reference points on the head midline ( joining the root of the nose and the occipital protuberance ; fpz and oz were calculated at 10% above each point and ft7 at 40% anterior to the horizontal line between fpz and oz)7 , 9 . in a previous study8 , the ft7 area was deemed to correspond to the left dlpfc . to reduce artifacts due to probe shifting during measurements , subjects were fixed with a philadelphia collar to restrict their head and neck movements . as exercise - related changes in hemoglobin concentration can create artifacts , subjects were not allowed to exercise before undergoing the nirs . furthermore , during the test , subjects were asked to focus their gaze on the center of the display to limit any influence from eyeball movement . measurements were obtained by syncing with the personal computer used for the stroop test using the electrical signal input into the nirs apparatus at the beginning of the test . oxygenated hemoglobin ( oxy - hb ) was used to represent changes in brain blood flow during the stroop test . we focused our analysis on channels at related regions of the ft7 , including 1 , 4 , 5 , and 8 . arithmetic means were calculated for changes in oxy - hb for each channel during each of the 15 neutral and incongruent trials . next , data for each channels were averaged according to oxy - hb changes in the left dlpfc region . the change in oxy - hb 2 seconds before each task was displayed was set as the baseline , with the peak occurring 411 seconds after the task began . the degree of oxy - hb change was calculated from the baseline to peak , and this value was used to calculate the arithmetic mean . subsequently , the mean change in oxy - hb during the neutral trials was subtracted from that during the incongruent trials ( incongruent neutral ) . the resultant value was used as an index of brain blood flow during the stroop task . specifically , subjects with less than 313 steps per hour were considered to have low pa , those with 314417 steps per hour had moderate pa , and those with 418 or more steps / hour had high pa . oxy - hb concentration variations during the stroop task were then compared among the three groups by nirs . first , participants were allocated to high and low cognitive function groups according to their cognitive function score . then , unpaired t - tests were used to compare the variables of interest between the high group and low groups . while the lifestyle factors were compared using cross - tabulation , tests , and residual analysis . furthermore , spearman s correlation coefficient was used to assess the correlations between variables . we also conducted logistic regression analysis , calculating odds ratios ( or ) and 95% confidence intervals ( ci ) , with the cognitive function score as the dependent variable and all variables that were significant ( p<0.05 ) in the group comparison as independent variables . kruskal wallis test were used to compare the mean change in oxy - hb concentration in the left dlpfc region during the stroop task among the three pa groups , both overall and for each channel corresponding to the left dlpfc region . in addition , because we considered that iq might have had an influence on the stroop task , it was compared between groups using kruskal wallis test for the fiq , viq , and piq scores . all statistical analyzes were performed using spss statistics 22 ( ibm corp . , armonk , ny , usa ) . we observed significant differences in fiq , viq , number of steps , and total energy expenditure between the low and high cognitive function groups ( table 1table 1.camprison of the between cognitive function score high group and low group evaluation item valuehigh cognitivefunction group ( n=18)low cognitivefunction group ( n=22)cognitive function score<0.19cognitive function score>0.19tmt - a ( sec)20.8 2.926.6 4.2*tmt - b ( sec)41.9 9.749.6 8.0*stroop interference in reaction time ( msec)98.4 50.6161.6 69.3*age ( years)20.5 1.2 20.4 1.1 gender ( f / m)7/118/14bmi ( kg / m)21.6 2.822.2 3.5average sleep time ( hour)6.0 0.75.9 1.0education ( year)13.7 1.213.1 1.2fiq ( score)122.7 13.4110.9 12.9*viq ( score)69.0 9.661.9 8.5*piq ( score)53.6 7.449.0 8.7number of steps per hour 397.9 97.8326.1 88.9*activity energy expenditure ( kcal / day)236.9 99.5190.3 68.6total energy expenditure ( kcal / day)1526.2 220.01405.6 179.4*self - efficacy for exercise ( score)11.9 2.911.3 4.2medical history n % smoking4 ( 22.2%)1 ( 4.5%)*family history of dimentia ( within three degrees of consanguinity)3 ( 16.7%)6 ( 27.3%)leisure 12 ( 66.7%)8 ( 36.4%)sports historytype of sportno experience2 ( 11.1%)3 ( 13.6%)non - contact sports9 ( 50.0%)13 ( 59.1%)contact sports7 ( 38.9%)6 ( 27.3%)duration of sports ( years)02 ( 11.1%)3 ( 13.6%)142 ( 11.1%)5 ( 22.7%)595 ( 27.8%)8 ( 36.4%)1010 ( 55.6%)6 ( 27.3%)compentitive level of sportsrecreational 10 ( 55.6%)17 ( 77.3%)competitive 8 ( 44.4%)4 ( 18.2%)*semiprofessional 0 ( 0.0%)1 ( 4.5%)exercise time ( hours ) , n ( % ) 08 ( 44.1%)12 ( 54.5%)within 25 ( 27.7%)4 ( 18.2%)35 ( 27.7%)6 ( 27.3%)values are mean sd . high cognitive function group ; a subject s cognitive function score was calculated from the z score of the tmta execution time , the tmtb execution time , and the stroop interference time . the subjects with lower scores than the median cognitive function score were designated as the high cognitive function group , low cognitive function group ; the subjects with higher scores than the median cognitive function score were designated as the low cognitive function group ; fiq : full - scale iq ; viq : verbal iq ; piq : performance iq ; semiprofessional : semi - professional level of the sports was defined as the national tournament . * p<0.05 . ) . regarding lifestyle factors , we observed significant differences between the two groups in terms of competitive level and smoking history . the results of the logistic regression analysis revealed that fiq and number of steps were significantly related to cognitive function score . specifically , the or of the fiq score and number of steps were 1.104 ( 95% ci : 1.0251.19 ) and 1.012 ( 95% ci : 1.0021.022 ) , respectively ( table 2table 2.summary of multiple logistic regression analysis results for cogniitive function scoreindependent variableodds ratio , 95% clfiq score1.104 ( 1.0251.190)*number of steps per hour1.012 ( 1.0021.022)*fiq : full - scale iq ; * p<0.05 ) . the results of multiple comparisons after on kruskal wallis test indicated that the high pa group showed significantly higher oxy - hb changes in the left dlpfc region during the stroop interference than did those in the low pa group ( table 3table 3.differences in fiq , viq , piq score and oxy - hb changes ( total and each channel ) among the different physical activity groups ( based on number of steps)number of steps per hour313 ( n=12)314417 ( n=18)418 ( n=10)fiq ( score)113.5 ( 99.5124.8)120.5 ( 111.8128.8)115.0 ( 101.5117.0)viq ( score)64.0 ( 58.876.5)64.5 ( 58.569.0)62.0 ( 58.568.5)piq ( score)47.5 ( 43.553.9)55.0 ( 53.360.9)47.0 ( 41.557.1)differences in oxy - hb signalsleft ft7 areach 10.086 ( 0.0290.061)0.016 ( 0.0450.029)0.036 ( 0.0170.071)*ch 40.058 ( 0.0340.033)0.085 ( 0.0200.029)0.040 ( 0.0170.050)*ch 50.020 ( 0.0140.022)0.001 ( 0.0250.021)**0.039 ( 0.0250.056)*ch 80.006 ( 0.0210.007)0.003 ( 0.0110.028)**0.043 ( 0.0290.076)*total0.004 ( 0.0190.029)0.005 ( 0.0140.025)0.035 ( 0.0290.060)*values are median ( range ) . * significant differences between the 313 steps per hour group and the 418 steps per hour group ( p<0.01 ) ; * * significant differences between the 314417 steps per hour group and the 418 steps per hour group ( p<0.05 ) ; fiq : full - scale iq ; viq : verbal iq ; piq : performance iq ; oxy - hb : oxygenated hemoglobin ) . this same pattern was found in the analysis by each channel ( channels 1 , 4 , 5 , and 8 ; table 3 ) . high cognitive function group ; a subject s cognitive function score was calculated from the z score of the tmta execution time , the tmtb execution time , and the stroop interference time . the subjects with lower scores than the median cognitive function score were designated as the high cognitive function group , low cognitive function group ; the subjects with higher scores than the median cognitive function score were designated as the low cognitive function group ; fiq : full - scale iq ; viq : verbal iq ; piq : performance iq ; semiprofessional : semi - professional level of the sports was defined as the national tournament . * p<0.05 . fiq : full - scale iq ; * p<0.05 values are median ( range ) . * significant differences between the 313 steps per hour group and the 418 steps per hour group ( p<0.01 ) ; * * significant differences between the 314417 steps per hour group and the 418 steps per hour group ( p<0.05 ) ; fiq : full - scale iq ; viq : verbal iq ; piq : performance iq ; oxy - hb : oxygenated hemoglobin we analyzed the factors related to cognitive function of young adults , including factors of cognitive decline in the elderly , intelligence , the past activities history . our results indicated a significant difference in fiq , viq , number of steps , total energy expenditure , health awareness , smoking history and competitive level of sports between the low and high cognitive function groups ( table 1 ) . however , according to the results of a logistic regression analysis , only fiq and number of steps were significant contributors to cognitive function score ( table 2 ) . furthermore , differences in pa levels was confirmed that affects the brain activity during the cognitive task using nirs . there are reports about the relationship between pa and cognitive functions in some of the previous studies12,13,14 about young adulthood . however , there is no report that analyzed related factors of the cognitive function and considered the relationship between the factors and the brain activity during a cognitive task . dementia risk among elderly adults is reported to be related to a genetic predisposition , as evidenced by a family history of dementia15 . other , non - genetic risk factors include smoking , bmi , pa , eating habits , and leisure activities16 , 17 . in the present study , the lifestyle factors that we chose to examine were specifically those related to dementia in the elderly . the results indicated a significant difference between the cognitive function groups in terms of smoking history and competitive level of sports ( table 1 ) . the smoking rates were also higher in the high group than in the low group . however , we did not specify the extent of smoking in smoking status and questions paper table of the previous test cognitive function , we can not clarify the precise impact of smoking on cognitive function in this study . on the other hand , subjects competitive level in sports was found to be significantly higher among those in the high group than among those in the low group ( table 1 ) . this accords with findings that athletes exhibit better performance for cognitive tasks and basic attention compared to non - athletes18 . on the other hand , one study found no difference in the orientation and execution of attention and visuospatial working memory between professional and amateur soccer players19 . it is possible that the competition level of subjects in this study does not correspond to the sporting events and competition levels among athletes in previous studies , so there is a need for a more detailed study on the impact of competitive level on cognitive function . previous study indicated that tmt - a time was negatively correlated with piq score20 , while fiq score has been shown to be related to stroop test performance21 . these reports20 , 21 showed the relationship between iq and executive function test scores , and supported the results of this research . meanwhile , iq in late adolescence has been found to be strongly correlated with pa and health22 . importantly , while we observed a correlation between viq and total energy expenditure ( r=0.35 ) , we observed no relationship between iq and number of steps . there are different possibilities and the results of this study are to evaluate the iq and pa by using the questionnaire in the previous study . notably , the number of steps significantly predicted cognitive function in this study ( table 2 ) . specifically , the high group had a significantly higher number of steps and total energy expenditure than did the low group ( table 1 ) . pa has been found to relate to activity mainly in the prefrontal and temporal cortices23 . another study indicated that maximum oxygen uptake , gray matter volume , and performance on stroop and spatial working memory tests among elderly adults were all found to relate to prefrontal cortex activity . indeed , maximum oxygen intake was found to relate specifically to activity in the dlpfc24 . another study indicated that adolescent pa among males had a stimulating effect on executive functions in adulthood , thus emphasizing the importance of an active lifestyle among adolescent males25 . taken together , these results all suggest that maintaining and improving pa and total energy expenditure may help in maintaining brain function . it is notable that the number of steps was one of the factors relating to cognitive function score , especially because we used this variable as the basis ( based on catrine et al.10 , 11 ) for subjects pa levels in the analysis of executive function using nirs . importantly , the three pa groups showed no statistically significant differences in fiq , viq , or piq score ( table 3 ) . our results suggest that high levels of pa sustain activity in brain regions associated with the stroop effect . previous studies have also reported increased dlpfc activity during the stroop task26 and the ft7 area in particular has been identified as corresponding to the dlpfc in prior research using nirs8 . areas with increased oxy - hb concentrations are judged , during nirs , to have higher levels of neural activity . as the oxy - hb concentration was much higher in the ft7 area in the high pa group in this study , it seems that greater pa relates to higher dlpfc activity , and thus greater executive function . high pa has been found to increase expression of insulin - like growth factor 1 ( igf-1 ) , which enhances neurogenesis and angiogenesis , and vascular endothelial growth factor , which stimulates vasculogenesis and angiogenesis ; thus , pa may influence the brain activity , angiogenesis , and neurogenesis of the brain27 . igf-1 in particular has diverse neuroprotective effects aside from angiogenesis and neurogenesis , including improving neuronal excitability and cognitive function28 . in addition , high pa appears to alter the function of neurotransmitters to increase the expression of factors associated with synaptic plasticity , such as the glutamatergic system29 . pa and fitness in adolescents have also both been found to relate to improved cognitive function in adults via an increase in the production of igf-125 . . meanwhile , young adulthood with a higher cognitive function level may be more likely to have a higher physical activity level , so there is a need to consider other factors as well . our overall results show that fiq and number of steps were associated with cognitive function score in young adults . furthermore , via nirs , we observed differing levels of activity in the dlpfc according to pa level . the results emphasize the importance of an active lifestyle among young adults as well as the elderly . further , as noted above , follow - up studies are needed to clarify the relationships between pa and cognitive ability .

[ purpose ] prevention of dementia requires early intervention against it . to ensure that early interventions are effective it is crucial to study the cognitive functions related to dementia in young adulthood . moreover , it is needed not only to verify the cognitive function test but also to elucidate the actual brain activity and the influence of related factors on the brain activity . to investigate the factors influencing cognitive function among young adults and examine the differences in executive function by physical activity level . [ subjects and methods ] forty healthy university students ( mean age , 20.4 years ) were classified into two groups by cognitive function score ( high and low ) , determined according to trail making test performance and stroop task processing time . we then assessed what factors were related to cognitive function by logistic regression analysis . executive function was determined by brain blood flow using near - infrared spectroscopy during the stroop task , and was then compared by physical activity levels ( determined according to number of steps per hour ) . [ results ] full - scale intelligence quotient according to the 3rd wechsler adult intelligent scale and number of steps per hour influenced cognitive function score , with odds ratios of 1.104 and 1.012 , respectively . oxy - hemoglobin concentrations in areas related to executive function during the stroop task were significantly higher among those in the high physical activity group than among those in the low physical activity group . [ conclusion ] the study revealed that full - scale intelligence quotient and a number of steps per hour are factors associated with the cognitive functions in young adulthood . in addition , activity in execution function related area was found to be significantly higher in the high physical activity group than in the low physical activity group , suggesting the importance of physical activity for enhancing young adulthood cognitive functions .

You are an expert at summarizing long articles. Proceed to summarize the following text: psychophysical data suggest that number is represented as a point on an analog mental number line . for example , rats or humans asked to produce n responses or estimate n events do so with less precision as n increases ( platt and johnson , 1971 ; whalen et al . , 1999 ) . in addition , the variability of responses increases proportionally with n such that the coefficient of variation ( cv , the ratio of the standard deviation to the mean ) is constant as n increases . indeed , members of the piraha tribe of amazonia , whose numerical language is limited to one - two - many , show a similar pattern of behavior in which both the number and variability of numerical estimates increase with n , with a constant cv ( gordon , 2004 ) . the similarity between animals and humans , even those using innumerate language , suggests a common underlying system for numerical estimation . humans reporting the larger of two numbers do so faster and more accurately as the distance between them increases . and , when the distance between two numbers is fixed , accuracy and speed decrease as the overall magnitude of the two numbers increases ( moyer and landauer , 1967 ) . thus , subjects more accurately and quickly discriminate 2 vs. 9 than 6 vs. 7 ( distance effect ) or 32 vs. 39 ( magnitude effect ) . distance and magnitude effects are also found in the accuracy and reaction times of monkeys and pigeons ordering pairs of numerosities ( brannon and terrace , 1998 , 2000 ; nieder and miller , 2004a ; scarf et al . , 2011 ) . figure 1 shows the similar ratio - dependence in the accuracy and speed of monkeys and humans reporting which of a pair of numerosity stimuli contains more ( or fewer ) elements ( cantlon and brannon , 2006 ) . these behavioral findings endorse the idea that the internal representation by the mental number line has greater variability with increasing quantity . such a number line could be logarithmically compressed or linear with scalar variability ( brannon et al . humans ' and monkeys ' judgments of relative numerosity ( more / fewer ) depend on the ratio difference between the two stimuli . when judging arrays of dots that differ in quantity , accuracy increased ( a ) and response time decreased ( b ) as their ratio deviated from 1 . for example , discrimination performance for 2 vs. 10 ( ratio = 0.2 ) was faster and more accurate than for 9 vs. 10 ( ratio = 0.9 ) . performance of simple approximate arithmetic tasks suggests that these operations are carried out using an analog representation of quantity . participants who can not rely on the rote memorization of basic mathematical operations ( such as 2 + 3 = 5 ) nevertheless demonstrate the ability to perform simple calculations . pre - schoolers accurately report whether the sum of two arrays of dots contains a larger number than a comparison array ( barth et al . , 2006 ) and monkeys can choose a visual array that matches the sum of two sample arrays ( cantlon and brannon , 2007 ) . even pigeons can discriminate the result of a subtraction operation from a constant value ( brannon et al . the munduruku tribe of amazonia , which lacks language for quantities greater than five , can estimate the results of approximate addition and subtraction , as well as compare quantitative stimuli well beyond their range of numerical literacy ( pica et al . , 2004 ) . further , in these studies , accuracy for mathematical operations depended on the ratio of quantities compared . these findings suggest that mathematical operations are computed over a representation of quantity that is either linear with scaled variability or logarithmically compressed . a critical prediction of weber 's law is that the ratio of two numbers determines their discriminability , regardless of their actual magnitude . several lines of evidence using tests of non - symbolic numerical processing suggest number is innately represented on a compressed analog scale that supports ratio - dependence in discriminations . human infants have been shown to discriminate large numbers , provided they differ by a ratio of 2:1 , e.g. , 8 vs. 4 or 16 vs. 8 ( xu and spelke , 2000 ; lipton and spelke , 2003 ; wood and spelke , 2005 ) . adult human discrimination of non - symbolic visual arrays has also been shown to depend on the ratio of values compared , rather than their absolute magnitude ( piazza et al . a potential advantage of compressed scaling is the ability to process a wide range of quantities , just as the visual or auditory systems can process stimuli differing over orders of magnitude . in studies of non - verbal subjects , such as animals and human infants , the confounding relationship between number and other stimulus attributes makes it difficult to demonstrate the capacity to represent number per se . for example , choices based on simultaneously presented stimuli that differ in number could be determined on the basis of such features as total surface area or density whereas the discrimination of sequentially presented stimuli , or production of a series of n responses , could be controlled by duration ( of individual elements or the entire series ) rather than number . more generally , number , space , and time all show similar properties of discriminability that follow weber 's law ( walsh , 2003 ) , thus it is difficult to disentangle judgments based solely on numerosity apart from spatial and temporal magnitudes . although animals are able to use number , it is possible that they do so only as last resort ( davis and perusse , 1988 ) . this proposition seems unlikely since both humans and animals performing tasks that do not oblige them to represent number do so ( meck and church , 1983 ; roberts and mitchell , 1994 ; brannon and terrace , 1998 ; roitman et al . number thus appears to be spontaneously encoded , even when it is redundant with other cues . neurological and neurophysiological data indicate that parietal cortex is a critical component of the circuits that form the basis of numerical abilities in humans . patients with parietal lesions are impaired in their ability to access the deep meaning of numbers . acalculiac patients with inferior parietal damage often have difficulty performing arithmetic ( 2 + 4 ? ) or number bisection ( what is between 3 and 5 ? ) tasks , but are able to recite multiplication tables and read or write numerals ( dehaene and cohen , 1991 , 1997 ; cohen and dehaene , 1994 ) . gerstmann syndrome , which is characterized by the tetrad of acalculia , left - right disorientation , finger agnosia , and agraphia , is found in patients with inferior parietal damage ( gerstmann , 1940 ; roeltgen et al . , 1983 ; the progress of gerstmann syndrome onset in alzheimer 's disease patients suggest that the degeneration underlying these four cognitive impairments share anatomical proximity in the parietal lobe ( wingard et al . , 2002 ) . further , turner 's syndrome , an x - linked chromosomal disorder in humans , is marked by both structural abnormalities of the intraparietal sulcus ( ips ) and abnormal development of numerical representation ( molko et al . , 2003 ) . complementary data from fmri studies of neurologically intact humans performing subtraction ( simon et al . , 2002 ) , number comparison ( pinel et al . , 2001 ) , and non - verbal magnitude comparison ( fias et al . , taken together , clinical cases and imaging studies support a critical role for parietal cortex in the mental manipulation of numerical quantities . ( 2002 ) suggest that the functional organization of human parietal lobe resembles that found in monkeys ( rizzolatti et al . , 1998 ) , and propose that correlates of numerical processing in primates may be found in areas along the ips . studies of the role of parietal cortex in non - symbolic numerical representation in humans have produced conflicting data . imaging studies have consistently reported the activation of parietal cortex in the processing of symbolic number , i.e. , number words or arabic numerals ( dehaene and cohen , 1997 ; pinel et al . , 2001 ; simon et al . , 2002 ) . to test whether representation of number in parietal cortex extends to non - symbolic stimuli , piazza et al . , human participants passively viewed visual arrays of n elements . as subjects habituated to a standard number ( 16 or 32 ) , deviant values , ranging from half to double the value of the standard , were presented infrequently . although participants were not explicitly required to discriminate the visual stimuli in any way , recovery of the bold signal along right and left ips was proportional to the ratio of the standard and deviant stimuli ( figure 2 ) . further , adaptation to repeated numerosities and recovery in response to a deviant numerical value did not depend on whether non - symbolic ( arrays of dots ) or symbolic ( arabic numerals ) stimuli were used ( piazza et al . , 2007 ) . subsequent studies not only replicated the adaptation of regions along the ips to non - symbolic visual stimuli , but extended these findings to proportions ( jacob and nieder , 2009 ) . subjects habituated to arrays of elements in which 50% ( of totals ranging from 4 to 32 ) were colored blue and the rest were red . infrequent probes with deviant stimuli composed of 6090% red items drove recovery of the bold signal , with greater recovery as the distance between habituation and deviant proportion increased . thus , regions along the ips not only appear to encode estimates of whole numbers , but proportions as well . areas along the horizontal intraparietal sulcus showed activation in response to a change in the numerosity of sequentially presented visual stimuli . the level of activation was proportional to the magnitude in the change of numerosity from a habituated standard value ( 16 or 32 ) . the discriminability of probe values relative to the standard is compressed on a linear scale ( a ) , and symmetrical on a logarithmic scale ( b ) , consistent with weber 's law . counter to the suggestion that dedicated circuitry in parietal cortex is responsible for processing symbolic and non - symbolic quantity , shuman and kanwisher ( 2004 ) did not find adaptation of parietal responses to repeated presentations of non - symbolic numerical stimuli . although they found greater ips activation for difficult non - symbolic numerical comparisons , similar patterns of activation were observed for difficult color comparisons , suggesting that activation of this region is not limited specifically to the number domain . ongoing research using electrophysiological methods ( described below ) similarly suggests that broader functions of parietal cortex support numerical cognition . the earliest findings of a neural representation of number in animals also suggested a role for parietal cortex . neurons in parietal cortex in anesthetized cats responded to the n stimulus in a series , regardless of modality or inter - stimulus interval ( thompson et al . , 1970 ) . in monkeys , parietal neurons in area 5 were shown to respond to repetition number in a sequence of arm movements ( sawamura et al . , 2002 ) . these neurons had somatosensory receptive fields , but approximately one - third of the neurons studied had activity that was also modulated in relation to the position of the movement in a sequence . when inactivated , monkeys were impaired in completing the number of required repetitions of movements accurately , suggesting that these neurons were required to track the number of movements completed ( sawamura et al . , 2010 ) . although the majority of studies related to neural encoding of quantity focus on regions within parietal cortex that process visual and oculomotor function , the work of sawamura and colleagues shows similar encoding of quantity in circuits that process somatosensory information in arm movements . the strongest evidence for neural correlates of numerical quantity has been found in the activity of single neurons in ppc of macaque monkeys judging visual stimuli varying in numerosity . ppc has been implicated in higher order sensorimotor processing and while not primarily sensory or motor in function , receives inputs from multiple sensory modalities and influences movement planning . there are several characteristics of ppc neurons that have implications for our interpretation of how quantity may be encoded at the level of single neurons . the areas along the ips are considered to be part of the dorsal visual pathway carrying information about the location and movement of objects , and guiding eye or hand movements toward those objects in space ( ungerleider and mishkin , 1982 ) . the ventral intraparietal area ( vip ) , located in the fundus of the ips , is situated to process visual and somatosensory information via inputs from the middle temporal ( mt ) and medial superior temporal ( mst ) visual areas , and from somatosensory areas 5 and 7 of the superior parietal lobule ( seltzer and pandya , 1986 ; ungerleider and desimone , 1986 ; boussaoud et al . , 1990 ; neurons in the lateral intraparietal area ( lip ) , in the lateral bank of the ips , also receive inputs from visual motion areas mt and mst , but are driven by auditory stimuli as well ( felleman and van essen , 1991 ; mazzoni et al . , 1996b ; mullette - gillman et al . , 2005 ) . area lip is interconnected with areas involved in the generation of saccadic eye movements , such as the superior colliculus and frontal eye field ( baizer et al . , 1991 ) . anterior to lip along the lateral bank of the ips is the anterior intraparietal area ( aip ) , which responds to both visual stimuli and grasping movements of the hand ( jeannerod et al . , 1995 ; sakata et al . , intraparietal neurons are thus ideally situated to organize perception of multimodal stimuli toward appropriate behavioral responses . a defining trait of neurons along the ips is their spatially selective response fields ( rf ) . ( 1996 ) and/or movements directed toward ( barash et al . , 1991 ; mazzoni et al . , 1996a ) a restricted area of space , typically in the contralateral hemi - field . the spatial selectivity of parietal neurons is modulated by a variety of task parameters , such as the salience of visual stimuli ( colby and goldberg , 1999 ) , motor planning ( snyder et al . , 1997 ) , decision - making ( shadlen and newsome , 2001 ) , categorization ( freedman and assad , 2006 ) , reward expectation ( platt and glimcher , 1999 ; sugrue et al . , 2004 ) , social expectations ( klein et al . , 2008 ) , and elapsed time ( leon and shadlen , 2003 ) . in addition , responses of parietal neurons can be affected by non - spatial information such as shape and color ( sereno and maunsell , 1998 ; toth and assad , 2002 ) , as well as information located outside of the classical rf ( freedman and assad , 2009 ) . neurons in ppc were first shown to encode the cardinal value , e.g. , 4 , of visible objects in monkeys performing a delayed - match - to - sample task ( nieder and miller , 2004b ) . on each trial , a sample stimulus containing 15 elements was presented , followed by a delay period in which no stimuli were visible . after the delay , a test stimulus containing either the same number of elements or a set that differed by one element was presented . the locations of the elements were randomized around a central fixation point , and monkeys reported when the test stimulus matched the sample by releasing a lever . thus , the spatial configuration of the stimuli was not matched to the rfs of neurons studied , and the motor response did not have a spatial component such as a reach or eye movement to a particular target . the area , circumference , arrangement , density , and shape of the items in the numerosity stimuli were systematically varied to ensure that number alone was the basis for a match . consistent with standard magnitude effects on numerical performance , behavioral response accuracy declined as the number of items in the sample increased . in an additional set of behavioral experiments where the sample and test stimuli differed by more than one element , performance improved as the difference between the sample and test stimuli increased ( merten and nieder , 2009 ) . the performance of monkeys in this task thus demonstrated distance and magnitude effects like those seen in brannon and terrace ( 1998 , 2000 ) . while monkeys performed the delayed - match - to - numerosity task , the activity of randomly selected neurons in prefrontal and ppc was measured . for approximately one - third of neurons in prefrontal cortex ( pfc ) , ~20% of neurons in the fundus of the vip , and ~10% of neurons in the lateral bank of the intraparietal sulcus ( lip ) , activity measured during the presentation of the sample stimulus or the delay period was maximal for one quantity and declined as distance from that quantity increased . curves for numerosity were broader as numerosity increased from 1 to 5 , suggesting a possible correlate of numerical distance and magnitude effects ( nieder et al . , 2002 ; nieder and miller , 2003 ) . figure 3 shows an example of a single neuron with tuned for the preferred value of 3 . for numerosities up to 30 , individual pfc neurons preferred a particular value , with tuning curves better fit by logarithmic rather than linear scaling ( nieder and merten , 2007 ) . the onset of numerical discrimination by parietal neurons preceded that of prefrontal neurons by ~30 ms , suggesting that quantity is initially encoded in ppc then passed to pfc for task - related processing ( dehaene , 2002 ; nieder and miller , 2004a ) . single neurons in posterior parietal cortex and prefrontal cortex ( shown ) respond most strongly for a preferred numerosity . in this example , firing rate was most elevated for arrays of 3 in a delayed - match - to - numerosity task , and declined with numerical distance from 3 . reprinted with permission from nieder et al . in addition to coding the quantity of elements in simultaneously presented numerical arrays , vip neurons show similar preferences for a preferred ordinal position in a numerical sequence , i.e. , respond best to the second stimulus , regardless of whether the number of elements in the sequence is 1 , 2 , 3 , or 4 ( nieder et al . , 2006 ) . the tuning for preferred sequence position resembles that for preferred numerosity , in that different sets of neurons represent each of the possible ordinal positions . in fact , in vip a larger proportion of neurons ( ~22% ) were selective for sequential quantity than were selective for simultaneous quantity ( ~12% ) . single neurons did not exhibit an abstract preference for 3 , regardless of whether presented simultaneously or sequentially during the sample viewing period . during the delay period , when subjects are presumably holding an abstract representation of quantity in working memory , neurons representation of quantity did not depend on the format of presentation . overall , the findings suggest coding for ordinal position as well as cardinal value in vip that potentially drives representation of cardinal value in pfc . in the explicit delayed - match - to - numerosity task , it is possible that factors other than number modulated neural responses . the majority of number - selective neurons in pfc and ppc preferred the quantity 1 ( nieder et al . , 2002 ; nieder and miller , 2004b ) . behavioral studies also showed that monkeys ' accuracy was highest when the sample value was 1 ( nieder and miller , 2004a ) . an alternative explanation for the over - representation of the value 1 by neurons may be that the responses also convey information about reward expectations . it is possible that monkeys were more certain of achieving rewards when the sample value was 1 , and this certainty is reflected in the discharge of some neurons categorized as preferring 1 ( leon and shadlen , 1999 ) . in this task , monkeys have extensive experience with a limited range of numerosities , and potentially treat cardinal number as other stimulus categories ( freedman et al . extensive experience with categorization of visual stimuli as governed by task demands may contribute to the generation of different patterns of neural responses . in the non - symbolic numerical stimuli contain cardinal values of stimulus elements ( e.g. , 1 , 2 , 3 , etc . ) , thus while we hypothesize that these values correspond to values drawn from a continuous representation of quantity , the stimuli themselves are inherently categorical . when monkeys were tasked with the discrimination of the continuous variable of line length , neurons in vip exhibited tuning for one preferred line length from four possibilities , similar to tuning for cardinal value in numerosity tasks ( tudusciuc and nieder , 2009 ) . thus , the delayed - match - to - sample task requires subjects to categorize even continuous stimulus characteristics , and the patterns of neural activity observed may be a product of experience and/or task demands . indeed , when tested on comparisons of relative magnitude ( greater than or less than a sample ) pfc neurons did not show selective responses at the time the monkeys viewed the sample stimulus . only when the monkeys were told which comparison rule to perform did task - related modulation emerge ( bongard and nieder , 2010 ) . although monkeys viewed the same numerical arrays as those used in the delayed - match - to - numerosity task , the neural responses were qualitatively different . rather than peaking for one cardinal value , most neurons represented the mathematical rule ( greater than , less than ) , suggesting that they carry higher - level cognitive signals , rather than performing a basic calculation of quantity . it is not known whether ppc neurons likewise might encode a rule for quantitative comparisons while monkeys perform this task , or if they maintain a representation of magnitude / cardinal value for such comparisons . given the human literature supporting a strong role for ppc in numerical cognition , it is perhaps surprising that a greater proportion of neurons in vip and lip were not driven by numerical stimuli in the previous studies . several models of how to calculate numerosity from a set of elements include the process of accumulation as a critical step ( meck and church , 1983 ; dehaene and changeux , 1993 ; verguts and fias , 2004 ) . monkeys discriminating the direction of motion of a random - dot stimulus behave as though they integrate the amount of information in the stimulus ( measured as percent coherence ) across the viewing duration ( gold and shadlen , 2000 , 2002 ) . while monkeys view the motion stimulus outside of the rf , neurons in lip show time- and motion coherence - dependent increases in activity that reach a common level when a decision to shift gaze into the rf is reached ( roitman and shadlen , 2002 ) . that is , when an eye movement is used to report the direction of visual motion , the activity of single lip neurons increases with the amount of evidence favoring the eye movement toward its rf . here , the integration of information is toward the initiation of a motor response . while related to the amount of information contained in the motion stimulus , the activity does not report the strength or direction of the motion in the manner of a sensory mt neuron ( britten et al . , 1992 ) . the pattern of activity exhibited by lip neurons has been modeled as the accumulation of sensory information from visual area mt toward a threshold , at which time a binary decision is complete and the eye movement initiated ( mazurek et al . , 2003 ) . the notion that lip neurons would estimate the number of stimuli within their spatially selective rfs by the computation of integration was directly tested using an implicit numerical discrimination task similar to that used to map numerical processing of the ips in humans ( piazza et al . , 2004 ) . here , monkeys passively viewed arrays of dots with different numerosities ranging from 2 to 32 located within the rf of each lip neuron studied ( roitman et al . , 2007b ) . in each block of trials , a standard numerosity ( e.g. , 8 ) was presented on half of the trials , while on the remaining half a deviant numerosity ( 2 , 4 , 16 , or 32 ) was displayed . although monkeys were required only to maintain fixation on a central point while the stimulus was displayed , presentation of a deviant stimulus predicted that the monkey would receive a larger reward for completing a gaze shift to a target in the opposite hemi - field from the rf when the fixation point was extinguished . other stimulus variables ( size , color , area , density ) were controlled to not systematically vary with number . when visual arrays were presented within the rfs of lip neurons , and monkeys were not trained to explicitly discriminate numerosity , the majority of lip neurons recorded ( 54% ) had activity that was significantly modulated by the number of elements in the visual array . neurons responded in a graded manner , either increasing or decreasing activity as the number of elements increased ( figure 4 ) . responses did not depend on other stimulus characteristics , or whether the numerosity served as standard or deviant in a given block of trials . the neurons with increasing responses resemble what would be expected by the integration of the number of elements within the rf . similar monotonically increasing responses have also been observed in parietal neurons encoding the rate of a mechanical vibration applied to the fingertips ( hernandez et al . , 2000 , 2002 ) . neurons with responses that decreased with increasing numerosity may reflect the operation of other processes . in the random - dot motion discrimination , for example , lip neurons show a time - and coherence - dependent reduction in activity when evidence favors a saccade away from the rf ( roitman and shadlen , 2002 ; mazurek et al . , 2003 ) . multiple stimuli within a rf lead to competitive interactions and a reduction in activity in superior colliculus neurons , which are strongly interconnected with lip ( li and basso , 2005 ) , in a process akin to divisive normalization ( carandini and heeger , 2011 ) . single neurons in the lateral parietal area ( lip ) respond in a graded manner to numerosity . arrays containing 432 elements were presented within the response fields of lip neurons in an implicit task , while the subjects prepared to shift their gaze away from the array . neuronal firing rate either increased ( a ) or decreased ( b ) with larger numerosities . positive and negative profiles of graded responses are sufficient to support the basic characteristics of numerical judgments . in numerical bisection tasks , participants tend to treat the geometric mean of large and small anchor values as the subjective midpoint , e.g. , 4 as the midpoint between 2 and 8 ( meck and church , 1983 ; jordan and brannon , 2006 ) . that the subjective midpoint falls at the geometric , rather than arithmetic , mean provides further evidence that mental estimations are based on ratio differences between numbers . numerical bisection judgments also show superposition regardless of the range of anchors tested ( 2 vs. 8 , 3 vs. 12 , 4 vs. 16 ) the probability that an intermediate value is judged as bisection points at the geometric mean and superposing judgments can be predicted over a range of anchor values based on a calculation of the difference between the responses of positive and negative neurons reported in lip ( pearson et al . , 2010 ) . because the ideal performance of a pair of neurons with monotonic responses ( one increasing and one decreasing ) produce judgments with sensitivity greater than that exhibited behaviorally , the model matches behavior by pooling noisy neurons , much as that needed by computational comparisons of neuronal and psychophysical sensitivity in visual area mt ( shadlen et al . , 1996 ) . the graded response profiles of lip neurons can , therefore , support numerical judgments consistent with weber 's law and without explicit representation of cardinal numerical value . this type of coding scheme of number has adaptive value as it can represent a wide range of values , without having to represent every possible number explicitly . to date , there are not data to address the maximum non - symbolic quantity that can be encoded with a graded coding scheme or the extent to which this value depends on experience / task - demands . for example , responses in lip could increase to some maximum firing rate , which could correspond to the maximal numerosity the circuitry could represent . alternatively , neural responses may adapt in order to encode multiple ranges of numerosities , such that when asked to discriminate values ranging from 1 to 5 , the numerosity 5 elicits maximal responses , but when asked to discriminate values ranging from 2 to 64 , scaling is compressed such that 64 elicits a maximal response , with less precision at intermediate values . the range over which such scaling might occur , and the adaptations single neurons might display have not yet been explicitly tested . thus , the measurements of single neuron responses to date yield two patterns of numerosity encoding - graded responses in lip and peaked tuning curves for cardinal value in vip and pfc . models of numerical processing that ultimately represent cardinal number utilize an accumulation stage to sum the number of stimuli before converting this accumulated value to numerosity ( dehaene and changeux , 1993 ; verguts and fias , 2004 ) . these findings are consistent with models in which the representation of numerosity in vip is derived from lip inputs , and are then subsequently communicated to pfc to use as a categorical decision rule . recent modeling has shown that units detecting the numerosity of visual stimuli emerge from a network learning to represent visual arrays ( stoianov and zorzi , 2012 ) . these numerosity detectors showed spatial selectivity like neurons in lip , and encoded numerosity on a compressed analog scale . it is possible that differences in task demands and experience lead to the different patterns of responses in parietal cortex . in the implicit numerical discrimination task used by roitman et al . , monkeys were never required to employ the information about quantity to explicitly guide behavior . behavioral data suggest that monkeys do attend to the numerosity of the stimulus , as saccade response times decreased with increasing differences of the deviant value from the standard , although there was no explicit report of cardinal value . in addition , stimuli in the implicit numerical discrimination task were tailored to the spatial properties of neurons , while those in the delayed - match - to - numerosity used by nieder and colleagues were not . the degree to which numerical sensitivity in parietal cortex depends on the spatial properties of the task performed remains unclear . recent work has challenged the classical view of ppc physiological responses solely guiding sensorimotor transformations to guide spatial behavior . neurons in lip , originally thought to be involved in visual attention or oculomotor intention , have been shown to respond to stimuli outside of the rf . in monkeys reporting the category of the direction of a random - dot motion stimulus , lip neurons also discriminated category identity , even when the stimuli were presented outside of the rf and the behavioral response was the ( non - spatial ) release of a lever ( freedman and assad , 2009 ) . similarly , neurons in lip report the decision about the direction of a random - dot motion stimulus ( right vs. left ) in the absence of an available choice target for motor planning ( bennur and gold , 2011 ) . this flexibility of ppc responses beyond the confines of spatially restricted rf is considerably greater than previously considered . behavioral evidence from human , infant , and animal studies suggest that numerosity is represented in a common , non - verbal format in which larger quantities are represented with less precision , resulting in judgments that follow weber 's law . patients with ppc damage show deficits consistent with the notion that this region is necessary to support the estimation of quantity and understanding of the deep meaning of numbers . converging findings from human imaging studies and non - human primate electrophysiological recordings support the idea that neurons within ppc respond to quantity with both graded responses that represent magnitude and tuning to identify cardinal value . while it has not been shown that the spatial arrangement of favors a more literal embodiment of a number line , the physiological response profiles can functionally encode numerosity in a manner that can begin to account for the psychophysics of numerical judgments . future investigations of the neural bases of numerical cognition should address a number of issues . is the representation of cardinal value derived from graded estimates of magnitude ? to what extent are these representations innate , or do they depend on explicit training and experience ? how do they form the basis for such simple computations as addition or division ? the answers to these questions will undoubtedly shed light not only on the role of ppc in numerical cognition , but also its related abstract cognitive functions . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

humans and animals appear to share a similar representation of number as an analog magnitude on an internal , subjective scale . neurological and neurophysiological data suggest that posterior parietal cortex ( ppc ) is a critical component of the circuits that form the basis of numerical abilities in humans . patients with parietal lesions are impaired in their ability to access the deep meaning of numbers . acalculiac patients with inferior parietal damage often have difficulty performing arithmetic ( 2 + 4 ? ) or number bisection ( what is between 3 and 5 ? ) tasks , but are able to recite multiplication tables and read or write numerals . functional imaging studies of neurologically intact humans performing subtraction , number comparison , and non - verbal magnitude comparison tasks show activity in areas within the intraparietal sulcus ( ips ) . taken together , clinical cases and imaging studies support a critical role for parietal cortex in the mental manipulation of numerical quantities . further , responses of single ppc neurons in non - human primates are sensitive to the numerosity of visual stimuli independent of low - level stimulus qualities . when monkeys are trained to make explicit judgments about the numerical value of such stimuli , ppc neurons encode their cardinal numerical value ; without such training ppc neurons appear to encode numerical magnitude in an analog fashion . here we suggest that the spatial and integrative properties of ppc neurons contribute to their critical role in numerical cognition .

You are an expert at summarizing long articles. Proceed to summarize the following text: such programs utilize defined mechanisms to select target conditions , based on their prevalence , severity , treatment options , and availability of a confirmatory test . similar screening programs ( based on genomics ) may be emerging for the adult population , approximately 1% of whom are predisposed to a serious hereditary condition that may be preventable or ameliorated through early diagnosis . large scale genomic sequencing initiatives comprising over 100,000 people have been announced and screening of the general adult population for hereditary cancer has recently been proposed . initiative to recruit a cohort of one million people in order to advance the cause of precision medicine , echoing the uk s effort to sequence whole genomes of 100,000 patients focusing on cancer and rare diseases . finally , we are witnessing the emergence of direct to consumer companies marketing the opportunity for genomic screening to healthy individuals , thus potentially initiating a vast uncontrolled experiment in such an approach . the vast majority of variants have no health implications , but certain rare variants cause heritable monogenic conditions . some variants have undisputed pathogenicity in these disorders , whereas most have limited or no evidence of pathogenicity and all individuals have novel variants that are essentially private to their family . importantly , many variants previously claimed as causal for monogenic disorders have conflicting assertions regarding pathogenicity , have been disputed by subsequent evidence , or have been determined to have less penetrance than other disease - causing variants in the same gene . genetic variants identified in clinical sequencing are typically classified into 5 categories with respect to their etiologic role in monogenic disorders : pathogenic , likely pathogenic , uncertain significance , likely benign , and benign . the pathogenic designation implies virtually complete certainty that the variant is causal for the disorder ; however , there is no universal agreement on what likely means . one proposal suggested that the likely pathogenic designation should imply 95 - 99% confidence in the pathogenicity of the variant , but quantitating confidence in variant pathogenicity is difficult and few standardized methods exist . for most conditions there are no gold standard confirmatory tests that can adjudicate the pathogenicity of genetic variants . in screening , the test performance ( sensitivity and specificity ) and the prevalence of the disorder determine the predictive value of a screen positive result . if genomic screening is misapplied in the general population , false positive results could lead to overtreatment , overt harm and monetary waste . thus , it is imperative to understand the performance of sequencing and how to optimize thresholds for returning results in the novel context of population screening , which are likely to be dramatically different than in a clinical diagnostic context . because of their low population prevalence , some monogenic disorders would require screening > 10,000 people in order to detect a single true positive result . in such conditions , positive predictive value ( ppv ) is highly dependent on specificity , such that for a condition with 0.01% population frequency , reduction from 100% specificity to 99.94% specificity decreases ppv to 10% . although the technical sensitivity and technical specificity of sequencing ( whether a genetic variant is truly present or not ) can be measured relatively easily , there has so far been no effort to determine the clinical sensitivity or clinical specificity ( whether the condition is truly present or not ) of sequencing in the general population . thus , it is completely unknown how genomic screening will fare in terms of predictive value . the center for genomics and society at the university of north carolina at chapel hill is conducting an exploratory project , genescreen , to examine the feasibility and ethical considerations of screening 1,000 adults from the general population using massively parallel targeted sequencing of 17 genes responsible for 11 conditions that are among the most clinically actionable monogenic disorders in adults . a central obstacle to such screening is to clearly define criteria for variant selection and return , so as to avoid unacceptable numbers of false positives that would lead to unnecessary intervention and negative emotional , physical , or social consequences . here the most stringent algorithm chooses variants that correspond closely to those that would be classified as pathogenic in human review ; the least stringent algorithm selects many additional variants that would be classified as having we estimate the specificity of these algorithms in 478 exomes from a diverse cohort of well - phenotyped participants in a separate clinical sequencing exploratory research project , allowing us to simulate expected findings in the general population . this represents the first attempt to empirically measure the performance of genomic sequencing for population screening . exome data from 478 participants in the irb - approved north carolina clinical genomic evaluation by next - gen exome sequencing ( ncgenes ) project were analyzed for the 17 genescreen genes ( apc , brca1 , brca2 , hfe , fbn1 , kcnh2 , kcnq1 , ldlr , mlh1 , msh2 , msh6 , mutyh , pms2 , ret , ryr1 , scn5a , serpina1 ) . the ncgenes participants were previously sequenced in a diagnostic context for a variety of phenotypes , including cancer , aortic aneurysm , and arrhythmia ( manuscript in preparation ) . any participants who were sequenced for a primary indication overlapping with a condition described in this manuscript were excluded from the analysis for those conditions . exome variants were loaded into a postgressql database ( v.9.0.3 ) for annotation and facilitation of queries . variants classified as pathogenic or likely pathogenic in the national center for biotechnology information clinvar database ( downloaded 2/14 ) and variants labeled as dm ( disease mutation ) in the human gene mutation database ( hgmd ; 2014 , v2 ) were collected as a source of potentially pathogenic variants . recognizing that many variants in these databases may be erroneously classified , variants were excluded if pathogenicity assertions were discordant . population allele frequency estimates were determined using the exome aggregation consortium ( exac ) , a resource composed of 63,358 unrelated individuals sequenced through a variety of studies . each gene was analyzed using one of three different minor allele frequency thresholds : 1% , 0.1% , or 0.01% . the minor allele frequency threshold chosen for each gene was based on the maximum expected population frequency of pathogenic alleles for the associated condition . in addition , variants in genes associated with conditions having dominant inheritance were eliminated if the minor allele frequency in the exome sample was > 0.5% . cadd scores were retrieved for novel missense variants , with a phred score of 13 as the threshold for deleteriousness . conserved functional domains within proteins five variant selection algorithms ( vsa1 - 5 ) were applied to the 17 genes , with each successive algorithm choosing more potentially pathogenic variants that could qualify as a positive screening result : vsa-1 includes rare variants classified as pathogenic in clinvar . pathogenic in human review.vsa-2 adds rare predicted truncating variants ( nonsense , frameshift , canonical splice - site ) . these additional variants would largely be considered likely pathogenic in human review.vsa-3 adds rare variants classified as likely pathogenic in clinvar and/or as a disease mutation ( dm ) in hgmd . uncertain significance in human review.vsa-4 adds rare missense variants with cadd scores > 13 that are located within a conserved functional domain . most of these variants would be considered to have uncertain significance in human review.vsa-5 adds all rare missense variants , regardless of cadd score or location . the algorithms take into account zygosity , such that either a homozygous variant or two potentially biallelic variants were required for a positive screen in mutyh , hfe , and serpina1 . vsa-2 adds rare predicted truncating variants ( nonsense , frameshift , canonical splice - site ) . likely pathogenic in clinvar and/or as a disease mutation ( dm ) in hgmd . vsa-4 adds rare missense variants with cadd scores > 13 that are located within a conserved functional domain . most of these variants would also be considered to have uncertain significance . while each successive algorithm is expected to have increased sensitivity , the actual sensitivity can not be directly measured in this cohort because we excluded participants with phenotypes overlapping these conditions . given the rarity of the conditions being evaluated , we do not expect to find truly affected individuals for most of the disorders . therefore , the number of true positives in the sample should be between 0 - 1 for most conditions , even including non - penetrant alleles . for estimated specificity calculations , we assumed that all positive screening results in this small sample were false positives , with the exception of certain variants with undisputed pathogenicity after curation of results from vsa-1 and vsa-2 ( eg . exome data from 478 participants in the irb - approved north carolina clinical genomic evaluation by next - gen exome sequencing ( ncgenes ) project were analyzed for the 17 genescreen genes ( apc , brca1 , brca2 , hfe , fbn1 , kcnh2 , kcnq1 , ldlr , mlh1 , msh2 , msh6 , mutyh , pms2 , ret , ryr1 , scn5a , serpina1 ) . the ncgenes participants were previously sequenced in a diagnostic context for a variety of phenotypes , including cancer , aortic aneurysm , and arrhythmia ( manuscript in preparation ) . any participants who were sequenced for a primary indication overlapping with a condition described in this manuscript were excluded from the analysis for those conditions . exome variants were loaded into a postgressql database ( v.9.0.3 ) for annotation and facilitation of queries . variants classified as pathogenic or likely pathogenic in the national center for biotechnology information clinvar database ( downloaded 2/14 ) and variants labeled as dm ( disease mutation ) in the human gene mutation database ( hgmd ; 2014 , v2 ) were collected as a source of potentially pathogenic variants . recognizing that many variants in these databases may be erroneously classified , variants were excluded if pathogenicity assertions were discordant . population allele frequency estimates were determined using the exome aggregation consortium ( exac ) , a resource composed of 63,358 unrelated individuals sequenced through a variety of studies . each gene was analyzed using one of three different minor allele frequency thresholds : 1% , 0.1% , or 0.01% . the minor allele frequency threshold chosen for each gene was based on the maximum expected population frequency of pathogenic alleles for the associated condition . in addition , variants in genes associated with conditions having dominant inheritance were eliminated if the minor allele frequency in the exome sample was > 0.5% . cadd scores were retrieved for novel missense variants , with a phred score of 13 as the threshold for deleteriousness . conserved functional domains within proteins five variant selection algorithms ( vsa1 - 5 ) were applied to the 17 genes , with each successive algorithm choosing more potentially pathogenic variants that could qualify as a positive screening result : vsa-1 includes rare variants classified as pathogenic in clinvar . pathogenic in human review.vsa-2 adds rare predicted truncating variants ( nonsense , frameshift , canonical splice - site ) . these additional variants would largely be considered likely pathogenic in clinvar and/or as a disease mutation ( dm ) in hgmd . likely pathogenic or to have uncertain significance in human review.vsa-4 adds rare missense variants with cadd scores > 13 that are located within a conserved functional domain . most of these variants would be considered to have uncertain significance in human review.vsa-5 adds all rare missense variants , regardless of cadd score or location . the algorithms take into account zygosity , such that either a homozygous variant or two potentially biallelic variants were required for a positive screen in mutyh , hfe , and serpina1 . vsa-2 adds rare predicted truncating variants ( nonsense , frameshift , canonical splice - site ) . likely pathogenic in clinvar and/or as a disease mutation ( dm ) in hgmd . vsa-4 adds rare missense variants with cadd scores > 13 that are located within a conserved functional domain . most of these variants would be considered to have uncertain significance in human review . most of these variants would also be considered to have uncertain significance . while each successive algorithm is expected to have increased sensitivity , the actual sensitivity can not be directly measured in this cohort because we excluded participants with phenotypes overlapping these conditions . given the rarity of the conditions being evaluated , we do not expect to find truly affected individuals for most of the disorders . therefore , the number of true positives in the sample should be between 0 - 1 for most conditions , even including non - penetrant alleles . for estimated specificity calculations , we assumed that all positive screening results in this small sample were false positives , with the exception of certain variants with undisputed pathogenicity after curation of results from vsa-1 and vsa-2 ( eg . the genescreen project has identified 17 genes implicated in 11 monogenic disorders that are expected to be highly actionable in the adult population , in which to explore genomic screening in the general population . we simulated the performance of genomic screening of these genes in the general population by applying five algorithms for identifying potentially pathogenic variants in 478 exomes ( figure 1 ) . pathogenic in clinvar , has the lowest sensitivity of the algorithms tested and returned the fewest variants overall , with specificity expected to approach 100% in ideal testing conditions if results are restricted to unquestionably pathogenic variants . even so , some variants currently listed in clinvar as pathogenic are not definitively pathogenic and thus the specificity of vsa-1 was 99.5% . the overall specificity of vsa-2 was also 99.5% and the overall specificity of vsa-3 was 99.4% . as expected , the most sensitive algorithms , which include rare missense variants , had the lowest specificity : vsa-4 had an overall specificity of 98.7% , and vsa-5 had an overall specificity of 97.1% . this demonstrates that the increased sensitivity afforded by inclusion of missense variants results in a concomitant decrease in overall specificity and hence would result in a substantial increase in false positive results . however , it is more important to consider the performance of the algorithms with respect to each gene . two individuals were homozygous for the hfe c282y pathogenic variant , and another two individuals were homozygous for the serpina1 pathogenic variant that results in the pi - z these findings are interpreted to be true positives since their pathogenicity is undisputed . two of the genes with very low prevalence ( mutyh and ret ) had no positive screening results identified by any algorithm . most of the genes had very few positive results identified by either vsa-1 or vsa-2 , indicating that increasing the sensitivity of the algorithm by including rare predicted truncating variants does not dramatically reduce specificity . vsa-3 ( which includes variants classified in clinvar as likely pathogenic or hgmd as disease mutations ) identified numerous positive results in several genes , including brca1 , brca2 , kcnq1 , ldlr , and ryr1 , consistent with the well - established concern of misclassification of variants in current reference databases and highlighting the need for databases with high quality lists of pathogenic variants . finally , a large number of positive results were identified in most genes by the more sensitive algorithms , vsa-4 and vsa-5 , reflecting higher underlying variation in certain genes that could impose an upper limit on the possible clinical sensitivity of genomic screening in order to preserve specificity . the performance of the variant selection algorithms for each gene was plotted as 1-specificity ( figure 2 ) . this study models genomic screening of 17 genes for 11 highly actionable monogenic disorders and demonstrates the tradeoff between sensitivity and specificity among variant selection algorithms that might be used in a large - scale screening program . genomic screening of the general population differs significantly from the much more familiar pursuit of diagnostic genomic sequencing because a symptomatic patient has a much higher pre - test probability of having a pathogenic variant than the average individual in the general population . we have evaluated informatics algorithms that can be used to screen genomic data for potentially pathogenic variants , and for the first time attempted to measure the specificity of genomic findings in the context of population screening . for most conditions , the true clinical sensitivity of genetic testing is not well established . in some cases , a very small number of variants account for a high proportion of cases and thus sensitivity of the most stringent variant selection algorithms will be high , whereas in other conditions a high proportion of cases are due to novel or private mutations that would not be documented in databases of known pathogenic variants , thus reducing the sensitivity of the most stringent variant selection algorithms . in most conditions it is very difficult to discern what fraction of cases are caused by recurrent mutations ( which would be considered known pathogenic ) versus novel or rare mutations that may only occur in a small fraction of cases ( which might be considered that being said , the predictive value of a sequencing - based screening test for rare monogenic disorders hinges predominantly on specificity , not sensitivity . we suggest that the degree of confidence regarding variant pathogenicity is analogous to the specificity of that result . variants have 90 - 95% specificity depending on the confidence standard applied . in the diagnostic context , reduced specificity is acceptable because of the high pre - test probability and the importance of excluding a diagnosis , when possible . however , when screening the general population for rare conditions , even a small decrease in specificity has a devastating impact on ppv . conversely , in the case of rare conditions npv is not significantly improved by even large changes in sensitivity , which decreases the imperative to consider novel variants that inherently reduce the specificity of the screening test . these factors are critical points to consider in the design of genomic screening algorithms for the healthy population . for example , the prevalence of three brca1 and brca2 pathogenic founder mutations in the ashkenazi jewish population is 2.6% and the specificity for these variants is 100% , resulting in a very high ppv . however , the specificity of most other variants ( including novel truncating variants ) will be less than 100% . in the general population , where disease prevalence is less than 1% and a much wider range of pathogenic variants is detected , a decrease of specificity to even 99% would result in a ppv of 37% , which some may find unacceptable for application of such screening in the general population . this dramatic decrease in ppv , despite a very small change in specificity , is true for all rare monogenic conditions . it should be noted that fully automated analysis of results without some level of human curation prior to confirmation and reporting is not possible at present ; thus variants flagged as a possible positive screening result by informatics algorithms are expected to undergo scrutiny by a human analyst to further reduce reporting of clearly non - pathogenic variants . this necessity for some level of human curation will be a critical limiting factor for deployment of genomics in large - scale population screening but can be optimized by designing variant selection algorithms that maximize the sensitivity of the screen without burdening the reviewer with numerous non - pathogenic variants . in the long term , the empiric sensitivity and specificity of variant selection algorithms may be a more accurate measure of predictive value than the pathogenicity classifications used in diagnostic testing . the conditions being evaluated in the genescreen project are heterogeneous with respect to the penetrance , expressivity of manifestations , and recommended follow - up management strategies ( table 1 ) . positive genomic screening results in these conditions would lead to increased clinical surveillance and other interventions . in the case of pathogenic variants in brca1 or brca2 , these recommendations are very different from management of familial hypercholesterolemia due to pathogenic variants in ldlr , which includes periodic monitoring of cholesterol and treatment with cholesterol - lowering medications , an efficacious intervention with dramatically less impact ( physical , psychosocial and monetary ) . it should be noted that in conditions with incomplete penetrance , even truly pathogenic variants may not manifest in disease and therefore would constitute overdiagnosis in some individuals who would not develop disease in their lifetime . this concern is similar in many ways to a false positive result , in that the downstream consequences would not be expected to benefit these individuals and would only expose them to harm . the negative consequences of genomic screening can be minimized if any of the following conditions exists : 1 ) test performance maximizes ppv and thus results in few false positives , 2 ) low - risk confirmatory follow - up tests can reduce the number of false positives , or 3 ) downstream consequences of false positives are relatively insignificant . thus , a genomic screening project could consider customizing ppv thresholds for different conditions based on the above criteria and available information about the mutational spectrum and proportion of cases attributable to known versus novel mutations ( table 1 ) . for example , for brca1 or brca2 the false positive rate will need to be very low , because risk - reducing surgery is an important management step and no confirmatory tests exist to ensure that a genetic variant is indeed pathogenic . thus , only carefully curated lists of pathogenic variants and , perhaps , rare truncating variants ( the equivalent of vsa-2 ) should be reported in a screening context . in other cases , inclusion of rare , potentially damaging missense variants ( vsa-4 ) may be acceptable , depending on the specificity of variant selection algorithms for the gene , the spectrum of pathogenic mutations observed , and the false positive tolerance based on clinical implications of a positive screening result . the argument that population genomic screening should utilize gene - specific false positive thresholds requires precise measurement of the clinical sensitivity and clinical specificity of variant selection algorithms ( as well as the prevalence of the condition ) in order to optimize ppv . however , such estimates will likely require a dataset of 100,000 + individuals with extensive phenotypic data , which does not yet exist , and the specificity estimates provided here should be considered provisional . existing datasets fail to comprehensively ascertain the pathogenic and benign variants that are present in diverse populations , which will impact variant selection algorithms and pathogenicity assessments . in addition , databases of clinically relevant variants are known to have entries with misattributed pathogenicity , and will need to be greatly improved before they can be relied upon for screening . screening the general population for deleterious variants in highly selected genes holds great promise to decrease morbidity and mortality for millions of individuals . however , we must be cognizant of our limited ability to interpret the pathogenicity of rare genomic variation , the implications this has for standards used to analyze and report genomic findings , and the downstream consequences of screening in the general population . otherwise , great harm could result . much additional research is required to assess the overall cost of screening efforts , including the downstream effects of false positive tests , in order to evaluate the overall economic impact of genomic screening . a host of factors will need to be studied , including cost - effectiveness , adverse consequences of interventions , insurance impact , education and consent materials that address the complexity of potential harms and benefits of screening , implications for reproductive choices , potential psychosocial impacts , and the benefits and harms of familial cascade testing . in this study we have addressed a small subset of highly actionable genetic conditions , that we think are currently the most promising candidates for genomic screening in the general adult population . however , these results also have fundamental implications for any effort that considers genome - scale sequencing in healthy individuals . although genomic sequencing is inherently appealing for personalized medical care , it should be initiated cautiously with rigorous attention to the predictive value of genetic variation , and with careful consideration of the implications of false positive results across the broad range of genetic conditions that could potentially be identified . we suggest that the degree of confidence regarding variant pathogenicity is analogous to the specificity of that result . variants have 90 - 95% specificity depending on the confidence standard applied . in the diagnostic context , reduced specificity is acceptable because of the high pre - test probability and the importance of excluding a diagnosis , when possible . however , when screening the general population for rare conditions , even a small decrease in specificity has a devastating impact on ppv . conversely , in the case of rare conditions npv is not significantly improved by even large changes in sensitivity , which decreases the imperative to consider novel variants that inherently reduce the specificity of the screening test . these factors are critical points to consider in the design of genomic screening algorithms for the healthy population . for example , the prevalence of three brca1 and brca2 pathogenic founder mutations in the ashkenazi jewish population is 2.6% and the specificity for these variants is 100% , resulting in a very high ppv . however , the specificity of most other variants ( including novel truncating variants ) will be less than 100% . in the general population , where disease prevalence is less than 1% and a much wider range of pathogenic variants is detected , a decrease of specificity to even 99% would result in a ppv of 37% , which some may find unacceptable for application of such screening in the general population . this dramatic decrease in ppv , despite a very small change in specificity , is true for all rare monogenic conditions . it should be noted that fully automated analysis of results without some level of human curation prior to confirmation and reporting is not possible at present ; thus variants flagged as a possible positive screening result by informatics algorithms are expected to undergo scrutiny by a human analyst to further reduce reporting of clearly non - pathogenic variants . this necessity for some level of human curation will be a critical limiting factor for deployment of genomics in large - scale population screening but can be optimized by designing variant selection algorithms that maximize the sensitivity of the screen without burdening the reviewer with numerous non - pathogenic variants . in the long term , the empiric sensitivity and specificity of variant selection algorithms may be a more accurate measure of predictive value than the pathogenicity classifications used in diagnostic testing . the conditions being evaluated in the genescreen project are heterogeneous with respect to the penetrance , expressivity of manifestations , and recommended follow - up management strategies ( table 1 ) . positive genomic screening results in these conditions would lead to increased clinical surveillance and other interventions . in the case of pathogenic variants in brca1 or brca2 , these recommendations are very different from management of familial hypercholesterolemia due to pathogenic variants in ldlr , which includes periodic monitoring of cholesterol and treatment with cholesterol - lowering medications , an efficacious intervention with dramatically less impact ( physical , psychosocial and monetary ) . it should be noted that in conditions with incomplete penetrance , even truly pathogenic variants may not manifest in disease and therefore would constitute overdiagnosis in some individuals who would not develop disease in their lifetime . this concern is similar in many ways to a false positive result , in that the downstream consequences would not be expected to benefit these individuals and would only expose them to harm . the negative consequences of genomic screening can be minimized if any of the following conditions exists : 1 ) test performance maximizes ppv and thus results in few false positives , 2 ) low - risk confirmatory follow - up tests can reduce the number of false positives , or 3 ) downstream consequences of false positives are relatively insignificant . thus , a genomic screening project could consider customizing ppv thresholds for different conditions based on the above criteria and available information about the mutational spectrum and proportion of cases attributable to known versus novel mutations ( table 1 ) . for example , for brca1 or brca2 the false positive rate will need to be very low , because risk - reducing surgery is an important management step and no confirmatory tests exist to ensure that a genetic variant is indeed pathogenic . thus , only carefully curated lists of pathogenic variants and , perhaps , rare truncating variants ( the equivalent of vsa-2 ) should be reported in a screening context . in other cases , inclusion of rare , potentially damaging missense variants ( vsa-4 ) may be acceptable , depending on the specificity of variant selection algorithms for the gene , the spectrum of pathogenic mutations observed , and the false positive tolerance based on clinical implications of a positive screening result . the argument that population genomic screening should utilize gene - specific false positive thresholds requires precise measurement of the clinical sensitivity and clinical specificity of variant selection algorithms ( as well as the prevalence of the condition ) in order to optimize ppv . however , such estimates will likely require a dataset of 100,000 + individuals with extensive phenotypic data , which does not yet exist , and the specificity estimates provided here should be considered provisional . existing datasets fail to comprehensively ascertain the pathogenic and benign variants that are present in diverse populations , which will impact variant selection algorithms and pathogenicity assessments . in addition , databases of clinically relevant variants are known to have entries with misattributed pathogenicity , and will need to be greatly improved before they can be relied upon for screening . screening the general population for deleterious variants in highly selected genes holds great promise to decrease morbidity and mortality for millions of individuals . however , we must be cognizant of our limited ability to interpret the pathogenicity of rare genomic variation , the implications this has for standards used to analyze and report genomic findings , and the downstream consequences of screening in the general population . otherwise , great harm could result . much additional research is required to assess the overall cost of screening efforts , including the downstream effects of false positive tests , in order to evaluate the overall economic impact of genomic screening . a host of factors will need to be studied , including cost - effectiveness , adverse consequences of interventions , insurance impact , education and consent materials that address the complexity of potential harms and benefits of screening , implications for reproductive choices , potential psychosocial impacts , and the benefits and harms of familial cascade testing . in this study we have addressed a small subset of highly actionable genetic conditions , that we think are currently the most promising candidates for genomic screening in the general adult population . however , these results also have fundamental implications for any effort that considers genome - scale sequencing in healthy individuals . although genomic sequencing is inherently appealing for personalized medical care , it should be initiated cautiously with rigorous attention to the predictive value of genetic variation , and with careful consideration of the implications of false positive results across the broad range of genetic conditions that could potentially be identified .

purposeutilization of sequencing to screen the general population for preventable monogenic conditions is receiving substantial attention due to its potential to decrease morbidity and mortality . however , the selection of which variants to return is a serious implementation challenge . procedures must be investigated to ensure optimal test characteristics and avoidance of harm from false positive test results.methodswe scanned exome sequences from 478 well - phenotyped individuals for potentially pathogenic variants in 17 genes representing 11 conditions that are among the most medically actionable mendelian disorders in adults . we developed 5 variant selection algorithms with increasing sensitivity and measured their specificity in these 17 genes.resultsvariant selection algorithms with increasing sensitivity exhibited decreased specificity , and performance was highly dependent on the genes analyzed . the most sensitive algorithm ranged from 88.8% to 99.6% specificity among the 17 genes.conclusionfor very low prevalence conditions , small reductions in specificity greatly increase false positives . this inescapable test characteristic governs the predictive value of genomic sequencing in the general population . to address this issue , test performance must be evaluated systematically for each condition so that the false negatives and false positives can be tailored for optimal outcomes , depending on the downstream clinical consequences .

You are an expert at summarizing long articles. Proceed to summarize the following text: over the past decade , public and private funding institutions have invested billions of dollars in the fields of human neuroimaging and genetics ( akil et al . , 2010 ) . recently , researchers have sought to use quantitative measures from brain images to test how genetic variation influences the brain . imaging measures are thought to have a simpler genetic architecture than diagnostic measures based on cognitive or clinical assessments ( gottesman and gould , 2003 ) . in other words , the penetrance of an individual genetic polymorphism is expected to be higher at the imaging level than at the diagnostic level . as such , imaging - derived traits may offer more power to detect how specific genes contribute to brain disease . genetic analysis of images has been used to discover how susceptibility genes affect brain integrity ( braskie et al . , 2011b ) . recent studies have revealed gene effects operating within an entire population , in the form of a 3d brain map ( thompson et al . , 2001 ; stein et al . optimally merging these two well - developed fields requires innovative mathematics and computational methods , guided by genomics and neuroscience . they generally test how a single genetic variant , or a small set of such variants ( usually single nucleotide polymorphisms , or snps ) are associated with a single summary measure of the brain . these studies begin to bridge the gap between the two fields , but do not take full advantage of advanced methods from either field , which can survey the entire genome or allow an image - wide search . by contrast , multivariate statistical methods such as machine learning and sparse regression can handle high dimensional datasets . many of these are being adapted to analyze a range of brain processes and biological markers of disease . in this review , we summarize the recent evolution of imaging genetics , from candidate gene studies to multilocus methods and genome - wide searches to genome - wide , image - wide searches . we explain how images are used in different ways , ranging from single region - of - interest ( roi ) methods that assess the volume or shape of a specific brain region , such as the hippocampus to voxelwise approaches that survey the whole brain at once in 3d . in these efforts , multivariate , multilocus techniques can model how several genetic variants affect the brain at once . specialized approaches such as sparse coding methods can simultaneously handle the high dimensionality and high degree of correlation observed across the genome and in image - derived maps . in studies that scan a large number of patients or controls , candidate gene studies have often been used to assess genetic effects on the brain . this approach is appealing as one can test biologically plausible hypotheses and determine how specific , well - studied genetic variations affect brain structure and function . early studies , for instance , explored how genes related to serotonin transport affected measures extracted from single - photon emission computed tomography ( spect ) and functional magnetic resonance imaging ( fmri ; heinz et al . . serotonin s role in neurotransmission and neuromodulation and the well - known anatomy of the monoamine systems made it possible to frame and confirm testable hypotheses for pertinent regions such as the raphe nuclei and amygdala ( munafo et al . candidate gene studies , such as those above , may assess a single measure derived from a specific roi in the image . this may be the whole brain , or a subregion such as the gray matter , or the volume or mean activation of a subcortical region . more recently , voxel - by - voxel searches have been conducted to assess candidate gene effects throughout the whole brain in 3d . this unbiased search across the brain makes no prior assumptions on which regions may be affected . spatial statistics , such as principal components analysis ( pca ) or ica , may also be performed for dimension reduction , and multiple comparisons corrections , such as the false discovery rate ( fdr ) method , can help to decide if a pattern of gene effects is significant across the voxels searched . 2010 ) investigated the effects of a proxy snp in the fat mass and obesity - associated ( fto ) gene reliably associated with increased risk for obesity ( rs3751812 ; frayling et al . , 2007 ) on brain structure . they used mri along with tensor - based morphometry ( tbm ) , to evaluate 206 healthy elderly subjects . fto risk allele carriers had lower frontal and occipital lobe volumes ( figure 1 ) . in such studies , maps of statistical associations are created by performing separate association tests at each imaging voxel in the brain . as the number of statistical tests is very large , a standard correction for multiple comparisons can be used , such as the fdr method ( benjamini and hochberg , 1995 ) or its more advanced variants such as topological fdr ( chumbley et al . , 2010 ) , which consider the geometry of the effects . these corrections assess how likely it is that the overall pattern of associations could be observed by chance . voxel - based analyses may also be informed by prior hypotheses : roi may be defined as search regions , such as the temporal lobes , to include prior information on the expected location or patterns of effects ( stein et al . , 2010a ) . p - values ( corrected using the false discovery rate method ; left panel ) and corresponding regression coefficients ( right ) show the statistical associations between a candidate single nucleotide polymorphism in the fto gene ( which is associated with higher risk of obesity ) and tensor - based morphometry maps derived from anatomical mri scans of the brain . clearly , if other regions had been specified in advance as the target of study , association effects may have been missed . brain imaging measures used in genetic studies should ideally be highly heritable and be genetically related to a biological process affected by genetic variation , such as a disease process ( gottesman and gould , 2003 ; glahn et al . some argue that the use of imaging endophenotypes should boost power to detect genetic variants that have reliable but small effects on disease status ( meyer - lindenberg and weinberger , 2006 ) . one neuroimaging modality that shows great promise in candidate gene studies is diffusion tensor imaging ( dti ) , which assesses the fiber integrity of the brain s white matter . dti is based on the observation that myelination restricts water diffusion , and disease processes typically increase water diffusion across cell membranes ( beaulieu , 2002 ) . some dti - derived measures , such as the fractional anisotropy ( fa ) of diffusion , fa is highly heritable ( chiang et al . , 2009 ; kochunov et al . , 2010 ) and is consistently altered in a range of developmental and psychiatric disorders ( thomason and thompson , 2011 ) . candidate polymorphisms already associated with brain disorders may be surveyed to discover associations with maps of dti parameters such as fa . one recent dti study of young healthy adults ( braskie et al . , 2011a ) , studied the voxelwise effects of the rs11136000 snp in the recently discovered alzheimer s disease ( ad ) risk gene , clu . significant associations were detected in several anatomical regions that undergo atrophy in ad ( figure 2 ) . in similar candidate gene studies using dti , other genes such as bdnf ( chiang et al . , 2011a ) and comt ( thomason et al . , 2010 ) have been found to influence white matter structure , with carriers of one variant showing consistently higher or lower fa . corrected p - values ( a ) and regression coefficients ( b ) are shown for the voxelwise effects of a candidate polymorphism in the clu gene a highly prevalent alzheimer s susceptibility gene on fractional anisotropy maps derived from dti scans of 398 young adults . the axial slice shows the extensive influence of the genetic variant on white matter structure . candidate gene studies have successfully discovered patterns of brain differences associated with genetic variants whose function is relatively well - known ( such as apoe , for example a risk gene for late - onset ad ; shaw et al . , 2007 ) . the choice of a candidate gene , however , requires a strong prior hypothesis , and most of the genetic determinants of the highly heritable imaging measures ( connectivity or cortical thickness , for example ) are unknown . in most candidate gene studies in imaging , there is a correction for multiple comparisons to control the rate of false discoveries across the image , but this does not take into account the genetic variant tested , or the fact that it could have been selected from a wide list of possibly associated genes . in genetics , and by extension imaging genetics , there is a high risk of false - positive findings unless appropriate corrections are made . moving beyond candidate gene studies to an unbiased search of the whole genome otherwise , many false - positive associations will be reported that would not be replicated in the future ( ioannidis , 2005 ) . genome - wide association ( gwa ) studies typically assess associations between hundreds of thousands of snps and a phenotype of interest ( such as a disease , or a specific image - derived measure ) . gwa studies have discovered hundreds of common risk loci for diseases and traits in recent years ( hindorff et al . , 2009 ) . gwa studies are frequently conducted for discrete , case control phenotypes , such as the diagnosis of a specific disease ( such as ad or schizophrenia vs. healthy control ) . these studies , however , are limited as participants do not always fall clearly into unique diagnostic categories , and may vary in dimensions not relevant to disease ( pearson and manolio , 2008 ) . for neuropsychiatric disorders in particular , symptoms expressed by members of specific diagnostic groups may be highly heterogeneous and there may also be substantial co - morbidity and overlap in symptom profiles across disorders ( psychiatric gwas consortium coordinating committee et al . measures derived from brain images in principle are closer to the underlying biology of gene action , offering an alternative target for genome - wide searches , by serving as intermediate phenotypes or endophenotypes for gwa studies ( gottesman and gould , 2003 ; hall and smoller , 2010 ) . ( 2009b ) identified snps in two genes ( rsrc1 and arhgap18 ) that showed associations with a blood - oxygen - level dependent ( bold ) contrast measure from a brain region implicated in schizophrenia . ( 2010a ) discovered a snp in the grin2b gene ( rs10845840 ) and an intergenic snp ( rs2456930 ) associated with an mri - derived tbm ) measure of temporal lobe volume in 740 elderly subjects from the ad neuroimaging initiative . in these and other studies , linear regressions are used to assess the additive or dominant allelic effect of each snp , after adjusting for covariates such as age and sex , and the confounding effects of population stratification ( e.g. , potkin et al . , 2009a ) . this yields p - values assessing the evidence for the association of each snp with the imaging summary chosen . the overall significance of any one snp effect is then assessed through a form of genome - wide correction for multiple comparisons . commonly , a nominal p - value less than 5 10 is used . the gwa study design has been extended to analyze whole images , but one of the shortcomings of all gwas studies is their limited power ( or alternatively , the large sample sizes needed ) to detect relevant gene variants . most snps affecting the brain have modest effect sizes ( often explaining < 1% of the variance in a quantitative phenotype ) . replication , and meta - analysis in particular , have been widely embraced as a way to aggregate evidence from multiple genetic studies , including studies of disease risk , and normally varying traits such as height ( de bakker et al . , 2008 ; mccarthy et al . , 2008 ; zeggini and ioannidis , 2009 ; yang et al . , 2010 ) . even so , most imaging gwa studies consider under a thousand subjects , so are limited in detection power . this led many researchers in the field to band together to search for relevant genetic associations with imaging traits meta - analytically , in many large samples . one promising initiative is called enhancing neuro imaging genetics through meta - analysis ( enigma ) and is currently accepting research groups who want to become involved in meta - analytic imaging genomics projects ( http://enigma.loni.ucla.edu/ ) . the enigma pilot project is a large meta - analysis to discover genes associated with hippocampal volume on brain mri in over 9,000 subjects scanned by 21 research centers ( the enigma consortium , 2011 ) . future imaging genetics studies may rely on large meta - analyses and international collaborations to overcome the low power and relatively small effect sizes . however , some genetic associations can be found and replicated without vast meta - analytic approaches like enigma . 2011 ) discovered and replicated an association between caudate volume and the snp rs163030 located in and around two genes , wdr41 and pde8b . these genes are involved in dopamine signaling and development ; a mendelian mutation in one leads to severe caudate atrophy . similarly , joyner et al . ( 2009 ) replicated an association with cortical surface area in a common variant ( rs2239464 ) of the mecp2 gene , which is linked to microencephaly and other morphological brain disorders . studying a single imaging measure with a genome - wide search is as limited as picking a single candidate gene from the entire genome it may not fully reflect how a given genetic variant influences the brain , or it may miss an important effect by being too restrictive . important links may be overlooked if a gene variant influences a brain feature present but not measured in the images . to broaden the range of measures surveyed in each image , shen et al . ( 2010 ) studied patients with ad and mild cognitive impairment ( mci ) using whole - brain voxel - based morphometry ( vbm ; good et al . , 2001 ) and split the brain into 142 cortical and subcortical rois using the segmentation software package freesurfer ( fischl et al . , 2002 ) . the vbm measure within each roi was averaged for each subject and those values were used as traits for gwa scans . one snp , rs6463843 , from the nxph1 gene , was significantly associated with gray matter density in the hippocampus , and had broad morphometric effects in a post hoc exploratory analysis . while this study found plausible results , the computation of summaries from roi may miss patterns of effects that lie only partially within the chosen roi . as such , a combination of map - based and roi - based methods seems ideal . some researchers have combined unbiased tests of association across the genome with unbiased searches of the entire brain , instead of relying on summary measures derived from roi . combining gwa scans with an image - wide search is computationally intensive , requiring new methods to handle the high dimensionality and multiple statistical comparisons . three dimensional brain images may contain over 100,000 voxels , and a completely unbiased search may test up to one million snps for association at each voxel . this is extremely computationally intensive , but can be completed in a feasible time frame if the process is parallelized . ( 2010b ) performed a full gwa scan at each voxel in maps of regional brain volume calculated by tbm ( leow et al . , sixteen billion tests of association were conducted in a so - called voxelwise genome - wide association study ( vgwas ) . to accommodate the huge number of statistical tests performed , the p - value distribution for the top snp was modeled as a beta distribution , beta(1 , n ) , where n is an estimate of the effective number of independent tests performed ( ewens and grant , 2001 ) . the resulting distribution of minimum p - values across the genome , assembled from voxels across the image , was transformed into a uniform distribution in the null case for multiple comparisons correction across the image . fdr was used to correct for multiple comparisons across the image , and to assess whether credible effects had been detected ( benjamini and hochberg , 1995 ) . several top snps were associated with moderate regional brain volume differences ; many were in genes that are expressed in the brain ( figure 3 ) . however , no snps passed the strict correction for multiple comparisons . the stein et al . study was a proof of concept , showing that a completely unbiased search of the genome is feasible with imaging phenotypes . however , the huge correction for multiple comparisons across the image and genome are practically insurmountable unless the effect size or cohort size is very large . in addition , the vgwa study required 27 h when spread across 500 cpus ; this is more computational power than most researchers typically have access to . clearly , an optimal balance must be made between pure discovery methods , unconstrained by prior hypotheses , and those that invoke prior biological information to boost power and reduce the multiple comparisons correction . the five most highly associated snps identified by vgwas are shown on slices of an averaged brain mri template , indicating regions where these snps were the most highly associated out of all snps ( in purple ) . coordinates refer to the icbm standard space , and the cohort is the adni sample . multivariate methods can be used to assess the joint effect of multiple genetic variants simultaneously , and are widely used in genetics ( phillips and belknap , 2002 ; gianola et al . , 2003 ; cantor et al . , for example , set - based permutation methods use gene annotation information and linkage disequilibrium values to group univariate p - values from traditional gwa studies into gene - based test statistics ( hoh et al . , 2001 ; set - based approaches use prior information on gene structure to incorporate all genotyped snps in a given gene into a single test statistic . this can offer , in some cases , greater power than univariate statistical tests to detect snp effects . combining univariate p - values into a single gene - based test it can also aggregate the cumulative evidence of association across a gene block to account for allelic heterogeneity ( hoh et al . , 2001 ) . individual snp p - values may not achieve the genome - wide significance level for a traditional gwa study ( nominally p < 5 10 ) , but if several snps in the same ld block show moderate association , the combined evidence for association may be enough to beat a gene - wide significance level ( nominally p < 5 10 ) . for example , one study examined snps from the sorl1 gene for association with hippocampal volume in healthy elderly controls ( bralten et al . , 2011 ) . while they did not find evidence for association of individual snps in a discovery and replication dataset , some set - based statistics may be derived from the separate p - values from the individual univariate tests , enabling post hoc analysis of published studies . a major issue in applying set - based statistics in imaging genetics is that the permutation procedure applied across snp groupings would be very computationally intensive . set - based methods are currently not feasible to apply at > 100,000 voxels , as a single gene test takes around 5 min ( or 22.8 years to test a single gene at every voxel of the full brain on one cpu ) . in addition , combining snps by p - value may miss an important effect where a set of snps from the same gene have moderate covariance , but explain different portions of variance in the phenotype . in other words , if they were considered together in the same model , the overall variance explained may be greater than its univariate significance level would imply . an alternative to set - based methods is to group snps into a single statistical model and then test that model for overall association . however , a problem with applying mlr to genetic data is that snps tend to be highly correlated , as they co - segregate in haplotype blocks ( frazer et al . , 2007 ) . the mlr is highly sensitive to collinearity among predictors ; the inversion step in calculating regression coefficients involves a matrix that is not full rank as the variables are collinear . this leads to wildly inaccurate beta value estimates and se ( kleinbaum , 2007 ) . to avoid collinearity in multivariate analysis of genetic data , dimensionality is often reduced using sparse regression methods , such as penalized or principal components regression ( pcreg ) . some data reduction methods compute a new set of statistically orthogonal variables , for inclusion in a classical mlr model . a data reduction method such as pca transforms a matrix of snp predictors into a new orthogonal set of predictors , ranked in descending order based on the amount of the variance in the data that each component explains ( jolliffe , 2002 ) . the output of pca is typically a matrix that explains the same amount of the overall variance as the original predictors , but without the collinearity . as the individual components are sorted by amount of variance they explain , the resulting statistical models can strike an efficient balance between the total variance explained ( the number of components to include ) and the number of degrees of freedom used ( model complexity increases as more variance components are included ) . it then builds a multiple partial - f regression model where the number of components included is based on the desired proportion of variance to be explained ( massy , 1965 ) . wang and abbott ( 2008 ) used pcreg to group snps into a single multivariate test statistic . ( 2011 ) extended this method to be applicable to images , conducting gene - based tests at each voxel with pcreg . , 2005 ; hemminger et al . , 2006 ; hinrichs et al . , 2006 ) to group snps based on gene membership , resulting in 18,044 unique genes . using the set of snps in each individual gene as predictors , hibar et al . used pcreg to assess the degree of association for every gene at every voxel in the full brain . the resulting method was termed a voxelwise gene - wide association study vgenewas . by compressing the snps into gene - based tests , the total number of tests was reduced to around 500 million tests from the 16 billion tests in vgwas . however , even with this much smaller number of tests , no genes identified passed correction for multiple comparisons . the most highly associated gene , gab2 , showed strong credibility as it is consistently associated with neurodegenerative disorders such as ad ( reiman et al . , 2007 ) . 2011 ) simulated full brain parametric maps using statistical priors based on their observed data to show that observed clusters of associated genes were larger than would be expected by chance . this provides evidence that vgenewas is a valid and powerful multivariate method to detect gene effects in full brain neuroimaging data . a head - to - head comparison of vgwas and vgenewas was also performed on the same datasets . the cumulative distribution function ( cdf ) plots of p - values for each study show that the fdr in the multivariate vgenewas was controlled at a lower rate than in the mass univariate vgwas method ( figure 4 ) . cumulative distribution function ( cdf ) plot of corrected p - values from vgenewas ( hibar et al . , 2011 ) and vgwas ( stein et al . vgwas could only be controlled for false - positives at q = 0.50 threshold , while vgenewas could be controlled for false - positives at q = 0.30 . the difference in q - value thresholds for the cdf of the p - values obtained from both studies on the same dataset suggests that the gene - based analysis is more powerful , though neither study controlled the false - positive rate at the nominal q = 0.05 threshold . an extension of pcreg and other data reduction techniques is to perform data reduction on both the genome and the 3d brain imaging traits . one approach that appears to be promising is parallel independent components analysis ( parallel ica or pica ; liu et al . , 2009 ) . parallel ica works by first performing pca on a set of snps and also a different pca on a voxelwise imaging measure . next , a modified version of ica is applied to both modalities and independent factors from each modality are chosen simultaneously by a correlation measure ( hence parallel ica ) . selecting imaging features and snps together can be more powerful than mass univariate tests of voxelwise imaging traits as the total number of tests is greatly reduced . for example , liu et al . ( 2009 ) used pre - processed fmri maps from 43 healthy controls and 20 schizophrenia patients and a pre - selected set of 384 snps chosen for their potential associations with schizophrenia . via a t - test , liu et al . ( 2009 ) demonstrated that genetic components ( p = 0.001 ) and fmri bold ( p = 0.0006 ) response loadings from parallel ica were able to distinguish healthy subjects from patients with schizophrenia , with reasonable accuracy . similar approaches have been applied to structural mri ( jagannathan et al . , 2010 ) . ica requires an initial round of pca , it is difficult to recover which snp sets are contributing to a given component and similarly it is difficult to localize the 3d spatial effect contributing to each component from the image . in addition , it is not clear how data reduction methods will perform with whole genome and full brain data . ( 2010 ) both performed considerable downsampling of the images , reducing the total number of voxels included in the parallel ica model . in addition , both studies tested only small sets of pre - selected snps instead of data from the full genome , or a standard 500,000 snp genome - wide scan . the power of parallel ica to find common components may be greatly reduced if there is additional noise from genome - wide data . ( 2009 ) found that as the amount of random noise increased , so did the number of independent components . as the number of independent components increases , the power to detect associations decreases . also querying full brain phenotypes for effects of genetic variants , another recently proposed multivariate method by chiang et al . ( 2011b ) , identified patterns of voxels in a dti image with a common genetic determination , and aggregated them to boost power in gwa ( figure 5 ) . approximately 5,000 brain regions were selected , where genetic influences accounted for > 60% of the total variation of white matter integrity . from these , a 5,000 5,000 correlation matrix was obtained . hierarchical clustering was used to select the largest clusters , and these voxels were defined to be rois . the mean fas for these rois were then tested for evidence of association with all snps genotyped across the genome . by identifying a genetic network that influences white matter integrity over multiple brain regions , chiang et al . ( 2011b ) were able to boost power to detect associations between fa in these brain areas and snps from the whole genome . in all , they identified 24 snps with genome - wide significance , which is unusual for a study with fewer than 1,000 subjects . to ensure the findings are not false - positives , however , simulations of imaging and genomic data may be necessary ( as carried out by vounou et al . , 2010 see below ) . clustering regions of a brain image that have common genetic determination . in a dti study of twins , the known kinship structure made it possible to estimate the genetic correlation matrix and a this was used to gage the similarity of genetic influences on all pairs of brain regions ( a ) . the 18 largest clusters parts of the image with common genetic influences were selected as regions of interest ( rois ) for gwas . by associating the mean white matter integrity of these regions with genetic variants , a genetic interconnection network was obtained ( b ) , where each network node represents a single snp ( colored circles ) . the figure shows only those snps associated with white matter integrity in at least one roi with a significance p - value < 10 . snps whose associations reach genome - wide significance are colored in red , with their names labeled . variants near each other on the genome can be highly correlated due to linkage disequilibrium . this leads to problems if all variants are included in a standard multiple regression model to predict the values of a trait . to address this , many new mathematical methods have been used to handle the high dimensionality in the genome ( a p n problem ) and interactions between genetic variants . these include penalized and sparse regression techniques , such as ridge regression ( hoerl , 1962 ) , the least absolute shrinkage and selection operator ( lasso ; tibshirani , 1996 ) , the elastic net ( zou and hastie , 2005 ) , and penalized orthogonal - components regression ( malo et al . , 2008 ; cho et al . , 2009 ; lin et al . , 2009 ; zhang et al . , 2009 ; chen et al . , 2010 ) . the various penalty terms ( e.g. , l in lasso and l in ridge ) in the regularized regression methods can incorporate large numbers of correlated variants with possible interaction terms , in single models . although these studies are almost invariably applied to case control gwa studies , similar approaches may be applied to imaging phenotypes . ( 2011a ) , for instance , implemented ridge regression to study the association of genomic scanning windows with mri - derived temporal lobe and hippocampal volume . they reported boosting of power in detecting effects of several snps , when compared to univariate imaging gwa . one statistical challenge of such sliding - window approaches is finding optimal window sizes , which can capture the correlation structure in the genomic data without adding excessive degrees of freedom to the model . considered several fixed , scanning window sizes ( 50 , 100 , 500 , and 1000 kbp ) in their study , and found boosting of power in detecting snps with different window sizes for different genomic regions . a more flexible approach may incorporate information such as the sample size and variant - specific ld structure into the selection of optimal window sizes for each genomic region ( e.g. , li et al . , 2007 ) . in addition , l - driven methods , such as lasso , may provide greater detection power by selecting sparse sets of genomic variants in association with imaging measures ( kohannim et al . as discussed above , however , multivariate methods can be applied not only to the genome , but also to the images , which are also high dimensional and show high spatial correlations . ( 2010 ) applied a sparse reduced - rank regression ( srrr ) method to detect whole genome - whole image associations . they computed a matrix of regression coefficients , c , whose rank was p ( number of snp genotypes ) times q ( the number of imaging phenotypes , or pre - defined anatomical rois in their case ) . they reduced the rank of this large matrix to r , by factorizing the matrix into the product of a p r matrix , b , and an r q matrix , a , and constraining a and b to be sparse ( figure 6 ) . to evaluate the power of their method and compare it to that of mass univariate modeling , vounou et al . generated realistic , simulated imaging and genetic data . using the forward evolution of genomic regions ( fregene ) software , and the adni baseline t1-weighted mri dataset , they obtained a simulated dataset , to which they introduced genetic effects in a number of rois . it was not feasible for the investigators to consider all possible genetic effect sizes and sample sizes , but they were able to show boosted power for all parameter settings they explored . setting the desired , reduced - rank r equal to 2 or 3 , they obtained higher sensitivities with srrr at any given specificity for a sample size of 500 . when they increased the sample size from 500 to 1,000 , they noted gains in sensitivities with srrr , which were more considerable than the merely linear gains obtained with univariate modeling . they also demonstrated that boosted sensitivities obtained with srrr increase with higher numbers of snps ; sensitivity ratios ( srrr / mass univariate modeling ) could be boosted even further to ratios far exceeding 5 ( observed with 40,000 snps ) with numbers of snps considered in a typical gwas ( e.g. , 500,000 snps ) . direct power comparisons between association methods on dna microarray data show that models that incorporate linear combinations of variables perform better than those that perform simple data reduction ( bovelstad et al . , 2007 ) . bovelstad et al . found that the penalized method , ridge regression , was more powerful than lasso , pcreg , supervised pcreg , and partial least squares regression ( pls ) , when it comes to predicting survival rates in cancer patients from dna microarray data . in the future , direct comparisons of methods on imaging genetics data could inform the direction of new methods development . imaging and genomic data are incorporated into a sparse , reduced - rank regression model , where regions of interest ( rois ) , and single nucleotide polymorphisms ( snps ) attain sparse coefficients , simultaneously . , it demonstrates higher power than mass univariate models for detecting effects of genetic variants . comprehensive modeling of whole - brain voxelwise and genome - wide data remains challenging , due to the high dimensionality of the data . recently , there have been new developments applying sparse regression methods to genome - wide data ; one such method is iterative sure independence screening ( isis ; fan and lv , 2008 ; fan and song , 2010 ; he and lin , 2011 ) . isis is an iterative selection procedure that builds a marginal model using the cyclic coordinate descent ( ccd ; friedman et al . , 2010 ) algorithm with the lasso and combines it with a conditional model of interactions based on pairwise correlations . the combined model has lower dimensionality , but effects of individual snps are still identifiable , as are snp snp interactions . isis has not yet been applied to brain images , but it should be feasible . methods such as isis could also be modified to jointly select imaging phenotypes and genomic data as done by vounou et al . ( 2010 ) but without first having to select roi or only a small subset of snps from the genome . the field of imaging genetics started with candidate gene studies , where hypotheses about gene action on brain structure and function could be tested in a novel way . more recently , candidate gene studies have been extended to investigate voxelwise associations between genetic variants and images of the brain , to map 3d profiles of genetic effects without requiring a priori selection of roi . to consider the entirety of the genome and discover potentially new variants , however , gwa studies have been introduced to the field of imaging genetics . in these studies , quantitative measures derived from images are considered as intermediate phenotypes , which are in some respects closer to the underlying biology of brain disorders and processes of interest . despite their unbiased consideration of the whole genome , the standard , univariate gwa approach considers only one snp at a time and has several limitations . from a genetic perspective , it does not take into account the interdependence between genetic variants due to linkage disequilibrium ; and in regard to imaging , such studies typically rely on single summary measures from images , which only weakly represent the wealth of information in a full 3d scan . among the most promising applications of imaging genetics a major advantage of penalized or sparse regression methods is that they accommodate collinearity inherent in the genome and in the images , but they still offer a familiar regression framework to accommodate covariates and confounding variables . this may discover genetic effects undetected by other data reduction methods , such as pica and pcreg . for studies of large 3d statistical maps of imaging phenotypes , methods to penalize the selection of both voxels from the image and associated genetic variants from the genome seem to have higher power than related discovery - based methods . even so , this is largely an empirical question that depends on the structure of the true signal . ( 2010 ) demonstrated the increased power of the srrr method , which favors the selection of an efficient set of roi and a reduced number of snps has increased power . a major limitation of penalized methods is that they may fail to converge on a solution when the data dimensions are very high . even methods designed for p n problems such as least angle regression ( efron et al . , 2004 ) tend to fail when given a full 3d imaging phenotype . this illustrates why current implementations of penalized regression in imaging genetics often rely on prior groupings of voxels or sliding windows in the genome . these prior groupings do not appear to be motivated by strong prior hypotheses , but by limitations in the statistical modeling . methods similar to isis ( fan and lv , 2008 ; fan and song , 2010 ; he and lin , 2011 ) designed for ultra - high dimensional datasets will likely be useful for future imaging genetics projects . once we have a set of validated genetic variants that affect the brain , multivariate models may be used to combine imaging , genetics , and other physiological biomarkers to predict outcomes in patients with brain disorders . the resulting combination of imaging and genetic data , with other biomarkers , can be used to predict an individual s personalized aggregate risk for specific types of brain disorders . as genomic and proteomic data are added , prognosis and diagnosis may be possible at an earlier stage or more accurate than is possible with current biomarkers . machine learning algorithms ( e.g. , decision trees , support vector machines , and neural networks ) have shown promise for making disease predictions from genomic and proteomic data ( cruz and wishart , 2007 ) . similar approaches may be useful in psychiatry research , and neuroimaging measures such as fiber anisotropy from diffusion imaging may help in making early predictions of brain integrity from genes . in a recent , preliminary study , our group incorporated several candidate polymorphisms in a multi - snp , machine learning model , to predict personal measures of fiber integrity in the corpus callosum ( kohannim et al . , 2011b ) . ideally , by incorporating both genomic and proteomic data from larger cohorts , one may be able to obtain personalized scores for brain integrity from biomarker profiles . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

the quest to identify genes that influence disease is now being extended to find genes that affect biological markers of disease , or endophenotypes . brain images , in particular , provide exquisitely detailed measures of anatomy , function , and connectivity in the living brain , and have identified characteristic features for many neurological and psychiatric disorders . the emerging field of imaging genomics is discovering important genetic variants associated with brain structure and function , which in turn influence disease risk and fundamental cognitive processes . statistical approaches for testing genetic associations are not straightforward to apply to brain images because the data in brain images is spatially complex and generally high dimensional . neuroimaging phenotypes typically include 3d maps across many points in the brain , fiber tracts , shape - based analyses , and connectivity matrices , or networks . these complex data types require new methods for data reduction and joint consideration of the image and the genome . image - wide , genome - wide searches are now feasible , but they can be greatly empowered by sparse regression or hierarchical clustering methods that isolate promising features , boosting statistical power . here we review the evolution of statistical approaches to assess genetic influences on the brain . we outline the current state of multivariate statistics in imaging genomics , and future directions , including meta - analysis . we emphasize the power of novel multivariate approaches to discover reliable genetic influences with small effect sizes .

You are an expert at summarizing long articles. Proceed to summarize the following text: thalidomide , an oral agent with antiangiogenic and immunomodulatory properties , is being investigated extensively in the management of advanced cancer . multiple myeloma is a b - cell malignancy characterized by an excess of monotypic plasma cells in the bone marrow . multiple studies with large numbers of patients have proven that this drug has significant activity in multiple myeloma . on may 26 , 2006 , the u.s . food and drug administration ( us - fda ) granted accelerated approval for thalidomide in combination with dexamethasone for the treatment of newly diagnosed multiple myeloma patients . stevens - johnson syndrome ( sjs ) is an immune - complex - mediated hypersensitivity complex that typically involves the skin and the mucous membranes with less than 10% body surface area ( bsa ) detachment . the more severe forms of the sjs spectrum are sjs - ten overlap ( 10 - 30% bsa detachment ) and toxic epidermal necrolysis ( ten ) with > 30% detachment of bsa . we report a case of sjs - ten overlap in a patient of multiple myeloma treated with thalidomide . a 69-year - old normotensive non - diabetic male patient was newly diagnosed with multiple myeloma ( 56% plasmacytosis , gamma m1 = 3.2 in bone marrow aspirate ) and was started on thalidomide monotherapy ( 200 mg once daily orally ) . three days later , he developed fever , stinging eyes , and pain upon swallowing ; along with skin lesions which appeared first on the trunk , spreading to the neck , face and proximal upper extremities . the skin lesions were tender , and the mucosal erosions were very painful . over the next two days the erythema increased and some areas showed peeling of the skin as well . a local physician started paracetamol , antihistamine ( cetirizine ) , proton pump inhibitor ( pantoprazole ) and topical application of calamine ; and referred the patient to our tertiary care centre . on admission the cutaneous examination revealed erythematous , dusky red , purpuric macules of irregular sizes and shapes with a tendency to coalesce and involved approximately 25% of bsa [ figure 1 ] . flaccid blisters with positive asboe - hansen sign were also noted in various parts of the body . skin could be easily peeled away by tangential pressure , revealing large areas of raw and bleeding dermis beneath , thus conforming to positive pseudo - nikolsky sign . mucous membrane involvement which had preceded the skin eruption , was characterized by erythema and painful erosions of the lips [ figure 2 ] , buccal , ocular , and genital mucosa ; leading to impaired food intake , photophobia , and painful micturition . this past history revealed that he had taken first line anti - tubercular drugs for one month due to a possible diagnosis of tuberculosis and splenic abscess . these medications were stopped when the patient was diagnosed as multiple myeloma and the specific therapy for multiple myeloma ( with thalidomide ) began three weeks after diagnosis . laboratory investigations showed he had acute kidney injury ( serum creatinine 4 mg / dl ) , raised liver enzymes , anemia , leucocytosis , and thrombocytopenia . purpuric macules ( some surmounted by vesicles ) scattered on the trunk and coalescing at areas to form sheets of necrotic epidermis erosion and crusting of lips with areas of peeling of necrotic epidermis on the bridge of nose and malar areas causality assessment was carried out using who - uppsala monitoring centre ( umc ) criteria and naranjo 's scale . ( naranjo 's score = 5 ) relationship between the drug and development of sjs . severity assessment by the hartwig scale showed the reaction as severe ( level 5 ) . the patient was withdrawn from all the drugs he was having then ( apart from thalidomide also those which were started later , that is , paracetamol , cetirizine , and pantoprazole ) . apart from this , he was given supportive management , including intravenous fluids with a meticulous monitoring of intake - output chart , moist oxygen inhalation , maintenance of temperature chart . blood sample was sent for serum electrolytes ( na , k , cl and hco3 ) , culture and sensitivity . history was obtained from the patient that he had taken beta - lactum antibiotics in the past with no adverse reaction , hence intravenous injections of piperacillin - tazobactam combinations was started along with condy 's compress for the oozy lesions . emollients were advised on lips and antibiotic eye ointment and artificial tears prescribed for eyes . in spite of the vigorous management , our patient did not show any signs of improvement manifested by deteriorating glasgow - coma score ( gcs ) , reduction in urine output , increasing breathlessness and tachycardia ; features suggestive of progress of the patient towards acute respiratory distress syndrome ( ards ) and unfortunately , he succumbed to the ongoing disease process . thalidomide and immunomodulatory drugs ( imids ) have now been shown to block several pathways important for disease progression in multiple myeloma . first established as agents with antiangiogenic properties , thalidomide and imids inhibit the production of interleukin ( il)-6 , which is a growth factor for the proliferation of myeloma cells . thalidomide due to its immunomodulatory and antiangiogenic action had been considered as a possible treatment for sjs - ten . however , the only trial available on thalidomide usage did not show any benefit from the treatment compared to placebo , but highlighted increased chances of mortality in the active intervention group . thalidomide can cause neurological , haematological , immunologic gastrointestinal , genitourinary , and dermatological side effects . incomplete sjs and ten in hiv - seropositive patients have been mentioned in the product information . however , extensive pubmed search of relation between thalidomide , sjs did not reveal a single report . there has been one report in which thalidomide caused ten in a patient of glioblastoma . in the above mentioned case report , the authors observed that although thalidomide - induced dermatologic disorders rarely were reported before thalidomide was administered to patients positive for the human immunodeficiency virus ( hiv ) , hypersensitivity reactions including rash are the agent 's major dose - limiting toxicities in them . as it is prescribed for other immunosuppressed patients , such as those with malignancies , the frequency of dermatologic reactions ( including ten ) may increase . in our case , the patient had multiple myeloma , which compromised his immune status . reports on a related drug , lenalidomide showed that it had caused sjs in patients of plasma cell leukemia , multiple myeloma . however , whether this adverse drug reaction is a class effect has not been clearly delineated yet . a drug which was researched into being the cure has caused the very disease it was intended to cure .

thalidomide developed in 1954 for morning sickness had proven to be a teratogen and hence was withdrawn from market . resurgence of thalidomide began as an immunomodulator when it was shown to be effective in the management of multiple myeloma and many conditions like erythema nodosum leprosum , graft versus host disease , recurrent aphthous ulcers etc . we report a case of stevens johnson syndrome - toxic epidermal necrolysis developing in an elderly male who was prescribed thalidomide after being diagnosed with multiple myeloma .

You are an expert at summarizing long articles. Proceed to summarize the following text: despite advances in diagnosis and therapy , breast cancer is still the leading cause of cancer - related death among women worldwide [ 1 , 2 ] . with metastatic disease , expression of her2 and hormone receptor genes , a disease - free interval , and age are among the factors that influence the choice of first - line therapy in metastatic disease [ 5 , 6 ] . the use of paclitaxel combined with gemcitabine ( doublet protocol ) has shown efficacy as first - line initial and maintenance therapy treatment in metastatic breast cancer ( mbc ) when compared to monotherapy with paclitaxel . there is current evidence that the use of the doublet protocol can also be an interesting alternative to maintenance therapy in women under 50 years old . this study reports the case of an 81-year - old woman with aggressive mbc who was treated under a doublet protocol of gemcitabine and paclitaxel as first - line and maintenance treatment after an initial 12 cycles , and she showed complete clinical and radiological response on pet - ct . despite patients advanced age and high toxicity described in the literature [ 4 , 7 ] an 81-year - old woman with an ulcerated skin lesion in the right parasternal region measuring 2 cm , as well as multiple satellite injuries in the same area , presented to the clinical oncology service in july 2014 . she had several diffusely and bilaterally distributed pulmonary nodules detected by ct , the largest located in the right higher basal segment measuring 1 cm . the patient had a history of malignant neoplasm in the right breast , diagnosed in november 1998 and treated with radical mastectomy , followed by adjuvant chemotherapy with anthracyclines and subsequent adjuvant hormone therapy for 5 years . the anatomical and pathological as well as the immunohistochemical study of the cutaneous lesions confirmed the recurrence of breast cancer , being both positive for hormone receptors and negative for her2 , which was in agreement with a biopsy from the first diagnosis of neoplastic disease . in july 2014 , she underwent control pet - ct ( fig 1a ) , which showed hypermetabolism in pulmonary nodules [ baseline standardized uptake values ( suv ) 4.05.0 ] , in a right parasternal lesion ( suv 7.7 at baseline ) , and in left axillary ( suv 4.9 at baseline ) , right cardiophrenic ( suv 2.0 at baseline ) , and right retrosternal ( suv 3.0 at baseline ) lymph nodes . the chemotherapy protocol with a doublet was started ( gemcitabine 1,250 mg / m on days 1 and 8 combined with paclitaxel 175 mg / m on day 1 every 21 days ) and initially planned until progressive disease or limiting toxicity . in addition , the patient underwent 16 sessions of 3d conformal radiotherapy for the right parasternal lesion ( dose of 4,000 cgy in a truebeam stx machine with an energy of 6 mv per dose fraction of 250 cgy ) during 23 days due to metastasis to the anterior chest region ( fig 2 ) . in october 2014 , after the 6th cycle of treatment , thorax and abdomen ct showed a reduction of the mediastinal cardiophrenic lymph nodes and parasternal lesion as well as stability of the pulmonary nodules . in april 2015 , in the 12th cycle , a new pet - ct for evolution control showed the disappearance of areas of increased uptake in multiple pulmonary nodules . there was also disappearance of increased uptake in the right parasternal lesion as well as the left axillary , right cardiophrenic , and right retrosternal lymph nodes . there was no appearance of new metabolically active lesions compared with the previous pet - ct , except for the appearance , in the right upper lobe , of a slightly increased uptake ( suv 3.3 ) suggestive of bronchopneumonic alteration or even secondary to the applied therapy ( fig 1b ) . twelve cycles of first - line treatment with the doublet protocol were carried out from the time of relapse in july 2014 . since april 2015 , the patient has received maintenance treatment with the doublet protocol ( 16 cycles thus far ) with improvement in performance status and resuming her regular activities . the carcinoembryonic antigen and cancer antigen 15 - 3 markers remained stable throughout treatment ( from 1.8 to 2.8 ng / ml and from 10 to 20 u / ml , respectively ) . regarding the treatment and maintenance polychemotherapy used in breast cancer , the use of paclitaxel combined with gemcitabine has shown better results than monotherapy with paclitaxel , one of the options recommended as first - line treatment . currently , there is no consensus on the optimal duration of the doublet protocol for maintenance therapy . a meta - analysis showed improvement in progression - free survival in patients undergoing maintenance chemotherapy ( several schemes ) until progressive disease or limiting toxicity compared to patients who underwent schemes with a fixed number of cycles . subsequently , the kcsg - br07 - 02 study ( phase iii ) showed that patients who achieved disease control with 6 initial cycles of chemotherapy with paclitaxel plus gemcitabine and received maintenance doses equal to the initial treatment ( gemcitabine 1,250 mg / m on days 1 and 8 coupled with paclitaxel 175 mg / m on day 1 every 21 days ) had an average progression - free survival higher than that of the group that was only monitored ( 7.5 vs. 3.8 months ; p = 0.026 ) . the mean overall survival was also higher in the group that received the maintenance scheme ( 32.3 vs. 23.5 months ; p = 0.047 ) , but these findings were obtained from patients younger than 50 years . our 81-year - old patient presented a better response than what was shown in this phase iii study . currently , she has a disease - free survival of 16 months and an overall survival of 26 months . the findings of the kcsg - br07 - 02 study also draw attention to the high hematological toxicity ( grade 3 and 4 ) resulting from this scheme compared to what was found in the observation group ( patients who did not keep receiving treatment until disease progression or who withdrew their consent to participate in the study ) ( neutropenia 87.1 vs. 30.4% ; p < 0.001 ) . in contrast to these findings regarding high toxicity in maintenance treatment , our patient , despite her advanced age , achieved a complete and sustained radiological response in the 12th cycle of treatment with doublet protocol maintenance chemotherapy and so far has had no sign of toxicity higher than grade 2 . it is noteworthy that the toxicity found in our patient is considerably less than expected for doublet treatment ( mainly during the maintenance phase ) , even though she was treated with the same dose as the patients in the other studies [ 9 , 10 , 11 ] . in addition , our patient had normal anthropometric measurements and absence of sarcopenia , which contributed to the lower toxicity ( threshold level 2 ) , since studies show that anthropometric measurements , as well as sarcopenia , function as toxicity indicators in chemotherapy [ 13 , 14 ] . in fact , there is still a lack of studies investigating the risk - benefit relation for maintenance gemcitabine - paclitaxel doublet therapy in older patients with mbc . our report contributes to answering this question by showing that an elderly patient treated under a prolonged doublet protocol showed increased overall survival without severe toxicity . therefore , this report reinforces the need for larger studies of maintenance therapy with doublet protocols in patients over 50 years with breast cancer , given the complete and sustained radiological response , increased progression - free survival , and acceptable tolerability found in our patient , as well as considering our patient 's age .

metastatic breast cancer ( mbc ) entails an overall 5-year survival of approximately 25% . the choice of therapy is influenced by expression of the her2 gene and hormone receptors , by a disease - free interval , and by age . the use of paclitaxel combined with gemcitabine ( doublet protocol ) has shown efficacy as first - line treatment for mbc in either initial or maintenance therapy when compared to monotherapy with paclitaxel . there is evidence showing that the doublet protocol is a good alternative to maintenance therapy in women under 50 years old . nevertheless , there is a lack of information concerning individuals above that age . we report the case of an 81-year - old patient presenting with recurrence of mbc , with lung and skin metastases both positive for hormone receptor and negative for her2 . we implemented a therapy based on the combination of gemcitabine and paclitaxel for 12 cycles , when complete response was achieved . currently , 16 months after this achievement , the patient is receiving maintenance treatment under the doublet protocol , presenting acceptable parameters of toxicity since the beginning of treatment , which shows satisfactory tolerability and management of chemotherapy in an elderly patient . we suggest that the maintenance treatment protocol with a doublet might be an alternative with a satisfactory response in patients with mbc .

You are an expert at summarizing long articles. Proceed to summarize the following text: the introduction of new contraceptive methods in service delivery settings is widely regarded as a means of improving quality of family planning ( fp ) care . beginning with the debut of the oral contraceptive in the 1960s , a gradual expansion of contraceptive choice has taken place , thanks to the introduction of an array of reversible options such as the intrauterine device ( iud ) , subdermal implants , and injectables . every contraceptive option has different characteristics in terms of safety , side effects , permanence , protection against sexually transmitted infections ( stis , including hiv ) , or mode of administration . for instance , the introduction of no - scalpel vasectomy necessarily demands an assessment of the surgical capacity of a facility and its personnel . the standard days method ( sdm ) , a new fertility awareness - based method , requires providers to understand a woman 's fertile cycle , as well as to address relationship dynamics between the man and the woman . this paper describes how the introduction of sdm in a variety of service delivery settings expanded the range of contraceptive options in developing countries , and encouraged providers to consider natural fp as an appropriate choice for certain clients . since the early 1900s , women have used a variety of fertility - awareness devices and guidelines to abstain from intercourse on days when they are likely to become pregnant . some natural fp strategies entail monitoring biological symptoms such as cervical secretions and basal body temperature . for example , the billings ovulation method ( bom ) requires that women monitor and distinguish between different cervical secretions to detect fertile days ; the twoday method ( tdm ) is based on observing cervical secretions , though without the requirement to distinguish between different types of secretions ; and the symptothermal method ( stm ) requires monitoring both cervical secretions and basal body temperature . reported typical - use efficacy of these methods ranges from 19.6 per 100 woman - years for the bom to less than 2.0 pregnancies per 100 woman - years for the stm , with tdm efficacy at 13.7 per 100 woman - years . however , there were pronounced differences in the country contexts and socioeconomic status of study populations in these efficacy trials , so cross - method comparisons should be interpreted with caution . in addition to natural fp methods that rely on observing physiological changes , other fertility awareness - based options consist of detecting the fertile window by monitoring the length of the menstrual cycle . sdm is a simple , effective , fertility awareness - based fp method developed in 2001 by the institute for reproductive health ( irh ) at georgetown university . sdm requires avoiding unprotected intercourse during a fertile 12-day window of time in the middle of a woman 's cycle ( days 819 ) . it is most appropriate for women with cycles that usually range from 2632 days . to help couples monitor cycle length and identify fertile days , irh also developed a mnemonic device ( cyclebeads ) consisting of a strand of colour - coded beads that correspond to fertile and safe days . in contrast to the bom , the stm , and the tdm , the length of the fertile window is fixed under the sdm ; users do not need to rely on varying physiological symptoms to determine when they are fertile . a multi - country efficacy trial demonstrated that sdm failure rate is less than five pregnancies per 100 woman - years during the first year of perfect use , or 12 pregnancies per 100 woman - years with typical use . a recent follow - up study found that in the second and third years of sdm use , typical - use failure rates drop to less than six per 100 woman - years . sdm is a fertility awareness - based method characterised by its simplicity , scientific basis , and its widespread introduction in more than 30 countries , most prominently in the developing world . currently included in the national fp norms in 16 countries , the sdm is recognised by the world health organisation as an evidence - based modern method , and cyclebeads can be procured along with other contraceptive methods through the central contraceptive procurement project of the us agency for international development ( usaid ) . compared to the bom and stm , sdm is both easier to teach and to learn , requiring substantially less training time for providers , as well as a shorter amount of time before clients can use it autonomously . this makes it unique among natural methods , in that it can be offered in service delivery settings where client - provider interaction may be limited . however , unlike the bom , stm , or tdm , sdm is only appropriate for women with regular menstrual cycles , which can preclude its use among postpartum women or young adolescents whose menstrual cycles have not yet stabilised . in addition , as is the case with any non - barrier contraception , the sdm does not protect users against sexually transmitted infections , including hiv , so it is intended to be a couple method , and is inappropriate for women who are not in monogamous relationships . in the past decade , irh has fielded sdm pilot studies in public sector facilities and in community settings in latin america , sub - saharan africa , asia , as well as more recent pilots in the united states . in addition , international and local organisations other than irh have led efforts to introduce sdm in their programmes , as illustrated by pathfinder international 's recent sdm introduction in community - based service delivery settings in ethiopia . although the previously described natural fp methods have been tested and introduced in various countries , to our knowledge , they have not been expanded widely in existing fp service delivery settings , as has sdm . the purpose of this paper is to describe how sdm introduction can improve the quality of fp services in developing countries . guided by the bruce - jain quality of care framework , we will present examples of how fp services benefited from sdm introduction . the findings and descriptions presented here are based primarily on reviews of published articles , internal project documents , and interviews with irh staff . the bruce - jain quality of care framework is regarded as the main paradigmatic model for assessing the quality of international fp services . the six elements of quality of care in the bruce - jain framework are : choice of contraceptive methods , information given to users , interpersonal relations , re - contact and follow - up mechanisms , and appropriate constellation of services . to discuss the role of sdm in modern fp services in an orderly fashion , we have structured this paper around these six elements of quality of care . throughout this discussion , it is important to bear in mind that , consistent with recommendations by simmons and colleagues , sdm introduction activities are not exclusively focused on promoting sdm . rather , the overarching objective is to increase contraceptive choice by expanding the existing method mix . sdm provider trainings begin with a contraceptive technology update , which offers an overview of all available methods , including information on efficacy , side effects , and contraindications . it is not enough to merely add a new contraceptive to the mix ; it is critical that the available methods meet the needs of potential users with different preferences or contraindications . sdm users have repeatedly cited their satisfaction in terms of its minimal cost , simplicity , naturalness , involvement of both partners , and , to a lesser extent , its compatibility with religious beliefs . irregular menstrual cycles are the only medical contraindication for using sdm , and among women who discontinue use of this method , one of the more commonly cited reasons is that their cycle lengths were outside of the required 2632 day range . in summary , sdm is appropriate for those who prefer non - hormonal and non - clinical birth control , who have regular menstrual cycles , who are at low risk of hiv / sti , and are able to use condoms or abstain from vaginal intercourse for 12 consecutive days each cycle . a critical component of fp quality of care is the information given to potential users . this information should include contraindications , risks , and benefits of various methods , instruction on how to use the selected method , how to manage potential side effects , and what users can expect from service providers regarding advice , support , supply , and referral to other services . when introducing sdm , provider trainings always include an overview of all methods , taking care to present the new method as one of many contraceptive options . when clients select sdm , this method choice provides a natural entry point to further explore partner communication , sexuality , intimate partner violence , condom use , and hiv / stis . because sdm users must identify a strategy for managing the fertile days one option being condom use sdm counselling can seamlessly include discussion about supplementing sdm with periodic condom use , should a couple wish to have sex during the fertile period . in contrast , if a woman were a hormonal method user , a proposal to combine use with condoms would typically be framed as a means of protecting the woman from hiv , which providers are reluctant to do and may not be well received . when counselling about sdm , condoms can be discussed in a manner that weakens their sole association with hiv , emphasising their usefulness as contraceptives . furthermore , sdm presents a rare opportunity to explain the basic mechanisms involved in fertility and regulation of the menstrual cycle . this information is useful regardless of which method the client eventually adopts , and can also be helpful if the woman tries to become pregnant in the future . by teaching her to identify the days of the month when she is fertile , sdm counselling can help her better understand when she is most likely to get pregnant , heightening her awareness of the probability of pregnancy from unprotected sex . provider competence refers to their technical skills and capacity with regard to , for instance , asepsis and adherence to protocols of clinical contraceptive methods such as surgical sterilisation or the iud . although such technical skills do not apply to a natural method like sdm , providers who have undergone sdm training have increased awareness of women 's fertility , which is important fundamental knowledge that likely improves providers ability to counsel on all methods , as well as on the menstrual cycle generally . in fact , providers report that this increased ability to explain simply basic concepts of fertility helps them reassure their clients about the safety and efficacy of contraceptive methods generally , resulting in increased fp acceptance . in addition , because sdm requires the awareness and involvement of both partners , providers who counsel on the method develop the capacity to discuss relationship dynamics and partner communication , which is a valuable skill regardless of the contraceptive method in question . an important aspect of interpersonal relations in fp counselling is respect for the client 's right to make an informed choice about which method is appropriate for him or her . when being trained on sdm , providers must overcome not only preconceived biases against fertility - awareness - based methods , but also a deeply rooted assumption that efficacy is the most valued characteristic of a fp method for everyone , regardless of where they are in the life course . for a variety of reasons , some women may feel most comfortable with a natural method , even if other , more effective modalities are available . whereas , previously , providers in many developing countries felt they had little to offer to these women , sdm now presented an option that satisfied their need for scientific evidence that a natural method can have proven contraceptive efficacy , while also satisfying women 's desire to use a non - hormonal , non- clinical fp method . the scientific basis of sdm can help to assure otherwise sceptical providers that fertility awareness - based methods can be an effective means of preventing pregnancy , and providers often report that sdm introduction made them more receptive to natural methods as an option for some women . this provider ability to maintain an objective openness to all available , effective methods is an indispensable element of quality client - provider relations . in addition , simulated client studies conducted by irh have demonstrated that providers trained on sdm were rated highly in terms of their interpersonal relations in india , peru , and rwanda . these studies consisted of having trained volunteers pose as real clients who consulted providers who had undergone sdm training ; each volunteer was given a user profile to enact , including marital status , childbearing desires , partner relationship dynamics , comfort with various methods , phase of the menstrual cycle , and specific method to be selected . as an indication of the high levels of courtesy exhibited by the providers , the proportion of simulated clients who felt that the provider treated them amiably and respectfully ranged from 75100% . to best promote continuity of use , it is critical to have follow - up mechanisms in place that allow providers and users to confirm correct use , address any concerns , and improve user satisfaction . the quality component is particularly relevant for methods that may carry a risk of side effects . follow - up counselling sessions provide an opportunity to verify that sdm users are using cyclebeads properly , that the woman 's menstrual cycles are still within the regular range , confirm that the couple is able to abstain from unprotected sex during the fertile days , and clarify and address any confusion or concerns . because subsequent research determined that removing follow - up sessions did not lead to less correct sdm use , such follow - ups were deemed optional , which allows providers to treat sdm services as they do other methods . in facilities where follow - up is routine for all methods , it also is required for sdm . however , if follow - up is not standard for other methods in a given facility , then there would be no required follow - up for sdm . in cases where follow - up is possible , it can be offered in the form of a counselling session after the first cycle to check cycle length , confirm correct use , and assess user satisfaction with sdm . fp services must be offered in a convenient , acceptable manner to women and their partners . recognising that different settings warrant different strategies for contraceptive introduction , irh has collaborated with a variety of local and international partners across sectors to introduce sdm through a wide range of venues and programmes . for example , in guatemala , irh and partners trained traditional birth attendants to provide fp counselling , including sdm . community health workers in india provide sdm counselling in household visits . in rwanda and honduras , faith - based organisations have played a prominent role in offering natural fp methods compatible with religious teachings , in large part due to irh 's sdm introduction activities . in addition , given that sdm requires male participation for correct use , irh and partners have made a concerted effort to encourage male involvement in birth spacing and contraception . for example , in an effort to reach men who would not otherwise participate in reproductive health activities , irh worked with project concern international in el salvador to introduce fp discussion groups into a water and sanitation project , whose participants were primarily male . throughout this discussion , it is important to bear in mind that , consistent with recommendations by simmons and colleagues , sdm introduction activities are not exclusively focused on promoting sdm . rather , the overarching objective is to increase contraceptive choice by expanding the existing method mix . sdm provider trainings begin with a contraceptive technology update , which offers an overview of all available methods , including information on efficacy , side effects , and contraindications . it is not enough to merely add a new contraceptive to the mix ; it is critical that the available methods meet the needs of potential users with different preferences or contraindications . sdm users have repeatedly cited their satisfaction in terms of its minimal cost , simplicity , naturalness , involvement of both partners , and , to a lesser extent , its compatibility with religious beliefs . irregular menstrual cycles are the only medical contraindication for using sdm , and among women who discontinue use of this method , one of the more commonly cited reasons is that their cycle lengths were outside of the required 2632 day range . in summary , sdm is appropriate for those who prefer non - hormonal and non - clinical birth control , who have regular menstrual cycles , who are at low risk of hiv / sti , and are able to use condoms or abstain from vaginal intercourse for 12 consecutive days each cycle . a critical component of fp quality of care is the information given to potential users . this information should include contraindications , risks , and benefits of various methods , instruction on how to use the selected method , how to manage potential side effects , and what users can expect from service providers regarding advice , support , supply , and referral to other services . when introducing sdm , provider trainings always include an overview of all methods , taking care to present the new method as one of many contraceptive options . when clients select sdm , this method choice provides a natural entry point to further explore partner communication , sexuality , intimate partner violence , condom use , and hiv / stis . because sdm users must identify a strategy for managing the fertile days one option being condom use sdm counselling can seamlessly include discussion about supplementing sdm with periodic condom use , should a couple wish to have sex during the fertile period . in contrast , if a woman were a hormonal method user , a proposal to combine use with condoms would typically be framed as a means of protecting the woman from hiv , which providers are reluctant to do and may not be well received . when counselling about sdm , condoms can be discussed in a manner that weakens their sole association with hiv , emphasising their usefulness as contraceptives . furthermore , sdm presents a rare opportunity to explain the basic mechanisms involved in fertility and regulation of the menstrual cycle . this information is useful regardless of which method the client eventually adopts , and can also be helpful if the woman tries to become pregnant in the future . by teaching her to identify the days of the month when she is fertile , sdm counselling can help her better understand when she is most likely to get pregnant , heightening her awareness of the probability of pregnancy from unprotected sex . provider competence refers to their technical skills and capacity with regard to , for instance , asepsis and adherence to protocols of clinical contraceptive methods such as surgical sterilisation or the iud . although such technical skills do not apply to a natural method like sdm , providers who have undergone sdm training have increased awareness of women 's fertility , which is important fundamental knowledge that likely improves providers ability to counsel on all methods , as well as on the menstrual cycle generally . in fact , providers report that this increased ability to explain simply basic concepts of fertility helps them reassure their clients about the safety and efficacy of contraceptive methods generally , resulting in increased fp acceptance . in addition , because sdm requires the awareness and involvement of both partners , providers who counsel on the method develop the capacity to discuss relationship dynamics and partner communication , which is a valuable skill regardless of the contraceptive method in question . an important aspect of interpersonal relations in fp counselling is respect for the client 's right to make an informed choice about which method is appropriate for him or her . when being trained on sdm , providers must overcome not only preconceived biases against fertility - awareness - based methods , but also a deeply rooted assumption that efficacy is the most valued characteristic of a fp method for everyone , regardless of where they are in the life course . for a variety of reasons , some women may feel most comfortable with a natural method , even if other , more effective modalities are available . whereas , previously , providers in many developing countries felt they had little to offer to these women , sdm now presented an option that satisfied their need for scientific evidence that a natural method can have proven contraceptive efficacy , while also satisfying women 's desire to use a non - hormonal , non- clinical fp method . the scientific basis of sdm can help to assure otherwise sceptical providers that fertility awareness - based methods can be an effective means of preventing pregnancy , and providers often report that sdm introduction made them more receptive to natural methods as an option for some women . this provider ability to maintain an objective openness to all available , effective methods is an indispensable element of quality client - provider relations . in addition , simulated client studies conducted by irh have demonstrated that providers trained on sdm were rated highly in terms of their interpersonal relations in india , peru , and rwanda . these studies consisted of having trained volunteers pose as real clients who consulted providers who had undergone sdm training ; each volunteer was given a user profile to enact , including marital status , childbearing desires , partner relationship dynamics , comfort with various methods , phase of the menstrual cycle , and specific method to be selected . as an indication of the high levels of courtesy exhibited by the providers , the proportion of simulated clients who felt that the provider treated them amiably and respectfully ranged from 75100% . to best promote continuity of use , it is critical to have follow - up mechanisms in place that allow providers and users to confirm correct use , address any concerns , and improve user satisfaction . the quality component is particularly relevant for methods that may carry a risk of side effects . follow - up counselling sessions provide an opportunity to verify that sdm users are using cyclebeads properly , that the woman 's menstrual cycles are still within the regular range , confirm that the couple is able to abstain from unprotected sex during the fertile days , and clarify and address any confusion or concerns . because subsequent research determined that removing follow - up sessions did not lead to less correct sdm use , such follow - ups were deemed optional , which allows providers to treat sdm services as they do other methods . in facilities where follow - up is routine for all methods , it also is required for sdm . however , if follow - up is not standard for other methods in a given facility , then there would be no required follow - up for sdm . in cases where follow - up is possible , it can be offered in the form of a counselling session after the first cycle to check cycle length , confirm correct use , and assess user satisfaction with sdm . fp services must be offered in a convenient , acceptable manner to women and their partners . recognising that different settings warrant different strategies for contraceptive introduction , irh has collaborated with a variety of local and international partners across sectors to introduce sdm through a wide range of venues and programmes . for example , in guatemala , irh and partners trained traditional birth attendants to provide fp counselling , including sdm . community health workers in india provide sdm counselling in household visits . in rwanda and honduras , faith - based organisations have played a prominent role in offering natural fp methods compatible with religious teachings , in large part due to irh 's sdm introduction activities . in addition , given that sdm requires male participation for correct use , irh and partners have made a concerted effort to encourage male involvement in birth spacing and contraception . for example , in an effort to reach men who would not otherwise participate in reproductive health activities , irh worked with project concern international in el salvador to introduce fp discussion groups into a water and sanitation project , whose participants were primarily male . the introduction of any new contraceptive option can improve the quality of fp services , but we have sought to demonstrate that our experiences introducing sdm can address unmet client need , particularly in low - resource developing - country settings . as a couple strategy that requires management of fertile days , partner communication , consideration of hiv / sti risk , and a basic understanding of the menstrual cycle , sdm provides an opportunity for health services not only to increase the range of available fp options , but also to broaden the scope of fp counselling to cover other important issues . arguably one of the most significant quality improvements brought about by sdm introduction has been how the method sensitises providers to the reality that they can not take a one - size - fits - all approach to fp counselling , and that each method suits the preferences and needs of a distinct user profile . for married women who place a premium on maximising efficacy and are comfortable with hormonal methods , but who do not wish to remember to take a pill each day , injectables may be an appropriate option . in contrast , sdm could suit the needs of couples who prefer a natural method , whether due to discomfort with hormonal contraception , religious beliefs , financial considerations , or relationship dynamics . while other natural methods share these characteristics , they are not routinely offered by health and fp services . previously , most providers had little awareness of scientifically proven methods that could accommodate such clients , but sdm has helped to fill this gap while simultaneously reinforcing the importance of client - centred contraceptive counselling . in summary , ten years of experience with sdm have demonstrated the value of expanding the contraceptive method mix in a wide range of countries and service delivery settings . previous research has documented the method 's efficacy , described sdm users , and assessed the fp counselling given by providers trained on the sdm . this paper adds a reflection on how and why sdm introduction can improve quality of care and the client - provider interaction .

background the mere availability of family planning ( fp ) services is not sufficient to improve reproductive health ; services must also be of adequate quality . the introduction of new contraceptive methods is a means of improving quality of care . the standard days method ( sdm ) is a new fertility - awareness - based contraceptive method that has been successfully added to reproductive health care services around the world.contentframed by the bruce - jain quality - of - care paradigm , this paper describes how the introduction of sdm in developing country settings can improve the six elements of quality while contributing to the intrinsic variety of available methods . sdm meets the needs of women and couples who opt not to use other modern methods . sdm providers are sensitised to the potential of fertility - awareness - based contraception as an appropriate choice for these clients . sdm requires the involvement of both partners and thus offers a natural entry point for providers to further explore partner communication , intimate partner violence , condoms , and hiv / stis.conclusionsdm introduction broadens the range of fp methods available to couples in developing countries . sdm counselling presents an opportunity for fp providers to discuss important interpersonal and reproductive health issues with potential users .

You are an expert at summarizing long articles. Proceed to summarize the following text: several experimental techniques are available for molecular profiling studies such as dna microarray , differential display , serial analysis of gene expression , massive parallel signature sequencing , and suppression subtractive hybridization . although useful , shortcomings with these systems are often encountered especially in input dna , rna , or proteins from pure population . for example , surgical samples are variable in shape and size , and are often a mixture of several kinds of tissues . thus , the outcome of molecular biological analyses from these samples may not be accurate . the laser capture microdissection- ( lcm- ) based molecular biological analysis has been developed as a powerful methodology that improves these problems [ 24 ] . lcm was first introduced as a system that is able to retrieve defined cell population from human tissue samples . the original system was invented by the national institutes of health to isolate specific cells from histological slides under microscope . nowadays a variety of lcm apparatus are available and , the pixcell system ( arcturus , mds analytical technology , ca , usa ) uses both ultraviolet ( uv ) laser to cut and infrared ( ir ) laser to collect cells ( figure 1(a ) ) . zeiss 's palm system ( a subsidiary of carl zeiss microimaging , jana , germany ) uses uv laser to cut the tissues via inverted microscope and collect cells by photonic pressure ( figure 1(b ) ) . leica as lmd system ( mannheim , germany ) uses a uv laser to cut , and then dissected cells fall into a collecting tube by gravity ( figure 1(c ) ) . analyses using lcm technology have been further developed / improved and performed in various fields . in dentistry , this technology has been utilized in different research fields such as oral embryology [ 510 ] , oral oncology [ 1116 ] , oral cell biology [ 7 , 1721 ] , and tissue engineering including teeth [ 17 , 2224 ] . in this paper , we will focus on the presentation and discussion of existing literature that covers the dental researches using lcm , especially in the field of rna analysis . oral cancer is a type of head and neck cancers developed in any part of the oral cavity or oropharynx . when oral cancer spreads ( metastasizes ) , it usually travels through the lymphatic system and appears first in nearby lymph nodes in the neck . the new tumor at the metastatic site has the same kind of abnormal cells as the primary tumor . although the recently gained knowledge of normal and aberrant function of oncogenes and tumor suppressor genes has provided unique opportunities to understand , and ultimately to control the processes leading to malignancy , the molecular mechanisms of this disease remain poorly understood . the recent development of hybridization - based methods utilizing cdna arrays , provides an opportunity to identify genes expressed in normal and tumor tissues , as well as to analyze gene expression profiles in tumor progression . however , an accurate procurement of specific cell types for rna isolation is a critical step influencing the validity of this analysis . on this point of view , lcm provides a great advantage since it enables the procurement of pure cell populations from tissue sections , a key consideration as many tumors are heterogeneous , and include areas of connective tissues , blood vessels , and even inflammatory cells that infiltrate into the tumor mass . the use of lcm to harvest cells from their native tissue environment , followed by the use of high - density oligonucleotide probe arrays to identify gene expression differences between normal and malignant oral epithelial cells , provide powerful means to decode the molecular events involved in the genesis and progression of oral cancer . in oral cancer tissues , a number of genes have been identified by either lcm / oligonucleotide microarray approach or the lcm / cdna library approach to be highly expressed / upregulated . [ 14 , 15 ] used lcm and cdna arrays , which approach allowed the detailed analysis of gene expression and provided the first evidence for the feasibility of performing a comprehensive molecular characterization of normal , premalignant , and malignant head and neck squamous cell carcinoma ( hnscc ) cells . biopsies from hnscc patients were snap frozen and hnscc cells were harvested from hematoxylin - stained section using pixcell lcm for studying differential gene expression and gapdh mrna . results demonstrated that high - quality , representative cdna libraries can be generated from microdissected oscc tissue . in another study , alevizos et al . applied lcm to study differential gene expression from solid tumor tissues . the cancer tissues were snap frozen after surgical removal , and the pixcell system ( lcm / genechip analysis ) was successfully used to harvest normal and tumor cells for oligonucleotide microarray analysis and real - time pcr of collagenase , urokinase plasminogen activator , and cathepsin l. results from these studies support the notion that analyzing lcm - derived rna with microarrays provides powerful approaches for identifying candidate genes that have not been implicated in oral cancer . lcm method can minimize possible contamination from infiltrated inflammatory cells so that cancer cells were differentially captured from the tumor tissue , cancer tissues were immediately fixed with formalin and embedded in paraffin . the sections were stained with hematoxylin and eosin and subjected to the palm lcm to analyze igg1 , v3 , and v4f mrna . using in situ hybridization and lcm - correlated rt - pcr , the authors found that igg heavy chain transcripts were present in the oral cancer cells and in some normal epithelial cells adjacent to the tumor . these findings suggest that tumor - derived immunoglobulin may be an important new target molecule for tumor biotherapy . in clinical application , the use of lcm technologies therefore allows for scanning of gene expression patterns and search for those correlating with a disease state . normally , clinical staging of cervical lymph nodes is carried out by clinical examination of the neck region or by ultrasound , computed tomography , and magnetic resonance imaging . however , the sensitivity of these methods is still limited due to the fact that the false negative rate is high in clinically diagnosed metastasis - negative ( n0 ) patients . in an effort to find new biomarkers that will provide more accurate diagnosis and safer and more efficacious treatment for oral squamous cell carcinoma ( oscc ) , nguyen et al . applied lcm and microarray technology to investigate the differences in gene expression profiles between primary oscc metastasized and no metastasized to cervical lymph nodes . primary oral specimens were embedded with oct and frozen sections were fixed with cold ethanol . then they successfully selected genes that showed a difference in expression levels between the two groups , using dna - chip analysis software for high - level analysis . we have recently developed a methodology of immune - lcm of formaldehyde - fixed , paraffin - embedded , and coagulation factor viii - immunostained head and neck carcinoma by using leica lmd system . this method allows us to correct rna of factor viii - positive endothelial cells retrieved from the tumor mass ( figure 2 ) . this method may be ideally suited for the analysis of relatively rare cell types within a tissue and should improve on our ability to perform differential diagnosis of pathologies as compared to conventional lcm . initial molecular signals in the dental epithelium induce gene expression in the adjacent dental mesenchyme . reciprocal signaling between the epithelial and mesenchymal tissues continues throughout tooth development , resulting in the formation of a tooth of specific size and shape . werner et al . studied the role of macrophage colony stimulating factor ( csf-1 ) isoforms on tooth morphogenesis by using pixcell ii lcm to capture ameloblasts and odontoblast from histogene lcm - stained frozen tissue sections , followed by the mrna expression analysis using rt - pcr . the results showed that csf-1 is important for optimal cytodifferentiation and dentin matrix protein-1 ( dmp-1 ) expression . absence of csf-1 receptor was associated with shortened ameloblasts , loss of odontoblastic polarization , and dramatically reduced dmp-1 expression . cscsf-1 may act in an autocrine fashion in odontoblasts to regulate dmp-1 since odontoblasts express the csf-1r and may be involved in mediating tooth matrix formation [ 6 , 10 ] . tooth eruption requires alveolar bone resorption as well as possible bone growth at the base of the tooth . the detailed mechanisms of tooth eruption is yet to be clarified , mainly because many issues regarding growth factors , such as types of expressing cells , temporo - spacial changes of expression patterns , and results of growth factor interaction , remain fully understood , lcm is applicable to molecular profiling of tissue specimens , permitting correlation of cellular and molecular signatures with specific cell population , especially comparison of cellular elements within the tissue microenvironment or in the variety of cell types . thus , lcm has been applied to the studies of tooth eruption including evaluation of the tissue surrounding unerupted tooth , dental follicle microenvironment , factors involved in tooth eruption process , time expression of growth factors , and/or cytokines and type of cells releasing growth factors to conclude mechanism of tooth eruption [ 5 , 810 , 26 ] . the use of lcm enables collecting interested and specific cells such as stellate reticulum ( sr ) and dental follicle cells from the tissue surrounding unerupted tooth [ 5 , 8 ] . lcm has also been used for study of time releasing factors for tooth eruption that cells retrieved from different age of tissues [ 10 , 26 ] . in these studies , palm lcm was used to purify sr cells collected from liquid nitrogen - frozen mandible and gene expression of factors involved in tooth eruption , such as parathyroid hormone - related protein ( pthrp ) and in vitro effect of pthrp on gene expression of vegf and bmp-2 , was analyzed . after collecting cells , result showed that pthrp was maximally expressed at day 7 postnatally in the sr and still high at day 9 . wise and yao studied gene expression of bone morphogenetic protein-2 ( bmp-2 ) and receptor activator of nuclear factor kappa b ligand ( rankl ) , as a marker gene for alveolar bone formation , and resorption , respectively , in the dental follicle harvested by liquid nitrogen frozen mandible of new born rats , using palm lcm . the authors found that rankl showed a higher expression in the coronal half of the follicle , whereas bmp-2 showed a higher expression in the basal half . the regional differences in the expression of the bone - related genes are not the sole factors regulating bone resorption / formation during tooth eruption . thus , cytokines and growth factors involved in bone resorption process were studied on their influence on the tooth eruption . il-10 is an anti - inflammatory cytokine that inhibits osteoclast formation and may act to suppress the alveolar bone resorption . liu et al . studied the dental follicle tissue harvested from cold ethanol - fixed , toluidine blue - stained sections of liquid nitrogen frozen - mandibles by using palm lcm . they found that il-10 and il-10r were expressed in the dental follicle of postnatal rats by rt - pcr . expression of pthrp gene was also found in the stellate reticulum adjacent to the dental follicle , using similar strategy . the periodontal ligament ( pdl ) is classified as connective tissue , but its histochemical and genetic properties are different from other connective tissues . mature pdl is very active in reabsorbing and secreting collagen to maintain pdl fibers under stress of mastication . many investigations have been performed on the pdl to identify the molecular biological characteristics differing from other connective tissues [ 2830 ] . analyzing the pdl tissue attached to a root following tooth extraction is subjected directly to molecular biological analysis for in vivo studies , and cultured tissues and outgrown cells are used for in vitro studies [ 27 , 32 ] . however , there is difficulty to obtain the target tissues and/or cells without contaminations of other tissues and/or cells in vivo . on the other hand , in vitro , the environment of the cells may be changed during cell culture and thus may influence the expression of molecular characteristics from original tissues . thus , it would be more reliable to extract the sample directly from the tissues by using lcm . nakamura et al . retrieved the pdl directly from toluidine blue - stained sections of liquid nitrogen - frozen rat molars by using palm lcm and examined the gene expression of transforming growth factor ( tgf)-1 , which plays an important role in the modulation of tissue formation and development of the pdl , to compare with the pulp and subgingival connective tissues . the authors successfully compared the gene expression levels among the three tissues directly from undecalcified frozen sections . lcm , however , has the limitation that it is difficult to microdissect the cells located near hard tissues , such as osteoblasts , odontoblasts , and cementoblasts , and also mineralized tissues , even at the maximum output of the laser beam . three major events are associated with the initiation and progression of periodontal attachment loss ; local epithelial cell proliferation and migration , dissolution of sharpey 's fibers with loss of attachment , and ultimately resorption of alveolar bone . however , regulation of these processes is poorly understood , although local expression of cytokines and growth factors likely play significant roles . in one study , the arcturus lcm technology was successfully used to search for the source of gene expression of kgf , kgfr , k19 , and type i collagen , by dissecting target cells from snap - frozen , acetone - fixed sections of pooled control and diseased tissues followed by rt - pcr amplification . we recently performed lcm for formaldehyde - fixed , demineralized , and frozen sections of rat pdl , and retrieved the inflamed or normal tissues from furcal pdl by using the leica lmd system . this research allowed us to quantify mrnas of some antigen presenting cell - related molecules such as cd86 and cd83 . the dental pulp is the part in the center of a tooth made up of living soft tissue , and odontoblasts contain large nerve trunks and blood vessels to functions of dentin formation , nutrition , sensory and protection . dental pulp may be capable of regenerating following injury , but the specific mechanisms underlying pulp regeneration and reparative dentinogenesis have still to be clarified . it is due in part to the limitation to obtain sufficient number of pure and intact cell population and maintain those cells in culture . thus , cell differentiation and dentin formation processes , in relation to the genetic profile of specific types of cells , for example , odontoblasts , are not completely known . lcm technology may overcome most of these problems , since it allows pure population of defined cells to be isolated from frozen or paraffin tissue sections and rna retrieval from these cells for studies of gene expression of , for example , growth factors . hoffmann et al . used palm - lcm to retrieve homogeneous population of odontoblasts followed by rt - pcr analysis to determine the exact molecular mechanism leading to cell differentiation , function , and biochemical profile of these cells [ 23 , 24 ] . the laser was focused through the objective lens of an inverted microscope on a circumscribed area within the cusp tip . in the sections from embryos , laser pressure catapulting was used to eject selected clusters of odontoblasts into a microfuge cap . total rna was measured by rt - pcr analysis with probes of dentin matrix genes , 1 collagen , dentin sialophosphoprotein ( dspp ) , and osteocalcin . paraffin - embedded sections were also prepared to perform in situ hybridization technique to detect the expression of these genes in vivo . therefore , lcm appeared a powerful tool to procure a homogeneous population of odontoblasts from tissue sections and allowed to retrieve a clear - cut odontoblast monolayer ; target cells were easily distinguished by their morphology in unstained sections , but the stain was useful for identifying captured clusters of odontoblasts within the microfuge caps [ 23 , 24 ] . chronic bacterial infection of the root canal system causes the establishment of periapical inflammatory lesions as a result of the activation of local defense reactions against intracanal pathogens . immunological responses also have critical roles to establish the lesions , because bacterial elements potentially activate various forms of immune responses by acting as antigens . we performed lcm for hla - dr - positive dendritic cells and macrophages in human radicular granulomas by using the leica lmd system . we demonstrated that , in the lymphocyte - rich area , expression levels of hla - dr alpha - chain , cd83 , and cd86 mrnas were higher in hla - dr - positive dendritic cell as compared with hla - dr - positive macrophages . the result suggests that dendritic cells in radicular granulomas act as stronger antigen - presenting cells , as compared with macrophages . tissue engineering / regenerative medicine is an emerging multidisciplinary field involving biology , medicine , and engineering that is likely to revolutionize the ways improving the health and quality of life by restoring , maintaining , or enhancing tissue and organ function . lcm is a new technology that overcomes the problem of inaccurate results due to contaminated tissues . the study of gene expression profiles is a pivotal instrument for development biology . for the investigation and analysis of molecular interaction , in situ hybridization , immunohistochemical localization , and histomorphological studies have been the methods of choice to study the molecules of interest in the tissues . demonstrated the successful bioengineering of complex tooth crowns closely resembling those of naturally developing teeth . to confirm the identity of putative odontoblast - like cells present in bioengineered tooth tissues , leica lcm was used to perform rt - pcr analyses from paraffin - embedded sections . the results showed that dspp product was generated from control porcine third molar and tissue - engineered odontoblasts . the analysis of morphology , histology , immunohistochemistry , and lcm rt - pcr analysis demonstrated the successful engineering of recognizable tooth structures exhibiting the cellular organization and presence of appropriate proteins found in natural teeth such as a morphologically correct enamel organ consisting of stellate reticulum , stratum intermedium , ameloblasts , and dental enamel . we recently performed lcm for engineered pulp tissue samples using leica lmd ( figure 3 ) . notably , the samples allowed us to perform a gene expression analysis of dspp by using real - time pcr ; we demonstrated the upregulation of dspp mrna in tissues of the odontoblast layer just underneath the dentin , as compared with the tissues underneath the odontoblast layer . this method constitutes a new approach for gene expression studies of mineralized tissues such as bone and teeth , and opens the door for the acquisition of new data from archived specimens . tissue preparation of hard tissue sample is important for immune - lcm , if the target tissue is surrounded by calcified tissues such as enamel / dentin and bone . in our research , we performed tissue fixation and demineralization as follows : fixation of the tissues with 10% neutral buffered formaldehyde at 4c , and demineralization with 10% formic acid at 4c . paraffin embedding was performed as follows : dehydration in 70% ethanol for 30 minutes , 90% ethanol for 1 hour , 95% ethanol for 30 minutes at 4c , and 3 times in 100% ethanol for 1 hour at room temperature , immersion 2 times in xylene for 1 hour at room temperature , 4 times in infiltrating paraffin for 30 minutes at 58c , and embedding in paraffin . sectioning of the paraffin embedded samples at 5 m thickness was performed on a microtome with a new sterile disposable blade . sample sections were mounted on poly - l - lysine coated glass foiled polyethylene naphthalate ( pen ) slides for lcm ( leica microsystems , bannock burn , il ) . the slides were dried in an incubator at 35c for 6 hours . nuclear staining by hematoxylin was performed as follows : deparaffination of the slides twice in xylene for 3 minutes at room temperature , washing 3 times in 100% ethanol for 30 seconds , 90% ethanol for 30 seconds , 70% ethanol for 1 minute , and in rnase - free water for 30 seconds at 4c , immersion in hematoxylin for 510 seconds at room temperature , followed by washing with rnase - free water for 30 seconds at 4c . the slides were let to dry at 4c and keep in freezing compartment for preservation of rna until immune staining . laser capture microdissection is a useful method for obtaining microscopic samples as small as individual cells from tissues for molecular analysis . the different outcome of the various lcm studies are likely reflective of the experimental approaches and methods of analyses . second , sample number and the type of gene expression analysis used may be relevant to the discrepancies . third , the stage of the tissue , source , and anatomical site of the cells , and handling methods can further result in different gene expression levels . an advantage of the lcm approach is that only a small amount of starting material is required for the extraction of a sufficient quantity of total rna . furthermore , the quality and integrity of the rna make this approach suitable for use with available array technology , thus affording the possibility to define a pattern of gene expression because the combination of using lcm and applied rt - pcr protocol allows the specific isolation and characterization of selected cells . the use of lcm technologies therefore allows for the scanning of gene expression patterns and the search for those correlating with a disease state . comparative analysis of gene expression profile may help identify aberrant expressed or mutate gene . furthermore , gene expression profiles can now be investigated within histologically defined , homogeneous population of cells by using lcm , thus affording the possibility of these newly available techniques being applied to investigations of expression patterns in normal as well as in neoplastic tissues .

laser capture microdissection ( lcm ) allows for the microscopic procurement of specific cell types from tissue sections that can then be used for gene expression analysis . according to the recent development of the lcm technologies and methodologies , the lcm has been used in various kinds of tissue specimens in dental research . for example , the real - time polymerase - chain reaction ( pcr ) can be performed from the formaldehyde - fixed , paraffin - embedded , and immunostained sections . thus , the advance of immuno - lcm method allows us to improve the validity of molecular biological analysis and to get more accurate diagnosis in pathological field in contrast to conventional lcm . this paper is focused on the presentation and discussion of the existing literature that covers the fields of rna analysis following lcm in dentistry .

You are an expert at summarizing long articles. Proceed to summarize the following text: search is a multicenter study that conducts population - based ascertainment of nongestational cases of physician - diagnosed diabetes in youth age < 20 years at diagnosis ( 15 ) . a total of 402 search participants with type 1 diabetes , residents of colorado and ohio , who had a duration of diabetes of at least 5 years , were enrolled in the search cvd study between 2009 and 2011 . during the same time period , a total of 204 frequency - matched ( by age , sex , and race / ethnicity ) youth without type 1 diabetes ( control subjects ) were also recruited in the study . control participants were enrolled from the primary - care offices in the same geographical areas from which the patients with diabetes were referred and were confirmed free of diabetes by fasting glucose levels < 126 mg / dl ( 16 ) . the study was reviewed and approved by the local institutional review boards that had jurisdiction over the local study population , and all participants provided signed informed consent or assent . participants were invited for an outpatient research visit after an 8-h overnight fast , and medications , including short - acting insulin , were withheld the morning of the visit until after the blood draw was complete . all participants were asked to refrain from any strenuous exercise , smoking , or consumption of any caffeinated drinks 12 h prior to the visit . race / ethnicity was self - reported , and the participants were categorized into non - hispanic white ( nhw ) and other racial / ethnic group ( including hispanic , african american , and asian / pacific islander racial / ethnic groups ) . participants completed standardized questionnaires including medical history , medication inventory , smoking status , physical activity , daily insulin dose , and family history of diabetes and cvd . current cigarette smoking was defined as having smoked cigarettes on one or more of the 30 days preceding the survey . individuals who had tried smoking or smoked regularly ( at least one cigarette every day for 30 days ) but were not current smokers were considered past smokers . participants were asked the average number of days in a typical week that they participated in physical activity for at least 20 min that made them sweat or breathe hard and were then categorized as physically inactive ( 02 days / week ) or physically active ( 37 days / week ) ( 17 ) . height was measured in centimeters using a stadiometer and weight in kilograms using a standardized scale . bmi was calculated as weight in kilograms divided by the square of height in meters , and age- and sex - specific bmi z - scores were derived based on the centers for disease control and prevention national standards ( 18 ) . waist circumference was measured to the nearest 0.1 cm with the national health and nutrition examination survey protocol ( 19 ) . resting systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) were measured three times , using an aneroid sphygmomanometer , while the subjects were seated for at least 5 min and the average of the three measurements was taken . laboratory samples were obtained under conditions of metabolic stability , defined , for case subjects , as no episode of diabetic ketoacidosis during the previous month . a fasting blood draw was conducted for the assessment of the metabolic parameters ( hba1c , ldl cholesterol [ ldl - c ] , hdl cholesterol [ hdl - c ] , and triglyceride [ tg ] levels ) . urinary albumin was measured from overnight timed urine samples by radioimmunoassay and expressed as albumin excretion rate ( aer ) . aer levels between 20 and 199 g / min were defined as microalbuminuria ( 20 ) . measurements of tg and hdl - c were performed enzymatically on a hitachi 917 autoanalyzer ( roche molecular biochemicals diagnostics , indianapolis , in ) . ldl - c was calculated by the friedewald equation for individuals with tg concentration < 400 mg / dl and the beta quantification procedure for those with tg concentration 400 mg / dl . hrv was measured in the morning between 7:00 and 11:00 a.m. in a room with a stable room temperature , with the participant lying in the resting supine position for 10 min , using the sphygmocor device ( atcor medical , sydney , australia ) . the device takes into account the normal heart beats , ignoring ectopic beats , to derive the statistical parameters of the normal r - r intervals ( n - n intervals ) of the electrocardiogram and estimates several time- and frequency - domain hrv indices ( 21 ) . the time - domain indices of hrv used in the present analysis were sd of the r - r intervals ( sdnn ) and root mean square difference of successive normal r - r interval ( rmssd ) . sdnn is a measure of overall hrv , so lower sdnn levels indicate reduced overall hrv . rmssd is a measure of parasympathetic autonomic function , and reduced rmssd is a marker of parasympathetic loss . brachial distensibility ( brachd ) was measured using a dynapulse pathway instrument ( pulse metric , san diego , ca ) , as previously described ( 22 ) . this device derives brachial artery pressure curves using pulse dynamic analysis of arterial pressure signals obtained from a standard cuff sphygmomanometer to assess distensibility ( % /mmhg ) . brachd was calculated using an empirical model to estimate baseline brachial artery diameter from sex , height , weight , and mean arterial pressure ( 22 ) . pulse wave velocity ( pwv ) in the carotid to femoral segment ( pwv - trunk ) was measured with the sphygmocor device ( atcor medical ) . pwv calculates the speed for the pressure wave generated by cardiac ejection to reach the periphery ( m / s ) ( 23 ) . three electrocardiogram leads were applied to the torso , and the average of three distances from the lowest portion of the sternal notch to the carotid and femoral artery sites was obtained . a pressure waveform was obtained for the proximal site ( carotid ) , and a second was recorded from the femoral artery using an applanation tonometer . pwv - trunk is the difference in the carotid - to - femoral path length divided by the difference in r wave - to - waveform foot times , using an average of at least 10 beats to cover a complete respiratory cycle ( 23 ) . augmentation index ( aix ) provides information concerning both wave reflections and as ( 24 ) . the applanation tonometer was placed over the right radial artery , and three radial pulse waves were obtained , as described previously ( 5 ) . the pressure waves were calibrated using mean arterial pressure and dbp obtained in the same arm . the device then analyzed the pulse wave using a generalized transfer function ( 24 ) . wave forms collected over a 10-s period were averaged to produce peripheral and corresponding central ( ascending aortic ) pressure waveforms . ascending aortic the aix was calculated as the difference between the main outgoing wave and the reflected wave of the central arterial waveform , expressed as a percentage of the central pulse pressure . because aix is affected by heart rate , values were adjusted to a standard heart rate of 75 bpm ( aix75 ) ( 25 ) . all cardiac autonomic and vascular function tests were conducted fasting to prevent the possible influence of a surge in acute ambient glucose levels after a meal ( 26 ) . statistical analyses were performed using sas for windows ( version 9.2 ; sas institute , cary , nc ) . sdnn , tg , and aer were log - transformed to better meet model assumptions ( e.g. , homogeneity of variance ) . comparisons of demographic and clinical characteristics between youth with and without type 1 diabetes were examined using tests for categorical variables and t tests for normally distributed continuous variables . the associations between sdnn ( main predictor variable ) and as outcomes were initially explored in a combined model , including both youth with and without type 1 diabetes , to test for effect modification by presence of type 1 diabetes by including an interaction term between sdnn and diabetes status . since there was a suggestion of effect modification by presence of type 1 diabetes , subsequent analyses were stratified according to diabetes status . multiple linear regression models were built separately for youth with and without type 1 diabetes to assess the relationships between sdnn ( independent variable ) and each of the three as measures ( dependent variables ) : peripheral ( brachd ) , central ( pwv - trunk ) , and aix75 . separate models for each as outcome were constructed . a base model ( model 1 ) examined the relationship between sdnn and each as measure after adjustment for demographic factors age , sex , and race / ethnicity and was the model used for our primary test of association between sdnn and each of the as measures . then , sequentially adjusted models explored the effect of adjustment for traditional cvd risk factors : dbp ( model 2 ) , lipid ( ldl - c , hdl - c , tg : model 3 ) , bmi ( model 4 ) , microalbuminuria ( model 5 ) , smoking status ( model 6 ) , the combined model with all cvd risk factors ( model 7 ) , and a final model with all covariates and hba1c ( model 8) . finally , model 9 explored potential mediation of the association between hrv and as by heart rate . similar analyses were conducted to assess the associations between rmssd and each measure of as . search cvd is an ancillary study to the search for diabetes in youth study , conducted in colorado and ohio . search is a multicenter study that conducts population - based ascertainment of nongestational cases of physician - diagnosed diabetes in youth age < 20 years at diagnosis ( 15 ) . a total of 402 search participants with type 1 diabetes , residents of colorado and ohio , who had a duration of diabetes of at least 5 years , were enrolled in the search cvd study between 2009 and 2011 . during the same time period , a total of 204 frequency - matched ( by age , sex , and race / ethnicity ) youth without type 1 diabetes ( control subjects ) were also recruited in the study . control participants were enrolled from the primary - care offices in the same geographical areas from which the patients with diabetes were referred and were confirmed free of diabetes by fasting glucose levels < 126 mg / dl ( 16 ) . the study was reviewed and approved by the local institutional review boards that had jurisdiction over the local study population , and all participants provided signed informed consent or assent . participants were invited for an outpatient research visit after an 8-h overnight fast , and medications , including short - acting insulin , were withheld the morning of the visit until after the blood draw was complete . all participants were asked to refrain from any strenuous exercise , smoking , or consumption of any caffeinated drinks 12 h prior to the visit . race / ethnicity was self - reported , and the participants were categorized into non - hispanic white ( nhw ) and other racial / ethnic group ( including hispanic , african american , and asian / pacific islander racial / ethnic groups ) . participants completed standardized questionnaires including medical history , medication inventory , smoking status , physical activity , daily insulin dose , and family history of diabetes and cvd . current cigarette smoking was defined as having smoked cigarettes on one or more of the 30 days preceding the survey . individuals who had tried smoking or smoked regularly ( at least one cigarette every day for 30 days ) but were not current smokers were considered past smokers . participants were asked the average number of days in a typical week that they participated in physical activity for at least 20 min that made them sweat or breathe hard and were then categorized as physically inactive ( 02 days / week ) or physically active ( 37 days / week ) ( 17 ) . height was measured in centimeters using a stadiometer and weight in kilograms using a standardized scale . bmi was calculated as weight in kilograms divided by the square of height in meters , and age- and sex - specific bmi z - scores were derived based on the centers for disease control and prevention national standards ( 18 ) . waist circumference was measured to the nearest 0.1 cm with the national health and nutrition examination survey protocol ( 19 ) . resting systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) were measured three times , using an aneroid sphygmomanometer , while the subjects were seated for at least 5 min and the average of the three measurements was taken . laboratory samples were obtained under conditions of metabolic stability , defined , for case subjects , as no episode of diabetic ketoacidosis during the previous month . a fasting blood draw was conducted for the assessment of the metabolic parameters ( hba1c , ldl cholesterol [ ldl - c ] , hdl cholesterol [ hdl - c ] , and triglyceride [ tg ] levels ) . urinary albumin was measured from overnight timed urine samples by radioimmunoassay and expressed as albumin excretion rate ( aer ) . aer levels between 20 and 199 g / min were defined as microalbuminuria ( 20 ) . measurements of tg and hdl - c were performed enzymatically on a hitachi 917 autoanalyzer ( roche molecular biochemicals diagnostics , indianapolis , in ) . ldl - c was calculated by the friedewald equation for individuals with tg concentration < 400 mg / dl and the beta quantification procedure for those with tg concentration 400 mg / dl . hrv was measured in the morning between 7:00 and 11:00 a.m. in a room with a stable room temperature , with the participant lying in the resting supine position for 10 min , using the sphygmocor device ( atcor medical , sydney , australia ) . the device takes into account the normal heart beats , ignoring ectopic beats , to derive the statistical parameters of the normal r - r intervals ( n - n intervals ) of the electrocardiogram and estimates several time- and frequency - domain hrv indices ( 21 ) . the time - domain indices of hrv used in the present analysis were sd of the r - r intervals ( sdnn ) and root mean square difference of successive normal r - r interval ( rmssd ) . sdnn is a measure of overall hrv , so lower sdnn levels indicate reduced overall hrv . rmssd is a measure of parasympathetic autonomic function , and reduced rmssd is a marker of parasympathetic loss . brachial distensibility ( brachd ) was measured using a dynapulse pathway instrument ( pulse metric , san diego , ca ) , as previously described ( 22 ) . this device derives brachial artery pressure curves using pulse dynamic analysis of arterial pressure signals obtained from a standard cuff sphygmomanometer to assess distensibility ( % /mmhg ) . brachd was calculated using an empirical model to estimate baseline brachial artery diameter from sex , height , weight , and mean arterial pressure ( 22 ) . pulse wave velocity ( pwv ) in the carotid to femoral segment ( pwv - trunk ) was measured with the sphygmocor device ( atcor medical ) . pwv calculates the speed for the pressure wave generated by cardiac ejection to reach the periphery ( m / s ) ( 23 ) . three electrocardiogram leads were applied to the torso , and the average of three distances from the lowest portion of the sternal notch to the carotid and femoral artery sites was obtained . a pressure waveform was obtained for the proximal site ( carotid ) , and a second was recorded from the femoral artery using an applanation tonometer . pwv - trunk is the difference in the carotid - to - femoral path length divided by the difference in r wave - to - waveform foot times , using an average of at least 10 beats to cover a complete respiratory cycle ( 23 ) . augmentation index ( aix ) provides information concerning both wave reflections and as ( 24 ) . the applanation tonometer was placed over the right radial artery , and three radial pulse waves were obtained , as described previously ( 5 ) . the pressure waves were calibrated using mean arterial pressure and dbp obtained in the same arm . the device then analyzed the pulse wave using a generalized transfer function ( 24 ) . wave forms collected over a 10-s period were averaged to produce peripheral and corresponding central ( ascending aortic ) pressure waveforms . ascending aortic the aix was calculated as the difference between the main outgoing wave and the reflected wave of the central arterial waveform , expressed as a percentage of the central pulse pressure . because aix is affected by heart rate , values were adjusted to a standard heart rate of 75 bpm ( aix75 ) ( 25 ) . all cardiac autonomic and vascular function tests were conducted fasting to prevent the possible influence of a surge in acute ambient glucose levels after a meal ( 26 ) . statistical analyses were performed using sas for windows ( version 9.2 ; sas institute , cary , nc ) . sdnn , tg , and aer were log - transformed to better meet model assumptions ( e.g. , homogeneity of variance ) . comparisons of demographic and clinical characteristics between youth with and without type 1 diabetes were examined using tests for categorical variables and t tests for normally distributed continuous variables . the associations between sdnn ( main predictor variable ) and as outcomes were initially explored in a combined model , including both youth with and without type 1 diabetes , to test for effect modification by presence of type 1 diabetes by including an interaction term between sdnn and diabetes status . since there was a suggestion of effect modification by presence of type 1 diabetes , subsequent analyses were stratified according to diabetes status . multiple linear regression models were built separately for youth with and without type 1 diabetes to assess the relationships between sdnn ( independent variable ) and each of the three as measures ( dependent variables ) : peripheral ( brachd ) , central ( pwv - trunk ) , and aix75 . separate models for each as outcome were constructed . a base model ( model 1 ) examined the relationship between sdnn and each as measure after adjustment for demographic factors age , sex , and race / ethnicity and was the model used for our primary test of association between sdnn and each of the as measures . then , sequentially adjusted models explored the effect of adjustment for traditional cvd risk factors : dbp ( model 2 ) , lipid ( ldl - c , hdl - c , tg : model 3 ) , bmi ( model 4 ) , microalbuminuria ( model 5 ) , smoking status ( model 6 ) , the combined model with all cvd risk factors ( model 7 ) , and a final model with all covariates and hba1c ( model 8) . finally , model 9 explored potential mediation of the association between hrv and as by heart rate . similar analyses were conducted to assess the associations between rmssd and each measure of as . a total of 344 youth with type 1 diabetes and 171 healthy control subjects with complete measures of hrv and as were included in these analyses . youth with and without type 1 diabetes had a similar age and sex distribution , though youth with diabetes were more likely to be nhw than control subjects ( 87 vs. 77% ; p = 0.004 ) . bmi , bmi z - score , and bp were similar among youth with and without type 1 diabetes . however , youth with type 1 diabetes had a worse metabolic profile with higher hba1c ( p < 0.0001 ) and ldl - c ( p = 0.01 ) levels and a higher prevalence of microalbuminuria ( 10 vs. 2% ; p = 0.007 ) as compared with healthy control subjects . the heart rate was significantly higher among youth with type 1 diabetes as compared with their healthy counterparts ( p < 0.0001 ) . finally , sdnn and rmssd were significantly lower among youth with type 1 diabetes ( 69.7 vs. 79.4 ms , p = 0.002 ; and 63.7 vs. 79.7 ms , p = 0.0003 , respectively ) as compared with their healthy counterparts . characteristics of youth with and without type 1 diabetes figure 1 displays graphically the association between sdnn and each of the vascular stiffness measures , brachd ( fig . 1c ) , in youth with and without type 1 diabetes . among youth with type 1 diabetes , reduced hrv ( marked by lower sdnn ) was significantly associated with all vascular stiffness outcomes : increased peripheral stiffness ( lower brachd , p = 0.01 ; fig . in contrast , among control youth , the only significant association was between reduced hrv and peripheral stiffness ( brachd , p = 0.004 ; fig . 1a ) . a formal test for effect modification by diabetes status of the association between sdnn and as measures was marginally significant for central as ( pwv - trunk , p = 0.06 ; fig . 1b ) . the associations between lower hrv and as measures ( panel a : brachd ; panel b : pwv - trunk ; panel c : aix75 ) . the p value for interaction is in the combined sample including case and control subjects . the coefficients and p values are from the linear regression models shown separately for case and control subjects adjusted for age , sex , and race / ethnicity . p value for interaction is derived from the combined model including case and control subjects . ( a high - quality color representation of this figure is available in the online issue . ) table 2 shows results of multiple linear regression analyses exploring the association between sdnn and the three as outcomes , stratified by diabetes status , in sequentially adjusted models . associations between sdnn and measures of as ( brachd , pwv - trunk , and aix75 ) in sequentially adjusted linear regression models among youth with type 1 diabetes , lower sdnn was significantly associated with lower brachd ( p = 0.01 ) , higher pwv - trunk ( p < 0.0001 ) , and higher aix75 ( p = 0.007 ) independent of demographic variables ( model 1 ) . these associations were unchanged on additional adjustment for dbp ( model 2 ) , lipid levels ( model 3 ) , obesity - related parameter ( bmi , model 4 ) , microalbuminuria ( aer , model 5 ) , and smoking ( model 6 ) . in the fully adjusted model ( model 7 ) , with all the covariates included , the relationships between sdnn and pwv - trunk / brachd among youth with type 1 diabetes were virtually unchanged , but the association with aix75 was reduced ( p = 0.1 ) . above and beyond the variability included in the base model , blood pressure and obesity - related variables explained most of the variability in brachd ( change in adjusted r of 13 and 11% , respectively , from base model ) and pwv ( change in adjusted r of 7 and 4% , respectively , from base model ) . addition of hba1c ( model 8) resulted in minimal improvement from the model with all cvd risk factors . finally , on additional adjustment for resting heart rate in model 9 , the associations between sdnn and markers of as became nonsignificant , with resting heart rate remaining significantly associated with as in all models ( data not shown ) . among healthy control subjects , lower sdnn was significantly associated with brachd ( p = 0.004 ) and remained unchanged and statistically significant in the sequentially adjusted and final models ( p = 0.01 ) . obesity - related variables explained most of the variability in brachd in youth without diabetes , with an increase of 26% in adjusted r from the base model . supplementary table 1 shows results of multiple linear regression analyses exploring the association between rmssd and the three as outcomes , stratified by diabetes status , in sequentially adjusted models . among youth with type 1 diabetes , a significant inverse association was found between rmssd and all measures of as ( pwv - trunk , brachd , and aix75 ) . we found that cardiac autonomic dysfunction , as measured by lower hrv , is associated with increased vascular stiffness in both central and peripheral vascular beds , among youth with type 1 diabetes . these associations are independent of traditional cvd risk factors , including blood pressure , lipid levels , obesity - related parameters , microalbuminuria , and smoking . no associations between hrv and measures of as were found in the nondiabetic control group , except for an association between sdnn ( though not rmssd ) and peripheral stiffness ( as measured by brachd ) . our data extend the findings from previous studies that have demonstrated an association between cardiac autonomic function and various measures of as in adults with type 1 diabetes ( 1214 ) . ahlgren et al . ( 12 ) found that heart rate variation during deep breathing , the expiration / inspiration ratio , correlated with increased aortic stiffness in 40 women ( r = 0.49 ; p = 0.002 ) but not in 38 men ( r = 0.14 ; p = 0.4 ) with type 1 diabetes , independent of duration of diabetes . the stockholm diabetes intervention study found , in a group of 59 adults with type 1 diabetes , that hrv correlated with arterial wall stiffness of the right common carotid artery ( 13 ) . of note , all these studies were cross - sectional and did not examine the relationship independent of the traditional cvd risk factors . however , in the pittsburgh edc study , lower baseline expiration / inspiration ratio correlated strongly with both greater as ( measured by both aix and augmentation pressure ) and with reduced estimated myocardial perfusion ( measured by subendocardial viability ratio ) in 144 adults with type 1 diabetes some 18 years later ( 11 ) . moreover , although edc did not measure aix and augmentation pressure at baseline , the authors suggested , based on their findings , that cardiovascular autonomic neuropathy may play an important pathophysiological role in the development of arterial stiffening in adults with type 1 diabetes . similarly , an association between lower hrv and progression of coronary artery calcification in both adults with type 1 diabetes and nondiabetic control subjects was recently reported by the coronary artery calcification in type 1 diabetes study ( 27 ) . our finding of a strong correlation between reduced hrv and increased central as in youth with type 1 diabetes , but not among healthy control subjects , provides indirect support to the hypothesis of a pathophysiological role for can in the development of as . however , given the cross - sectional design of our study , we can not directly test this hypothesis . data from a limited number of animal ( 28 ) and human studies ( 29,30 ) suggests that the amplified sympathetic tone present in the early stage of can , also identified previously in our youth with type 1 diabetes ( 9 ) , could potentially increase the vascular tone and thus contribute to increased vascular stiffness , thus providing biologic plausibility for the above hypothesis . indeed , on additional adjustment for resting heart rate ( elevated in youth with type 1 diabetes versus control subjects ) , the associations between sdnn and markers of as became nonsignificant , with resting heart rate remaining significantly associated with as in all models ) . this suggests that increased resting heart rate may be on the causal pathway linking the reduced hrv with altered sympathovagal balance ( parasympathetic loss with sympathetic override ) in youth with type 1 diabetes to increased as . we found an association between lower hrv and increased central stiffness in youth with type 1 diabetes but not in control subjects , and this association was independent of traditional cvd risk factors ( lipids , blood pressure , microalbuminuria , obesity , and smoking).these results may indicate , rather than a causal relationship , a common pathway , possibly hyperglycemia , leading in parallel to both cardiac autonomic dysfunction and increased as in individuals with type 1 diabetes . there is ample biologic plausibility for the role of hyperglycemia as a common mediator of both abnormalities ( 31,32 ) . hyperglycemia has been shown to promote accumulation of advanced glycation end products , causing cross - linking and polymerization of collagen molecules within the vessel wall ( 33 ) , thus resulting in loss of elasticity with subsequent reduction in arterial and myocardial compliance . moreover , hyperglycemia was also shown to induce abnormal signaling of the autonomic neurons via accumulation of advanced glycation end products and microangiopathy , causing ischemic atrophy of the autonomic nerve fibers innervating cardiac and vascular tissue ( 34 ) . other mechanisms , in addition to hyperglycemia , are likely to be involved . similar to edc , we also found an association between lower hrv and increased aix75 . however , in our study , the association was attenuated on adjustment for traditional cvd risk factors . this is not unexpected since , although cardiac autonomic dysfunction and arterial stiffening are both accelerated in the hyperglycemic environment , they likely share additional cvd risk factors . for example , elevated blood pressure levels and smoking were shown to be associated with both as and cardiac autonomic dysfunction in subjects with type 1 diabetes ( 11,3537 ) . finally , we found a significant association between hrv and peripheral as , independent of demographic and cvd risk factors , in both youth with and without type 1 diabetes . ( 38 ) among 382 young healthy japanese men , with a significant negative association between brachial - ankle pwv and hrv parameters for parasympathetic nervous activity . first , the cross - sectional nature of the study limits our ability to evaluate causality and order of events . we therefore intend to prospectively follow this cohort to better understand the progression of cardiac autonomic dysfunction and vascular stiffening over time . second , our sample of healthy control subjects was approximately half of that of youth with type 1 diabetes . however , the nonsignificant associations between hrv and as measures ( pwv - trunk and aix75 ) were not equivocal among our control sample and likely not the result of a type ii error ( lack of power ) . finally , the hrv measure used in our study was derived from a 10-min recording of the baseline electrocardiogram . while this is a relatively short length of recording , it is considered standard practice for clinical and research purposes , and it is advocated by the task force of the european society of cardiology and the north american society of pacing and electrophysiology ( 21 ) , as opposed to the hrv measures derived from the 24-h holter recordings . our study also has several unique strengths : the setting of this study in a young adult contemporary population , the large and diverse sample of patients with type 1 diabetes , inclusion of a healthy control sample , and the simple noninvasive , bedside assessment of multiple measures of as , including both central and peripheral arteries . in summary , we found a strong association between cardiac autonomic dysfunction and both central and peripheral as in youth with type 1 diabetes , independent of traditional cvd risk factors . while lower hrv was also associated with increased peripheral stiffness in nondiabetic control youth , the association with central stiffness may be unique to individuals with type 1 diabetes . regardless of the mechanisms responsible for this association , which need to be further explored in longitudinal studies , this association may contribute to the increased and premature cardiovascular disease burden in people with type 1 diabetes .

objectivereduced heart rate variability ( hrv ) and increased arterial stiffness ( as ) are both present in youth with type 1 diabetes . however , it is unclear whether they are associated and whether their association is independent of cardiovascular disease ( cvd ) risk factors.research design and methodsthe search cardiovascular disease ( search cvd ) study explored the cross - sectional relationships between hrv and several measures of as in youth with ( n = 344 ) and without ( n = 171 ) type 1 diabetes . the sphygmocor device ( atcor medical , sydney , australia ) was used to measure hrv using sd of normal r - r interval ( sdnn ) , as well as as , using pulse wave velocity in the carotid to femoral segment ( pwv - trunk ) and augmentation index adjusted to a heart rate of 75 bpm ( aix75 ) . brachial distensibility ( brachd ) , another index of as , was measured with a dynapulse instrument ( pulse metric , san diego , ca ) . multiple linear regression analyses explored the associations between hrv and each of the three as measures , after adjusting for demographic characteristics and traditional cvd risk factors ( blood pressure , lipids , obesity , microalbuminuria , and smoking ) separately , for youth with and without type 1 diabetes.resultsamong youth with type 1 diabetes , lower sdnn was associated with peripheral as ( lower brachd , p = 0.01 ; r2 = 0.30 ) and central as ( higher pvw - trunk , p < 0.0001 ; r2 = 0.37 ; and higher aix75 , p = 0.007 ; r2 = 0.08 ) . these associations were attenuated with adjustment for cvd risk factors , but remained statistically significant for brachd and pwv - trunk . while a similar association between hrv and brachd was present in control youth , lower hrv was not associated with increased central as or with aix75.conclusionslongitudinal studies are needed to understand the pathways responsible for these associations .

You are an expert at summarizing long articles. Proceed to summarize the following text: there is an increasing awareness pertaining to epithelial thickness characteristics in keratoconus ( kcn).13 specifically , overall corneal epithelial thickness,4,5 as well as epithelial thickness topographic variability , may serve as diagnostic elements , in synergy with other topographic and scheimpflug tomographic screening indicators , such as irregular corneal thickness6,7 and anterior - surface topographic variability.8,9 in addition , the corneal epithelial layer - thickness distribution can be very useful in clinical10 as well as in basic research.11,12 we have introduced10 and reported13 a potentially novel epithelial clinical indicator for biomechanical corneal instability in keratoconus ( kcn ) as a criterion demonstrating increased overall corneal epithelial thickness . the recent popularity of clinical in - vivo epithelial mapping by anterior - segment optical coherence tomography ( as - oct ) presents a new and potentially more practical tool , with the speed of optical imaging and noncontact - mode ease of use compared to the previous gold standard for epithelial imaging , high frequency ultrasound.1416 this work aims to investigate three - dimensional epithelial layer thickness characteristics in a large pool of keratoconic patients via clinically available as - oct . keratoconic investigation and severity stratification was facilitated by scheimpflug imaging ; oct - derived epithelial thickness characteristics were correlated on one - to - one basis with scheimpflug - derived kcn classification and as - irregularity indices , which have been previously identified and reported as robust indicators for kcn severity and progression.8 this comparative case - series study received approval by the ethics committee of our institution , adherent to the tenets of the declaration of helsinki . informed written consent was obtained from each subject at the time of the first clinical visit . study group a ( n=160 different eyes ) consisted of cases with keratoconic eyes , confirmed by a complete ophthalmologic evaluation and corneal imaging , in which no previous surgery had been applied . kcn diagnosis was established by slit - lamp biomicroscopy for clinical signs of kcn , such as the pattern of opposing central and peripheral retinoscopic movements , the conical reflection on the nasal cornea under temporal lighting ( rizzutti s sign ) , the fleischer ring , iron deposits within the epithelium near the cone base , and finally the presence of vogt s striae.17 the kcn diagnosis was further confirmed by the wavelight oculyzer ii ( alcon surgical , fort worth , tx , usa ) and a pentacam high - resolution scheimpflug imaging camera ( oculus optikgerte , wetzlar , germany).18 quantitative data supporting the kcn diagnosis included keratometry > 45.00 d and asymmetric topographic patterns . in addition to not having been subjected to any previous ocular intervention , for a patient to be included in study group a , the following criteria had to be met : absence of systemic disease , no history of chemical injury , or delayed epithelial healing . the control group , b ( n=160 different eyes ) , consisted of normal , healthy eyes , confirmed by a complete ophthalmologic evaluation and corneal imaging . while participants were randomly selected from the pool of screening patients , age and sex were considered in order to match study group a. exclusion criteria for the control group ( b ) included current or past ocular pathology , previous surgery , present irritation , or dry - eye disorder , as well as contact lens wear . female patients with ongoing pregnancy or lactating at the time of the study were excluded from either group . in all cases , to minimize testing variations , oct and scheimpflug imaging were conducted by skilled trained investigators and preceded ocular clinical examination . the sample size was established by the following parameters : estimated epithelial thickness variability ( standard deviation ) , minimum spotted difference , significance criterion , and statistical power.19 the epithelial thickness variability was established by a recent study20 to be in the order of 2.5 m . the minimum spotted difference was 1 m , while the significance criterion was set to 0.05 and the intended statistical power was set to 0.95 . based on these criteria , the total sample size was estimated to be n=320 . the fourier - domain as - oct system rtvue 100 ( optovue , fremont , ca , usa ) , running on analysis and report software version a6 ( 9.0.27 ) , was employed in the study . data output included total corneal and epithelial thickness maps corresponding to a 6 mm - diameter area . the settings were : l - cam lens , eight meridional b scans per acquisition , consisting of 1,024 a scans each with 5 m axial resolution . the main analysis report produced by the system displayed total corneal ( reported as pachymetry ) and epithelial three - dimensional thickness maps covering the 6 mm - diameter area , examples of which are provided in figure 1 . as shown in figure 1 , each pachymetry map is divided in to 17 sectors . specifically , these are the 2 mm - diameter pupil - center disk of 12.56 mm area , eight sectors ( octants ) within the annulus between the 25 mm zones , each of 8.24 mm area , and eight sectors ( octants ) within the annulus of 56 mm zones , each of 4.32 mm area . for each one of these sectors , the average thickness is displayed numerically over the corresponding area . in our study , the reported epithelium center the superior , inferior , minimum , and maximum thickness , as well as the topographic thickness variability ( computed by the epithelial thickness standard deviation of the 17 segments ) were obtained directly by the statistics report . epithelial thickness range , defined as the minimum minus the maximum epithelial thickness , was derived accordingly . mean epithelial thickness was computed by the integer values of the seventeen octant numerical results , and the peripheral epithelial thickness was computed by the average of the thickness corresponding to eighteen equispaced points along the 5 mm radius ( data collected via mouse - over indication on the epithelial thickness map ) . to assess intraindividual repeatability the standard deviation of the three respective values was reported as repeatability , while the mean of these values has been included in the study . scheimpflug imaging was employed to provide simulated keratometry ( in diopters ) , topographic kcn classification ( tkc ) , and ac - irregularity indices.21 these data are offered , eg , by the specifically , the tkc grading scheme comprised of the following stages , indicating not kcn , kc1 , kc12 , kc2 , kc23 , kc3 , kc34 , and kc4 , indicating advancing stages of kcn , from the mildest to the most severe , respectively . to facilitate statistical analysis , we introduced a numeric conversion , ie , grade ( ) was set to 0 , kc1 to 1 , kc12 to 2 , kc2 to 3 , kc23 to 4 , kc3 to 5 , kc34 to 6 , and kc4 to 7 , as was previously introduced.22 the as - irregularity indices investigated in the study were : index of surface variance ( isv ) , the value of the standard deviation of individual corneal sagittal radii from the mean curvature ; and index of height decentration ( ihd ) , the value of the decentration of elevation data in the vertical direction , calculated from a fourier analysis . both of these indices have been recently studied in screening , classification , and clinical follow - up8,18,21,23 of keratoconic patients , indicating a robust correlation with kcn severity . to investigate further the possible correlation of oct - derived epithelial thickness characteristics with scheimpflug - derived kcn severity , two subgroups were formed from group a. specifically , subgroup a1 ( n=40 ) was formed from the cases whose kcn grading ( tkc ) was less or equal to kc1 , while subgroup a2 ( n=58 ) was formed from the advanced kcn cases ( tkc equal to or greater than kc3 ) . descriptive statistics , linear regression , analysis of variance to seek possible correlations , and analysis of variance between subgroups were performed by minitab version 16.2.3 ( minitab , coventry , uk ) and origin version 9 ( originlab , northampton , ma , usa ) . paired analysis p - values less than 0.05 were considered an indication of statistically significant results . results are presented in the form of means standard deviation of the mean ( minimum to maximum ) . study group a ( n=160 different eyes ) consisted of cases with keratoconic eyes , confirmed by a complete ophthalmologic evaluation and corneal imaging , in which no previous surgery had been applied . kcn diagnosis was established by slit - lamp biomicroscopy for clinical signs of kcn , such as the pattern of opposing central and peripheral retinoscopic movements , the conical reflection on the nasal cornea under temporal lighting ( rizzutti s sign ) , the fleischer ring , iron deposits within the epithelium near the cone base , and finally the presence of vogt s striae.17 the kcn diagnosis was further confirmed by the wavelight oculyzer ii ( alcon surgical , fort worth , tx , usa ) and a pentacam high - resolution scheimpflug imaging camera ( oculus optikgerte , wetzlar , germany).18 quantitative data supporting the kcn diagnosis included keratometry > 45.00 d and asymmetric topographic patterns . in addition to not having been subjected to any previous ocular intervention , for a patient to be included in study group a , the following criteria had to be met : absence of systemic disease , no history of chemical injury , or delayed epithelial healing . the control group , b ( n=160 different eyes ) , consisted of normal , healthy eyes , confirmed by a complete ophthalmologic evaluation and corneal imaging . while participants were randomly selected from the pool of screening patients , age and sex were considered in order to match study group a. exclusion criteria for the control group ( b ) included current or past ocular pathology , previous surgery , present irritation , or dry - eye disorder , as well as contact lens wear . female patients with ongoing pregnancy or lactating at the time of the study were excluded from either group . in all cases , to minimize testing variations , oct and scheimpflug imaging were conducted by skilled trained investigators and preceded ocular clinical examination . the sample size was established by the following parameters : estimated epithelial thickness variability ( standard deviation ) , minimum spotted difference , significance criterion , and statistical power.19 the epithelial thickness variability was established by a recent study20 to be in the order of 2.5 m . the minimum spotted difference was 1 m , while the significance criterion was set to 0.05 and the intended statistical power was set to 0.95 . the fourier - domain as - oct system rtvue 100 ( optovue , fremont , ca , usa ) , running on analysis and report software version a6 ( 9.0.27 ) , was employed in the study . data output included total corneal and epithelial thickness maps corresponding to a 6 mm - diameter area . the settings were : l - cam lens , eight meridional b scans per acquisition , consisting of 1,024 a scans each with 5 m axial resolution . the main analysis report produced by the system displayed total corneal ( reported as pachymetry ) and epithelial three - dimensional thickness maps covering the 6 mm - diameter area , examples of which are provided in figure 1 . as shown in figure 1 , each pachymetry map is divided in to 17 sectors . specifically , these are the 2 mm - diameter pupil - center disk of 12.56 mm area , eight sectors ( octants ) within the annulus between the 25 mm zones , each of 8.24 mm area , and eight sectors ( octants ) within the annulus of 56 mm zones , each of 4.32 mm area . for each one of these sectors , the average thickness is displayed numerically over the corresponding area . in our study , the reported epithelium center the superior , inferior , minimum , and maximum thickness , as well as the topographic thickness variability ( computed by the epithelial thickness standard deviation of the 17 segments ) were obtained directly by the statistics report . epithelial thickness range , defined as the minimum minus the maximum epithelial thickness , was derived accordingly . mean epithelial thickness was computed by the integer values of the seventeen octant numerical results , and the peripheral epithelial thickness was computed by the average of the thickness corresponding to eighteen equispaced points along the 5 mm radius ( data collected via mouse - over indication on the epithelial thickness map ) . to assess intraindividual repeatability the standard deviation of the three respective values was reported as repeatability , while the mean of these values has been included in the study . scheimpflug imaging was employed to provide simulated keratometry ( in diopters ) , topographic kcn classification ( tkc ) , and ac - irregularity indices.21 these data are offered , eg , by the refractive and topometric reports provided by the pentacam software . specifically , the tkc grading scheme comprised of the following stages , indicating not kcn , kc1 , kc12 , kc2 , kc23 , kc3 , kc34 , and kc4 , indicating advancing stages of kcn , from the mildest to the most severe , respectively . to facilitate statistical analysis , we introduced a numeric conversion , ie , grade ( ) was set to 0 , kc1 to 1 , kc12 to 2 , kc2 to 3 , kc23 to 4 , kc3 to 5 , kc34 to 6 , and kc4 to 7 , as was previously introduced.22 the as - irregularity indices investigated in the study were : index of surface variance ( isv ) , the value of the standard deviation of individual corneal sagittal radii from the mean curvature ; and index of height decentration ( ihd ) , the value of the decentration of elevation data in the vertical direction , calculated from a fourier analysis . both of these indices have been recently studied in screening , classification , and clinical follow - up8,18,21,23 of keratoconic patients , indicating a robust correlation with kcn severity . to investigate further the possible correlation of oct - derived epithelial thickness characteristics with scheimpflug - derived kcn severity , two subgroups were formed from group a. specifically , subgroup a1 ( n=40 ) was formed from the cases whose kcn grading ( tkc ) was less or equal to kc1 , while subgroup a2 ( n=58 ) was formed from the advanced kcn cases ( tkc equal to or greater than kc3 ) . descriptive statistics , linear regression , analysis of variance to seek possible correlations , and analysis of variance between subgroups were performed by minitab version 16.2.3 ( minitab , coventry , uk ) and origin version 9 ( originlab , northampton , ma , usa ) . paired analysis p - values less than 0.05 were considered an indication of statistically significant results . results are presented in the form of means standard deviation of the mean ( minimum to maximum ) . the keratoconic study group ( a ) was formed from 160 eyes , of which 72 belonged to female and 88 belonged to male patients . the mean age of patients at the time of examination was 33.89.7 ( 1860 ) years . there were 83 right ( oculus dexter ) and 77 left ( oculus sinister ) eyes . average simulated keratometry for group a ( kcn ) , as provided by the scheimpflug imaging , was k1 ( flat ) 46.633.78 d , and k2 ( steep ) 50.865.14 d. average tkc was between the kc2 and the kc23 stages . the as - irregularity indices had the following values : ihd 0.0760.055 ( 0.0300.287 ) and isv 82.847.7 ( 10237 ) . the control group ( b ) was formed from 160 eyes , of which 70 belonged to female and 90 to male patients . the mean age of patients at the time of examination was 34.89.3 ( 1859 ) years . average simulated keratometry for this control group , as provided by the scheimpflug imaging , was k1 ( flat ) 42.781.33 d and k2 43.471.95 d. average tkc was ( ) . the as - irregularity indices had the following values : ihd 0.0290.21 and isv 31.7822.61 . in all cases , following correct fixation and centering , oct epithelial imaging - acquisition time was less than 0.5 second . following acquisition , the epithelial thickness summary report was furnished in less than 1 minute . intraindividual repeatability for the epithelial thickness for the center , superior , inferior , maximum , minimum , and topographic thickness variability was evaluated by the standard deviation of four consecutive acquisitions in each case . as reported in table 1 , for study group a ( keratoconic eyes ) , the epithelial thickness had an average repeatability for center 1.781.31 m , superior 1.920.99 m , inferior 1.581.01 m , minimum 1.331.15 m , maximum 1.721.30 m , and topographic thickness variability 0.460.25 m . for the control group ( b , normal eyes ) , the epithelial thickness had an average repeatability for center 0.890.75 m , superior 1.210.89 m , inferior 0.730.67 m , minimum 1.071.02 m , maximum 1.731.05 m , and topographic thickness variability 0.190.11 m , respectively . for study group a ( keratoconic eyes ) , the center epithelial thickness was on average 51.757.02 ( 3672 ) m , with superior 55.576.79 ( 4276 ) m , inferior 49.655.54 ( 3372 ) m , minimum 40.738.51 ( 1960 ) m , maximum 63.548.85 ( 4994 ) m , mean 52.395.48 ( 43.5070.33 ) m , and mid - peripheral thickness 52.525.36 ( 43.6070.00 ) m . for the control group ( b , healthy eyes ) , the center epithelial thickness was 52.543.23 ( 4559 ) m , with superior 51.353.41 ( 4460 ) m , inferior 53.133.27 ( 4559 ) m , minimum 48.503.98 ( 2857 ) m , maximum 55.333.67 ( 4664 ) m , mean 52.243.21 ( 44.5859.42 ) m , and mid - peripheral thickness 52.183.23 ( 44.5059.50 ) m . these results are reported in table 2 and are illustrated in the form of box plots in figure 2 . the epithelium was thinner in the center in the kcn group ( 0.79 m ) , while thicker overall ( + 0.15 m ) and mid - peripherally ( + 0.35 m ) in comparison to the control group ( 0.0760 and 0.0491 , respectively ; p=0.0199 ) . the epithelium at the superior position ( + 4.22 m ) and maximum ( + 8.21 m ) was thicker , while the inferior ( 3.48 m ) and minimum ( 7.77 m ) were thinner in the kcn group in comparison to the control group ( in all cases , p<0.01 ) . more pronounced were the differences in topographic thickness variability ( + 4.48 m ) and range ( 15.94 m ) , both significant statistical differences ( p<0.001 ) . figure 3 illustrates ( in the form of box plots ) epithelial thickness topographic variability and epithelial thickness range for the two groups . we note the negative sign in the thickness range , a result of the definition adopted by the as - oct software , which we preserved in this study for conformity . we further investigated distribution characteristics within the two subgroups formed within study group a , namely the lower keratoconic stage a1 and the advanced - stage subgroup a2 . the center epithelium was thicker in the lower keratoconic stage subgroup a1 ( + 0.36 m , p=0.118 ) and thinner in the advanced - stage subgroup a2 ( 1.93 m , p=0.032 ) in comparison to the control group . mean and peripheral epithelial thickness was also higher in the lower keratoconic subgroup a1 ( + 0.63 and + 1.14 m , p=0.045 and 0.021 , respectively ) in comparison to the control group . the epithelial thickness topographic variability was 2.460.75 ( 4 to 18 ) m in the lower keratoconic stage subgroup a1 and 9.273.25 ( 14 to 66 ) m in the advanced - stage subgroup a2 . the analysis between topographic variability for the control group ( b ) , kcn group ( a ) , and subgroups a1 and a2 indicated ( p<0.01 ) that the means differed at the 0.05 level of significance . similar results were obtained for the epithelial range : in the advanced kcn subgroup a2 , the epithelial thickness range was 34.0511.31 ( 14 to 66 ) m , in the entire kcn group 22.8112.55 ( 4 to 66 ) m , and in the low kcn subgroup a1 10.333.82 ( 4 to 18 ) m , while in the control group it was 6.863.33 ( 3 to 29 ) m ( p<0.001 ) . as indicated by the statistically significant differences observed in the topographic thickness variability and thickness range ( difference of the minimum minus the maximum ) in relation to the keratoconic severity , we further considered the one - to - one correlation of these two epithelial thickness topographic variables , obtained by oct with two as - irregularity indices , ihd and isv , obtained by scheimpflug imaging . specifically , regression analysis was performed on the following pairs : epithelial thickness variability versus ihd and isv , and epithelial thickness range versus ihd and isv . regression analysis indicated statistically significant relationships ( p<0.01 in both pairs ; coefficients of determination 0.58 , 0.61 , 0.53 , and 0.58 , respectively ) . scatter and fitted - line plots for these relationships are illustrated in figures 4 and 5 . in all cases , following correct fixation and centering , oct epithelial imaging - acquisition time was less than 0.5 second . intraindividual repeatability for the epithelial thickness for the center , superior , inferior , maximum , minimum , and topographic thickness variability was evaluated by the standard deviation of four consecutive acquisitions in each case . as reported in table 1 , for study group a ( keratoconic eyes ) , the epithelial thickness had an average repeatability for center 1.781.31 m , superior 1.920.99 m , inferior 1.581.01 m , minimum 1.331.15 m , maximum 1.721.30 m , and topographic thickness variability 0.460.25 m . for the control group ( b , normal eyes ) , the epithelial thickness had an average repeatability for center 0.890.75 m , superior 1.210.89 m , inferior 0.730.67 m , minimum 1.071.02 m , maximum 1.731.05 m , and topographic thickness variability 0.190.11 m , respectively . for study group a ( keratoconic eyes ) , the center epithelial thickness was on average 51.757.02 ( 3672 ) m , with superior 55.576.79 ( 4276 ) m , inferior 49.655.54 ( 3372 ) m , minimum 40.738.51 ( 1960 ) m , maximum 63.548.85 ( 4994 ) m , mean 52.395.48 ( 43.5070.33 ) m , and mid - peripheral thickness 52.525.36 ( 43.6070.00 ) m . for the control group ( b , healthy eyes ) , the center epithelial thickness was 52.543.23 ( 4559 ) m , with superior 51.353.41 ( 4460 ) m , inferior 53.133.27 ( 4559 ) m , minimum 48.503.98 ( 2857 ) m , maximum 55.333.67 ( 4664 ) m , mean 52.243.21 ( 44.5859.42 ) m , and mid - peripheral thickness 52.183.23 ( 44.5059.50 ) m . these results are reported in table 2 and are illustrated in the form of box plots in figure 2 . the epithelium was thinner in the center in the kcn group ( 0.79 m ) , while thicker overall ( + 0.15 m ) and mid - peripherally ( + 0.35 m ) in comparison to the control group ( 0.0760 and 0.0491 , respectively ; p=0.0199 ) . the epithelium at the superior position ( + 4.22 m ) and maximum ( + 8.21 m ) was thicker , while the inferior ( 3.48 m ) and minimum ( 7.77 m ) were thinner in the kcn group in comparison to the control group ( in all cases , p<0.01 ) . more pronounced were the differences in topographic thickness variability ( + 4.48 m ) and range ( 15.94 m ) , both significant statistical differences ( p<0.001 ) . figure 3 illustrates ( in the form of box plots ) epithelial thickness topographic variability and epithelial thickness range for the two groups . we note the negative sign in the thickness range , a result of the definition adopted by the as - oct software , which we preserved in this study for conformity . we further investigated distribution characteristics within the two subgroups formed within study group a , namely the lower keratoconic stage a1 and the advanced - stage subgroup a2 . the center epithelium was thicker in the lower keratoconic stage subgroup a1 ( + 0.36 m , p=0.118 ) and thinner in the advanced - stage subgroup a2 ( 1.93 m , p=0.032 ) in comparison to the control group . mean and peripheral epithelial thickness was also higher in the lower keratoconic subgroup a1 ( + 0.63 and + 1.14 m , p=0.045 and 0.021 , respectively ) in comparison to the control group . the epithelial thickness topographic variability was 2.460.75 ( 4 to 18 ) m in the lower keratoconic stage subgroup a1 and 9.273.25 ( 14 to 66 ) m in the advanced - stage subgroup a2 . the analysis between topographic variability for the control group ( b ) , kcn group ( a ) , and subgroups a1 and a2 indicated ( p<0.01 ) that the means differed at the 0.05 level of significance . similar results were obtained for the epithelial range : in the advanced kcn subgroup a2 , the epithelial thickness range was 34.0511.31 ( 14 to 66 ) m , in the entire kcn group 22.8112.55 ( 4 to 66 ) m , and in the low kcn subgroup a1 10.333.82 ( 4 to 18 ) m , while in the control group it was 6.863.33 ( 3 to 29 ) m ( p<0.001 ) . as indicated by the statistically significant differences observed in the topographic thickness variability and thickness range ( difference of the minimum minus the maximum ) in relation to the keratoconic severity , we further considered the one - to - one correlation of these two epithelial thickness topographic variables , obtained by oct with two as - irregularity indices , ihd and isv , obtained by scheimpflug imaging . specifically , regression analysis was performed on the following pairs : epithelial thickness variability versus ihd and isv , and epithelial thickness range versus ihd and isv . regression analysis indicated statistically significant relationships ( p<0.01 in both pairs ; coefficients of determination 0.58 , 0.61 , 0.53 , and 0.58 , respectively ) . scatter and fitted - line plots for these relationships are illustrated in figures 4 and 5 . clinical in vivo epithelial mapping by as - oct is currently in practice , and introduces a simple and effective clinical tool for corneal epithelium mapping . the data are very easily obtained , and epithelial thickness parameters are automatically calculated by the system software report.20,24 the ease of use , as well as the reliable and predictable measurement , as indicated by the low intraindividual repeatability,25 which was only slightly elevated in the keratoconic group ( table 1 ) , suggest that epithelial imaging by as - oct holds promise for wider clinical application , such as screening of young adults for early kcn , and in a much wider perspective , potential candidates for laser cornea refractive surgery . one may wonder what the clinical potential of epithelial thickness measurements might be and what this technology could accomplish that other imaging technologies in widespread use might not ? one possibility lies in the fact that irregular epithelial thickness distribution can compensate for underlying irregular stromal distribution,26,27 and thus may mask topographic and tomographic results , particularly in early stage kcn investigation . we believe therefore that epithelial thickness imaging may be extremely helpful in kcn investigation by revealing the accentuated stromal irregularities that may not be detected by traditional corneal topography . the comprehensive study presented herein not only confirms our previous findings10,13 regarding increased overall epithelial thickness and variation in keratoconic eyes , and to a much lesser degree in less affected eyes , but also that the newly clinically available as - oct feature of in vivo epithelial imaging may illustrate these differences in a more reliable , repeatable , and quantitative way . the epithelium in the keratoconic eye group presents with relatively increased overall levels and noticeably increased thickness variations ( in simple terms , not only choppy waters , but high tide as well ) . specifically , the defining qualitative feature of the epithelium in the keratoconic group was the pattern of thin epithelium over the cone ( corresponding to the thinnest cornea , figure 1 ) , typically in the temporal / inferior area , while a thicker epithelium appears in the superior / nasal area , away from the cone . it is noteworthy that in the normal population ( group b in this study ) , and also extensively presented in kanellopoulos and asimellis,20 the superior epithelium was thinner superiorly than inferiorly ; the opposite held true in the keratoconic group ( table 2 , figure 2 ) . quantitatively , these differences can be expressed by the epithelial minimum being on average 7.77 m and inferior 3.48 m thinner in the keratoconic group , while maximum and superior thickness were thicker by + 8.21 m and + 4.22 m in the keratoconic group , in comparison to the controls . this pattern is in agreement with previous results obtained with high - frequency ultrasound biomicroscopy1,10 and oct.13,15 overall epithelial thickness variability as well as thickness range appear even more significant . for example , in the keratoconic group , thickness variability ( + 4.48 m , or 380% more ) and range ( 15.94 m , or 332% more ) increased a large margin and were statistically significant compared to the control group ( table 2 ) , in agreement with a previous study.2 more importantly , these indices , derived by clinical oct imaging , were well correlated with established kcn indices , such as the pentacam - derived topographic as - irregularity indices of isv and ihd ( figures 4 and 5 ) . such a comparison has not been previously reported in the peer - reviewed literature in kind or in scale , and in our opinion presents a novel , specific , and sensitive tool for the clinician . although not documented yet , epithelium depiction with as - oct probably represents longer - term remodeling associated with kcn , and not a temporary effect due to recent eye rubbing . it could be the irregular corneal shape and thickness ( although normalization of the epithelium following corneal cross - linking treatment minimizes the influence of this theory ) , as has been introduced by our team.7 it could be related to eye rubbing , although regular stability of the epithelial maps through long - term investigation also minimized the potential influence of this theory . finally , it appears that the specific epithelial pattern that is encountered in keratoconic eyes is directly related to the degree of biomechanical instability , and thus it may be linked to partial deformation of the cornea associated with blinking and eye rubbing , but more importantly we feel that normal oscillation of the cornea due to lateral and vertical oscillation of the eye and its possible inertia effect on the corneal biomechanics , during normal binocular fixation , reaching the astounding speeds of 900 degrees / sec.28,29 additionally possibly due to the fluid pulse wave reaching the cornea posteriorly through aqueous conduction and deriving from the arterial ventricular human heart pulse wave.10 partial normalization of the epithelial pattern following collagen cross - linking further supports this theory . the comprehensive investigation of epithelial thickness by as - oct in this work suggests high predictability of measurement in kcn patients . our previously reported finding of overall epithelial thickness in keratoconic eyes in comparison to normal when studied with high frequency ultrasound , has been confirmed with this technology as well . of particular diagnostic interest is the relation of this finding to lower / earlier stages of keratoconus or even preclinical keratoconus manifestation . the increase in topographic thickness variability and range , easily captured by the device studied , has been identified to be in very close correlation with severity of keratoconus . additionally the oct - derived epithelial topographic thickness variability and epithelial thickness range correlate remarkably with established scheimpflug imaging - derived anterior surface - irregularity indices for keratoconus . again of particular clinical significance , the interest would be this relation in lower / earlier keratoconus stages , or even when evaluating the fellow corneal collagen crosslinking has changed the therapeutic paradigm for keratoconus and ectasia , dictating vigorous work on the side of the clinician on early diagnosis and more sensitive progression detection . as cornea imaging modalities multiply , early detection and sensitive progression monitoring appears to redefine the traditional metrics used up until now . epithelial imaging has been probably greatly ignored up until recently , due to mainly the technical difficulty of its imaging capture , may become an easy and important clinical tool with the help of oct .

purposeto investigate epithelial thickness - distribution characteristics in a large group of keratoconic patients and their correlation to normal eyes employing anterior - segment optical coherence tomography ( as - oct).materials and methodsthe study group ( n=160 eyes ) consisted of clinically diagnosed keratoconus eyes ; the control group ( n=160 ) consisted of nonkeratoconic eyes . three separate , three - dimensional epithelial thickness maps were obtained employing as - oct , enabling investigation of the pupil center , average , mid - peripheral , superior , inferior , maximum , minimum , and topographic epithelial thickness variability . intraindividual repeatability of measurements was assessed . we introduced correlation of the epithelial data via newly defined indices . the epithelial thickness indices were then correlated with two scheimpflug imaging - derived as - irregularity indices : the index of height decentration , and the index of surface variance highly sensitive to early and advancing keratoconus diagnosis as validation.resultsintraindividual repeatability of epithelial thickness measurement in the keratoconic group was on average 1.67 m . for the control group , repeatability was on average 1.13 m . in the keratoconic group , pupil - center epithelial thickness was 51.757.02 m , while maximum and minimum epithelial thickness were 63.548.85 m and 40.738.51 m . in the control group , epithelial thickness at the center was 52.543.23 m , with maximum 55.333.27 m and minimum 48.503.98 m epithelial thickness . topographic variability was 6.073.55 m in the keratoconic group , while for the control group it was 1.590.79 m . in keratoconus , topographic epithelial thickness change from normal , correlated tightly with the topometric asymmetry indices of ihd and isv derived from scheimpflug imaging.conclusionsimple , oct - derived epithelial mapping , appears to have critical potential in early and advancing keratoconus diagnosis , confirmed with its correlation with established scheimpflug - derived asymmetry topometric indices .

You are an expert at summarizing long articles. Proceed to summarize the following text: tuberculosis ( tb ) continues to be a major cause of pleural effusion in developing countries such as india and the yield of cpb in tb effusion is 6691% in various series from india . a second biopsy increases the yield by 18% . in malignancy , the yield of cpb is 6386% . results from a randomized controlled trial from india shows that mt has a diagnostic yield of 86.2% with complication rate of 10.3% compared to the diagnostic yield of 62.1% and complication rate of 17.2% respectively in the cpb group . however , the hospital stay in the mt group was 9 days more than the cpb group . in this era when the practice of medicine is based on established guidelines , transthoracic ultrasound ( us ) is suggested routinely for the evaluation of pleural effusion . cpb should not be equated to blind pleural biopsy . for optimal safety and increased yield compared mt- and computed tomography ( ct)-guided abrams cpb for the diagnosis of patients with pleural effusions . there was no difference in sensitivities based on the cause of effusion and ct findings of pleural thickening . the sensitivities of various procedures for malignant pleural effusion were compared by koegelenberg et al . the sensitivity of us - guided cpb was 77% as compared to 95% in the case of thoracoscopy . when combined with the pleural fluid analysis , the sensitivities were 83% and 96% in cpb and thoracoscopy , respectively , a difference of only 13% . when we consider ct - guided biopsy , the difference between mt and cpb is only 6% . if the symptom profile is typical of tb and the analysis shows exudative lymphocytic pleural effusion with high adenosine deaminase ( ada ) or interferon , a presumptive diagnosis of tubercular pleural effusion can be made . if the fluid analysis is not typical for tb , then cpb would be a prudent first step . reusable abram 's pleural biopsy costs around 1,700 while the cost of rigid thoracoscope will be 5 lakhs and that of semi - rigid thoracoscope will be approximately 12 lakhs excluding the cost of monitor and processor . total cost that the patient will incur for the biopsy will be about 500 for cpb , whereas in thoracoscopy the cost may range from 15,000 to 70,000 as it requires hospitalization of the patient . mt in some centers is performed in operative theaters under general anesthesia , which further adds to the cost . it is customary to monitor the patient for 4 h before he / she is sent home . but mt needs hospitalization . it can vary from a few hours to many days . in some patients after introduction of the pneumothorax , the lung does not expand despite giving suction . if the tube is removed without lung expansion , there is a chance of reaccumulation and secondary infection . five supervised cpb procedures followed by five biopsy procedures per year are suggested to be adequate for competency , whereas the learning curve of mt is steep , with the recommendation of initial performance of at least 20 supervised procedures . the patient must also be stable to lie for at least 30 min in the lateral position . since one lung is collapsed during mt , the patient should have a stable cardiorespiratory status to withstand unilateral lung ventilation . hence , mt becomes a risky procedure in those with bilateral lung disease and cardiac failure . the chest tube needs to be connected meticulously to an underwater seal and care should be taken to keep the chest tube wound site , tubes , and collecting chamber sterile . repeated chest x - rays are necessary after mt till the lung expands and then the chest tube needs to be removed in a sterile manner by trained personnel . the patient has to return to the physician for suture removal after a few days . complications related to cpb include hydropneumothorax in 8% and bleeding in 2% of the patients . these are comparable to mt . it is interesting to remember that the incidence of hydropneumothorax after mt is 100% , although it is intentional ! mt is a much more painful procedure and requires more sedatives or analgesics as compared to cpb . in the largest series from india by maturu et al . , mt was associated with mortality rate and complication rate of 0.37% and 5.6% , respectively , whereas the complication rate in case of cpb was 8.3% with no mortality . given the advantages of cpb , mt should be reserved to select cases of exudative pleural effusion where the fluid analysis and cpb are noncontributory . we indian pulmonologists , especially keeping the economic factors in mind , should not fall for the glamor of mt though it is true that many pulmonologists in india are jumping on the bandwagon of mt and cpb is becoming a skill of the past . cpb has become what one of the authors has called victim of western advancement . in patients with undiagnosed exudative pleural effusion , performing cpb will provide the diagnosis in nearly 80% of the cases . only for the remaining 20% in whom cpb is nondiagnostic , the more invasive and costly intervention of mt should be considered . the delay in diagnosis in this small percentage of cases would only be a few days . evidence - based practice is the need of the hour . with evidence of cpb being easier and safe with a yield comparable to mt

closed pleural biopsy used to be a popular method of evaluation of pleural effusion . with the advent of thoracoscopy , this valuable method is being neglected . studies have shown that closed pleural biopsy especially done with image guidance has high yield and low complication rate as compared to thoracoscopy . given the ease of the procedure and the less cost involved , imaged guided closed pleural biopsy should be considered as the initial diagnostic step in undiagnosed pleural biopsy especially in developing countries with high prevalence of tuberculosis .

You are an expert at summarizing long articles. Proceed to summarize the following text: online continuing medical education ( cme ) for physicians can be carried out via telemedicine systems . telemedicine systems thus offer new ways to practice medicine and enable the remote delivery of personal health services , continuing medical education , and patient health education . an extensive international literature has reported on the efficacy of telemedicine [ 2 , 3 ] and clinical outcomes of telemedicine [ 46 ] . little attention has been paid to the benefit reported for practitioners [ 7 , 8 ] , despite this being a rationale for the use of telemedicine in rural and remote areas . physicians are reported to benefit from telemedicine by increased contact with specialists via the telecommunications system [ 6 , 7 ] . the appropriate use of online cme via telemedicine has the potential to contribute to the improvement in the population 's health through increased access upskilled health professionals and enhancing confidence of the rural health workforce . however , the provision of more online cme might crowd out the time that a physician can devote to medicine practice and thus worsen the health status of his or her patients . the relation between online cme and health may thus be nonmonotonic , and there could be an optimum amount of online cme that can achieve sustainable improvements in health . public health researchers use life expectancy at birth as a good proxy that reflects population 's health , and this is also used in the current study to evaluate variations in health . first , our outcome measure of life expectancy on the effects of online cme via telemedicine permits us to estimate the optimal provision of telecommunications health professionals . second , this study is among the first to integrate technology development and healthcare provision to highlight the effectiveness of online cme via telemedicine in sustainable health improvement . third , the telemedicine system in taiwan is a good model system that other countries can learn from when seeking to provide the accessibility and affordability of healthcare for rural residents as well as health professionals for remote physicians . this study thus aims to investigate what factors affect online cme provision in healthcare systems and what the optimal online cme lectures are for improving health . the telemedicine program provides real time teleconferencing , transfers medical data for consultation , and increases confidentiality of health workers and patients in remote areas . the cme lectures that are provided through the educational technology system may be affected by the healthcare system as a whole , including factors such as telecommunications and face - to - face programs used , as well as medical resource concerns , including per capita gross domestic product ( gdp ) and per capita national health expenditure ( nhe ) . the online cme that is provided could thus be a function of the following factors:(1)online cme = ftel . physicians spend time on cme activities to cover the full range of topics important to their professional development . research has shown that cme is an effective tool for changing physician practices and improving patient care [ 1012 ] . online cme thus aims to improve physician performance and the health status of their patients . there is a potential trade - off between online cme and other economic and healthcare factors that possibly affect health status . a rise in the lectures provided by online cme can affect health status through two channels . the first is the health crowding - out effect , whereby an increase in online cme lectures reduces activity with regard to other healthcare factors and the economy 's resources which might also improve health status . the second is the effects of health improvement , whereby an increase in online cme lectures tends to improve the quality of healthcare . the net effect of a rise in online cme lectures on health status thus depends upon the relative strength of these two channels . the relationship between online cme lectures and health status is possibly nonlinear , and this needs to be examined . healthcare provision through in - person and telecommunications systems has also unclear health effects , due to similar concerns . this research thus incorporates these ambiguous health effects and tries to find the optimal level of online cme lectures , as follows:(2)life exp.=1 online cmeit+2 online cmeit2+3xit+it , t=1,2, ,t ; i=1,2, ,n , where life exp . represents the population 's life expectancy , online cmeit represents the number of online cme lectures , online cmeit represents the square of the number of online cme lectures , it represents an idiosyncratic error term , and i and t represent hospitals and time period , respectively . the subjects of this study are to examine the following : ( 1 ) what factors foster learning processes in the cme context in telemedicine ? ( 2 ) what is the possible role of online cme in the context of health improvement ? and ( 3 ) how optimal learning processes can be integrated with various health services ? the results of this investigation can serve as paradigms for providing optimal online cme via telemedicine , thus improving the population 's health . in econometrics , panel data can contain multidimensional data and observations on multiple phenomena observed over multiple time periods for the same hospitals or patients . by applying telemedicine experiences in taiwan over the period 19952004 , this study uses panel data and the method of ordinary least squares for the multiple regression model with stata 10.0 ( stata corp . , college station , tx ) and aims to embed an adequate set of phenomena affecting the provision of online cme lectures versus health status . in taiwan , telemedicine services were first introduced in 1995 for physicians in remote sites in order to provide healthcare in rural areas . such services included online cme for physicians and special medical services for the elderly , the handicapped , and terminally ill patients at home . the national health insurance ( nhi ) system was established in the same year , and enrollees enjoy almost free access to healthcare , with only a small copayment in most clinics and hospitals . however , in 2004 , a telemedicine cost - benefit analysis conducted by the government cast doubt on the effectiveness of the system , and now its provision is limited to a number of qualitative pilot experiments . based on ( 1 ) , the possible factors affecting online cme lectures are telemedicine health services ( tel . care ) , per capita gross domestic product in us dollars ( per capita gdp ) , per capita national health expenditure in us dollars ( per capita nhe ) , and conventional health services ( con . services ) . based on ( 2 ) , we hypothesize that there is a nonmonotonic relationship between these variables and health status , which is represented by life expectancy ( life exp . ) . healthcare factors include the number of online cme lectures ( online cme ) , the square of the number of online cme lectures ( online cme square ) , telemedicine expenditure in us dollars ( tel . ex . ) , the square of telemedicine expenditure ( tel . ex . the economic factors are represented by per capita gross domestic product in us dollars ( per capita gdp ) . the panel datasets of dependent and explanatory variables are observed over the period 19952004 and are regarded as a national sample . the mentioned variables are collected from the ministry of health and welfare and the ministry of interior , taiwan . the panel data regression estimated results for the provision of online cme lectures and other selected variables are presented in table 2 . increases in conventional health services ( con . services ) and per capita national health expenditure ( per capita nhe ) are associated with increases in online cme lectures provided via telemedicine . this is because with higher incomes the use of cme lectures via telemedicine may be substituted by a synthesis of different types of knowledge , which can be seen as a form of continuous medical training . economic development is thus associated with decreases in the provision of online cme lectures . a 10% increase in the provided health services via telemedicine increases the provision of online cme lectures by 4.99% . the statistics for r and the adjusted r are 0.94 and 0.93 , respectively , and these indicate that the selection of variables is valid and the overall fit of the specification is good . based on ( 1 ) , apart from the provision of telemedicine services , the influences of con . services , per capita nhe , and per capita gdp are averagely specified by incorporating the mean values from table 1 into the constant term . the impact of telemedicine services on the provision of online cme lectures is estimated as ( 3)online cme lectures=1306.8 + 0.499 tel . care . based on the statistics provided in table 1 and ( 3 ) , by substituting the real and estimated telemedicine services for online cme lectures , figure 1 presents the positive relationship between telemedicine healthcare services and the provision of online cme lectures . this graph has an intercept on the vertical axis and shows that , even without telemedicine healthcare , the provision of online cme lectures through telecommunications should be at 1306.08 to meet physicians ' needs . to reach the telemedicine health services at 182.46 , which is the real level of provision , the number of online cme lectures should be increased to 1398 instead of the 1344.5 that is currently provided . the main concern of this study is to explore the influences of healthcare factors on health status and to find out the optimum of the online cme lectures that should be provided . the multiple regression results for the application of health status to selected variables are presented in table 3 and contain some interesting information . the statistics for r and the adjusted r are 0.99 and 0.99 , respectively , and indicate that the selection of variables is valid and the overall fit of the specification is good . online cme , conventional health expenditure and services , and per capita gdp all significantly affect health status . however , telemedicine expenditure , rather than the quantity of telemedicine services , affects health status . the explanation for this is that expenditure on the telemedicine system has the widespread effects , not only with regard to practicing medicine , but also for providing health consultations , and this can also lead to health improvements . the quantity of telemedicine services provided might thus not present the whole picture of such healthcare provision , and this may affect the health status insignificantly . nevertheless , the provision of in - person health services affects the health status negatively and significantly . fortunately , the magnitude of such effect is trivial . in a nation with an nhi system funded by government , the provision of unnecessary services is wasteful and may not help the population 's health . per capita gdp affects the health status negatively , and a 10% increase in per capita gdp leads to a 0.002% decrease in life expectancy at birth . higher incomes could lead to high pressure working and living conditions , and these are associated with worse health status , which implies the possibility of a health fast lane effect , with higher incomes being associated with worse health . we are interested in the nonlinear relationship between the provision of online cme lectures with health status . based on ( 2 ) , apart from the provided online cme lectures , the significantly influenced explanatory variables are averagely specified by the constant term , and the effects of provided online cme lectures on health status are estimated as(4)life exp . = 74.84 + 0.0010182 online cme2.56e07online cme2 . differentiating ( 4 ) , we find that the optimal online cme lectures provided via telemedicine are 1988.67 , with life expectancy at birth at 75.85 . the real online cme lectures provided are less than this , being 1344.5 , with life expectancy at birth at 75.75 . figure 2 presents the inverse u - shaped relationship between the number of online cme lectures provided via telemedicine and health status . this research has discussed the effective ways of online and telemedicine system of medical services as well as presents rationale and need for online cme and provides evidence of online cme effects on health improvement . subject investigated is current and relevant as governments decide to adopt and implement such mechanisms in technology and healthcare provision . moreover , to our knowledge , the existing literature has not discussed the health sustainability of online cme via telemedicine . increases in the provision of online cme lectures are not necessarily associated with better health status once the provision exceeds the optimal level . however , the results show that the real provision of online cme lectures in taiwan is currently too low . the contributions of cme , a major facilitator of changes in practitioner behavior , are currently underprovided due to difficulties in cme delivery at remote sites . moreover , the measures for health attainment could be partially viewed as being determined by the attainment of the appropriately providing online cme lectures . this research also finds that higher income could be associated with worse health , and health fast lane effects could explain fast rising health expenditures in developing and developed countries . telecommunications access is an increasingly important prerequisite to exploiting social , economic , and educational opportunities . evaluations of innovative technologies to support the provision of healthcare , such as telemedicine , have been centered on cost efficiency and the provider 's perspective [ 1618 ] . measuring and improving the wellbeing of the population is a means of assessing the progress of a society and thus should be a focus of governments . this study has evaluated the population 's health outcomes in order to measure the effectiveness of physician performance and thus respond to the currently inadequate provision of online cme lectures via telemedicine .

background . this research aims to investigate the quantitative relationship between telemedicine and online continuing medical education ( cme ) and to find the optimal cme lectures to be delivered via telemedicine to improve the population 's health status . objective . this study examines the following : ( 1 ) what factors foster learning processes in cme via telemedicine ? ( 2 ) what is the possible role of online cme in health improvement ? and ( 3 ) how optimal learning processes can be integrated with various health services ? methods . by applying telemedicine experiences in taiwan over the period 19952004 , this study uses panel data and the method of ordinary least squares to embed an adequate set of phenomena affecting the provision of online cme lectures versus health status . results . analytical results find that a nonlinear online cme - health nexus exists . increases in the provision of online cme lectures are associated with health improvements . however , after the optimum has been reached , greater provision of online cme lectures may be associated with decreasing population health . conclusion . health attainment could be partially viewed as being determined by the achievement of the appropriately providing online cme lectures . this study has evaluated the population 's health outcomes and responded to the currently inadequate provision of online cme lectures via telemedicine .

You are an expert at summarizing long articles. Proceed to summarize the following text: it could have been a good idea to replace diseased liver tissue by healthy hepatocytes in order to provide the metabolic power , which gets lost during liver damage from any kind of challenge viral , genetic , chemical intoxication , etc . , ( muraca , 2011 ; puppi et al . , 2011 ; hughes et al . , 2012 ) . this concept is based on the assumption that the hepatocyte represents the smallest functional unit of the liver executing all the single metabolic services as the liver does as a whole . indeed , hepatocyte transplantation has been proven feasible in animal trials and turned out to promise an alternative to liver transplantation in clinical settings . usually , in rodents cells are administered to the liver either via the splenic vein after injection into the spleen or via the portal vein . cells then spread with the blood stream over the entire organ and enter the parenchyma after endothelial penetration . they integrate and proliferate and there is huge experience in hepatocyte transplantation available from animal trials comprising acute and chronic liver disease models . provided that a mitotic challenge and a regenerative advantage is presented to the donor hepatocytes then significant or even nearly complete repopulation of the host liver might be achieved . yet , without this the rate of repopulation is rather low ranging at about 1% ( santoni - rugiu et al . , 2005 ; christ , 2006 ; weber et al . , 2009 ; shafritz and oertel , 2011 ) . there is doubt whether this is sufficient to supply the metabolic capacity needed to overcome the malfunction of the damaged host liver in clinical applications . an estimate of 15% of repopulating hepatocytes has been considered to suffice for the correction of a genetic metabolic defect of the liver ( fox and roy - chowdhury , 2004a ; lee et al . , 2004b ) . patients suffering from the defect of udp - glucoronosyltransferase ( crigler najjar - syndrome ; fox et al . , 1998 ) or of glucose-6-phosphatase ( glycogen storage disease type ia ; muraca et al . , 2002 ) improved after receiving human hepatocyte transplants at least for a transient period of time . thus , hepatocyte transplantation has also gained proof - of - concept in clinical trials , which is documented by more than 30 ongoing or published studies ( muraca , 2011 ; christ and brckner , 2012 ; hughes et al . , 2012 ) . there are 30% more patients on the waiting list for liver transplantation than actually receive the life - saving organ both in the united states and in europe indicating the scarcity of donor livers . it is self - evident that in this situation also livers to isolate primary hepatocytes for purposes of cell transplantation are scarce and , they are often marginal yielding hepatocytes of minor quality and insufficient quantity . hence , even if hepatocyte transplantation turned out a versatile alternative to liver transplantation the shortage of donor livers prompted the search for novel cell resources to generate hepatocytes or hepatocyte - like cells . it might be assumed that the principles of hepatocyte transplantation are also valid for these artificial hepatocytes in terms of cell transplant quantity , site of application , mode of action , principles of tissue integration , and finally therapeutic support in the short- and long - term range . this approach sounds rather straightforward and therefore it is worthy to talk about alternatives , which would aid to provide surgical potential in order to manage the bottleneck of donor liver availability both for organ and hepatocyte transplantation . tissue turnover is not the liver s most prominent quality under resting , i.e. , healthy conditions . with only 0.01% hepatocytes undergoing mitosis , 1966 ; koniaris et al . , 2003 ) . yet , in case of liver damage accompanied by massive hepatocyte loss the organ displays a remarkable regenerative potential . after two third partial hepatectomy the liver mass is restored after only about 12 weeks in rodents . the regenerative process is tightly regulated by a plethora of cytokines , hormones , factors , and their interactions . the initial response is triggered by the liver - resident macrophages , the kupffer cells , which engages the activation by tumor necrosis factor ( tnf- ) , components of the complement system ( c3a/5a ) , lymphotoxin , just to mention some of those best known until today . the kupffer cells then secrete the pro - inflammatory cytokine il-6 , which targets the hepatocytes and activates the canonical il-6-signaling pathway involving gp130-mediated dimerization of stat3 and the downstream activation of il-6 target genes . this so - called priming phase initiates hepatocyte proliferation involving a second set of factors comprising hepatocyte growth factor ( hgf ) and epidermal growth factor ( egf ) receptor ligand family such as transforming growth factor ( tgf- ) , heparin - binding egf - like growth factor and amphiregulin . hepatocyte proliferation continues until the original mass of the liver is restored ( fausto and campbell , 2003 ; michalopoulos , 2007 , 2010 ; riehle et al . , 2011 ) . yet , there is evidence that hepatocytes may not only generate hepatocytes but may also differentiate into other liver cell types such as biliary epithelial cells ( michalopoulos et al . , 2005 ) or pancreatic cells ( horb et al . hence , hepatocytes themselves fulfill the basic criteria of stem cells , the self - renewal and multiple differentiation potential giving rise to progeny of at least two different lineages . the liver contains a parenchymal back - up compartment , which is activated under injury conditions preventing mature hepatocyte proliferation and/or causing hepatocyte replicative senescence . experimentally , such situations may be provoked in rodents by feeding a choline - deficient diet in combination with the administration of acetylaminofluorene ( aaf ) or ethionine , by galactosamine or dipin combined with partial hepatectomy to mention a few ( koniaris et al . , 2003 ; santoni - rugiu et al . , 2005 ; shafritz and oertel , 2011 ) . liver progenitor cells called oval cells in rodents emerge in the periportal areas of the liver lobule comprising the canals of hering , structural links between the terminal biliary branches and the periportal hepatocytes surrounding the proximal parts of the sinusoids . under healthy conditions oval cells are rare and hardly detectable . it is widely agreed upon that the oval cells are the bipotent progeny of hepatic stem cells , of which their real nature and existence in the adult liver has still to be substantiated ( sell , 2001 ; fausto , 2004 ; kofman et al . , 2005 ; santoni - rugiu et al . , 2005 ; but , due to similar marker gene expression patterns it has been proposed that there might exist a precursor / product relationship between the embryonic hepatoblasts and the oval cells ( fausto and campbell , 2003 ) . in humans hepatic progenitor cells , perhaps equivalent to the oval cells in rodents , appear in the pathophysiological situations of viral hepatitis , liver cancer and massive drug intoxication ( roskams et al . , 2004 , 2010 ) . injuries occurring under these conditions provoke so - called ductular reactions , of which the hallmark is the appearance of transit amplifying cells , the progeny of hepatic progenitor cells residing in the liver stem cell niche , the canals of hering ( roskams et al . hepatic progenitor cells may be identified based on the expression of cytokeratin 7 ( ck7 ) , epithelial cell adhesion molecule ( epcam ) , neural adhesion molecule , and cd133 ( alison et al . , 2009 ; the cells of the ductular reactions display an intermediate immunophenotype featuring both biliary and hepatocyte marker expression . there is emerging evidence that the etiology of the liver disease may imprint the phenotype of the cells of the ductular reaction indicating their bipotent differentiation capacity , but which may also be the result of stimulation of different hepatic stem cell niches or the differential activation of one and the same niche under different hepatic injury conditions ( van den heuvel et al . indeed , active notch signaling seems to specify cholangiocyte differentiation whereas this pathway must be shut off for hepatocyte differentiation , which , however , requires in addition active wnt signaling ( spee et al . in recent times it became obvious that hepatic stem cells might also derive from extrahepatic sources such as the bone marrow . in the animal model of fumarylacetoacetate hydrolase ( fah ) deficiency featuring human tyrosinemia type i transplantation of hematopoietic stem cells ( hsc ) resulted in the rescue of the disease phenotype in the mouse liver due to the generation of hsc - derived functional hepatocytes ( lagasse et al . oval cells were also attributed to be of bone marrow origin ( petersen et al . , 1999 ; alison et al . , 2000 ; theise et al . , 2000 ) . yet , not differentiation of the hsc into hepatocytes but rather fusion with host hepatocytes was the product of donor cell - derived hepatocytes ( petersen et al . , 1999 ; alison et al . , 2000 ; theise et al . , 2000 ; alvarez - dolado et al . , 2003 ; vassilopoulos et al . , 2003 the bone marrow harbors mesenchymal stem cells ( msc ) , which are cd34- and cd45-negative indicating their non - hematopoietic nature . they feature multiple differentiation potential including lineage commitment into cells of all three germ layers ( pereira et al . , 1995 ; their hepatocyte differentiation capacity in vitro and in vivo has been demonstrated and because of their easy availability and low ethical risks msc have become an attractive cell source for clinical cell therapy approaches including cell therapy of liver diseases ( see below ) . there is great hope in induced pluripotent stem cells ( ips ) , which were generated first in mice from somatic cells complemented with the so - called pluripotency factors , oct4 , sox2 , klf4 , and c - myc re - programming the cells into an embryonic stem cell - like genotype ( takahashi and yamanaka , 2006 ) . one prominent feature of these cells is their pluripotent differentiation capability , which comprises differentiation into cells from the three germ layers such as cardiomyocytes , adipocytes , neurons , hematopoietic precursors , osteoclasts , pancreatic cells ( for recent reviews cf . ; hanna et al . , 2010 ; okita and yamanaka , 2011 ; bilic and belmonte , 2012 ) . endodermal differentiation includes also hepatocyte differentiation ( yagi et al . , 2009 ; ghodsizadeh et al . introduction of the factors is achieved by viral , chemical , and dna - mediated delivery . all of these methods raise safety concerns , which in addition to the tendency of the ips to form teratoma , restrict the clinical use of these cells so far . however , first liver repopulation experiments in mice demonstrated the high regenerative potential of ips ( espejel et al . , 2010 ) , which certainly opens a clinical perspective . this is highly relevant since application of cells of autologous origin back to the patient avoids the long - term risks associated with immunosuppression . thus , in summary liver regeneration might be accomplished by liver stem cells either of intrinsic origin or from extrahepatic sources like bone marrow ( msc ) or any somatic cell . artificial hepatocytes from stem cells for clinical hepatocyte transplantation ( fox and roy - chowdhury , 2004b ) . one feasible alternative to human adult hepatocytes is the use of hepatocytes derived from human msc . experiments in rats ( wang et al . , 2004 ; lange et al . , 2005 ) , mice ( jiang et al . , 2002 ) , and humans ( schwartz et al . , 2002 ; lee et al . , 2004a ; hong et al . , 2005 ; seo et al . , 2005 ; talns - visconti et al . , 2006 ; . , 2007 ) confirmed the in vitro differentiation potential of msc from prominent sources like bone marrow or adipose tissue . in the following we will reference some of the studies using msc in order to indicate their versatile application in animal models of different liver diseases . cultured bone marrow - derived msc from male albino rats were infused into the tail vein of female rats treated with carbontetrachloride ( ccl4 ) to induce liver fibrosis . y chromosome - positive donor cells were found in the female host liver exhibiting reduced collagen depositions and improved liver functions ( abdel aziz et al . , 2007 ) . attenuation of ccl4-induced liver fibrosis was also demonstrated using hepatocyte - like cells differentiated from bone marrow - derived msc in the rat ( oyagi et al . , 2006 ) . undifferentiated human bone marrow - derived msc attenuated acute liver injury induced by allyl alcohol in sprague dawley rats ( sato et al . , 2005 ) . hepatic integration and function of human adipose tissue - derived msc pre - differentiated into hepatocyte - like cells prior to transplantation was shown both in ccl4-treated mice ( seo et al . , 2005 ; banas et al . , 2007 ) and rats after partial hepatectomy ( sgodda et al . , 2007 ) . not surprisingly , hepatocyte pre - differentiated msc were more effective as compared to their undifferentiated precursors . in the hepatectomized scid mouse model bone marrow - derived msc pre - differentiated into hepatocyte - like cells in vitro xenografted to the mouse livers and expressed hepatocyte markers such as albumin and ck18 ( lysy et al . , 2008 ; aurich et al . , mscs engrafted predominantly in the periportal portion of the liver lobule displaying hepatocyte - specific features like glycogen storage and expression of phosphoenolpyruvate carboxykinase , connexin32 , albumin , and the human hepatocyte - specific antigen heppar1 ( aurich et al . , 2007 ) . in summary , irrespective of the site of application , i.e. , systemic infusion , intrahepatic injection , intrasplenic delivery , or portal vein infusion msc were found in the liver of the host animal forming clusters of donor cells . these cells were functional in terms of expression of specific markers and secretion of albumin . in the case of acute and chronic liver architecture deterioration msc improved the disease . both undifferentiated and hepatocyte - differentiated msc integrate functionally into the host liver but at significant higher rates using differentiated cells . facing the fact that functional characterization of msc - derived hepatocyte - like cells after transplantation is fragmentary at best , is it then reasonable to use msc in clinical applications ? in the following section animal studies will be exemplified to delineate critical aspects of potential safety concerns before translation of msc - based hepatocyte transplantation into the clinics . these include site of administration , distribution , bioavailability , elimination , and tumorigenicity . msc display migratory competence . after systemic application they migrate to inflammatory sites attracted by chemokines liberated from the regions of tissue injury . intrasplenic and hepatic injection have been chosen as the sites primarily used for transplantation of adult hepatocytes . it may be anticipated that a portion of injected cells resides in the spleen , which provides an acceptable tissue environment for adult hepatocytes to survive , proliferate , and execute hepatocyte - specific functions without systemic side effects ( kusano and mito , 1982 ) . very likely the mechansims of hepatic integration of stem cell - derived hepatocytes is similar or even equal to that of adult hepatocytes as discussed above . transplanted hepatocytes mainly engraft in the periportal regions of the liver lobule and acquire the gene expression pattern of periportal hepatocytes ( aurich et al . , 2005 ) . however , shifting transplanted hepatocytes into the perivenous areas by treatment with carbontetrachloride resulted in the change from a periportal to a perivenous hepatocyte expression pattern in these cells . this indicates that the hepatic microenvironment governs the differentiation state of transplanted cells directing position - specific gene expression ( gupta et al . , 1999 ; intraportal infusion of hepatocytes resulted also in entrapment of cells passaged through the liver into the lung parenchyma of new zealand rabbits ( schneider et al . , virtually all hepatocytes were cleared from the pulmonary capillaries within 24 h ( rajvanshi et al . , 1999 ; schneider et al . , 2003 ) . hepatic engraftment after transplantation of human bone marrow - derived msc into the spleen or the liver was similar in scid mice ( lysy et al . , 2008 ) . as mentioned above msc - derived hepatocyte - like cells both after intrasplenic and portal administration were found in the periportal areas of the liver lobule where they featured typical characteristics of periportal hepatocytes 10 weeks post - transplant ( aurich et al . principally , undifferentiated msc may contribute to the formation of most if not all somatic cell types . donor cells were found in hematopoietic organs and in the epithelia of the lung , liver , and gut ( jiang et al . , 2002 ) . injection of undifferentiated murine bone marrow - derived msc into the tail vein of nod / scid mice resulted in engraftment of donor cells into gastrointestinal organs but also in the lung and skin ( anjos - afonso et al . , 2004 ) , a result , which was also demonstrated after intravenous application of undifferentiated bone marrow msc into baboons ( devine et al . , 2003 ) . taking advantage of the permissive milieu of tissues and organs during organogenesis , fetal sheep were transplanted i.p . with human bone marrow - derived msc , which integrated and differentiated into blood , liver , and skin cells ( almeida - porada and zanjani , 2004 ) . intrahepatic versus intraperitoneal injection of human msc improved the percentage amount of human hepatocytes in sheep livers by fivefold ( chamberlain et al . , 2007 ) . it may be concluded that under minimal injury conditions as in the models described here msc may give rise to cell types of different tissues and organs but that hepatic injury leads primarily to engraftment in the liver . hence , it is very likely that msc , both native and hepatocyte - differentiated home to the liver without significant extrahepatic tissue colonization . there is evidence that msc might contribute to extrahepatic manifestation of cancer or even liver cancer . it is a generally accepted concept that mature differentiated cells in a tissue originate from multipotent stem cells via tissue - specific stem and/or progenitor cell differentiation . tumorigenic transformation at each step of this one - way lineage leads to loss of the differentiated phenotype and may give rise to a putative cancer ( stem ) cell developing into tumors of the respective tissues ( cf . ; martnez - climent et al . , 2006 ; polyak and hahn , 2006 ; ailles and weissman , 2007 ; wu , 2008 ; for recent reviews ) . common properties of both tissue - specific stem cells and tumor ( stem ) cells are their potential of self - renewal , differentiation , and gene expression signatures supporting the abovementioned concept . thus , any mutational event given will cause expansion of stem / progenitor cells normally quiescent in the healthy tissue thereby increasing their propensity to tumor development . the tumor stroma contains mesenchymal cells ( mtc ) with an invasive phenotype contributing to neoangiogenesis , which they share with msc . thus , similar morphological and immunological features , as well as the expression of a common set of stemness signature genes might indicate the risk of the therapeutic use of mscs under tumor - promoting conditions ( studeny et al . there is controversy whether or not somatic stem cells are involved in hepatocarcinogenesis ( wu and yu , 2007 ) . however , in a transgenic mouse model of hepatocellular cancer ( hcc ) induced by diethylnitrosamine and phenobarbital bone marrow cells did not progress to hcc ( ishikawa et al . , 2004 ) . similar results were found in non - transgenic balb / c mice after chemical induction of hcc by diethylnitrosamine ( zheng and liang , 2008 ) . in the lewis rat , bone marrow - derived stem cells were recruited to the liver after feeding a choline - deficient diet , fused with hepatic oval cells but did not contribute to pre - neoplastic nodule formation ( kubota et al . , 2008 ) . numerous studies have since shown hepatogenic differentiation from both hematopoietic and msc without cellular fusion in a variety of different animal disease models ( ishikawa et al . , 2003 ; newsome et al . , 2003 ; jang et al . , 2004 ; sato et al . , 2005 ) . thus , even under conditions favoring tumorigenesis in the liver , no contribution of msc to tumor formation in the liver has been reported so far whatever site of application or carcinogen was being used . most of the studies described above applied msc not pre - differentiated into hepatocyte - like cells prior to hepatic transplantation . in a murine melanoma model ectopic administration of allogeneic msc showed that msc after chondrogenic differentiation did not display migratory activity and reduced the promotion of tumor growth while undifferentiated msc migrated to the site of the tumor and favored tumor growth and metastasis ( akay et al . , 2010 ) . it seems to be a general feature of undifferentiated msc to be recruited to the tumor stroma as shown previously in a culture model of human glioblastoma ( birnbaum et al . , 2007 ) . nevertheless it can not be excluded that msc promote tumor growth indirectly due to their propensity to form progenitor cells of tumor vessels exemplifying the pro - angiogenic properties of msc ( kinnaird et al . , 2004 ) and/or stromal - fibroblast like cells thus impacting the tumor stroma and supporting tumor growth ( huss et al . , 2004 ; there is also evidence that msc by producing anti - inflammatory molecules reduce pancreatic tumor growth ( zischek et al . , 2009 ) . on the other hand the immunosuppressive features of undifferentiated msc might favor tumor growth and metastasis as shown in rodent animal models ( djouad et al . thus , the current knowledge does not allow for the safe use of msc in clinical settings at least in terms of tumorigenicity . therefore , investigations in large animal models of liver diseases like in the pig are appreciated to study the behavior of msc under the given environment produced by the specific disease . in recent times pig models for isolation and transplantation of msc became available ( casado et al . , 2012 ) , which now allow for the evaluation of both the therapeutic and the potential side effects of msc as close as possible to the human situation ( shi et al . , 2010 ; groth et al . , 2012 ; li et al . , 2012 ) . due to their specific properties like low immunogenicity and promotion of anti - inflammatory responses msc act immunomodulatory ( djouad et al . , 2003 ; krampera et al . , 2007 ; newman et al . , 2009 ) . the application of allogeneic msc does not provoke an immune response in vitro or in vivo . this might be partially due to the expression of intermediate levels of hla class i antigens and lack of expression of hla class ii antigens on the cell surface ( di nicola et al . , 2002 ; le blanc et al . , 2003 ; klyushnenkova et al . , 2005 ; sotiropoulou et al . , the msc - mediated immune modulation mechanistically varies depending on the immune cell type affected ( meisel et al . , 2004 ; aggarwal and pittenger , 2005 ; nasef et al . , 2007 ; feng and chen , 2009 ; siegel et al . , 2009 ) . msc interact with dendritic cells ( dc ) as well as with t - cells , b - lymphocytes , and with nk cells ( aggarwal and pittenger , 2005 ; nauta and fibbe , 2007 ; noel et al . , 2007 ; stagg and galipeau , 2007 ) . they modulate generation , activation as well as function of dc at different levels of differentiation ( jiang et al . , 2005 ; nauta et al . , they inhibit the maturation and migration of dc to the lymph nodes and the secretion of tnf- by dc ( krampera et al . , 2006 ; spaggiari et al . , 2006 ; nasef et al . , 2007 ; ramasamy et al . , 2007 recent studies identified two different functional types of msc . depending on the prevailing conditions immunosuppressive msc or immunogenic msc may be distinguished . in the presence of pro - inflammatory cytokines like tnf- and interferon - gamma ( ifn- ) the immunosuppressive phenotype of msc is favored . if anti - inflammatory cytokines like il-10 are predominant the suppressive effect of msc is abrogated ( renner et al . , 2009 ) . depending on the level of ifn- msc furthermore exhibit antigen - presenting properties ( chan et al . , 2006 ) . differentiated msc promoted human dc maturation by stimulation of cd38 expression on the dc and upregulation of b7 expression on msc . yet , osteogenic , chondrogenic and adipogenic differentiation did not alter the immunosuppressive properties of msc ( chen et al . , 2007 ) , which supported the conclusion that msc , undifferentiated , or differentiated , may be accepted even by hla - incompatible patients . msc attenuate secretion of major pro - inflammatory cytokines like tnf- and ifn- and thus reverse tissue inflammation , which is supported by an increased expression of the immunosuppressive cytokines il-10 and tgf- secreted by the msc ( krampera et al . this would explain the anti - inflammatory features of msc ( di nicola et al . , 2009 ; newman et al . , 2009 ; mao et al . , 2010 ) . immunosuppressive and anti - inflammatory effects of msc may be mediated on the molecular level by heme oxygenase ( ho-1 ) and inos ( munn et al . , 1998 ) , indoleamine 2,3-dioxygenase ( ido ) preventing the t - cell response through tryptophan depletion ( aggarwal and pittenger , 2005 ) or prostaglandin e2 ( pge2 ; bartholomew et al . , 2002 ; aggarwal and pittenger , 2005 ; beyth et al . , 2005 ; le blanc and ringden , 2005 ; yanez et al . , so far major attempts are under way to apply msc for the prevention of graft versus host disease ( gvhd ) , rejection of organ transplants and for modulation of inflammation in general . it may be concluded that msc may play a pleiotropic role impacting a given disease by a specified mode of action , which is triggered by the diseased tissue environment . this includes tissue regeneration through substitution of the tissue lesion by functional cells differentiated from the msc but also modulation of an inflammatory tissue environment thus improving or stimulating self - regeneration of the affected tissue . these pleiotropic mode of action is highly appreciated to treat liver diseases of different etiology . acute or chronic liver injuries require the down - regulation of inflammatory processes in order to prevent progressing tissue damage whereas ample liver resection due to liver cancer might require substitution of functional loss . hence , in the one case undifferentiated msc might represent the cell source of choice while in the latter hepatocyte - differentiated msc might be appreciated . it must be anticipated that nearly all tissues harbor msc , which upon tissue injury proliferate and differentiate into the cells of the tissue of origin to replace and functionally regenerate the injured tissue regions . recently , msc - like cells have even been isolated from adult human liver ( najimi et al . , 2007 ; covas et al . , 2008 ) and liver grafts ( pan et al . , 2011 ) suggesting that these cells might contribute to tissue repair after hepatic injury . so why not use msc for allogeneic stem cell transplantation in liver diseases ? as outlined above this concept has widely been proven in animal models of a great variety of different liver diseases , and indeed , finds increasing interest to progress into clinical translation . liver cirrhosis is characterized by the irreversible deterioration of the liver s architecture resulting in the formation of regenerative nodules , which are separated by fibrotic septae . it may progress to liver cancer and/or liver failure with a very high incidence of mortality . msc have been shown to ameliorate liver fibrosis in mice and rats , which was likely due to the reduction of collagen synthesis and the induction of expression of metalloproteinases , the major players in matrix degradation and remodeling ( parekkadan et al . , 2007 ; banas et al . , 2008 ; acute liver failure is a highly inflammatory response of the liver to exogenous toxic insults , which is characterized by parenchymal dysfunction leading to systemic organ failures due to the lack of metabolic homeostasis normally provided by the healthy liver . the disease requires intensive care and like liver failure due to chronic dysfunction bears a high risk of mortality ( ostapowicz and lee , 2000 ; gill and sterling , 2001 ; rahman and hodgson , 2001 ; ogrady , 2005 ) . taking advantage of the anti - inflammatory , anti - apoptotic , and pro - proliferative features of msc it has been shown in animal models that the cells attenuated acute liver failure by inhibition of inflammatory infiltration , reducing the rate of cell death , by increasing tissue recovery through stimulation of hepatocyte proliferation , and finally by augmenting survival rate ( parekkadan et al . , 2007 ; van poll et al . , 2008 ; zagoura et al . , 2012 ) . these encouraging results from animal studies prompted clinical application of msc in chronic and acute liver failure . however , so far there is only limited information available on the clinical outcome . in patients suffering from decompensated liver cirrhosis treatment with umbilical cord - derived msc reduced ascites volume and improved liver function in the short - term range ( kharaziha et al . , 2009 ; zhang et al . , 2012 ) and patients with end - stage liver failure improved in terms of ascites volume reduction and improvement in child score after autologous bone marrow - derived msc transplantation ( amer et al . , 2011 ) . these phase i / ii clinical trials demonstrated safety of hepatic msc transplantation at least under these indications but efficacy still awaits confirmation . even if some clinical parameters might improve , the fate and long - term survival of the transplanted cells in the host liver , their mode of action , and finally safety in the long - term range have to be demonstrated . it is likely that depending on the etiology and pathophysiology of the liver disease to be treated msc act differently according to their pleiotropic spectrum of action . thus , the anti - inflammatory , anti - apoptotic , and pro - proliferative features of msc might be favorable in cases of chronic inflammatory liver diseases but in addition a functional tissue replacement is warranted in cases where massive tissue loss has to be substituted to provide sufficient metabolic capacity like in acute liver failure and huge liver resections . therefore , it is necessary to understand the impact of msc both on the molecular and cellular level and their interactions with the host liver tissue under a given microenvironment as created by the diseased liver . it might also be thought to use msc in combination with primary human hepatocytes to either support hepatocyte function and moreover to minimize immunological rejection of the transplant in the short - term range taking advantage of the immunosuppressive features of msc ( stutchfield et al . , 2010 ) . this could help to bridge the patient to liver transplantation and even through the critical phase of acute liver failure until the host liver recovers from the acute insult . this is of high interest because this setting would enable allogeneic hepatocyte transplantation avoiding long - term immunosuppression with all the known undesired adverse effects . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

mesenchymal stem cells represent an alternate cell source to substitute for primary hepatocytes in hepatocyte transplantation because of their multiple differentiation potential and nearly unlimited availability . they may differentiate into hepatocyte - like cells in vitro and maintain specific hepatocyte functions also after transplantation into the regenerating livers of mice or rats both under injury and non - injury conditions . depending on the underlying liver disease their mode of action is either to replace the diseased liver tissue or to support liver regeneration through their anti - inflammatory and anti - apoptotic as well as their pro - proliferative action .

You are an expert at summarizing long articles. Proceed to summarize the following text: a ductal adenocarcinoma is the most common tumor developing from the extrahepatic bile duct ( 1 ) . benign tumors of the extrahepatic biliary duct are extremely rare , and include adenomas and tumors of the supporting structures such as leiomyomas , lipomas , carcinoids , and fibromas . schwannomas occurring in the soft tissues of the head and neck , extremities and retroperitoneum can also develop in the extrahepatic biliary duct due to the abundant anastomotic network of sympathetic and parasympathetic nerve fibers and blood vessels from branches of the hepatic and gastroduodenal arteries ( 2 ) . we describe the first case of schwannomas arising in the extrahepatic bile duct in korea , which presented as intra- and extrahepatic bile duct and gallbladder stones . a 64-yr - old female patient was referred for a surgery for intrahepatic duct and gallbladder stones detected on a screening program . she had no previous history of any other major illness . her vital signs were as follows : blood pressure , 140/ 70 mmhg ; pulse rate , 72/min ; respiratory rate , 22/min ; and body temperature , 36. there was no evidence of jaundice or abdominal pain . the laboratory studies revealed : leukocyte count , 8,230/l ; hemoglobin , 15.7 g / dl ; total protein , 7.0 g / dl ; total albumin , 3.8 g / dl ; total bilirubin , 0.6 mg / dl ; direct bilirubin , 0.2 mg / dl ; serum asparate aminotransferase , 19 iu / l ; serum alanine aminotransferase 14 iu / l ; serum lactate dehydrogenase 298 iu / l ; serum alkaline phosphatase , 57 iu / l ; and serum gamma - glutamyl transpeptidase , 51 iu / l . the tumor markers including cea and ca 19 - 9 were within normal ranges . the abdominal computed tomography ( ct ) scan revealed that the intrahepatic bile ducts were slightly dilated and contained stones . the gallbladder was also filled with many small stones . however , the distal part of the common bile duct and pancreas were normal ( fig . endoscopic retrograde cholangiography revealed a threadlike stricture at the proximal part of the common bile duct and a dilatation of the upstream intra- and extrahepatic bile ducts with abundant stones . in addition , the gallbladder was filled with small stones , and the cystic duct was inserted aberrantly into the right intrahepatic bile duct ( fig . surgery was planned because it was believed the intrahepatic duct stones were caused by the stricture . the pathology findings of the surgical specimens showed several well - demarcated nodules in the bile ductal wall and an intact mucosal epithelium of the bile duct . microscopically , the tumors were mainly composed of spindle - shaped cells arranged in short bundles or interlacing fascicles with nuclear palisading ( fig . 3d ) , but were negative for cd 34 , cd 117 , and actin . the postoperative course was uneventful , and the patient has been doing well without any complications . schwannomas are benign neurogenic tumors that arise in the nerve sheaths of the peripheral nerves in young to middle - aged adults . they can occur almost anywhere in the body but have a predilection for the head , the neck , and the flexure surfaces of the upper and low extremities . they can sometimes show secondary degenerative changes such as cyst formation , calcification , hemorrhage , and hyalinization ( 3 ) . schwannomas arising in the digestive tract are quite rare , and occur most commonly in the stomach , followed by the colon and rectum ( 4 , 5 ) . schwannomas of the biliary tract can also develop because there is an abundant network of sympathetic and parasympathetic nerve fibers to the wall of the gallbladder and bile duct . however , schwannomas clinically arising in the biliary tract are extremely rare , and an extrahepatic bile ductal origin is the rarest . to our knowledge , only five cases of schwannomas involving the extrahepatic biliary duct have been reported ( 6 - 10 ) . first , it was found incidentally on health screenings while others mainly presented with obstructive jaundice . secondly , the present tumor was shown to be associated with intra- and extrahepatic bile duct stones , which were grossly pigmented stones . it seemed that bile stasis resulting from mechanical obstruction was an important antecedent to the development of pigment gallstones ( 11 ) . thirdly , our case manifested uniquely as a plexiform or multinodular growth similar to a plexiform neurofibroma . histologically , schwannomas originating in the digestive tract show distinct histological features that distinguish them from conventional schwannomas . these schwannomas are s-100 protein - positive spindle cell tumors that are composed mainly of cellular ( antoni a ) areas , and generally do not show a nuclear palisading pattern that is usually found in conventional schwannomas of the soft tissues ( 6 , 12 ) , moreover , schwannomas of the digestive tract were recently reported to lack neurofibromatosis-2 genetic alterations , which support the theory that schwannomas of the digestive tract are unique tumors distinct from conventional schwannomas ( 13 ) . in our case , the tumors showed a dominant antoni a area , but had a nuclear palisading pattern . more cases are needed to determine the pathological correlation between a biliary schwannoma and other digestive schwannoma . schwannomas usually appear in ct as a homogenous mass with heterogeneous contrast enhancement and often show secondary degeneration such as a cystic change , cavity formation , necrosis , or calcification . however , secondary degeneration rarely occurs in schwannomas of the digestive tract ( 14 ) . in our case , magnetic resonance imaging ( mri ) might also be useful to establish the nature of the tumor . the mri findings of schwannomas are mainly masses with low signal intensity on the t1-weighted images and inhomogeneous high signal intensity on the t2-weighted images ( 15 ) . schwannomas of the digestone tract have an excellent prognosis after a surgical resection , similar to conventional schwannomas , and there is no evidence to date that these tumors have a malignant potential . in conclusion , biliary schwannomas causing a biliary stricture are extremely rare and a preoperative diagnosis is quite difficult . however , these potentially curable tumors should be included in the differential diagnosis of tumors arising in the biliary system .

benign schwannomas arise in neural crest - derived schwann cells . they can occur almost anywhere in the body , but their most common locations are the central nervous system , extremities , neck , mediastinum , and retroperitoneum . schwannomas occurring in the biliary tract are extremely rare and mostly present with obstructive jaundice . we recently experienced a case of extrahepatic biliary schwannomas in a 64-yr - old female patient who presented with intra- and extrahepatic bile duct and gallbladder stones during a screening program . to the best of our knowledge , extrahepatic biliary schwannomas associated with bile duct stones have not been reported previously in the literature .

You are an expert at summarizing long articles. Proceed to summarize the following text: the larval stages ( metacestodes ) of several taeniids of carnivores represent aetiological agents of alveolar echinococcosis ( ae ) , caused by echinococcus multilocularis , cystic echinococcosis ( ce ) , caused by echinococcus granulosus sensu lato , and cysticercosis , caused e.g. by taenia crassiceps or taenia martis affecting mammals including rodents , ungulates and primates . ae is a zoonotic disease that is widely distributed in the northern hemisphere and is emerging in large parts of europe and asia ( torgerson et al . , 2010 , gottstein et al . , 2015 ) . the life cycle of e. multilocularis is maintained in europe by rodents ( eg , arvicola spp . , myodes spp . ) , which act as intermediate hosts , and red foxes ( vulpes vulpes ) , which are the most important definitive hosts . in addition , wild canids , like raccoon dogs ( nyctereutes procyonoides ) , and pet animals , such as domestic dogs , can contaminate the environment with e. multilocularis eggs ( eckert et al . , 2011 , conraths and deplazes , 2015 ) . in addition to humans , also a variety of other primates occasionally develop ae , predominantly in the liver . several cases of fatal ae have been diagnosed worldwide in gorillas ( gorilla gorilla ) ( kondo et al . , 1996 ) , an orangutan ( pongo pygmaeus ) ( taniyama et al . , 1996 ) , macaca spp . tappe et al . , 2007 ) , a diana monkey ( cercopithecus diana ) ( yamano et al . , 2014 ) and lemurs ( kondo et al . , 1997 , deplazes and eckert , 2001 , sato et al . , 2005 , 2013 ) . in switzerland , wenker and hoby ( 2011 ) diagnosed seven cases of ae in western lowland gorillas in basel zoo . furthermore , three chimpanzees ( pan troglodytes ) , five white - handed gibbons ( hylobates lar ) and two squirrel monkeys ( saimiri sciureus ) located in the walter zoo , a private zoo in eastern switzerland , were recently found to be infected ; all infections were confirmed at necropsy and in all animals except one chimpanzee ae was found to be the cause of primary disease . cystic echinococcosis ( ce ) is a globally distributed zoonosis with high burden of disease ( budke et al . , 2006 ) . in southern europe , e. granulosus sensu stricto ( genotypes 13 ) , with a typically dog - sheep cycle predominates , whereas in the eastern parts of central europe ( baltic countries , poland ) , echinococcus intermedius ( echinococcus canadensis , pig strain , g7 ) , maintained by a dog - pig cycle , is endemic ( bruinskait et al . , 2009 ) . in zoos , ce has been diagnosed and published in different primates ( boufana et al . , 2012 , there was one positive diagnosed great ape ( orangutan ) ( grimm f , personal communication ) . bernstein ( 1972 ) described six cases of cystic echinococcosis ce in orangutans in a zoo in california . a zoo - born chimpanzee had a perforation of the abdominal wall due to ce , and a gorilla reacted sero - positive to echinococcus granulosus . rare cases of carnivore - transmitted cysticercosis caused by , for example , t. crassiceps ( heldwein et al . , 2006 , flammer et al . , 2014 ) and t. martis ( brunet et al . , 2015 , eberwei et al . , 2013 ) , have been documented in people in europe . furthermore , several lethal t. martis ( brunet et al . , 2014 , de liberato et al . , 2014 ) and t. crassiceps infections were reported recently for lemurs in zoos ( luzon et al . , 2010 ) . captive animals can come in contact with faeces of free roaming wild or captive definitive hosts of taeniid spp . in endemic areas as fences do not prevent completely intrusion of foxes in wildlife parks ( umhang et al . , 2016 ) ; in addition , food contaminated with eggs is , arguably , another probable route of infection for primates kept in zoos . in the zoo basel , direct contact to the definitive hosts can be excluded and other routes of infection have to be evaluated . faecal contamination of vegetables and fruit can occur under various circumstances during production , manufacturing , storage or transport if they are produced in conditions that allow faecal contaminated waters to be used for irrigation or washing , or if the soil is contaminated . vegetables from such sources , if consumed raw and insufficiently washed , can be a potential source of parasitic disease ( slifko et al . , 2000 ) . cultivation in open fields , where wild animals have access , increases the risk of contamination , especially since taeniid eggs can remain viable for several months , if conditions ( humidity , temperature etc . ) are suitable , as experiments showed for e. multilocularis eggs ( veit et al . several studies in different countries have assessed parasite contamination of vegetables and fruits and , indeed , several protozoan oocysts or cysts , and helminth eggs could be documented in iran ( daryani et al . , 2008 ) , libya ( abougrain et al . , 2010 ) , egypt ( eraky et al . , 2014 ) and brazil ( silva et al . , 2014 ) . in india , vegetables , soil and wastewater samples were checked for helminth eggs and found in 83.3% of raw wastewater , 68.2% of treated wastewater , 68.6% of soil and 44.2% of vegetable samples ( gupta et al . , 2009 ) . in turkey , helminth eggs , including taeniid eggs , have been found in raw vegetables collected from wholesalers ( kozan et al . , 2005 ) and , in norway , protozoa and helminths have been detected in fruit and vegetables ( robertson and gjerde , 2001 ) . aside from direct detection of eggs by microscopy , e. granulosus eggs have been identified by monoclonal antibodies in environmental contamination sites in settlements in turkana ( kenya ) ( craig et al . , 1988 ) or in soil samples in gardens of rural homesteads in southern kazakhstan , using a modified flotation method followed by pcr identification ( shaikenov et al . , 2004 ) . the same group investigated unwashed fruits and vegetables in the same endemic region of poland and were able to amplify e. multilocularis dna in 24 of 103 samples ( lass et al . , 2015 ) . given that , in the past , primates in zoo were fed with raw vegetables that had not been washed intensively , the probability of a potential parasite transmission with helminth eggs might be higher than it is with washed vegetables used for human consumption . the aim of this study was to investigate cestode egg - contamination in raw vegetables and fruits fed to the gorillas at basel zoo , to evaluate them as a possible route of transmission of the infection with e. multilocularis . the total daily mass of vegetables ( around 50 kg ) and fruits ( around 10 kg ) prepared as food for the gorillas represented one sample ; its quantity varied according the specific daily needs of basel zoo . in autumn 2013 ( september to november , 95 samples ) , different vegetables and fruits , grown in fields and green houses in the basel region of switzerland , were purchased from a local farmer . the samples contained around 40 heads of lettuce ( including butterhead lettuce ( lactuca sativa var . longifolia ) ; weighing approximately 14 kg and varying quantities of fennel , beetroot , allium , broccoli , red pepper , cucumber , celery , carrot , potato , onion , tomato , apple and pear . additionally , in spring 2013 ( april and may , 46 samples ) , vegetables and fruits of the same varieties as in autumn , originating from europe but with unknown country / region of origin , were purchased from different markets in basel . all vegetables and fruits were of high quality , were processed at high hygienic standards , pre - washed by the farmer ( some root vegetables still contained less visible soil ) and were originally prepared for human consumption . they were delivered on a daily basis to basel zoo as food for the gorillas . each sample was washed in the food preparation station at basel zoo following the daily routine using tap water . first , all fruits and vegetables were checked , dirty spots were removed and the fruits and vegetables were sunken as a whole and washed in the sink filled with tap water for around 1 min . thereafter , the heads of lettuce were cut in halves to facilitate subsequent rinsing of the internal leaves . the lettuce leaves were not further separated and all other fruits and vegetables were left intact , since the structure of the food was important for later feeding to the animals . the food was then placed in a large meshed plastic - container and thoroughly rinsed with a dish sprinkler . the whole washing water ( 240 l collected in 60 l containers ) was collected and sieved through filters with different mesh sizes . for this purpose , a tube system ( diameter of 16 cm ) with two filters ( aperture sizes : subsequently , the 21 m filter containing the debris was turned upside down and washed again with tap water and placed inside two 1.5 l bottles . finally , at the institute of parasitology in zurich , the sediment was concentrated through a series of centrifugation steps and collected in a flat tube 10 ml volume to allow examination for the presence of eggs using an inverted microscope . due to difficulties of reliable recognition of taeniid eggs , especially within samples collected in autumn , where a lot of pollen was present , ( 2004 ) . a multiplex pcr for the discrimination of e. granulosus and e. multilocularis from other cestodes ( e.g. taenia spp . the multiplex pcr primers target two mitochondrial genes ; the nadh dehydrogenase subunit 1 ( cest1/cest2 ) and the small subunit of ribosomal rna ( cest3 , cest4 and cest5 ) . meanwhile , cest3/cest5 and cest4/cest5 are used to detect and discriminate between echinococcus spp . causing ce and other cestodes dna , respectively . the amplicons were directly sequenced after purification of the pcr products using the minelute pcr purification kit ( qiagen , hilden , germany ) . sequencing was performed by synergene biotech gmbh , biotech center zurich , switzerland ( http://www.synergene-biotech.com ) with the primer cest5seq for taenia spp . sequencing results were compared with those from genbank nucleotide database , using blast tool ( http://www.blast.ncbi.nlm.nih.gov ) . a total of 30 out of 141 investigated samples of vegetables and fruits purchased from local producers or markets in basel were positive for dna of cestode species ( table 1 ) . from 95 samples obtained from the basel region in autumn , furthermore , 13 out of 46 samples collected in spring ( european origin but from unspecified locations ) were positive for taeniids including , in two cases , e. granulosus and , in one case , taenia saginata . the e. granulosus sequences were short ( 42/57bp ) with 98% and 100% identity with e. granulosus sequences available in genbank ( e. g. accession number : dq822451 ; kj559023 ) . due to the short sequences obtained with the e. granulosus sensu lato positive samples , two samples had mixed infections ( one with h. taeniaeformis and e. granulosus s.l . , and one with an unidentified cestode and e. granulosus ) . this study , using the method described by tefanic ( 2004 ) for the isolation of taeniid eggs combined with subsequent dna characterisation , documents a contamination with taeniids in vegetables and fruits prepared for human consumption but used to feed zoo primates . the presence of dna of taenia hydatigena , taenia ovis , the taenia multiceps / taenia serialis - complex , and echinococcus granulosus suggests a contamination of the food with dog faeces . although no dna of e. multilocularis was detected in our study , the presence of typical fox species such as taenia polyacantha and t. crassiceps indicates fox faecal contamination , which means that e. multilocularis eggs could be potential contaminants of the same type of vegetables . in this context , it is worth mentioning that , although the basel region is a known e. multilocularis endemic area , the fox population has been reduced by fox mange in the last few years and the contamination of the environment with e. multilocularis eggs has been relatively low , as determined by investigating faecal samples of foxes ( frauchiger et al . , 2015 ) . so far only chewing grass and eating unwashed strawberries were considered as food - derived risk factors for alveolar echinococcosis , ( kern et al . , 2004 ) . our results and the study in poland ( lass et al . , 2015 ) indicate that vegetables have to be considered as a further risk of cestode infection . especially vegetables with rough surface and those that are difficult to wash ( such as lettuce or cabbage ) might be a greater potential risk . this study was focused on finding evidence of faecal contamination with cestodes that potentially can infect zoo primates . moreover , some of the cestodes found are also zoonotic parasites such as e. granulosus and t. crassiceps . despite that 21 m filter capture several kind of parasites eggs , due to the small size of the oocysts it can not be excluded that other food - borne zoonotic agents such as toxoplasma gondii and cryptosporidium spp it is also worth to mentioned that one sample of this study was found positive for t. saginata , which indicates human faecal contamination . although t. saginata eggs are not infective to humans , this finding suggests that the vegetables are grown or processed under suboptimal hygienic conditions and , thus , raise the alert for the transmission of geohelminths such as ascaris spp . or trichuris spp . , protozoa such as giardia spp . and other bacterial or viral pathogens ( dewaal et al . , 2006 ) . it is worth noting that microscopic identification could not be achieved for all samples due to the large amount of dirt and pollen particles of the same size as taeniid eggs . furthermore , primer specificity , especially in the case of primer cest5 , was a limitation concerning the taenia species identification . according to trachsel et al . ( 2007 ) , this primer is able to amplify dna from other cestodes such as mesocestoides spp . the amplicons of multiple cestodes species present in some of the samples could hinder the species identification by direct sequencing . it also needs to be remembered that , whilst the presence of taeniid dna is not strictly associated with the presence of viable eggs in the sample , it is an indicator of faecal contamination by taeniid 's definitive hosts . based on the sample preparation , however , it is unlikely that we isolated free dna or worm tissue in the samples sieved for the detection of particles between around 3040 m in diameter . further test development has to be initiated with the aim of detection of viable eggs . as recently shown , the most accurate and sensitive viability test for e. multilocularis eggs is the subcutaneous injection of free , not activated oncospheres ( federer et al . , 2015 ) . however , the potential of mrna - detection for viability testing for metacestode infections ( kern et al . , 1995 ) could represent an alternative approach . the presented study confirms the risk of parasite contaminated vegetables and fruits for cestode infections in non - human primate facilities , but also documents a possible risk of infections for humans . it confirms the importance of thorough food washing not just at basel zoo , but also as a standard procedure in every household . attempts to decontaminate raw vegetables by heating is problematic , as a recent study demonstrated the high heat tolerance of e. multilocularis eggs ( survival up to 65 c for 120 min at 70% relative humidity ) ( federer et al . , 2015 ) . an alternative for the food supply for basel zoo may be the use of vegetables from an area non - endemic for echinococcus species , such as the southern ticino region of switzerland ( hoby s. and wenker ch . personal communication ) .

due to frequent cases of alveolar echinococcosis ( ae ) in captive primates in europe , 141 samples of food , which consisting of vegetables and fruits , were investigated for contamination with egg - dna of taeniids . each sample consisted of at least 40 heads of lettuce as well as various vegetables and fruits . the samples were purchased at different times of the year : either from september to november ( autumn ) , originating from greenhouses or fields in the basel region in the north of switzerland , or in april and may ( spring ) when fruit and vegetables are sourced from throughout europe from various wholesalers . each sample was washed , and the washing water sieved through mesh apertures of 50 m and 21 m , respectively . the debris , including taeniid eggs , collected on the 21 m sieve were investigated by a multiplex pcr - analysis followed by direct sequencing . in 17 ( 18% ) of the 95 samples collected in autumn , taeniid - dna was detected ( taenia hydatigena in four , taenia ovis in three , taenia polyacantha in two and hydatigera ( taenia ) taeniaeformis in five cases ) . similarly , in 13 ( 28% ) of the 46 samples collected during spring taeniid - dna was detected ( echinococcus granulosus s.l . in two , taenia crassiceps in one , t. hydatigena in two , taenia multiceps / taenia serialis in two , taenia saginata in one and h. taeniaeformis in five cases ) . although dna of echinococcus multilocularis was not found specifically in this study , the detection of other fox taeniids reveals that vegetables and fruit fed to the primates at the zoo basel at different times of the year and from different origin are contaminated with carnivore 's faeces and therefore act as a potential source of ae infections .

You are an expert at summarizing long articles. Proceed to summarize the following text: [ h]lysine ( 99 ci mmol ) , [ h]leucine ( 115 ci mmol ) and [ c]meaib ( -(methylamino)isobutyric acid ) ( 51 mci mmol ) were from perkinelmer . human slc6a14 crna was produced by in vitro transcription ( using mmessage mmachine t7 ultra kit ( ambion ) ) of psport1 plasmid containing the slc6a14 sequence isolated originally from mcf-7 cells ( nakanishi et al . 2001 ) . oocytes were prepared and injected with 50 nl crna ( 1 mg ml ) or water , as previously described ( kennedy et al . 2002 , 2005 ) , and incubated at 18c in barth 's solution until required . uptake of radiolabelled amino acids ( 25 ci ml ) was measured in oocytes 25 days after injection , as previously described ( kennedy et al . oocytes were washed in a nacl - containing ph 7.4 solution ( 100 mm nacl , 2 mm kcl , 1 mm cacl2 , 1 mm mgcl2 , 10 mm hepes adjusted to ph 7.4 with tris base ) and uptake measured at 22c for 40 min . uptake measurements were performed in this nacl - containing ph 7.4 solution or using a solution adjusted as follows : for the na - free solution , nacl was replaced with choline chloride ; for the cl - free solution , nacl , kcl , cacl2 and mgcl2 were replaced with sodium gluconate , potassium gluconate , calcium gluconate and mgso4 , respectively ; for the ph 5.5 solution , hepes was replaced by mes . after uptake , oocytes were washed three times in ice - cold buffer and lysed in 10% sds . oocytes ( 28 days post - injection ) were superfused in an open chamber with a nacl - containing ph 7.4 solution ( see above ) . oocytes were clamped at 60 mv and exposed to various concentrations of -alanine ( 0.220 mm , 2min ) or different amino acids ( all at 20 mm , 2min ) to allow amino acid - induced currents to be measured using a geneclamp 500 amplifier , digidata 1200 ( axon instruments ) and clampex software ( kennedy et al . 2005 ) . currents were analysed using clampfit 8.2 . to determine the current evoked by a 2 min exposure to an amino acid , the current measured over the last 15 s of the 2 min exposure was averaged . the baseline current ( taken as the average current over the 15 s before exposure to the amino acid ) was then subtracted to determine slc6a14-specific current . statistical comparisons were made using anova and tukey 's post hoc test using graphpad prism 4 ( graphpad software inc . , san diego , ca , usa ) . [ h]lysine ( 99 ci mmol ) , [ h]leucine ( 115 ci mmol ) and [ c]meaib ( -(methylamino)isobutyric acid ) ( 51 mci mmol ) were from perkinelmer . human slc6a14 crna was produced by in vitro transcription ( using mmessage mmachine t7 ultra kit ( ambion ) ) of psport1 plasmid containing the slc6a14 sequence isolated originally from mcf-7 cells ( nakanishi et al . 2001 ) . oocytes were prepared and injected with 50 nl crna ( 1 mg ml ) or water , as previously described ( kennedy et al . 2002 , 2005 ) , and incubated at 18c in barth 's solution until required . uptake of radiolabelled amino acids ( 25 ci ml ) was measured in oocytes 25 days after injection , as previously described ( kennedy et al . oocytes were washed in a nacl - containing ph 7.4 solution ( 100 mm nacl , 2 mm kcl , 1 mm cacl2 , 1 mm mgcl2 , 10 mm hepes adjusted to ph 7.4 with tris base ) and uptake measured at 22c for 40 min . uptake measurements were performed in this nacl - containing ph 7.4 solution or using a solution adjusted as follows : for the na - free solution , nacl was replaced with choline chloride ; for the cl - free solution , nacl , kcl , cacl2 and mgcl2 were replaced with sodium gluconate , potassium gluconate , calcium gluconate and mgso4 , respectively ; for the ph 5.5 solution , hepes was replaced by mes . after uptake , oocytes were washed three times in ice - cold buffer and lysed in 10% sds . oocytes ( 28 days post - injection ) were superfused in an open chamber with a nacl - containing ph 7.4 solution ( see above ) . oocytes were clamped at 60 mv and exposed to various concentrations of -alanine ( 0.220 mm , 2min ) or different amino acids ( all at 20 mm , 2min ) to allow amino acid - induced currents to be measured using a geneclamp 500 amplifier , digidata 1200 ( axon instruments ) and clampex software ( kennedy et al . 2005 ) . currents were analysed using clampfit 8.2 . to determine the current evoked by a 2 min exposure to an amino acid , the current measured over the last 15 s of the 2 min exposure the baseline current ( taken as the average current over the 15 s before exposure to the amino acid ) was then subtracted to determine slc6a14-specific current . data are means s.e.m . statistical comparisons were made using anova and tukey 's post hoc test using graphpad prism 4 ( graphpad software inc . at a tracer concentration of 2 m there was a 9.5-fold increase in [ h]-alanine uptake in slc6a14 crna - injected oocytes compared to water - injected oocytes ( p < 0.01 ) ( fig . other amino acids identified as substrates for the -alanine carrier in rabbit ileum ( munck , 1985 ; munck & munck , 1992b ) also showed significant uptake into slc6a14-injected oocytes with 5.7-fold and 4.1-fold increases in uptake , compared to water - injected oocytes , being observed for the dipolar amino acid [ h]leucine and the cationic amino acid [ h]lysine ( both p < 0.001 versus water ) ( fig . the greater uptake of [ h]leucine and [ h]lysine compared to [ h]-alanine at tracer concentrations ( fig . 1 ) reflects the earlier observation in rabbit ileum that leucine and lysine are higher affinity substrates for the -alanine carrier ( munck , 1985 ) . there was no significant uptake ( p > 0.05 versus water ) of [ c]meaib into slc6a14-injected oocytes ( fig . 1 ) . meaib interacts very poorly with the -alanine carrier in rabbit ileum ( munck , 1985 ) . slc6a14-mediated [ h]-alanine uptake was abolished in the absence of either extracellular na or cl ( fig . 2 ) demonstrating that [ h]-alanine uptake via slc6a14 is a na- and cl - dependent process as observed with the -alanine carrier in rabbit ileum ( munck & munck , 1990 , 1992a ) . na- and cl - dependent [ h]-alanine uptake is reduced as extracellular ph becomes acidic ( ph 5.5 ) ( fig . 2 ) . uptake of various radiolabelled amino acids ( 25 ci ml ; all 2 m except [ c]meaib which was 20 m ) was measured over 40 min in a nacl - containing ph 7.4 solution into oocytes injected with either slc6a14 crna or water ( n= 1820 ) . ns , p > 0.05 ; * * p < 0.01 ; * * * p < 0.001 all versus water - injected oocytes . [ h]-alanine uptake ( 2 m ) was measured under control conditions ( nacl - containing solution , ph 7.4 ) , in na - free ph 7.4 ( na ) solution , in cl - free ph 7.4 ( cl ) solution , or in a nacl ph 5.5 solution . under each condition , uptake in water - injected oocytes was subtracted from that in crna - injected oocytes to give slc6a14-specific uptake ( n= 20 ) . * * * p < slc6a14-mediated -alanine / na / cl cotransport is a rheogenic process which generates inward current under two - electrode voltage - clamp conditions ( figs 3 and 4 ) consistent with a stoichiometry of 23 na : 1 cl : 1 amino acid , as suggested previously with other substrates for slc6a14 ( sloan & mager , 1999 ) . the relative low affinity of slc6a14 for -alanine ( km= 2.1 0.9 mm , fig . 3 ) , compared to leucine and lysine , is consistent with earlier observations of the -alanine carrier in rabbit ileum ( km= 2 mm ) ( munck , 1985 ; munck & munck , 1992a ) . at saturating substrate concentrations ( 20 mm ) , -alanine transport via slc6a14 is associated with a large inward current of similar magnitude ( p > 0.05 ) to that observed with the other dipolar substrate leucine ( fig . the cationic amino acid lysine was associated with a larger current ( p < 0.01 , lysine versus-alanine ) which raises the possibility that a component of the current is carried by the positively charged amino acid ( fig . 4 ) . meaib , which is excluded from the -alanine carrier , failed to induce significant current ( p > 0.05 ) in the slc6a14-injected oocytes ( fig . 4 ) . none of the three -alanine carrier substrates induced inward current in water - injected oocytes ( fig . the higher affinity of slc6a14 for lysine and leucine compared to -alanine is confirmed by the greater inhibition of [ h]-alanine uptake observed ( fig . 5 ) when all competing cold substrates were present at a concentration ( 2 mm ) around the km for -alanine ( leucine and lysine both p < 0.001 versus cold -alanine ; -alanine p < 0.001 versus control ) . -alanine - induced current in two - electrode voltage - clamped oocytes was measured at 60 mv following exposure to -alanine ( 0.220 mm , 2 min ) in a nacl ph 7.4 solution . a , example traces of amino acid - induced currents in slc6a14-expressing and water - injected oocytes following exposure ( 2 min ) to saturating concentrations ( 20 mm ) of different amino acids in nacl ph 7.4 solution . b , mean results for experiments described in a using slc6a14-expressing oocytes where data are expressed as the percentage current induced by 20 mm leucine ( n= 7 ) . inhibition of [ h]-alanine ( 100 m ) transport into slc6a14-expressing oocytes by various amino acids ( all 2 mm ) in nacl ph 7.4 solution ( n= 1821 ) . ns , p > 0.05 ; * * * p < 0.001 ; all versus slc6a14 control . a key functional characteristic of the -alanine carrier in rabbit ileum ( munck , 1985 ) is the reduction in affinity of the carrier for dipolar substrates following n - methylation . as measured in rabbit ileum ( munck , 1985 ) , the effects of n - methylation on the ability of leucine , glycine , alanine and aminoisobutyric acid ( aib ) to inhibit [ h]-alanine transport via the -alanine carrier were determined here in slc6a14-injected oocytes ( fig . 6 ) to those measured earlier for the -alanine carrier in rabbit ileum ( munck , 1985 ) . the ability of each amino acid to inhibit [ h]-alanine transport was reduced by n - methylation . for example , greater inhibition of [ h]-alanine uptake into slc6a14-injected oocytes was observed at 10 mm for leucine ( leu ) versus n - methyl - leucine ( n - me - leu ) ( p < 0.001 ) ( fig . 6a ) , glycine ( gly ) versus n - methyl - glycine or sarcosine ( sar ) ( p < 0.001 ) ( fig . 6b ) , alanine ( ala ) versus n - methyl - alanine ( n - me - ala ) 6d ) . slc6a14-mediated [ h]-alanine ( 100 m ) uptake ( measured in nacl ph 7.4 solution ) in the presence of various amino acids ( filled squares ) and their n - methylated analogues ( open squares ) at 0.1 , 1 and 10 mm . amino acids are : a , leucine and n - methyl - leucine ( n - me - leu ) ; b , glycine and sarcosine ( sar ; n - methyl - glycine ) ; c , alanine and n - methyl - alanine ( n - me - ala ) ; d , aib ( aminoisobutyric acid ) and meaib ( -(methylamino)isobutyric acid ) . data are expressed as percentage of control ( absence of competing amino acids ) after subtraction of uptake in water - injected oocytes under each condition ( n= 1820 ) . the key functional characteristics of the -alanine carrier , as previously described only in situ in rabbit ileum ( munck , 1985 ) , are demonstrated following expression of the slc6a14 transporter in xenopus laevis oocytes ( figs 16 ) . the transport system is both na and cl dependent , can transport non--amino acids such as -alanine with low affinity , and has a higher affinity for dipolar and cationic amino acids such as leucine and lysine ( figs 15 ) . n - methylation of the substrates leucine , glycine , alanine and aib reduces the affinity for transport ( fig . in addition , the characteristic of weak stereoselectivity has been demonstrated previously with the identification of d - serine transport via slc6a14 ( hatanaka et al . these observations confirm the hypothesis that the slc6a14 gene encodes the transport protein known as the -alanine carrier ( munck , 1985 ; anderson & munck , 1987 ) . the -alanine carrier is considered to be the na - dependent transporter of leucine , lysine and alanine observed originally in rabbit ileum by munck & schultz ( 1969 ) and paterson et al . importantly , these observations also indicate that the studies of the -alanine carrier in the 1960s to 1980s can now be considered to represent in situ measurements of slc6a14 function in the intestine . the tissue distribution of the -alanine carrier is unusual as the only intestinal location where function has been described is at the luminal surface of the ileum ( munck , 1985 ; anderson & munck , 1987 ; munck & munck , 1990 , 1992a , b , 1995 ) . this predominantly distal intestinal expression pattern is supported by observations using mouse gastrointestinal tract that demonstrate greater expression of slc6a14 mrna in the ileum and colon compared to duodenum and jejunum ( hatanaka et al . the physiological role of the -alanine carrier seems certain to lie in nutrient absorption from the diet as the ileum is the site of maximal amino acid absorption in rabbit small intestine ( munck & munck , 1992b ) . the physiological role in the human intestine is not known but the broad substrate specificity of slc6a14 means that this distal intestinal site of absorption could be important in both nutrient and drug absorption . -alanine is a non - proteinogenic amino acid and is a component of the dipeptide carnosine ( -alanine l - histidine ) , found at high concentrations in both vertebrate and non - vertebrate skeletal muscle . in humans , dietary supplementation with -alanine ( at concentrations relevant to diet ) leads to an increase in skeletal muscle carnosine ( harris et al . 2006 ) which is associated with an improvement in performance during exercise , proposed to be due to the enhanced ph buffering effect of carnosine ( harris et al . 2006 ; stout et al . 2007 ; zoeller et al . 2007 ) . in addition to cationic and dipolar amino acids , slc6a14 transports carnitine , a range of nitric oxide synthase inhibitors , and the antiviral prodrugs valacyclovir and valganciclovir ( hatanaka et al . 2001 , 2004 ; nakanishi et al . 2001 ; umapathy et al . thus , slc6a14 has great potential as a target for drug delivery programmes using slow release formulations or rectal suppositories . in addition , the colonic expression may have relevance for the absorption of bacterially derived d - amino acids as d - serine is transported by slc6a14 ( hatanaka et al . 2002 ) . interestingly , the distribution pattern of slc6a14 parallels the regions of the gastrointestinal tract that are generally colonized by bacteria . the hypothesis that slc6a14 expression might be up - regulated following bacterial colonization is consistent with the recent demonstration of selective up - regulation of slc6a14 mrna and protein expression in acute cholera patients compared to convalescence such that slc6a14 protein has been immunolocalized to the luminal surface of the human duodenum during acute infection ( flach et al . after induction , e.g. following infection with cholera , slc6a14 could provide a highly concentrating mechanism ( due to its na and cl dependence ) for absorption of essential amino acids such as lysine and leucine that could otherwise be lost during excess intestinal fluid and electrolyte secretion . 2004 ) , and being up - regulated in colorectal cancer ( gupta et al . , this study describes the first demonstration of -alanine carrier - like function by any cloned transporter . the functional characteristics described here , which are identical to those determined by measurement of amino acid uptake across the luminal surface of flat sheets of rabbit ileal mucosa ( munck , 1985 ; munck & munck , 1990 , 1992a , b , 1994 , 1995 ) , can account for all -alanine carrier - like function and emphasize the added value of in situ measurements of physiological function over theoretical predictions of transport protein function based solely upon measurements of mrna distribution . slc6a14 was isolated originally from human mammary gland ( sloan & mager , 1999 ) and named atb due to its similarity in function to the amino acid transport system b , described in mouse blastocysts ( van winkle et al . the observations reported in this study demonstrate that slc6a14 is the -alanine carrier and that the blastocyst atb and intestinal -alanine carrier are one and the same transport system ( munck & munck , 1995 ) . the term -alanine carrier is somewhat inappropriate as a means of identification of this intestinal transport system as it has a low affinity for -alanine , and the intestinal tract contains another transport system for -alanine namely the h - coupled amino acid transporter slc36a1 which is also known variously as system pat , pat1 or the imino acid carrier ( thwaites et al . 1993 ; chen et al . 2003 to reduce confusion in the literature , the term -alanine carrier should be avoided and the names slc6a14 and atb adopted to be consistent with descriptions in other tissues ( van winkle et al . 1985 ; munck & munck , 1994 , 1995 ; sloan & mager , 1999 ; sloan et al . 2003 ) .

the -alanine carrier was characterized functionally in the 1960s to 1980s at the luminal surface of the ileal mucosal wall and is a na+- and cl-dependent transporter of a number of essential and non - essential cationic and dipolar amino acids including lysine , arginine and leucine . -alanine carrier - like function has not been demonstrated by any solute carrier transport system identified at the molecular level . a series of experiments were designed to determine whether solute carrier slc6a14 is the molecular correlate of the intestinal -alanine carrier , perhaps the last of the classical intestinal amino acid transport systems to be identified at the molecular level . following expression of the human slc6a14 transporter in xenopus laevis oocytes , the key functional characteristics of the -alanine carrier , identified previously in situ in ileum , were demonstrated for the first time . the transport system is both na+ and cl dependent , can transport non--amino acids such as -alanine with low affinity , and has a higher affinity for dipolar and cationic amino acids such as leucine and lysine . n - methylation of its substrates reduces the affinity for transport . these observations confirm the hypothesis that the slc6a14 gene encodes the transport protein known as the -alanine carrier which , due to its broad substrate specificity , is likely to play an important role in absorption of essential nutrients and drugs in the distal regions of the human gastrointestinal tract .

You are an expert at summarizing long articles. Proceed to summarize the following text: the presence of chromosome abnormalities in couples with repeated spontaneous abortion is known even if the phenomenon is far from a complete assessment . patients carrying balanced reciprocal translocation are subject to meiosis nondisjunction risk . indeed , the mispairing of translocated chromosomes during the first meiotic division can give rise to different forms of segregation , which can result in aneuploidy of the translocated chromosomes . a compilation of the cytogenetic results taken from 79 published surveys of couples with two or more pregnancy losses ( comprising 8208 women and 7834 men ) showed an overall prevalence of major chromosome abnormalities of 2.9% . results of different studies have shown that chromosomal reciprocal translocations in one of the partners will cause majorities of unfavorable pregnancy outcomes.[47 ] the main question that usually genetic counselors should answer to their consultants is to estimate the probability of recurrence of unfavorable pregnancy outcomes ( abortion , stillbirth , and birth of malformed child ) among their future pregnancies . in case of chromosomal translocations , if we have a few of pedigree members , then risk estimate should be performed on basis of our combined data and empiric data from literature . families with balanced chromosomal changes ascertained by unbalanced progeny , miscarriages , or by chance are interested in their probability for unbalanced offspring and other unfavorable pregnancy outcomes . this is usually done based on the original data published by stengel - rutkowski et al.(1988 ) , several decades ago . different risks are estimated for unbalanced offspring at birth or at second trimester prenatal diagnosis for abortions or stillbirths / early deaths . these risk estimates varied considerably from translocation to translocation . here , we present two different family in which one of the partners were carriers of balanced translocation . they were referred to our clinic because of their repeated spontaneous abortion : family number i : female partner was 26 and male partner was 32 years old . as it can be seen , the male partner had two siblings who died at the first month after birth . his karyotype with gtg banding technique showed that he was a balanced carrier of reciprocal translocation between two autosomes , numbers 2 and 12 [ figure 2 ] . the karyotyping of his wife showed that she was 45 , xx ( normal female karyotype ) . figure 2 shows the photographs of normal and translocated chromosomes numbers 2 and 12 , displaying also schematic representation of the breakpoint positions.family number ii : female partner was 38 and male partner was 50 years old at the time of our study . as it can be seen , the female partner had mother with three abortions in her medical history . his karyotype with gtg banding technique showed that he was a balanced carrier of reciprocal translocation between two autosomes , numbers 1 and 12 [ figure 3 ] . the karyotyping of her husband showed that he was 45 , xy ( normal male karyotype ) . figure 4 shows the normal and translocated chromosomes numbers 1 and 12 , and also it representsschematic diagrams of the breakpoint positions . family number i : female partner was 26 and male partner was 32 years old . as it can be seen , the male partner had two siblings who died at the first month after birth . his karyotype with gtg banding technique showed that he was a balanced carrier of reciprocal translocation between two autosomes , numbers 2 and 12 [ figure 2 ] . the karyotyping of his wife showed that she was 45 , xx ( normal female karyotype ) . figure 2 shows the photographs of normal and translocated chromosomes numbers 2 and 12 , displaying also schematic representation of the breakpoint positions . family number ii : female partner was 38 and male partner was 50 years old at the time of our study . figure 3 shows their pedigree chart . as it can be seen , the female partner had mother with three abortions in her medical history . his karyotype with gtg banding technique showed that he was a balanced carrier of reciprocal translocation between two autosomes , numbers 1 and 12 [ figure 3 ] . the karyotyping of her husband showed that he was 45 , xy ( normal male karyotype ) . figure 4 shows the normal and translocated chromosomes numbers 1 and 12 , and also it representsschematic diagrams of the breakpoint positions . pedigree chart of family number i , see text for details photographs of normal and translocated chromosomes numbers 2 and 12 , displaying also schematic representation of the breakpoint positions pedigree chart of family number ii , see text for details photographs of normal and translocated chromosomes numbers 1 and 12 , displaying also schematic representation of the breakpoint positions the estimation of the occurrence probability for individual carriers of two different autosome - autosome translocations with breakpoints at different positions is usually done based on the original data published by stengel - rutkowski et al.(1988 ) several decades ago . for example , probability rates of unbalanced progeny at birth and at second trimester of prenatal diagnosis as well as of unkaryotyped miscarriages and stillbirth / early death of newborn for rct carriers related to the total number of pregnancies after ascertainment correction are calculated according to the method of stengel - rutkowski et al . the ascertainment correction according to stene and stengel - rutkowski is performed by elimination of probands ( or index sibships ) and carriers with the proband in direct line of descent . the probability rate estimates for unfavorable pregnancies are presented as : p , risk value ; a , number of unfavorable pregnancies after ascertainment correction ; n , number of all pregnancies after ascertainment correction ; and s , standard deviation . if the number of abnormal pregnancies after ascertainment correction be 0 , the maximal risk estimate m , corresponding to the upper limit of the risk interval , is calculated using the formula : m , maximal risk where e=2.71828 is the base number for natural logarithms . also , using such formula in clinics takes a lot of time and usually the patients feel that the counselors are doing a lot for noting ! the families usually do not care about such estimations ; they want know why those miscarriages , stillbirths / early deaths happened ; are they in a high risk for those bad experiences or not ? and finally , if the answer is yes , they are eager to know the genetic counselor 's views about those complex estimations . in another word , they want to hear if there is a high , moderate , or low risk for unfavorable pregnancy outcome in a rct carrier . so , perhaps if the genetic counselors try to adopt their estimations to the roles of segregation during miosis and gametogenesis in carriers of balanced reciprocal translocations , the patients will get a better idea to reach to a final decision . based on the segregation role , the risk of unfavorable outcomes , in such situations , as we saw in our cases , are high ( about one - sixth ) and we advised for pgd or prenatal diagnosis . in addition of those two questions that are the cores of genetic counseling from the patients side and so genetic counselors might answer and explain them in an comprehensible way , there are two more points that although are in a limited probability , geneticists should bring them to light and pay enough attention . firstly , the people that are balanced carrier of , at least , some kinds of reciprocal translocation are at a higher risk for malignancy.[1316 ] therefore , carriers of such translocations should be noticed to have routine check - up for early detection of malignancies . secondarily , sometimes rcts lead to abnormalities in other chromosomes , phenomenon called inter - chromosomal effect ( ice ) ; so the risk of unfavorable outcomes in future pregnancies of such individuals may be more than primary estimations . because matters such as what we mentioned recently are studies called the sensitive studies,[1921 ] talking about them must be with special attention .

one of the main genetic causes involve in the pathogenesis of recurrent abortion is parental chromosomal abnormalities . the central concept in genetic counseling with such families is to estimate the probability of recurrence of unfavorable pregnancy outcomes . the main questions that consultants usually ask are : why did this happen ? what is the risk to be done again?our cases were two families with repeated miscarriage . the pedigrees were drawn , the chromosomes of couples were studied , and estimation for recurrent risk was done . we tried to answer those two main questions and clear the results for them.parental chromosome abnormalities were founded after karyotyping with gtg technique at 450 band resolution , revealing 46 chromosomes with balanced translocation of autosomes in one of the partner in both families . recurrent risk was estimated as high for their future pregnancies in each family.couples in which one partner is the carrier of such balanced translocation have increased risks of infertility , recurrent abortion , and delivery of chromosomally abnormal offspring . genetic counseling of such couples , therefore , presents a unique challenge and should be considered in dealing with such families .

You are an expert at summarizing long articles. Proceed to summarize the following text: the increasing incidence of complex percutaneous coronary intervention ( pci ) is accompanied by risks of device fracture or dislodgement . guide wire fractures during pci are very rare , but in such cases , life - threatening complications such as embolization , thrombus formation and perforation may occur . although , in most cases , percutaneous retrieval techniques of fractured guide wires are recommended , there have been several reports of fragments being left in place without complications.1 - 4 ) we present the case of a 78-year - old female patient who was diagnosed with non - st segment elevation myocardial infarction ( nstemi ) and treated with pci . the patient had remnant guide wire filaments in the left anterior descending artery ( lad ) and aorta but did not experience any serious complications during a one - year follow up period . a diagnostic coronary angiogram showed diffuse significant stenosis from the proximal to middle lad and first diagonal branch ( d1 ) ( fig . we initially treated the patient with a single paclitaxel - eluting stent ( 2.7532 mm taxus , boston scientific , natick , ma , usa ) . four days later , two coronary angioplasty 0.014 guide wires were inserted { one hi - torque balance middleweight ( bmw ) universal coronary guide wire ( abott vascular , santa clara , ca , usa ) into the lad , and one high - torque whisper coronary guide wire ( abott vascular ) into the d1}. an intravascular ultrasound after predilatation with a 2.520 mm voyager balloon ( abott vascular ) revealed a large plaque burden at both the lad and the d1 . we deployed two overlapped sirolimus - eluting stents at the proximal and middle lad : a 2.7533 mm cypher at the middle lad and a 2.7518 mm cypher at the proximal lad ( cordis corporation , miami lakes , fl , usa ) . when we exchanged the guide wires to perform kissing balloon angioplasty , a fracture occurred at the distal tip of the bmw guide wire ( fig . 1 ) . another guide wire was inserted to perform a beaded wire rotation , and distal balloon inflation retrieval was attempted , in order to remove the fractured guide wires . finally , we used a goose neck loop - snare ( microvena corporation , st . multiple forward and backward movements of the snare , combined with distal balloon inflation retrieval , successfully removed most of the fractured guide wires ( fig . 2 ) but we later observed retained filaments during echocardiography ( figs . 3 and 4 ) . the patient declined surgical intervention for removal of these stray filaments and was discharged from our hospital , with triple anti - platelet medication and no complications . the patient did not experience any thrombotic or embolic events and did not suffer from any subjective symptoms over the one year of clinical follow up . guide wire fractures during pci are very rare , occurring in approximately 0.1 - 0.2% of cases.5 ) guide wire remnants could lead to life threatening complications such as thrombosis , emboli , and perforation . therefore , in the event of failed percutaneous retrieval and persistent signs of ischemia , patients should be urgently referred for surgical intervention . there are several methods recommended for the management of fractured guide wires , including emergent surgery , loop snare removal , two- or three - wire rotation , stenting over the retained wire , and conservative treatment.6 - 8 ) surgical extraction is strongly recommended in cases of protrusion of the guide wire into the ascending aorta.9 - 11 ) however , guide wire segments retained within the coronary circulation may remain benign for a long time , particularly if they are entrapped within a distal part of the vessel and do not have accompanying total coronary occlusions.3 ) vascular endothelial cell covering over the guide wire fragments may render them immobile and non - thrombogenic . hi - torque bmw guide wires consist of a distal core and a stainless proximal shaft , facilitating treatment of multiple lesions and tortuous vessels . however , guide wire fractures may occur if the distal core and stainless proximal shaft are separated by either the trapping of the distal tip or by vascular resistance . because the fracture in the lad developed after stent deployment at the main branch , we could not determine the mechanism of fracture in this particular case . however , trapping of the distal tip of the bmw wire , or stent deployment over a severely angulated guide wire are two possible explanations . in conclusion , even though the most ideal management option for remnant guide wires is their removal , conservative treatment with the fragments left in situ may be successful in cases in which patients remain asymptomatic and hemodynamically stable . however , life - long administration of intensive anti - platelet medications and close observation are recommended for these patients .

guide wire fractures during percutaneous coronary intervention ( pci ) are very rare , but when they do occur they may lead to life - threatening complications , such as embolization , thrombus formation and perforation . in cases when percutaneous retrieval has failed , surgical extraction of the remnant fragments is recommended . we present a case of remnant guide wire filaments that remained in place without complications , over a one - year clinical follow up period .

You are an expert at summarizing long articles. Proceed to summarize the following text: full documentation , explicit command lines , and example files necessary to model the structure of the most conserved domain of the signal recognition particle ( pdb 1lnt ) and to redesign all of its residues are included in the manual and rosetta_demos directories that are part of the release , freely available for download at http://www.rosettacommons.org . an automated algorithm to parse non - canonical segments ( i.e. , residues forming base pairs besides watson - crick or g - u pairs ) , along with bounding canonical base pairs , was applied to rna crystal structures with diffraction resolutions of 3 or better , with a focus on ribozymes and riboswitches . candidate motifs that did not interact with other regions of the structure and had lengths of 20 nucleotides or less were selected . a final set of thirty - two sequence motifs and the assumed canonical base pairs ( which form boundary conditions for each motif ) are illustrated in supplementary fig . 2 . generation of de novo models was carried out by fragment assembly of rna ( farna ) , as described previously 5 , starting from extended chains with ideal bond lengths and bond angles . minor improvements to the farna score function were made to model base - backbone and backbone - backbone interactions at a coarse - grained level , as described in supplementary fig . further , small improvements in the conformational search were implemented . rather than using three - residue fragments , the fragment length was made finer , from 3 to 2 to 1 , in successive stages of monte carlo fragment assembly . in addition , variations in sugar bond - length and bond - angle geometries were recorded in the fragment library and copied during fragment insertion moves to ensure sugar ring closure . most of the motifs herein involved multiple chains connected by at least one watson - crick base pair . these canonical base pairs were assumed to form , because they are typically known a priori in rna modeling and because without these double - helical boundary constraints , rna sequences often form alternative structures ( see , e.g. , ref.18 ) . the energy function was supplemented with harmonic constraints placed between watson - crick edge atoms in the two residues that were assumed to form each bounding canonical base pair ( see supplementary fig . 2 ) . further , each de novo run was seeded with a random subset of n 1 watson - crick base pairs to define the connections between n chains by a tree - like topology for coordinate kinematics19,20 ; every ten fragment insertions , alternative base - pairing geometries , drawn from an rna database , were tested as an additional type of monte carlo move . the source of both the torsion fragments and the base pairing geometries was the refined structure of the archaeal large ribosomal subunit ( 1jj214 ) , with the sarcin - ricin loop and the kink - turn motifs excluded . using an alternative ribosome crystal structure for the fragment source ( 1vq8 ) gave indistinguishable results for , e.g. , z - scores ( see next section ) . 50,000 farna models were optimized in the context of the rosetta full - atom energy function . this energy function is a simple and transferrable function that represents an approximate free energy ( minus the conformational entropy ) for each molecular state . interactions between non - bonded atoms are modeled by pair - wise , distance - dependent potentials for van der waals forces , hydrogen bonds , the packing of hydrophobic groups , and the desolvation penalties for burying polar groups13 . based on recent work in the rosetta community on proteins and dna , three additional non - bonded terms ( supplementary fig . 8) were incorporated here and reweighted through an iterative calibration : ( 1 ) a potential for weak carbon hydrogen bonds , previously investigated for membrane proteins , ( 2 ) an alternative orientation - dependent model for desolvation based on occlusion of protein moeities , and ( 3 ) a term to approximately describe the screened electrostatic interactions between phosphates . because subtle , bond - specific quantum effects complicate the general derivation of torsional potentials , we derived preferred values for rna torsion angles and their corresponding spring constants from the ribosome crystal structure ( supplementary fig . 9 ) . more sophisticated treatments of electrostatics and the site - specific binding of water and multivalent metal ions , which are expected to be important for some rna molecules21 , will be explored in future work . combinatorial sampling of 2-oh torsions was followed by continuous , gradient - based optimization of all internal degrees of freedom by the davidson - fletcher - powell method . constraints were included to maintain bond lengths and angles within 0.02 and 2 , respectively , of ideal values and to tether atoms near their starting positions ( with harmonic constraints penalizing a 2 deviation by 1 unit ) . after removing the latter set of tethers , a second stage of 2-oh torsion optimization and minimization , steric clashes and bond geometry deviations were reduced to the level seen in experimental rna structures , as assessed by the independent molprobity toolkit ( see supplementary table 3 for a complete overview ) . to test the amber99 force field , the tinker module minimize with the gbsa keyword ( implementing the born radii of still et al.22 ) was applied to the models that had been refined with the full - atom rosetta energy function . to test the charmm27 force field , the charmm molecular mechanics program23 was applied , using the nucleic acid force field ( param27 ) 24 . the generalized born molecular volume ( gbmv ) current molecular mechanics packages do not offer the prospect of continuous minimization of model coordinates in the context of the computationally expensive non - linear poisson - boltzmann treatment of counterions ; as a first estimate of the effects of ion screening , we minimized models with the ion - free gbmv model , and then recomputed solvation energies with the poisson - boltzmann solver available in mmtsb . in principle , the explicit treatment of counterions and water in molecular mechanics calculations can provide increased accuracy , although the precise and efficient estimation of free energy differences between different molecular conformations remains an unsolved challenge in biomolecular simulation . base pairs of models and experimental structures were carried out with an automated annotation method based on rnaview , but implemented in the rosetta framework . the automated pair assignments were not entirely unambiguous . as an example , an ambiguity occurred for the srp motif ; base pair assignments from rnaview28 disagreed with the authoritative manual annotation15 by giving different interacting edges to a central bifurcated g - g base pair and assigning an extra hydrogen bond between two ( non - planar ) c residues ( see supplementary fig . half of the thirty - two rna motifs were randomly selected to optimize the weights on the tested score functions . two thousand rna models were generated by de novo fragment assembly , and two thousand additional native - like models were obtained by using a library of fragments drawn from the native structure rather than from the ribosome . weights on the different components of the force field ( 12 parameters for the rosetta energy function ) were optimized with the fminsearch method in matlab to maximize the sum of the z - score over the training set motifs , with the weights on the van der waals term fixed . the z - score for the force field was computed as the mean score of non - native decoys minus the mean score of the ten lowest - energy near - native models , divided by the standard deviation of non - native decoy scores . in this computation , non - native decoys with anomalously poor scores ( higher than three standard deviations from the mean ) were filtered out . results for large - scale de novo modeling for both training and test sets are given in table 1 . because weight fitting can lead to unfair bias , we also carried out our analyses on the training and test sets separately . results on the withheld test set were in fact better than for the training set ( mean z - scores of 3.61 vs 3.28;number of cases with positive energy gaps of 10 vs. 8 ; median rmsd for best of five clusters of 2.28 vs. 2.34 ; and recovery of non - watson - crick base pairs of 43% vs. 38% ) , indicating that weight over - parametrization did not occur . we recomputed the mean z - scores for native state discrimination after changing the weights of each energy function term by 50% and optimizing weights of the other scores . final z - scores changed by less than 5% despite these large perturbations , indicating a robustness to the choice of weights ; we have observed similar results in protein structure prediction ( r.d . tests of side - chain and sequence recovery were carried out on rna crystal structures with resolutions better than 2.5 without close interactions to protein partners and with bases stripped from the structures ( supplementary table 2 ) . using the same core routines as in protein side chain packing and design , the optimization of side - chain conformation and identity was carried out simultaneously at all residues ; rapid simulated annealing was aided by pre - computation of all rotamer - rotamer pairwise energies . the nucleobase rotamers were constructed with the glycosidic torsion angle set at its most probable anti value and at 1 , 1/2 , + 1/2 , and + 1 standard deviations from this central value . the central value and standard deviations were computed based on rna residues in the ribosome crystal structure for 2-endo and 3-endo sugar puckers separately . for purines , syn rotamers for the placement of the 2-oh hydrogen was also simultaneously optimized with the base rotamer ; the torsion angle defined by the c3-c2-o2-ho2 atoms was sampled at six torsion angles ( 140 , 80 , 20 , 40 , 100 , and 160 ) . a newly developed high - throughput rna preparation , chemical modification , and capillary electrophoresis readout protocol was used for thermodynamic and structure mapping experiments and is briefly summarized here . srp - motif rna constructs were prepared with sequence ggcuacgcaaguaaaacaaauuacucagguccggaaggaagcagguaaaaaccaaaccaaagaaacaacaacaacaac ( primer binding site in bold ) , or with the mutations shown in the text . dna templates including the 20 nt t7 primer sequence ( ttctaatacgactcactata ) were prepared by extension ( phusion , finnzymes , ma ) of 60 nucleotide sequences ( integrated dna technologies , ia ) , purified in qiaquick columns ( qiagen , ca ) , and used as templates for in vitro transcription with t7 polymerase ( new england biolabs , ma ) . rna was purified by phenol and chloroform extraction and buffer - exchanged into deionized water with p30 rnase - free spin columns ( biorad , ca ) . the rna ( 0.5 pmol ) was incubated at 44 c in a hybex incubator with 50 mm na - hepes , ph 8.0 , with varying concentrations of mgcl2 ; after 1 minute , dimethyl sulfate ( freshly diluted into water ) was added to a final concentration of 0.25% and final volume of 20 l . repeat reactions with a final volume of 100 l gave indistinguishable results for free energy differences between variants . after 15 minutes of modification , reactions were quenched with 0.25 volumes of 2-mercaptoethanol , oligo - dt beads ( poly(a ) purist , ambion , ca ) , and 5-rhodamine - green labeled primer ( aaaaaaaaaaaaaaaaaaaagttgttgttgttgtttcttt , 0.125 pmol ) , and purified by magnetic separation . reverse transcriptase reactions were carried out using superscript iii ( invitrogen , ca ) and 10 mm dntps ( with 2-deoxyinosine triphosphate replacing dgtp ) , and purified by alkaline hydrolysis of the rna and magnetic separation . fluorescent dna products , with a co - loaded texas - red - labeled reference ladder , were separated by capillary electrophoresis on an abi3100 dna sequencer and analyzed with specialized versions of the safa analysis scripts 29 . plots and fits of fraction folded were carried out in matlab ( mathworks , ma ) , with errors estimated by bootstrapping . free energy differences between variants with fitted mgcl2 midpoints k1 and k2 and apparent hill coefficients n1 and n2 were calculated as g = ( 1/2 ) ( n1+n2 ) kbt log ( k1/ k2 ) . this expression corresponds to a model in which the additional number of mg associated to the rna upon folding can vary linearly with log [ mgcl2 ] . an automated algorithm to parse non - canonical segments ( i.e. , residues forming base pairs besides watson - crick or g - u pairs ) , along with bounding canonical base pairs , was applied to rna crystal structures with diffraction resolutions of 3 or better , with a focus on ribozymes and riboswitches . candidate motifs that did not interact with other regions of the structure and had lengths of 20 nucleotides or less were selected . a final set of thirty - two sequence motifs and the assumed canonical base pairs ( which form boundary conditions for each motif ) are illustrated in supplementary fig . generation of de novo models was carried out by fragment assembly of rna ( farna ) , as described previously 5 , starting from extended chains with ideal bond lengths and bond angles . minor improvements to the farna score function were made to model base - backbone and backbone - backbone interactions at a coarse - grained level , as described in supplementary fig . further , small improvements in the conformational search were implemented . rather than using three - residue fragments , the fragment length was made finer , from 3 to 2 to 1 , in successive stages of monte carlo fragment assembly . in addition , variations in sugar bond - length and bond - angle geometries were recorded in the fragment library and copied during fragment insertion moves to ensure sugar ring closure . most of the motifs herein involved multiple chains connected by at least one watson - crick base pair . these canonical base pairs were assumed to form , because they are typically known a priori in rna modeling and because without these double - helical boundary constraints , rna sequences often form alternative structures ( see , e.g. , ref.18 ) . the energy function was supplemented with harmonic constraints placed between watson - crick edge atoms in the two residues that were assumed to form each bounding canonical base pair ( see supplementary fig . 2 ) . further , each de novo run was seeded with a random subset of n 1 watson - crick base pairs to define the connections between n chains by a tree - like topology for coordinate kinematics19,20 ; every ten fragment insertions , alternative base - pairing geometries , drawn from an rna database , were tested as an additional type of monte carlo move . the source of both the torsion fragments and the base pairing geometries was the refined structure of the archaeal large ribosomal subunit ( 1jj214 ) , with the sarcin - ricin loop and the kink - turn motifs excluded . using an alternative ribosome crystal structure for the fragment source ( 1vq8 ) gave indistinguishable results for , e.g. , z - scores ( see next section ) . 50,000 farna models were optimized in the context of the rosetta full - atom energy function . this energy function is a simple and transferrable function that represents an approximate free energy ( minus the conformational entropy ) for each molecular state . interactions between non - bonded atoms are modeled by pair - wise , distance - dependent potentials for van der waals forces , hydrogen bonds , the packing of hydrophobic groups , and the desolvation penalties for burying polar groups13 . based on recent work in the rosetta community on proteins and dna , three additional non - bonded terms ( supplementary fig . 8) were incorporated here and reweighted through an iterative calibration : ( 1 ) a potential for weak carbon hydrogen bonds , previously investigated for membrane proteins , ( 2 ) an alternative orientation - dependent model for desolvation based on occlusion of protein moeities , and ( 3 ) a term to approximately describe the screened electrostatic interactions between phosphates . because subtle , bond - specific quantum effects complicate the general derivation of torsional potentials , we derived preferred values for rna torsion angles and their corresponding spring constants from the ribosome crystal structure ( supplementary fig . 9 ) . more sophisticated treatments of electrostatics and the site - specific binding of water and multivalent metal ions , which are expected to be important for some rna molecules21 , will be explored in future work . combinatorial sampling of 2-oh torsions was followed by continuous , gradient - based optimization of all internal degrees of freedom by the davidson - fletcher - powell method . constraints were included to maintain bond lengths and angles within 0.02 and 2 , respectively , of ideal values and to tether atoms near their starting positions ( with harmonic constraints penalizing a 2 deviation by 1 unit ) . after removing the latter set of tethers , a second stage of 2-oh torsion optimization and minimization , steric clashes and bond geometry deviations were reduced to the level seen in experimental rna structures , as assessed by the independent molprobity toolkit ( see supplementary table 3 for a complete overview ) . to test the amber99 force field , the tinker module minimize with the gbsa keyword ( implementing the born radii of still et al.22 ) was applied to the models that had been refined with the full - atom rosetta energy function . to test the charmm27 force field , the charmm molecular mechanics program23 was applied , using the nucleic acid force field ( param27 ) 24 . the generalized born molecular volume ( gbmv ) method25,26 was used as an implicit representation of the solvent . current molecular mechanics packages do not offer the prospect of continuous minimization of model coordinates in the context of the computationally expensive non - linear poisson - boltzmann treatment of counterions ; as a first estimate of the effects of ion screening , we minimized models with the ion - free gbmv model , and then recomputed solvation energies with the poisson - boltzmann solver available in mmtsb . in principle , the explicit treatment of counterions and water in molecular mechanics calculations can provide increased accuracy , although the precise and efficient estimation of free energy differences between different molecular conformations remains an unsolved challenge in biomolecular simulation . base pairs of models and experimental structures were carried out with an automated annotation method based on rnaview , but implemented in the rosetta framework . the automated pair assignments were not entirely unambiguous . as an example , an ambiguity occurred for the srp motif ; base pair assignments from rnaview28 disagreed with the authoritative manual annotation15 by giving different interacting edges to a central bifurcated g - g base pair and assigning an extra hydrogen bond between two ( non - planar ) c residues ( see supplementary fig . half of the thirty - two rna motifs were randomly selected to optimize the weights on the tested score functions . two thousand rna models were generated by de novo fragment assembly , and two thousand additional native - like models were obtained by using a library of fragments drawn from the native structure rather than from the ribosome . weights on the different components of the force field ( 12 parameters for the rosetta energy function ) were optimized with the fminsearch method in matlab to maximize the sum of the z - score over the training set motifs , with the weights on the van der waals term fixed . the z - score for the force field was computed as the mean score of non - native decoys minus the mean score of the ten lowest - energy near - native models , divided by the standard deviation of non - native decoy scores . in this computation , non - native decoys with anomalously poor scores ( higher than three standard deviations from the mean ) were filtered out . results for large - scale de novo modeling for both training and test sets are given in table 1 . because weight fitting can lead to unfair bias , we also carried out our analyses on the training and test sets separately . results on the withheld test set were in fact better than for the training set ( mean z - scores of 3.61 vs 3.28;number of cases with positive energy gaps of 10 vs. 8 ; median rmsd for best of five clusters of 2.28 vs. 2.34 ; and recovery of non - watson - crick base pairs of 43% vs. 38% ) , indicating that weight over - parametrization did not occur . we recomputed the mean z - scores for native state discrimination after changing the weights of each energy function term by 50% and optimizing weights of the other scores . final z - scores changed by less than 5% despite these large perturbations , indicating a robustness to the choice of weights ; we have observed similar results in protein structure prediction ( r.d . tests of side - chain and sequence recovery were carried out on rna crystal structures with resolutions better than 2.5 without close interactions to protein partners and with bases stripped from the structures ( supplementary table 2 ) . using the same core routines as in protein side chain packing and design , the optimization of side - chain conformation and identity was carried out simultaneously at all residues ; rapid simulated annealing was aided by pre - computation of all rotamer - rotamer pairwise energies . the nucleobase rotamers were constructed with the glycosidic torsion angle set at its most probable anti value and at 1 , 1/2 , + 1/2 , and + 1 standard deviations from this central value . the central value and standard deviations were computed based on rna residues in the ribosome crystal structure for 2-endo and 3-endo sugar puckers separately . for purines , syn rotamers for the placement of the 2-oh hydrogen was also simultaneously optimized with the base rotamer ; the torsion angle defined by the c3-c2-o2-ho2 atoms was sampled at six torsion angles ( 140 , 80 , 20 , 40 , 100 , and 160 ) . a newly developed high - throughput rna preparation , chemical modification , and capillary electrophoresis readout protocol was used for thermodynamic and structure mapping experiments and is briefly summarized here . srp - motif rna constructs were prepared with sequence ggcuacgcaaguaaaacaaauuacucagguccggaaggaagcagguaaaaaccaaaccaaagaaacaacaacaacaac ( primer binding site in bold ) , or with the mutations shown in the text . dna templates including the 20 nt t7 primer sequence ( ttctaatacgactcactata ) were prepared by extension ( phusion , finnzymes , ma ) of 60 nucleotide sequences ( integrated dna technologies , ia ) , purified in qiaquick columns ( qiagen , ca ) , and used as templates for in vitro transcription with t7 polymerase ( new england biolabs , ma ) . rna was purified by phenol and chloroform extraction and buffer - exchanged into deionized water with p30 rnase - free spin columns ( biorad , ca ) . the rna ( 0.5 pmol ) was incubated at 44 c in a hybex incubator with 50 mm na - hepes , ph 8.0 , with varying concentrations of mgcl2 ; after 1 minute , dimethyl sulfate ( freshly diluted into water ) was added to a final concentration of 0.25% and final volume of 20 l . repeat reactions with a final volume of 100 l gave indistinguishable results for free energy differences between variants . after 15 minutes of modification , reactions were quenched with 0.25 volumes of 2-mercaptoethanol , oligo - dt beads ( poly(a ) purist , ambion , ca ) , and 5-rhodamine - green labeled primer ( aaaaaaaaaaaaaaaaaaaagttgttgttgttgtttcttt , 0.125 pmol ) , and purified by magnetic separation . reverse transcriptase reactions were carried out using superscript iii ( invitrogen , ca ) and 10 mm dntps ( with 2-deoxyinosine triphosphate replacing dgtp ) , and purified by alkaline hydrolysis of the rna and magnetic separation . fluorescent dna products , with a co - loaded texas - red - labeled reference ladder , were separated by capillary electrophoresis on an abi3100 dna sequencer and analyzed with specialized versions of the safa analysis scripts 29 . plots and fits of fraction folded were carried out in matlab ( mathworks , ma ) , with errors estimated by bootstrapping . free energy differences between variants with fitted mgcl2 midpoints k1 and k2 and apparent hill coefficients n1 and n2 were calculated as g = ( 1/2 ) ( n1+n2 ) kbt log ( k1/ k2 ) . this expression corresponds to a model in which the additional number of mg associated to the rna upon folding can vary linearly with log [ mgcl2 ] .

we present a rosetta full - atom framework for predicting and designing the non - canonical motifs that define rna tertiary structure , called farfar ( fragment assembly of rna with full atom refinement ) . for a test set of thirty - two 6-to-20-nucleotide motifs , the method recapitulated 50% of the experimental structures at near - atomic accuracy . additionally , design calculations recovered the native sequence at the majority of rna residues engaged in non - canonical interactions , and mutations predicted to stabilize a signal recognition particle domain were experimentally validated .

You are an expert at summarizing long articles. Proceed to summarize the following text: kaposi s sarcoma ( ks ) was first described in the 1800s as a rare , fairly indolent tumor of specific populations . this form of ks , now referred to as classic ks , usually presents on the skin of the lower extremities of elderly men of specific european regions and religious origins . in the middle of the twentieth century ks became endemic in parts of africa and is currently one of the most common tumors in parts of central africa ( wabinga et al . in the late twentieth century ks became one of the first aids defining illnesses and is the most common tumor of aids patients world - wide . aids associated ks is generally far more aggressive than classic ks , arising on the skin in many parts of the body as well as in the oral cavity and can occur on internal organs where it is often fatal . while they differ in aggressiveness , all forms of ks are relatively indistinguishable at the histological level . grossly , the tumors have a characteristic red to purple hue , indicative of the high vascularization of the tumor . histologically , the tumor exhibits large vascular slits lined by flattened endothelium ; the slits are often , but not always , filled with blood cells . there are discernable levels of extravasated red blood cells and infiltrating lymphocytes in the tumor . while a number of cell types are present , the tumor is predominantly made up of elongated spindle cells . the spindle cells express endothelial cell markers on their surface including cd31 and cd34 , but express low levels of factor viiira ( russell jones et al . , recent expression data and array studies have found that spindle cells most closely resemble lymphatic endothelium , expressing vegf receptor 3 ( vegfr3 ) , a specific marker of lymphatic endothelial cells ( jussila et al . , 1998 ; skobe et al . , 1999 other lymphatic endothelial cell specific markers , including lyve-1 , podoplanin , and prox-1 , are also expressed by the spindle cells ( carroll et al . based on the epidemiology and the multicentric nature of the tumor , ks was predicted to have an infectious cause ( beral et al . , , kshv was discovered associated with all ks tumors and is now considered to be the etiologic agent ( chang et al . , 1994 ) . kshv was the eighth human herpesvirus discovered and is sub - classified as a gamma herpesvirus . all of the greater than 90 viral genes are expressed , the virus replicates rapidly , produces infectious virions and ultimately causes cell death likely due to a combination of host cell shut off and virus production . during viral latency in endothelial cells , this locus includes lana , vcyc , vflip , a family of proteins from a repeat region called the kaposins , and 12 pre - micrornas encoding 17 or more mature mirnas . these latent genes are responsible for the maintenance of the latent viral episome as well as the survival of latently infected cells . in later - stage ks tumors , , 1995 ; staskus et al . , 1997 ; dupin et al . , 1999 as expected the virus is predominantly found in the latent state in spindle cells where the limited number of latent genes and mirnas are expressed ( staskus et al . , 1997 ; . however , approximately 15% of the spindle cells express lytic viral genes and produce infectious virus . in addition to spindle cells , kshv is also found in other cell types in the ks lesion including monocytes ( blasig et al . , kshv can only sporadically be detected in the endothelium lining the vascular slits in the ks tumor ( dupin et al . , 1999 ) . kshv is also associated with two lymphoproliferative diseases , primary effusion lymphoma ( pel ) a pleural cavity solid b - cell lymphoma , and plasmablastic multicentric castleman s disease , a lymph node b - cell growth ( cesarman et al . because ks is an angioproliferative disease and the ks tumors are highly vascularized even at early stages , it has been proposed that kshv may directly induce angiogenesis . endothelial cells of the vascular system are normally maintained in a quiescent , non - proliferating state . however , during solid tumor formation , the secretion of pro - angiogenic cytokines by tumor cells can activate nearby endothelial cells to induce new blood vessel formation . many of the vascular slits identified in histological sections of early stage ks lesions are lined by uninfected endothelium , suggesting they are formed by endothelial cells activated in a paracrine fashion ( dupin et al . , 1999 ) . these uninfected cells may later become infected , as kshv has , in some cases , been detected in the cells surrounding the vascular spaces of later - stage nodular ks ( boshoff et al . despite the evidence for paracrine activation of uninfected endothelial cells , kshv also likely activates infected endothelial cells in an autocrine or cell autonomous fashion . because ks spindle cells are endothelial in origin , induction of the ks tumor cell is similar to the processes of angiogenesis . many of the characteristics of activated endothelial cells and angiogenesis are also associated with oncogenesis , including proliferation , migration , and metalloprotease expression . this review discusses the recent evidence that suggests that ( 1 ) kshv promotes continual neovascularization through paracrine factors and ( 2 ) kshv may drive tumor cell growth through autocrine and cell autonomous activation of angiogenic phenotypes . the vascular endothelial growth factor ( vegf ) family of cytokines plays a prominent role in regulation of angiogenesis ( breen , 2007 ) . vegf - a and its receptors are required for embryonic vascular development and are important for vascular permeability , proliferation , and survival of newly formed vasculature . vegf - a expression is detected in spindle cells of ks lesions , and its secretion is known to be increased by inflammatory cytokines that are present in the ks lesions ( samaniego et al . , 1998 ) . vegf - a is also expressed by kshv - infected pel cell lines and conditioned media from these cells is sufficient to induce capillary morphogenesis by endothelial cells ( liu et al . , 2001 ; akula et al . , 2005 ; subramanian et al . , 2010 ) . infection of endothelial cells with kshv directly leads to increased expression of vegf - a ( masood et al . , 2002 ; sivakumar et al . , 2008 ; wang and damania , 2008 ) . further , kshv conditioned media has been shown to regulate angiogenic phenotypes in endothelial cells ( sharma - walia et al . , 2010 ) . therefore , kshv induction of vegf - a is likely to be critical for both the induction of angiogenesis as well as the activation of infected spindle cells . although the mechanisms by which kshv induces vegf - a expression and secretion are still unclear , several potential pathways have been uncovered . hypoxia induced factor ( hif)-1 is a transcription factor that has been shown to be important for upregulation of vegf - a ( sodhi et al . , 2000 ; shin et al . , 2008 ) . however , during hypoxia , hif-1 is stabilized and can induce expression of genes through hypoxia responsive elements , including vegf - a . interestingly , kshv infection of endothelial cells induces the expression of hif-1 during normoxia which leads to increased hif transcriptional activity ( carroll et al . , 2006 ) . other studies have shown that kshv encodes proteins that can lead to increased stability of hif-1 . the kshv latency associated nuclear protein ( lana-1 ) can stabilize hif-1 , through both degradation of its suppressors , von hippel lindau protein and p53 ( cai et al . , 2006 ) , and through direct interaction between hif-1 and lana-1 ( cai et al . , 2007 ) . additionally , the virally encoded interferon response factor ( virf3 ) can , like lana-1 , interact with and stabilize hif-1 , leading to increased vegf - a expression ( shin et al . , 2008 ) . the kshv viral g - protein coupled receptor ( vgpcr ) is able to increase the activity of hif-1 as a transcription factor through activation of the mapk and p38 signaling pathways and subsequent phosphorylation of hif-1 ( sodhi et al . while induction of hif mrna expression by kshv infection has been shown , stabilization of hif directly by kshv infection of endothelial cells has yet to be clearly shown . pro - angiogenic factors that are induced by kshv are indicated in red ovals , pro - lymphangiogenic factors induced by kshv are indicated in blue ovals . white ovals indicate the activated pathway necessary for kshv induction of blood to lymphatic endothelial cell differentiation . the upper left corner indicates phenotypes of angiogenesis that are activated in normal endothelium by kshv - infected cells and the gradient of cytokines secreted by kshv - infected cells is indicated by the red gradient . the blue gradient in the upper right hand corner indicates the gradient of lymphangiogenic cytokines induced by kshv - infected cells that could induce lymphangiogenesis . other host proteins have been shown to be involved in the induction of vegf - a during kshv infection of endothelial cells as well . for example , emmprin is a membrane - associated glycoprotein that promotes matrix metalloproteinase expression . its expression in kshv - infected cells promotes cell invasiveness through activation of the pi3k / akt and mapk pathways ( qin et al . further work is ongoing in multiple labs to determine the cellular pathways essential for kshv induction of vegf - a . several kshv genes expressed during lytic replication have been implicated in regulation of vegf - a expression ( table 1 ) . in bcbl-1 cells ( a pleural effusion lymphoma cell line ) , glycoprotein b ( gb ) and k8.1 are required for enhanced vegf expression ( subramanian et al . , 2010 ) . treatment of these cells with sirna or neutralizing antibodies to gb or k8.1 significantly reduced vegf - a production . vgpcr is a constitutively active signaling receptor that has been linked to a variety of cell survival and pro - angiogenic signaling pathways ( arvanitakis et al . when injected into mice , nih3t3 cells expressing vgpcr form highly vascularized tumors with some similarities to ks and this may be due , at least in part , to increased vegf - a secretion ( bais et al . , 1998 ; guo et al . vgpcr upregulates vegf - a through activation of mapk and p38 , which , as described above , promotes hif-1 activity ( sodhi et al . , 2000 ) . transgenic mice expressing vgpcr also form highly vascularized tumors that are reminiscent of ks tumors . however , cell lines derived from these tumors expressed the lymphatic growth factor vegf - c , rather than vegf - a ( guo et al . , 2003 ) . increased vegf - a expression in cells expressing vgpcr is associated with constitutive activation of its receptor , vegfr2/kdr and downstream activation of pi3k / akt , contributing to endothelial cell survival ( montaner et al . , 2001 ; bais et al . , 2003 ) . however , gb , k8.1 , and vgpcr have only been detected in cells supporting lytic kshv infection whereas the bulk of the tumor cells are latently infected . the kshv glycoprotein k1 also induces increased vegf - a expression in endothelial cells and is capable of immortalizing primary endothelial cells ( wang et al . while there is evidence that k1 is expressed at very low levels during latency , the majority of its expression occurs during lytic infection ( chandriani and ganem , 2010 ) . in summary , the lytic phase of kshv infection might play a role in the paracrine induction of angiogenesis through increased secretion of vegf - a into the tumor milieu . in addition to vegf - a , kshv - infected endothelial cells also express other angiogenic cytokines . angiopoietin-1 and -2 are ligands for the receptor tyrosine kinase tie2 . although less is known about the functions of angiopoietins and tie2 , their signaling is required for proper vascular development during embryogenesis ( dumont et al . , 1994 ) . angiopoietin-1 is an agonist for the tie2 receptor , promoting endothelial cell survival and stability . in contrast , ang2 acts as an antagonist for tie2 , although its role is context - dependent . ang2 is upregulated during pathologic angiogenesis and this expression is thought to destabilize endothelial cells , allowing them to be activated by other pro - angiogenic stimuli , such as vegf , see figure 1 , circle 1 ( gale et al . , 2002 ) . interestingly , ang2 is expressed in ks lesions , and is upregulated in endothelial cells infected with kshv ( brown et al . , 2000 ; this induction can be activated by the kshv genes vgpcr and vil-6 , and can occur through a paracrine mechanism ( vart et al . , 2007 ) . another study suggests that the mapk pathway activation of transcription factors ap-1 and ets-1 is involved ( ye et al . , 2007 ) . in addition to ang2 , cells transfected with the vgpcr gene expressed increased levels of angiopoietin - like 4 , a member of the angiopoietin - like proteins that may play a role in vascular permeability and angiogenesis ( ma et al . , 2010 ) . kshv induces a number of other cytokines known to be involved in angiogenesis in other systems . these include interleukin 6 ( il-6 ) , monocyte chemoattractant protein-1 ( mcp-1 ) , pax-1 , and prostaglandin e2 ( schwarz and murphy , 2001 ; polson et al . , 2002 ; xie et al . , 2005 ; caselli et al . , 2007 ; cyclooxygenase enzymes catalyze the rate limiting step in the conversion of arachidonic acid into prostaglandins . prostaglandins signal through g - protein coupled receptors to regulate a variety of functions , including metabolic , neuronal , and immune functions . cyclooxygenase-2 ( cox-2 ) expression is induced early during kshv infection of endothelial cells and plays a role in the establishment of latency ( naranatt et al . , 2004 ; sharma - walia et al . , this expression is associated with increased secretion of prostaglandin e2 , which promotes inflammatory cytokine expression , cell survival , and angiogenesis ( sharma - walia et al . , 2010 ) . an additional cellular factor associated with angiogenesis , angiogenin , is induced in endothelial cells by the latent protein , lana-1 . angiogenin was recently shown to aid in induction of angiogenesis by both vegf and basic fibroblast growth factor ( sadagopan et al . , 2009 ) . kshv - induced angiogenin was able to promote endothelial cell migration and capillary morphogenesis ( sadagopan et al . , 2009 ) . since angiogenin is internalized by both infected and uninfected cells , the authors suggested angiogenin may work in both paracrine and autocrine fashions . in fact , all kshv - induced cytokines that act on endothelial cells have the potential to promote angiogenesis - like phenotypes on the endothelial - derived spindle cells . kshv not only upregulates pro - angiogenic cytokines , it may also promote angiogenesis through repression of angiogenic inhibitors . the kshv latent locus encodes for 17 mirnas which may play a role in downregulation of angiogenic gene expression ( cai et al . , 2005 ; expression of 10 of these mirnas in 293 cells altered the expression of 81 genes ( samols et al . , 2007 ) . thrombospondin-1 plays multiple roles in the repression of angiogenesis , however one of its main functions is activation of the anti - angiogenic growth factor transforming growth factor- ( tgf- ) . this study found that thrombospondin-1 contains 34 putative mirna binding sites , and can be downregulated by multiple kshv mirnas ( samols et al . , 2007 ) . therefore , downregulation of anti - angiogenic factors may be an important way by which kshv promotes continual neovascularization . the kshv genome itself encodes for cytokine and chemokine - like factors that activate endothelial cells and stimulate angiogenesis ( table 1 ) . among these factors are three genes with homology to the cellular chemokine macrophage inflammatory protein , the vmips i iii ( boshoff et al . in addition to having chemoattractant properties , these proteins promoted neovascularization in the chick chorio - allantoic membrane angiogenesis assay ( boshoff et al . , 1997 ; stine et al . , 2000 ) . kshv also encodes a viral homolog of interleukin 6 ( il-6 ) , a pro - inflammatory and pro - angiogenic cytokine . this cytokine , when expressed in nih3t3 cells , promoted secretion of vegf - a ( aoki et al . furthermore , when these cells were injected into mice , they gave rise to tumors more quickly than control cells and the tumors were more highly vascularized ( aoki et al . the viral il-6 ( vil-6 ) is mostly detected in endothelial cells and spindle cells undergoing lytic replication but like k1 it has been shown to be expressed at very low levels in latently infected pel cells and to be induced during latency only under specific conditions ( chatterjee et al . , 2002 ; chandriani et al . , 2010 ) . in summary , conditioned media from kshv - infected cells can induce angiogenic phenotypes in uninfected endothelial cells as indicated by the red gradient in figure 1 . kshv infection of endothelial cells induces expression of a number of cytokines that are capable of inducing angiogenesis in a paracrine fashion . paramount among these is vegf - a , an angiogenic cytokine that is induced by kshv infection of endothelial cells . while the predominant viral mechanism of vegf - a induction is unknown , a number of lytic kshv genes are sufficient to induce vegf - a when overexpressed . kshv - infected cells also produce a number of other angiogenic cytokines of cellular and viral origin that likely play a role in the induction of angiogenesis . taken together , all of the cytokines and induced pathways likely create a milieu that is beneficial to the induction of new blood vessels and play a significant role in the high vascularization of ks tumors . therefore ks tumor formation is likely to include increased angiogenic capacity of the spindle cells . there is growing evidence demonstrating the manipulation of host cell phenotypes by kshv and the role of these changes in the promotion of angiogenesis related phenotypes . these infected cell phenotypes include increased stability of tubules formed by macrovascular endothelial cells , induction of capillary morphogenesis in low growth factor conditions , and enhanced migration and invasion ( qian et al . , 2007 ; sadagopan et al . , 2007 , 2009 ; wang and damania , 2008 ; couty et al . , 2009 ; dimaio et al . , additionally , kshv induces the expression of vegf receptors on the surface of infected endothelial cells as discussed below . breakdown of these junctions is necessary for initiation of angiogenesis , immune cell extravasation , and tumor cell metastasis . interestingly , several studies have evaluated the adherens junctions of kshv - infected endothelial cells and found them to be perturbed ( mansouri et al . , 2008 ; qian et al . , 2008 ; guilluy et al . , , 2008 ; qian et al . , 2008 ) as well as disruption of ve - cadherin therefore , kshv infection can directly initiate a key angiogenic step , the breakdown of cell cell adherence . while the direct mechanism of kshv - induced disruption of adherens junctions during latency is not known , there are a number of candidate kshv genes that could be involved ( table 1 ) . the kshv - encoded ubiquitin ligase protein , k5 , targets ve - cadherin for degradation ( mansouri et al . , 2008 ) . overexpression of the kshv vgpcr induces endothelial cell permeability and downregulation of cell surface ve - cadherin as well ( dwyer et al . , 2011 ) . k5 also targets other cellular proteins , including platelet / endothelial cell adhesion molecule-1 ( pecam-1 , cd31 ) , a transmembrane protein important for endothelial cell cell communication , which could contribute to barrier dysfunction and increased permeability ( tomescu et al . , 2003 ; mansouri et al . , k1 , a primarily lytic protein that may also be expressed at low levels during latency was also shown to initiate signaling similar to that required for disruption of cadherin signaling ( guilluy et al . , 2011 ) . while the exact viral mechanism of disruption of adherens junctions by kshv infection is not known , the virus encodes multiple genes capable of altering cadherin . during angiogenesis , endothelial cells migrate from the pre - existing vasculature toward the site of angiogenic stimulus . endothelial cells exhibit enhanced migration and invasion following latent kshv infection ( dimaio et al . kshv - infected cells also express increased levels of the matrix metalloproteinases mmp-1 , -2 , and -9 ( qian et al . , 2007 ) . mmp proteins break down the extracellular matrix supporting stable vasculature to allow for invasion and migration of endothelial cells during angiogenesis ( figure 1 , circle 2 ) . expression of mmp proteins induced by kshv allows for increased invasion of both infected and uninfected endothelial cells ( wang et al . while these processes constitute one component of angiogenesis , they are also known to play roles in oncogenesis ( gialeli et al . , 2011 ) indicating that kshv activation of angiogenic phenotypes in endothelial cells may lead to enhanced oncogenesis as well . endothelial cells grown in three - dimensional culture will migrate and organize into capillary - like structures . this activity is dependent , at least in part , on growth factors and cytokines present in the matrix or growth media . kshv - infected cells are able to undergo capillary morphogenesis in low growth factor conditions to a greater extent than uninfected cells ( wang and damania , 2008 ) . this could be partially due to increased cytokine secretion from kshv - infected cells . in fact , when endothelial cells are cultured in the presence of conditioned media from kshv - infected bcbl-1 cells , their ability to organize into capillary - like structures is increased ( wang and damania , 2008 ) . however , the effect of bcbl-1 conditioned media was greater on kshv - infected endothelial cells than on mock - infected cells , suggesting that infected cells are more receptive to angiogenic growth factors . in addition , this same study found that capillary - like structures formed by kshv - infected endothelial cells are more persistent than mock - infected cells , indicative of the promotion of cell survival and continual angiogenesis by kshv ( wang and damania , 2008 and our unpublished results ) . kshv latent infection of endothelial cells also induces vegf receptor expression , which may allow infected cells to respond more robustly to vegfs . vegf receptors 1 and 2 play roles in angiogenesis while 2 and 3 play a role in lymphangiogenesis ( described below ) . while kshv infection has not been reported to alter the expression levels of vegfr2 ( kdr ) , vegfr1 expression is significantly increased following kshv endothelial cell infection ( carroll et al . , 2004 ) . drugs that inhibited hif-1 activation and signaling also inhibited vegfr1 upregulation ( carroll et al . , 2006 ) . vegfr1 has been described as both a positive and negative regulator of angiogenesis depending on the context . vegfr1 mouse knockouts have higher levels of angiogenesis ( fong et al . , 1995 ) . however , in cell culture models , vegfr1 has been shown to potentiate angiogenesis ( cao , 2009 ) . more studies will be needed to determine the importance of increased vegfr1 expression in kshv infection and ks tumor formation . interestingly , expression of vegfr3 , the main receptor for vegf - c and d is also significantly increased by kshv infection ( carroll et al . , 2004 ; hong et al . , 2004 ) vegfr3 , a receptor specific to lymphatic endothelium and critical for lymphangiogenesis will be discussed below . importantly , endothelial tip cells at the leading edge of new vascular protrusions are the only main adult cell type known to express both the blood endothelial cell receptor , vegfr1 , and the lymphatic endothelial cell receptor , vegfr3 ( tammela et al . , 2008 ) : kshv infection of endothelial cells directly induces expression of both of these receptors . the mechanisms by which kshv induces angiogenic phenotypes in latently infected cells are largely unknown . a number of angiogenic phenotypes are likely to be a direct result of the cytokine milieu of the infected cells . as described above , kshv - infected cells secrete both viral and host cytokines that are sufficient to induce angiogenic phenotypes . however , it is also apparent that some of the angiogenic effects seen in latently infected cells are cell autonomous , independent of either paracrine or autocrine factors . as described above , conditioned media from pel cells had stronger effects on tubule formation of kshv - infected endothelial cells ( akula et al . , 2005 ) . we have also recently found that kshv infection induces the pro - angiogenic integrin , integrin 3 , during latent infection ( dimaio et al . , 2011 ) . induction of integrin 3 leads to increased cell surface expression of the v3 integrin heterodimer . we have further shown that latently infected endothelial cells become more adherent to the integrin ligands fibronectin and vitronectin , and are more migratory than mock - infected cells . although both uninfected and infected cells organize in three - dimensional cultures in complete media , infected cells are more sensitive to inhibitors of integrin 3 and its downstream signaling molecules , such as src kinase ( dimaio et al . , 2011 ) . this suggests that during latent kshv infection there is a shift in endothelial cell signaling that results in a more angiogenic phenotype dependent on v3 expression on the surface of the cell ( figure 1 , center ) . therefore , kshv alteration of endothelial cell signaling pathways can dramatically affect how the cell responds to intra- and extra - cellular signals . these changes that lead to alterations in angiogenic properties are likely to play a role in the growth and cell cell interactions of infected cells , thereby playing a role in ks tumor formation . during development of the vascular system , a subset of endothelial cells in the cardinal vein begin to express markers of lymphatic differentiation , including the master regulatory gene , prox-1 . these cells then bud from the cardinal vein , differentiate into lymphatic endothelial cells , and form the lymphatic vascular system ( wigle and oliver , 1999 ) . immunohistochemistry of ks tumors showed that spindle cells express markers of lymphatic endothelium , suggesting these cells may arise from primary infection of lymphatic endothelial cells , rather than blood endothelial cells ( jussila et al . , 1998 ; skobe et al . , 1999 ; weninger et al . , 1999 ; pyakurel et al . , 2006 ) . an alternative hypothesis is that kshv infection of blood endothelial cells drives differentiation toward a more lymphatic phenotype . this idea is supported by evidence that kshv infection of blood endothelial cells promotes expression of lymphatic - specific genes , including prox-1 , vegfr3 , podoplanin , and lyve-1 , effectively driving the reprogramming of blood endothelial cells to become lymphatic endothelium ( carroll et al . microarray analysis comparing kshv - infected blood endothelial cells to blood and lymphatic endothelial cells indicate that kshv - infected blood endothelial cells have gene expression profiles that align more closely to lymphatic endothelial cells than that of blood endothelial cells ( carroll et al . , 2004 ; the kshv latent gene kaposin b can directly promote the stability of prox-1 mrna ( yoo et al . , 2010 ) leading to increased expression of prox-1 . however , this effect was not sufficient to induce prox-1 expression in blood endothelial cells . we recently found that induction of blood to lymphatic endothelial cell reprogramming requires signaling through the cellular receptor gp130 . endothelial cells that are latently infected with kshv have increased expression and signaling of gp130 ( morris et al . , 2008 ) . this leads to activation of the jak / stat3 pathway and the pi3k / akt pathway leading to expression of lymphatic - specific genes starting with prox-1 . inhibition of this pathway by sirnas that target gp130 or akt or pharmacological inhibitors that block pi3 kinase or jak2/stat3 signaling is sufficient to block lymphatic differentiation ( see figure 1 , center ) . kshv vil-6 is sufficient to induce gp130 activation and we recently found that vil-6 is sufficient to induce lymphatic differentiation ( morris et al . , 2012 ) . however , kshv lacking vil-6 is still able to cause blood to lymphatic endothelial cell differentiation , indicating that kshv has evolved multiple strategies to activate gp130 and induce blood to lymphatic endothelial cell differentiation ( morris et al . , 2008 ) . induction of lymphatic differentiation by kshv is only part of the story , however . despite the expression of lymphatic - specific genes , blood endothelial cells infected with kshv retain expression of some blood specific markers ( wang et al . , 2004a ) . additionally , infection of lymphatic endothelial cells with kshv induces expression of blood specific markers ( wang et al . , 2004a ) . kshv mirnas were found to target the transcription factor maf ( hansen et al . , 2010 ) . downregulation of maf in lymphatic endothelial cells by sirna restored expression of blood endothelial markers , such as vegfr1 and cxcr4 . thus , infection of blood or lymphatic endothelial cells by kshv alters host gene expression to an intermediate state between the two cell types . as described above , this intermediate phenotype with both vegfr1 and r3 expression is only present in the leading tip of endothelial cells involved in active neo - angiogenesis . in the ks lesions only lana+ cells expressed prox-1 , indicating that this effect requires kshv gene expression ( hong et al . , 2004 ) . this suggests that differentiation toward lymphatic endothelial cells may specifically allow the spindle cells to respond to lymphangiogenic growth factors . in fact , kshv infection of endothelial cells induces both vegf - a and vegf - c ( sivakumar et al . , 2008 ) . therefore , induction of both vegfr1 and r3 allow kshv - infected cells to respond to key angiogenic and lymphangiogenic factors in the tumor environment . the direct role of kshv reprogramming of blood endothelial cells to lymphatic in induction of angiogenic and lymphangiogenic phenotypes is still under investigation . the highly vascular nature of ks tumors and the large amounts of neo - angiogenesis in the tumor led to the proposal that the etiologic agent of the tumor might directly induce angiogenesis . in accordance with this hypothesis kshv infection of endothelial cells , in particular , kshv induces the expression of vegf - a and -c and other cytokines as well as encoding angiogenic cytokines from its own genome ( boshoff et al . , 1997 ; aoki et al . , 1999 ; brown et al . , 2000 ; stine et al . , 2000 ; schwarz and murphy , 2001 ; masood et al . , 2002 ; polson et al . , 2002 ; wang et al . , 2004b ; xie et al . , 2005 ; caselli et al . , 2007 ; vart et al . , 2007 ; ye et al . , 2007 sivakumar et al . , 2008 ; wang and damania , 2008 ; sadagopan et al . additionally , because the tumor cell is endothelial in nature , induction of angiogenic cytokines may also activate the tumor cells and aid in the growth of ks tumors . kshv also induces angiogenic phenotypes directly in latently infected cells in a cell autonomous fashion , indicating that angiogenic activation of the infected endothelial cell may directly play a role in tumor formation . while kshv activates many growth - signaling properties and in general the induction of angiogenic phenotypes supports endothelial cell proliferation , in most cultures kshv does not induce increases in endothelial cell proliferation . it is possible that the cell culture milieu simply does not match the tumor milieu . ks spindle cells are not fully transformed ex vivo and , except in very rare cases , have a limited life span indicating that factors in the tumor environment that come from other cells types could be necessary to maintain ks spindle cell growth . the increase in growth could also be masked by the fact that endothelial cells in culture are rapidly dividing and therefore do not need additional growth signals . along those lines , that being said , the endothelial cell transforming potential of kshv in culture can be unmasked given specific conditions . dermal microvascular endothelial cells that were immortalized with the e6 and e7 genes from papillomavirus are readily transformed by kshv , including increased proliferation ( moses et al . , 1999 ) . therefore , kshv activation of endothelial cells can induce a proliferative advantage in the correct genetic environment . however , it is unknown if viral induction of angiogenic phenotypes is necessary for the growth in the e6/e7 immortalized endothelial cells . in general , viruses do not evolve to cause cancer , as it is likely a dead end for transmission . kshv likely evolved to activate the cell where it is maintained to ensure survival and spread of the virus . a major side effect of this activation may be providing an ideal environment for angiogenesis leading to increased vascularization of small tumor growths and expansion of ks tumors . while the study of viral induction of angiogenesis can lead to a better understanding of how kshv causes endothelial cell tumors , information gleaned from the study of viral mechanisms of induction of angiogenesis and lymphangiogenesis will also lead to a better understanding of endothelial cell activation and tumor angiogenesis in general . thus , the study of kshv infection of endothelial cells provides a controlled system for analyzing the regulation and induction of angiogenic phenotypes that will likely shed light on the field of tumor angiogenesis . the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .

kaposi s sarcoma ( ks ) is a highly vascularized tumor supporting large amounts of neo - angiogenesis . the major cell type in ks tumors is the spindle cell , a cell that expresses markers of lymphatic endothelium . kshv , the etiologic agent of ks , is found in the spindle cells of all ks tumors . considering the extreme extent of angiogenesis in ks tumors at all stages it has been proposed that kshv directly induces angiogenesis in a paracrine fashion . in accordance with this theory , kshv infection of endothelial cells in culture induces a number of host pathways involved in activation of angiogenesis and a number of kshv genes themselves can induce pathways involved in angiogenesis . spindle cells are phenotypically endothelial in nature , and therefore , activation through the induction of angiogenic and/or lymphangiogenic phenotypes by the virus may also be directly involved in spindle cell growth and tumor induction . accordingly , kshv infection of endothelial cells induces cell autonomous angiogenic phenotypes to activate host cells . kshv infection can also reprogram blood endothelial cells to lymphatic endothelium . however , kshv induces some blood endothelial specific genes upon infection of lymphatic endothelial cells creating a phenotypic intermediate between blood and lymphatic endothelium . induction of pathways involved in angiogenesis and lymphangiogenesis are likely to be critical for tumor cell growth and spread . thus , induction of both cell autonomous and non - autonomous changes in angiogenic and lymphangiogenic pathways by kshv likely plays a key role in the formation of ks tumors .

You are an expert at summarizing long articles. Proceed to summarize the following text: a well - constructed removable partial denture ( rpd ) can be an adequate treatment option for the partially edentulous patient [ 1 , 2 ] . the prosthesis is supported by the framework via teeth contact and by the distal extension base . the loading of the kennedy class i is complicated by the mismatch of tissue resiliency and the abutment teeth which have different viscoelastic responses . the soft tissue under load has a displacement range of 350500 m , whereas a sound tooth has a displacement of 20 m under the same load . this mismatch of support will result in the transmission of torque forces to the abutment teeth via a rotational movement of the rpd . in 1984 watt and macgregor linked tooth mobility to the torque forces that are developed against the abutment teeth . in addition , the rotational movement of the rpd is directed towards the underlying soft tissue , and as a result the torque force in the soft tissue is then transmitted as a shearing force , which progressively causes resorption of residual ridges . one of the recurrent problems associated with a bilateral distal extension rpd stems from the loading of the edentulous ridge . while the above issues are detrimental to the patients tissues the rpd typically remains undamaged . the most common failure of the rpd is predominantly due to fatigue of the clasp unit and incorrect casting or poor design of the framework [ 814 ] . the above issues associated with kennedy class i rpds have led to the use of posterior implants to resolve the biological issue . placing two implant abutments distally in the mandible has been recommended to transform a kennedy class i rpd into a tooth and implant assisted removable partial denture ( iarpd ) ( or pseudo - kennedy class iii ) [ 15 , 16 ] . implants in conjunction with a kennedy class i rpd were used for the first time in the early 1970s , and since then clinical trials have indicated good implant survival rates [ 1619 ] . it is also well accepted that the use of implants to stabilize and support mandibular prostheses can increase maximum muscular function [ 15 , 1922 ] . however , several studies have reported complications , such as screw loosening , framework fracture , loosening of healing caps , fracture of framework , and/or acrylic denture bases [ 18 , 23 , 24 ] . results from a multicenter randomized clinical trial of twenty - four patients fitted with an iarpd opposing a maxillary complete denture showed that after 12 months maintenance was required in 58.3% of the test group requiring intervention due to matrix activation / deactivation , loss of clasp retention , and fracturing of the iarpd acrylic . . explained how important it is to consider the loading situation in the mandible because of the significant displacement of the denture base if it is not supported by the major connector . in a clinical report by carpenter it was reported that it would be best to construct a new rpd , indicating that this could avoid the major complication for iarpds , which is the fracture of the acrylic around the implant attachment housing . carpenter recommended the iarpd should be well reinforced , with metal around the location of the implant attachments . kaufmann et al . , in an 8-year followup of implant supported removable appliances , which included iarpds , found that technical complications were a regular occurrence . in the first year there was a very high rate of technical complications , mostly related to the anchorage system ( matrices ) of root copings and implants . the cause of the complications can be linked to the additional forces placed on the prostheses and the altered support structure that needs to resist these forces . verri et al . used finite element analysis to measure the influence of the occlusal forces on iarpds . they verified that there was no reduction in the tension forces on the abutment teeth , but there was a reduction in the support required from the posterior half of the residual ridge . bilateral balanced occlusion is suggested as an option for distal extension iarpd , to evenly distribute forces across the prosthesis ; however , such an occlusal design is not easily achievable especially when the antagonist arch is fully dentate . there are currently no studies comparing the effects of bilateral versus unilateral loading on kennedy class i iarpd . conducted a single blind randomized crossover study of 5 partially edentulous patients ( kennedy class i ) . the study showed that the masticatory force and contact areas were greater and more distally located following placement of an iarpd . 's finite element analysis study of the influence of the location of the implants in association with an iarpd found that maximum stress was located around the implant in all situations . the aim is to better understand the strain distribution in a kennedy class i implant assisted removable partial denture under various loading conditions . the hypothesis is that the location of the occlusal load will not alter the way the strain is transferred to the iarpd . a mandibular clinical kennedy class i situation was duplicated using two components , polyurethane and silicone . easycast is a two - component rigid polyurethane compound with a shore hardness scale of 65d . the easycast was covered with a silicone layer ( degudent , deguform , germany ) to simulate the soft tissue . to standardize the experimentation the silicone covering the edentulous area was kept at a constant thickness of 2 millimetres . to achieve a uniform silicone layer the edentulous ridge areas of the mandibular model were covered with 2 mm of wax to simulate the maximum soft tissue thickness . a matrix was made with condensation silicone putty ( sil - tech ivoclar vivadent ag , schaan / liechtenstein ) . after removing the wax , deguform was injected into the matrix , and the uniform silicone layer was produced . the silicone material used has a shore hardness a of 14 to 16 , which is comparable to human soft tissue , which ranges from 16 to 21 . the implants and the interface between the root and pdl were considered to be bonded ; the movement of the teeth was not considered [ 31 , 32 ] . the properties of the periodontal ligament ( pdl ) reported in the literature are highly variable . ruse highlights the flawed pdl modulus of elasticity values used in various fea articles . the average hardness value for pdl - alveolar bone is 0.42 0.1 gpa , alveolar bone is 0.56 0.1 gpa , tubular dentin is 0.64 0.1 gpa , cementum is 0.5 0.1 gpa , and pdl - cementum is 0.5 0.2 gpa . factors such as size and shape of the root , thickness , loading direction , and nonlinear properties make pdl difficult to consider [ 34 , 35 ] . the model of the mandible was a rigid polyurethane compound with a shore hardness d of 65 . this study did not load the prothesis to failure so the influence of the pdl and cementum and bone hardness were considered to be minor . the volume ratio of trabecular bone to cortical bone depends on the type of bone and varies with age and gender . the mandible has been classified as having a flat bone structure and flat bone can have a ratio of 25 : 75 of cortical to trabecular bones . the overall stiffness of the bone was considered by taking the average , based on the relative volume of each bone type . it was calculated as follows : ( 1)eaverage = [ ( volume croticale - mod crotical ) + ( volume trabeculare - mod trabecular ) ] (volume crotical+volume trabecular)1 . the elastic modulus 14.7 gpa for cortical bone and 0.49 gpa for trabecular bone was considered to be well represented by the rigid polyurethane compound used in this study . a conventional cobalt - chrome molybdenum partial denture kennedy class i rpd with a lingual bar , mesial occlusal rests , and i bar clasps on the first premolar abutments was fabricated ( wironit , bego , bremer goldschlgereiwilh , germany ) . vishay sr-4 general purpose strain gages ( vishay electronic gmbh , germany ) were first placed on the fitting surface of the metal framework in a previously prepared slot to accommodate the strain gage thickness . in order to measure small changes in resistance , the strain gauges used had a wheatstone bridge arrangement with a voltage excitation . the voltage recorded needed to be converted to a resistance change value and then ultimately to a strain value . to find the resistance changes from voltage excitation in the wheatstone bridge , the gauge factor was calculated first . all values obtained from the strain gauges were placed in the equation below to calculate microstrain values . as the voltage excitation for the powerlab system is 2.5 volts ( vin = 2.5 ) the equation was modified to ( 2)=2.5dvoutgf . therefore , by placing the value of the output voltage in the strain equation , the value of strain could be calculated . the gauges type was 3057 cea-06 - 015uw-120 ( vishay electronic gmbh , germany ) , with the temperature coefficient of resistance of + 0.59% per degrees celsius over a temperature range of + 10 to + 65 degrees celsius ( vishay technical note manual ) . the nominal resistance for the gauges was 120 , and the gauges dimensions were 0.15 mm . two strain gages were placed perpendicular to one another in the mesial area of the metal framework . a further four strain gages were placed on the metal framework , around each implant site . a further twelve strain gages were then placed on the acrylic surface with the same orientation as on the metal framework ( figures 1(a ) and 1(b ) ) . a 2.2 mm diameter pilot drill ( number 044.211 ) ( straumann group , six : stmn , basel , switzerland ) was used initially , followed by a 2.8 mm diameter drill ( number 044.216 ) , and finally a 3.5 mm diameter drill ( number 044.219 ) . standard regular neck ( 4.8 mm ) iti straumann dental implants were placed into the model in the region of the first molar . easycast resin - based material was poured into the holes and the implants were screwed into place and left for 72 hours to cure . ball attachments were then placed on the implants and screwed down . then the retentive caps ( straumann titanium matrix , 048.450 ) were placed on the ball abutments , and the partial denture was relined with chemical - cured acrylic to secure the retentive caps in place . a load of 120 n was applied at a crosshead speed of 0.05 mm / sec using an instron 3369 universal testing machine ( instron , norwood , ma , usa ) . two steel bars with different widths were used for the bilateral loading condition . a wider bar that covered all the denture teeth was used for the uniform loading , and a narrower bar was used to cover only the selected premolar and molar teeth . for the uniform unilateral condition a thin silicone layer was placed between the bar and the teeth to distribute the forces more evenly . the silicone was placed on top of the teeth and a small amount of load was applied with the loading machine to ensure that even loading was achieved . the embedding of the bar into the silicone also minimized displacement of the steel bar during loading . a small v - shaped groove was created in the bar to locate the tip of the loading point accurately for the bilateral loading , whereas the uniform loading could be done by directly loading with a flat loading point fitted to the instron ( figures 2(a ) , 2(b ) , 2(c ) , 3(a ) , 3(b ) , and 3(c ) ) . the prosthesis was loaded , bilaterally and unilaterally , in the anterior premolar region , posterior molar region , and uniformly covering the premolar and molar regions . the data were detected as volts and recorded with chart 5 software and powerlab system ( ad instrument , sydney , australia ) . data was presented as a graph and the highest points for all of the test cycles were manually recorded and converted to strain . chicago , il , usa ) with an alpha level of 0.05 to compare the maximum strain values of all three loading conditions . predominantly all the three loading situations produced high tensile strain in the mesial area of the ridge in the buccal direction . premolar loading produced lower strain around the implants compared to the mesial area of the iarpd . uniform loading developed a similar force distribution as per premolar loading , with a small decrease of strain in the mesial area ( table 1 ) . statistical analysis of the highest microstrain values of all three loading conditions showed that there were significant differences ( p < 0.001 ) in the mesial area of the distal extension in the buccolingual direction . the maximum strain values in the mesiobuccal area of the distal extension are shown in figure 4 to illustrate consistency of data and provide a comparison of the acrylic areas . among the three loading conditions , molar loading showed the lowest strain values and had the most consistent maximum strain . premolar loading produced high tensile strain in the mesial area of the residual ridge in the buccal direction , while relatively high it was proportionally lower than the strain around the implants . during molar loading higher tensile strain was recorded in general , while compressive strain was measured in the anterior direction in the mesial area of the iarpd . premolar loading produced the highest tensile strain around the implant area with moderate compressive strain in the mesial area ( table 1 ) . because both implant and mesial areas of the distal extensions showed high strain values under different loading conditions , it was important to identify whether the differences were statistically significant . chicago , il , usa ) to compare maximum strain in all three loading conditions . the comparison showed a highly significant increase in the mean strain ( p < 0.001 ) around the mesial area of the distal extension in the buccolingual direction as the loading point moved forward . in contrast , a significant decrease of the mean strain ( p < 0.001 ) was observed in the buccolingual direction around the implant area as the loading point moved forward . a correlation analysis in figure 5 shows the reverse correlation when moving the load forward with an increase in the maximum strain ( r = 0.985 ) . during the bilateral loading , molar loading showed more even distribution of strain around both the mesial and implant areas of the acrylic . the maximum strain values of the bilateral loading conditions for the framework and acrylic base were compared . unscrambler x v10.1 software ( the unscrambler x , camo , norway ) was used to draw a 3d scatter plot graph . molar loading resulted in lower strain and the best matching of the strain between the framework and acrylic ( figure 6 ) . premolar loading produced tensile strain in the anterior direction in the mesial of the metal framework , while compressive strain was also evident in the buccal direction in that same area . uniform loading also produced similar strain patterns as the premolar and molar loading , but produced the lowest strain , except for the buccal gage around the implant ( table 1 ) . of the three loading conditions , the highest strain values were recorded in the mesial area of the distal extension . 0.001 ) between the maximum strain of all three loading conditions , and as the loading point moved forward there was a significant increase in the compression strain . premolar loading generated compressive strain in the mesial of the ridge with higher strain in the anterior direction . the strain around the implant was tensile with higher strain in the buccal and lingual directions . molar loading produced the highest tensile strain in the mesial area of the ridge in the buccal direction , but in the anterior direction under the same loading condition there was compressive strain present . again a similar pattern was seen in the mesial area , but of a lesser intensity ( table 1 ) . the uniform unilateral loading showed less strain in both the framework and acrylic structures with more evenly distributed strain than premolar and molar loading . however , there was a mismatch of strain type , the acrylic was in tension , and framework was in compression during all unilateral loading conditions ( figure 7 ) . the focus of this in vitro study was to investigate how the iarpd distributed occlusal load , to better understand the way an iarpd transmits occlusal load . the incorporation of ball attachments into existing kennedy class i rpd has led to subsequent increase maintenance of the iarpd . the area that appears to be most affected is predominantly around the implant attachment , resulting in attachment failure and/or acrylic fracture [ 18 , 23 , 24 ] . this fundamentally changes the load dynamics and gives more stability and support to the patient , which in turn increases masticatory loading [ 15 , 16 , 20 , 22 , 37 , 38 ] . the hypothesis that the location of the occlusal load will not alter the way the strain is transferred to the iarpd is rejected . bilateral loading provides more stability and consequently generates more on the occlusal rest arms . during unilateral loading of an iarpd the curvature of the dental arch created more displacement laterally as well as vertically . an off - axis lever is created , resulting in a twisting of the metal structure , and as the load was moved forward the effect of the twisting increased . the twisting also increased the tissue response against the acrylic and resulted in greater tension on the external surface of the acrylic . the metal structure is not in contact with the implant and twisting of the rigid lingual bar resulted in compressive strain being developed on the metal surface . since the implant attachment provides resistance to displacement most of the this study has certain limitations : ( 1 ) the strain patterns developed in iarpds are complex , and the strain gauges measure the surface strain at certain points and in pre - determined directions ; ( 2 ) the implant osseointegration and the physiological mobility of the abutment teeth were not considered ; ( 3 ) this study only looks at one iarpd design and does not consider the numerous designs that could be adopted . this study is only able to provide insight into the strain developed within this particular model ; ( 4 ) controlled loading conditions were investigated , namely , unilateral and bilateral ; unilateral loading imitated a fully dentate maxillary and bilateral loading simulated a patient with a complete maxilla denture . the physiological mobility of abutment teeth is unclear and potentially problematic to reproduce having one consistent material simulating the abutment and pdl produces more reliable results . in a finite element study by ichim et al . it was found that the strains in the mid - corpus and lower border of the mandible remain essentially the same regardless of the changes in the elastic modulus of the pdl . each loading situation was tested 10 times on the iarpd ; one test model was developed to limit the variables that could occur when using multiple models . the 120 n load selected represents a load relative to a standard bite force for a patient with an rpd and was a load that the polyurethane model could repeatedly withstand without deforming . loading the premolar and molar uniformly resulted in strain development throughout the iarpd , rather than local strain . as the loading point is moved forward , the strain is more evenly distributed between the two supporting structures . this strain pattern is typical of a beam structure , with forces inwardly directed relative to the implant and occlusal rest . the iarpd acts like a typical beam due to the implant and occlusal rest restraining it from vertical movement . therefore , moving the load closer to a supporting structure should reduce the amount of deflection in the beam . however , the beam deflection behavior was not always present ; this was due to additional resistance from the soft tissue on one side of the model . increases in tissue displacement resulted in greater flexural resistance , and consequently , higher strain developed on the acrylic surface . there were significant differences ( p < 0.001 ) between the maximum strain values for the three loading conditions . the microstrain - time plot for the distobuccal gauge shown in figure 8 provides further information about the microstrain behaviour during loading and unloading . during the loading phase , the microstrain - time curve changed its slope just prior to reaching a maximum value during the loading phase . the contacting of the supporting tissue during the loading phase limited the flexure of the denture and thereby reduced the gradient of strain . a possible explanation is that as the load continued to increase , the prosthesis was in contact with the silicone , and further increase in load deflected both the acrylic and also the underlying silicone resulting in a lower rate of strain increase . during the unloading phase a gradual decline of microstrain values was observed during the initial unloading stage due to the recovery of the structure as the load was released . as indicated above , the acrylic made contact with tissue , so during unloading , initially the acrylic will recover , and the adhesion of the tissue will add additional force ( the slight rise ) before it releases . the loading of the structure was also influenced by the location of the load and the supporting structures , which creates a lever . the implant and rest ( resistance arm ) are not in alignment with the effort arm ( figure 9 ) . bilateral loading minimized lateral displacement through the rest arms , but moving the loading point forward increases the length of the effort arm and as a result generates greater mechanical advantage . this resulted in more displacement and a larger tissue response and consequently a greater strain on the acrylic surface . the strain on the metal around the implant was not influenced by moving the loading area forward . this is understandable as the metal structure did not have direct contact with the implant , but it did have support via the occlusal rests placed on the abutment teeth . hence , the occlusal rest arms support the metal structure . during bending the tensile forces are generated on the bottom surface of the structure and the top acrylic is put into compression . as acrylic is weak in tension and has a low elastic modulus , it is preferable that most of the flexural tensile forces are carried by the metal structure . during loading , the metal framework helps reduce the flexure of the structure and lowers the tensile developed on the inner surface of the acrylic . therefore , the rigidity of the metal structure in the neutral axis is important when limiting deflection . in general , during unilateral loading the metal surface was subject to compressive strain , and the acrylic was in tension . the implant attachment provides retention and additional resistance to displacement during unilateral loading resulting in the strain being transferred to the areas surrounding the implant . there was a significant strain increase in the buccal of the mesial ridge area , from 59.1 strain to 234 strain as the loading point was changed from uniform to the molar area . the then changes from a tensile to a compressive strain when the load point was moved to the premolar area . in contrast to bilateral loading , which gives the prosthesis more vertical stability , unilateral loading can result in simultaneous vertical and lateral displacement . a possible explanation for the strain pattern seen during unilateral loading is the curvature of the dental arch . the occlusal rest arm on the same side as the load will no longer act as a vertical support , but rather act as a fulcrum point during displacement and cause twisting of the structure . since the implant provides retention , it could be expected that most of the strain will be formed around the implant during the twisting effect . however , the metal structure is not in contact with the implant and twisting of the very rigid lingual bar results in a compressive strain being developed on the metal surface . this twisting will increase the tissue response against the acrylic and result in much greater tensile force on the external surface of the acrylic . therefore , as the load moves forward , the effect of twisting becomes greater and results in greater compressive strain occurring around the mesial area of the ridge ( figure 10 ) . this study reinforces the results found in ohkubo et al . which showed in a clinical study that there was an increase in distal loading after the placement of an iarpd . 's finite elemental analysis study also identified that maximum stress was located around the implant area in iarpds . this study illustrates that destructive strain patterns are present that could lead to the fracture of the iarpd acrylic . unilateral loading created lateral and vertical displacement of the iarpd , which can result in strains and associated stresses on the major and minor connectors.unilateral uniform loading of the iarpd generates a destructive strain correlation between the framework and acrylic base ( acrylic in tension and framework in compression).the curvature of the dental arch created a fulcrum during unilateral loading which resulted in a twisting of the structure and as the load moved forward the effect of the twisting increased.bilateral loading minimized lateral displacement , but when the load is moved forward the effect of the effort arm generated more strain on the occlusal rests . unilateral loading created lateral and vertical displacement of the iarpd , which can result in strains and associated stresses on the major and minor connectors . unilateral uniform loading of the iarpd generates a destructive strain correlation between the framework and acrylic base ( acrylic in tension and framework in compression ) . the curvature of the dental arch created a fulcrum during unilateral loading which resulted in a twisting of the structure and as the load moved forward the effect of the twisting increased . bilateral loading minimized lateral displacement , but when the load is moved forward the effect of the effort arm generated more strain on the occlusal rests .

purpose . this in vitro study investigates how unilateral and bilateral occlusal loads are transferred to an implant assisted removable partial denture ( iarpd ) . materials and methods . a duplicate model of a kennedy class i edentulous mandibular arch was made and then a conventional removable partial denture ( rpd ) fabricated . two straumann implants were placed in the second molar region , and the prosthesis was modified to accommodate implant retained ball attachments . strain gages were incorporated into the fitting surface of both the framework and acrylic to measure microstrain ( strain ) . the iarpd was loaded to 120ns unilaterally and bilaterally in three different loading positions . statistical analysis was carried out using spss version 18.0 ( spss , inc . , chicago , il , usa ) with an alpha level of 0.05 to compare the maximum strain values of the different loading conditions . results . during unilateral and bilateral loading the maximum strain was predominantly observed in a buccal direction . as the load was moved anteriorly the strain increased in the mesial area . unilateral loading resulted in a twisting of the structure and generated a strain mismatch between the metal and acrylic surfaces . conclusions . unilateral loading created lateral and vertical displacement of the iarpd . the curvature of the dental arch resulted in a twisting action which intensified as the unilateral load was moved anteriorly .

You are an expert at summarizing long articles. Proceed to summarize the following text: type 2 diabetes is characterized by chronic hyperglycemia resulting in microvascular and macrovascular complications which may contribute to an increased risk of early cardiovascular morbidity and early mortality . now - a - days , the primary approach for type 2 diabetes management is steadily and continuously blood glucose control , with the aim of decreasing the risk of diabetic complications . a diabetes outcome progression trial ( adopt ) , which compared three antidiabetic agents currently available for the treatment of type 2 diabetes , showed that in terms of glycemic control , rosiglitazone showed a long - term glycemic control . since metformin and rosiglitazone act through different mechanisms , their combined use may be indicated in patients whose disease is poorly controlled with a maintenance dose of metformin . studies have shown that rosiglitazone in combination with metformin can decrease glycated hemoglobin ( hba1c ) while increase insulin sensitivity and improve -cell function . at present , china has listed the compound tablet containing a fixed dose of rosiglitazone and metformin , avandamet , which may improve patient compliance . data showed that , due to the increased number of patients with medication , it was very difficult to long - term adherence to their drug regimen . a compound tablet containing two different fixed dose drugs due to a different mechanism can reduce the number of medication , maintaining a more strict glycemic control , improving the compliance of patients with general . the aim of this randomized open study was to compare the efficacy and safety of avandamet and up titrated metformin in patients uncontrolled with metformin alone . patients aged 1865 years who have been diagnosed with type 2 diabetes ( defined according to world health organization criteria ) inadequately controlled with metformin were considered for this 48-week , multicenter , randomized , open - label , parallel group study . the study was conducted in accordance with good clinical practice guidelines and the 1996 version of the declaration of helsinki . written informed consent the study protocol and informed consent were approved by the ethics committee of peking university people 's hospital according to local requirements . participants with body mass index ( bmi ) 24 kg / m , 7.5% hba1c 9.5% , 7 mmol / l fasting plasma glucose ( fpg ) 15 mmol / l at screening , receiving 0.751.0 g metformin alone at constant dosage for at least 6 weeks prior to entry were included in this trial . exclusion criteria included : ( 1 ) treatment with glucose - lowing agents other than metformin within 12 weeks before screening ; ( 2 ) allergic to thiazolidinedione or their ingredients ; ( 3 ) treatment with exogenous insulin or receiving insulin within 12 weeks before screening ; ( 4 ) history of diabetic ketoacidosis ; ( 5 ) hemoglobin disease or chronic anemia with the level of hemoglobin < 11.0 g / dl ( male ) or < 10.0 g / dl ( female ) ; ( 6 ) a history of kidney dysfunction with serum creatinine levels reaching 135 mol / l ( male ) or 110 mol / l ( female ) ; ( 7 ) alanine aminotransferase or aspartate aminotransferase > 2.5 times the upper limit of normal , suffering from hepatic disease ; ( 8) type 1 diabetes , gestational diabetes , or other type of diabetes ( mody , et al . ) ; ( 9 ) a history of ischemic heart disease or heart failure according to the new york heart association classification class i iv ; ( 10 ) patients taking nitrates ; ( 11 ) ongoing edema requiring pharmacological treatment ; ( 12 ) systemic blood pressure > 170 mmhg or diastolic blood pressure > 100 mmhg while on anti - hypertensive treatment ; ( 13 ) any chronic disease requiring continuous intermittent treatment with corticosteroids ; ( 14 ) breastfeeding , pregnant or planning pregnancy women ( women of childbearing age before interview one to use effective contraception for at least 1 month ) ; ( 15 ) patients with abnormality during screening by the investigator judgement ; ( 16 ) active drug or alcohol abuse within the last 6-month or any associated condition that could preclude completion of the study ; ( 17 ) patients probably accept the iodinated contrast agent during study duration ; ( 18 ) electrocardiogram with qtc > 500 ms or unadjusted qt > 600 ms ; or patients with bundle branch block with qtc > 530 ms . this was a 48-week , multicenter , randomized , open - label , parallel group study , consisting of a screening visit and 48-week of follow - up after randomization . in an open regimen , patients were randomized into two groups receiving avandamet 4 mg/1000 mg or metformin 1500 mg as the initial daily dose . four weeks later , for each treatment group , drug dosage was increased to the maximum dosage ( 8 mg/2000 mg of avandamet or 2500 mg of metformin daily ) according to the protocol . if fpg level > 7.0 mmol / l ( 126 mg / dl ) and the maximum dosage was not reached , a dose increase was required at each visit ; while a dose reduction was permitted if adverse events ( aes ) occurred . the first patient was recruited on november 19 , 2009 and the last patient completed follow - up visit on march 15 , 2011 . the authors confirm that all ongoing and related trials for this drug / intervention are registered . the primary efficacy outcome is the percentage of patients who reached the target hba1c ( hba1c 7% ) at week 48 in avandamet treatment group and metformin treatment group . hypothesis was made as that the between group difference more than 15% of the percentage of patients who reached hba1c 7% at week 48 suggested that superiority was reached . the secondary outcomes included : ( 1 ) changes in hba1c from baseline ; ( 2 ) changes in fpg and prandial plasma glucose ( ppg ) from baseline ; ( 3 ) percentage of patients reached hba1c 6.5% at week 48 ; ( 4 ) percentage of patients with the changes from baseline in hba1c 0.7% in avandamet group and metformin group ; ( 5 ) changes in fasting insulin from baseline . all aes were recorded and judged by an investigator as the severity and possible relationship to study medication . safety laboratory assessments ( hematology and biochemistry ) and vital signs were assessed at each study visit . mild - to - moderate hypoglycemia was defined if the patient had symptoms or a self - measured capillary glucose level ( cg ) < 63 mg / dl ( 3.5 mmol / l ) . severe hypoglycemia was defined as any episode requiring assistance of another person with the cg below 2.8 mmol / l , unless the clinical situation prevented obtaining cg measurement . hba1c , fasting insulin and lipids profile were measured centrally at randomization and every 3 months . hba1c was measured by high - performance liquid chromatography ( ultra2 hba1c detector , primus corporation , usa ) . fpg , ppg , levels of low - density lipoprotein cholesterol ( ldl - c ) , high - density lipoprotein cholesterol ( hdl - c ) , and triglyceride were measured by immunonephelometry method ( cobas integra 400 plus system , roche diagnostics ltd . , insulin level was measured by electrochemiluminescence immune assay ( elecsys 2010 system , roche diagnostics ltd . , outline of study assessments aes : adverse events ; bmi : body mass index ; ecg : electrocardiogram ; -hcg : beta - human chorionic gonadotropin ; fpg : fasting plasma glucose ; ppg : prandial plasma glucose ; hba1c : glycated hemoglobin ; tc : total cholesterol ; ldl - c : low - density lipoprotein cholesterol ; hdl - c : high - density lipoprotein cholesterol ; tg : triglyceride ; alt : alanine aminotransferase ; ast : aspartate aminotransferase ; alp : alkaline phosphatase ; t - bil : total bilirubin ; bun : blood urea nitrogen ; cre : creatinine ; crp : c - reactive protein ; fins : fasting insulin . a sample size of 400 patients ( 200 avandamet and 200 metformin - uptitrated ) was required to ensure 85% power to detect a superiority difference of 15% in avandamet treated patients who achieve the target hba1c ( 7% ) to metformin - uptitrated treated patients ( i.e. , assuming in metformin monotherapy group 50% of patients at the end of the study achieving hba1c 7% , 65% of patients in avandamet group achieving hba1c 7% were needed ) at the level of = 0.05 ( two - sided ) . assuming 15% of loss rate and 15% of screening failure rate , totally there were 554 patients needed to be screened and 471 patients needed to be randomized , to ensure that ultimately 400 patients complete the study . the primary endpoint , the percentage of patients who achieved the target hba1c ( hba1c 7% ) at week 48 , was compared between avandamet treatment group and metformin treatment group by chi - square analysis . other efficacy analyses for continuous variables were compared by using a one - way analysis of variance test while frequency of dichotomous variables was performed by chi - square analysis . this group comprised all randomized patients who were treated with at least one dose of study medication , had a baseline hba1c measurement and had at least one on - treatment hba1c measurement . safety analyses conducted on the treated patients data set included all patients who received at least one dose of study medication . regression techniques were applied to assess the associations of variables with all continuous and categorical endpoints , respectively . patients aged 1865 years who have been diagnosed with type 2 diabetes ( defined according to world health organization criteria ) inadequately controlled with metformin were considered for this 48-week , multicenter , randomized , open - label , parallel group study . the study was conducted in accordance with good clinical practice guidelines and the 1996 version of the declaration of helsinki . written informed consent the study protocol and informed consent were approved by the ethics committee of peking university people 's hospital according to local requirements . participants with body mass index ( bmi ) 24 kg / m , 7.5% hba1c 9.5% , 7 mmol / l fasting plasma glucose ( fpg ) 15 mmol / l at screening , receiving 0.751.0 g metformin alone at constant dosage for at least 6 weeks prior to entry were included in this trial . exclusion criteria included : ( 1 ) treatment with glucose - lowing agents other than metformin within 12 weeks before screening ; ( 2 ) allergic to thiazolidinedione or their ingredients ; ( 3 ) treatment with exogenous insulin or receiving insulin within 12 weeks before screening ; ( 4 ) history of diabetic ketoacidosis ; ( 5 ) hemoglobin disease or chronic anemia with the level of hemoglobin < 11.0 g / dl ( male ) or < 10.0 g / dl ( female ) ; ( 6 ) a history of kidney dysfunction with serum creatinine levels reaching 135 mol / l ( male ) or 110 mol / l ( female ) ; ( 7 ) alanine aminotransferase or aspartate aminotransferase > 2.5 times the upper limit of normal , suffering from hepatic disease ; ( 8) type 1 diabetes , gestational diabetes , or other type of diabetes ( mody , et al . ) ; ( 9 ) a history of ischemic heart disease or heart failure according to the new york heart association classification class i iv ; ( 10 ) patients taking nitrates ; ( 11 ) ongoing edema requiring pharmacological treatment ; ( 12 ) systemic blood pressure > 170 mmhg or diastolic blood pressure > 100 mmhg while on anti - hypertensive treatment ; ( 13 ) any chronic disease requiring continuous intermittent treatment with corticosteroids ; ( 14 ) breastfeeding , pregnant or planning pregnancy women ( women of childbearing age before interview one to use effective contraception for at least 1 month ) ; ( 15 ) patients with abnormality during screening by the investigator judgement ; ( 16 ) active drug or alcohol abuse within the last 6-month or any associated condition that could preclude completion of the study ; ( 17 ) patients probably accept the iodinated contrast agent during study duration ; ( 18 ) electrocardiogram with qtc > 500 ms or unadjusted qt > 600 ms ; or patients with bundle branch block with qtc > 530 ms . this was a 48-week , multicenter , randomized , open - label , parallel group study , consisting of a screening visit and 48-week of follow - up after randomization . in an open regimen , patients were randomized into two groups receiving avandamet 4 mg/1000 mg or metformin 1500 mg as the initial daily dose . four weeks later , for each treatment group , drug dosage was increased to the maximum dosage ( 8 mg/2000 mg of avandamet or 2500 mg of metformin daily ) according to the protocol . if fpg level > 7.0 mmol / l ( 126 mg / dl ) and the maximum dosage was not reached , a dose increase was required at each visit ; while a dose reduction was permitted if adverse events ( aes ) occurred . the first patient was recruited on november 19 , 2009 and the last patient completed follow - up visit on march 15 , 2011 . the authors confirm that all ongoing and related trials for this drug / intervention are registered . the primary efficacy outcome is the percentage of patients who reached the target hba1c ( hba1c 7% ) at week 48 in avandamet treatment group and metformin treatment group . hypothesis was made as that the between group difference more than 15% of the percentage of patients who reached hba1c 7% at week 48 suggested that superiority was reached . the secondary outcomes included : ( 1 ) changes in hba1c from baseline ; ( 2 ) changes in fpg and prandial plasma glucose ( ppg ) from baseline ; ( 3 ) percentage of patients reached hba1c 6.5% at week 48 ; ( 4 ) percentage of patients with the changes from baseline in hba1c 0.7% in avandamet group and metformin group ; ( 5 ) changes in fasting insulin from baseline . all aes were recorded and judged by an investigator as the severity and possible relationship to study medication . safety laboratory assessments ( hematology and biochemistry ) and vital signs were assessed at each study visit . mild - to - moderate hypoglycemia was defined if the patient had symptoms or a self - measured capillary glucose level ( cg ) < 63 mg / dl ( 3.5 mmol / l ) . severe hypoglycemia was defined as any episode requiring assistance of another person with the cg below 2.8 mmol / l , unless the clinical situation prevented obtaining cg measurement . hba1c , fasting insulin and lipids profile were measured centrally at randomization and every 3 months . hba1c was measured by high - performance liquid chromatography ( ultra2 hba1c detector , primus corporation , usa ) . fpg , ppg , levels of low - density lipoprotein cholesterol ( ldl - c ) , high - density lipoprotein cholesterol ( hdl - c ) , and triglyceride were measured by immunonephelometry method ( cobas integra 400 plus system , roche diagnostics ltd . , insulin level was measured by electrochemiluminescence immune assay ( elecsys 2010 system , roche diagnostics ltd . , outline of study assessments aes : adverse events ; bmi : body mass index ; ecg : electrocardiogram ; -hcg : beta - human chorionic gonadotropin ; fpg : fasting plasma glucose ; ppg : prandial plasma glucose ; hba1c : glycated hemoglobin ; tc : total cholesterol ; ldl - c : low - density lipoprotein cholesterol ; hdl - c : high - density lipoprotein cholesterol ; tg : triglyceride ; alt : alanine aminotransferase ; ast : aspartate aminotransferase ; alp : alkaline phosphatase ; t - bil : total bilirubin ; bun : blood urea nitrogen ; cre : creatinine ; crp : c - reactive protein ; fins : fasting insulin . sas version 9.2 ( sas institute inc . , usa ) was used for all analyses . a sample size of 400 patients ( 200 avandamet and 200 metformin - uptitrated ) was required to ensure 85% power to detect a superiority difference of 15% in avandamet treated patients who achieve the target hba1c ( 7% ) to metformin - uptitrated treated patients ( i.e. , assuming in metformin monotherapy group 50% of patients at the end of the study achieving hba1c 7% , 65% of patients in avandamet group achieving hba1c 7% were needed ) at the level of = 0.05 ( two - sided ) . assuming 15% of loss rate and 15% of screening failure rate , totally there were 554 patients needed to be screened and 471 patients needed to be randomized , to ensure that ultimately 400 patients complete the study . the primary endpoint , the percentage of patients who achieved the target hba1c ( hba1c 7% ) at week 48 , was compared between avandamet treatment group and metformin treatment group by chi - square analysis . other efficacy analyses for continuous variables were compared by using a one - way analysis of variance test while frequency of dichotomous variables was performed by chi - square analysis . this group comprised all randomized patients who were treated with at least one dose of study medication , had a baseline hba1c measurement and had at least one on - treatment hba1c measurement . safety analyses conducted on the treated patients data set included all patients who received at least one dose of study medication . regression techniques were applied to assess the associations of variables with all continuous and categorical endpoints , respectively . five hundred and eighty - eight patients who met the inclusion criteria were recruited for the study . at the end of run - in period , 398 patients who still met the inclusion criteria were randomly assigned into avandamet treatment group and metformin treatment group , while 156 participants in avandamet treatment group and 160 participants in metformin treatment group were included in the fas [ figure 1 ] . baseline characteristics of patients between avandamet treatment group and metformin treatment group were comparable except that the average duration of diabetes in avandamet group was significantly longer than that in metformin group ( 3.56 3.49 years vs. 2.73 3.10 years , p = 0.01 ) [ table 2 ] . baseline characteristics of the patients * * baseline characteristics were comparable between the two groups except for diabetic duration ( p = 0.01 ) . bmi : body mass index ; sbp : systolic blood pressure ; dbp : diastolic blood pressure . the percentage of patients who did not complete the study did not differ significantly between avandamet group and metformin group ( 23.23% vs. 24.00% , p > 0.05 ) . baseline characteristics of the lost - to - follow - up patients did not differ from those who completed the study . baseline characteristics of the lost - to - follow - up patients between avandamet group and metformin group did not differ either . the primary efficacy outcome is the percentage of patients reached hba1c 7% at week 48 in avandamet group and metformin group . at the end of week 48 , the percentage of patients who reached hba1c 7% was 83.33% in avandamet group and 70.00% in metformin group ( p < 0.01 ) . however , according to the protocol , the significance for the superiority of avandamet treatment to metformin treatment was not reached ( < 15% ) . the percentage of patients who reached hba1c 6.5% in the two groups was 66.03% and 46.88% respectively ( p < 0.01 ) [ table 3 ] . at week 48 , the average level of hba1c in avandamet group and metformin group was 6.78% 0.94% and 7.03% 0.89% respectively ( p < 0.01 ) , hba1c change from baseline at week 48 was 1.49% 0.05% and 1.18% 0.09% respectively ( p < 0.01 ) . changes of hba1c during the 48-week were shown in figure 2 . comparisons of changes from baseline at week 48 between avandamet and metformin ci : confidence interval ; hba1c : glycated hemoglobin ; fpg : fasting plasma glucose ; ppg : prandial plasma glucose ; fins : fasting insulin ; means not applicable . changes of glycated hemoglobin , fasting plasma glucose , prandial plasma glucose and fasting insulin during 48 weeks in avandamet group and metformin group . in terms of fpg , at week 48 , the percentage of patients who reached fpg 6.1 mmol / l was 26.97% in avandamet group and 19.33% in metformin group without significance . the percentage of patients who reached fpg 7.0 mmol / l was 63.16% and 43.33% respectively ( p < 0.01 ) . at week 48 , the average fpg was 7.06 2.18 mmol / l and 7.66 2.05 mmol / l respectively ( p < 0.01 ) in the two groups , fpg change from baseline at week 48 was 1.98 0.17 mmol / l respectively ( p < 0.01 ) . at week 48 , the average ppg level was 10.61 3.17 mmol / l and 11.86 3.55 mmol / l respectively ( p < 0.01 ) , ppg decreased from baseline at week 48 was 3.09 0.27 mmol / l and 1.85 0.27 mmol / l respectively ( p < 0.01 ) [ table 3 ] . changes of fpg and ppg during 48 weeks were shown in figure 2 . at week 24 and week 48 , changes of fasting insulin from baseline in avandamet group was 3.89 1.01 u / ml and 3.24 0.98 u / ml respectively , while in metformin group , changes of fasting insulin from baseline was 2.40 0.98 u / ml and 0.72 1.10 u / ml respectively . comparisons between the two treatment groups showed significant difference both at week 24 and week 48 . changes of fasting insulin during 48 weeks were shown in figure 2 . at week 48 , the average body weight was 74.95 12.89 kg in avandamet group and 72.66 12.02 kg in metformin group . body weight decreased from baseline in the two groups was 0.09 0.32 kg and 2.46 1.03 kg respectively ( p < 0.01 ) . at week 48 , changes of cholesterol from baseline in avandamet group and metformin group were 0.33 1.09 mmol / l and 0.23 0.99 mmol / l respectively , with significant difference ( p < 0.01 ) . changes of triglyceride from baseline in avandamet group and metformin group were 0.05 1.52 mmol / l and 0.32 1.80 mmol / l respectively , with significant difference ( p < 0.05 ) . changes of hdl - c from baseline in avandamet group and metformin group were 0.09 0.36 mmol / l and 0.02 0.29 mmol / l respectively , with significant difference ( p < 0.01 ) . changes of ldl - c from baseline in avandamet group and metformin group were 0.27 0.94 mmol / l and 0.05 0.80 mmol / l respectively , with significant difference ( p < 0.01 ) . at week 48 , changes of hypersensitive c - reactive protein ( crp ) from baseline in avandamet group and metformin group were 1.06 4.10 and 0.35 6.50 respectively , with significant difference ( p < 0.01 ) . over 48 weeks , both treatment regimens were generally well tolerated . the proportion of patients experiencing any ae ( including hypoglycemia ) was 24.24% ( avandamet - treated patients ) and 31.50% ( metformin - treated patients ) . serious ae ( saes ) were comparable between groups ( 1.52% in avandamet - treated patients vs. 2.00% in metformin - treated patients , p > 0.05 ) [ table 4 ] . the most commonly reported aes ( occurring in > 5% of avandamet - treated patients vs. metformin - treated patients ) were abdominal discomfort ( 7.1% vs. 9.5% , p > 0.05 ) , dyslipidemia ( 7.6% vs. 8.5% , p > 0.05 ) , upper respiratory tract infection ( 6.6% vs. 6.5% , p > 0.05 ) , edema ( 6.6% vs. 0.5% , p < 0.01 ) , diarrhea ( 3.5% vs. 11.5% , p < 0.01 ) and constipation ( 4.5% vs. 0.5% , p < 0.01 ) . hypoglycemic rate in avandamet group was 0.51% while 2.00% in metformin group ( p > 0.05 ) . there were no cases of heart failure in either treatment group , but two occurrence of angina pectoris in avandamet treated patients . one is a 61-year - old female patient who was incharged into hospital for the treatment of angina pectoris with the investigator judgement as probably correlated with study drug and discontinued avandamet treatment . another is a 51-year - old female patient who was incharged into hospital with the investigator judgement as probably not correlated with study drug and continued avandamet treatment . both patients recovered and discharged from hospital soon . aes , hypoglycemia between the two groups ( n ) aes : adverse events ; sae : serious adverse event . five hundred and eighty - eight patients who met the inclusion criteria were recruited for the study . at the end of run - in period , 398 patients who still met the inclusion criteria were randomly assigned into avandamet treatment group and metformin treatment group , while 156 participants in avandamet treatment group and 160 participants in metformin treatment group were included in the fas [ figure 1 ] . baseline characteristics of patients between avandamet treatment group and metformin treatment group were comparable except that the average duration of diabetes in avandamet group was significantly longer than that in metformin group ( 3.56 3.49 years vs. 2.73 3.10 years , p = 0.01 ) [ table 2 ] . baseline characteristics of the patients * * baseline characteristics were comparable between the two groups except for diabetic duration ( p = 0.01 ) . bmi : body mass index ; sbp : systolic blood pressure ; dbp : diastolic blood pressure . the percentage of patients who did not complete the study did not differ significantly between avandamet group and metformin group ( 23.23% vs. 24.00% , p > 0.05 ) . baseline characteristics of the lost - to - follow - up patients did not differ from those who completed the study . baseline characteristics of the lost - to - follow - up patients between avandamet group and metformin group did not differ either . the primary efficacy outcome is the percentage of patients reached hba1c 7% at week 48 in avandamet group and metformin group . at the end of week 48 , the percentage of patients who reached hba1c 7% was 83.33% in avandamet group and 70.00% in metformin group ( p < 0.01 ) . however , according to the protocol , the significance for the superiority of avandamet treatment to metformin treatment was not reached ( < 15% ) . the percentage of patients who reached hba1c 6.5% in the two groups was 66.03% and 46.88% respectively ( p < 0.01 ) [ table 3 ] . at week 48 , the average level of hba1c in avandamet group and metformin group was 6.78% 0.94% and 7.03% 0.89% respectively ( p < 0.01 ) , hba1c change from baseline at week 48 was 1.49% 0.05% and 1.18% 0.09% respectively ( p < 0.01 ) . comparisons of changes from baseline at week 48 between avandamet and metformin ci : confidence interval ; hba1c : glycated hemoglobin ; fpg : fasting plasma glucose ; ppg : prandial plasma glucose ; fins : fasting insulin ; means not applicable . changes of glycated hemoglobin , fasting plasma glucose , prandial plasma glucose and fasting insulin during 48 weeks in avandamet group and metformin group . in terms of fpg , at week 48 , the percentage of patients who reached fpg 6.1 mmol / l was 26.97% in avandamet group and 19.33% in metformin group without significance . the percentage of patients who reached fpg 7.0 mmol / l was 63.16% and 43.33% respectively ( p < 0.01 ) . at week 48 , the average fpg was 7.06 2.18 mmol / l and 7.66 2.05 mmol / l respectively ( p < 0.01 ) in the two groups , fpg change from baseline at week 48 was 1.98 0.17 mmol / l respectively ( p < 0.01 ) . at week 48 , the average ppg level was 10.61 3.17 mmol / l and 11.86 3.55 mmol / l respectively ( p < 0.01 ) , ppg decreased from baseline at week 48 was 3.09 0.27 mmol / l and 1.85 0.27 mmol / l respectively ( p < 0.01 ) [ table 3 ] . at week 24 and week 48 , changes of fasting insulin from baseline in avandamet group was 3.89 1.01 u / ml and 3.24 0.98 u / ml respectively , while in metformin group , changes of fasting insulin from baseline was 2.40 0.98 u / ml and 0.72 1.10 u / ml respectively . comparisons between the two treatment groups showed significant difference both at week 24 and week 48 . at week 48 , the average body weight was 74.95 12.89 kg in avandamet group and 72.66 12.02 kg in metformin group . body weight decreased from baseline in the two groups was 0.09 0.32 kg and 2.46 1.03 kg respectively ( p < 0.01 ) . at week 48 , changes of cholesterol from baseline in avandamet group and metformin group were 0.33 1.09 mmol / l and 0.23 0.99 mmol / l respectively , with significant difference ( p < 0.01 ) . changes of triglyceride from baseline in avandamet group and metformin group were 0.05 1.52 mmol / l and 0.32 1.80 mmol / l respectively , with significant difference ( p < 0.05 ) . changes of hdl - c from baseline in avandamet group and metformin group were 0.09 0.36 mmol / l and 0.02 0.29 mmol / l respectively , with significant difference ( p < 0.01 ) . changes of ldl - c from baseline in avandamet group and metformin group were 0.27 0.94 mmol / l and 0.05 0.80 at week 48 , changes of hypersensitive c - reactive protein ( crp ) from baseline in avandamet group and metformin group were 1.06 4.10 and 0.35 6.50 respectively , with significant difference ( p < 0.01 ) . the proportion of patients experiencing any ae ( including hypoglycemia ) was 24.24% ( avandamet - treated patients ) and 31.50% ( metformin - treated patients ) . serious ae ( saes ) were comparable between groups ( 1.52% in avandamet - treated patients vs. 2.00% in metformin - treated patients , p > 0.05 ) [ table 4 ] . the most commonly reported aes ( occurring in > 5% of avandamet - treated patients vs. metformin - treated patients ) were abdominal discomfort ( 7.1% vs. 9.5% , p > 0.05 ) , dyslipidemia ( 7.6% vs. 8.5% , p > 0.05 ) , upper respiratory tract infection ( 6.6% vs. 6.5% , p > 0.05 ) , edema ( 6.6% vs. 0.5% , p < 0.01 ) , diarrhea ( 3.5% vs. 11.5% , p < 0.01 ) and constipation ( 4.5% vs. 0.5% , p < 0.01 ) . hypoglycemic rate in avandamet group was 0.51% while 2.00% in metformin group ( p > 0.05 ) . there were no cases of heart failure in either treatment group , but two occurrence of angina pectoris in avandamet treated patients . one is a 61-year - old female patient who was incharged into hospital for the treatment of angina pectoris with the investigator judgement as probably correlated with study drug and discontinued avandamet treatment . another is a 51-year - old female patient who was incharged into hospital with the investigator judgement as probably not correlated with study drug and continued avandamet treatment . both patients recovered and discharged from hospital soon . aes , hypoglycemia between the two groups ( n ) aes : adverse events ; sae : serious adverse event . the aim of this randomized open study was to compare the efficacy of avandamet and up titrated metformin in patients uncontrolled with metformin alone in a chinese population . avandamet treatment for 48-week in patients poorly controlled with metformin alone led to statistically significant and clinically relevant reductions in hba1c , fpg and ppg . compared with metformin up titreated treatment , treatment with avandamet also showed trends toward a greater proportion of patients achieving hba1c < 7% as well as achieving hba1c < 6.5% . results concluded from this study were comparable with that of the previous published studies in caucasians . fonseca et al . reported in a study that after 26 weeks , compared with metformin - placebo treatment , rosiglitazone - metformin treatment led to a 1% in hba1c decreased and 2.2 mmol / l in fpg decreased . rosenstock et al . reported from a randomized open - label trial that after 24 weeks of avandamet treatment , the average hba1c decreased 4.0% 2.2% and the average fpg decreased 7.7 4.4 mmol / l , as well as 33% patients reached the target of hba1c 6.5% . in another randomized double - blinded trial , after 32 weeks of avandamet treatment , the average hba1c decreased 2.3% and the average fpg decreased 4.1 mmol / l with significance , and about 60% and 77% patients with avandamet treatment reached the target of hba1c 6.5% and hba1c 7% respectively , which was higher than the proportion of patient receiving metformin treatment . borges et al . in an 80-week randomized double - blinded trial reported that , the avandamet treatment was superior to metformin treatment both in hba1c and fpg . in terms of fasting insulin , results from this study indicated that avandamet treatment led to a decrease of fasting insulin more than metformin treatment , which was also in adherence with previous reports . kahn et al . concluded from the results of adopt that compared with sulfonylurea , both rosiglitazone and metformin can decrease fasting insulin level , improving insulin sensitivity . combinated with rosiglitazone or pioglitazone showed that , except for glucose improving , metformin combinated with rosiglitazone decreased fasting and postprandial insulin level significantly . a 6-month small study in chinese also showed that metformin combination with rosiglitazone could decrease fasting and postprandial insulin level , which indicated that insulin resistance improving . according to results from this study , compared with up titrated metformin treatment , avandamet treatment was associated with less reduction in body weight as well as less decrease in lipid profile . in fonseca et al . 's study , total cholesterol , hdl - c and ldl - c were significantly higher in rosiglitazone - metformin treatment and body mass was increased compared with metformin - placebo control group . reasons for the increasing of lipid profile may be associated with the mechanism of glucotoxicity improvement or different percentage of usage of lipid lowering therapy between groups , or other reasons we still no know . the weight gain in avandamet group might be associated with fluid retention or increased appetite which was explained in other studies previously . the more reduction of crp in avandamet group might be associated with the efficacy in lowering free fatty acid or other inflammation factors . there was no significant difference of the number of aes and saes between the two groups . the incidence rate of diarrhea in patients with avandamet treatment was significantly lower than that of patients in metformin group , while the incidence rate of edema with avandamet treatment was significantly higher . the types of aes as well as the incidence rate of total aes of this trial were similar with those results of other clinical trials . in addition , no case of heart failure in either treatment group was reported during the 48-week of follow - up , but two occurrences of angina pectoris in avandamet treated patients were reported . both patients recovered and discharged from hospital soon , one continued the study drug while the other one discontinued . of course , longer duration and with the primary endpoint of study is needed to evaluate the cardiovascular outcome of avandamet treatment in the future . although some of our study design was similar with that of previous studies carried out in caucasians , there are some different points . first , this study was carried out in chinese type 2 diabetes patients , which is a totally different ethnic population . ethnicity difference might be associated with the incidence of type 2 diabetes as well as the treatment efficacy on glucose control or -cell function or body weight changes , therefore , results from this study will give us the answer whether the superior efficacy of avandamet treatment to metformin treatment alone could be shown in a chinese population . secondly , baseline characteristics of patients were different from previous studies in caucasian population such as bmi , hba1c , fpg , duration of diabetes and so on . results from different kinds of patients may result in a different conclusion , therefore , we just want to see whether the efficacy of rosiglitazone combination with metformin treatment was superior to that of up titrated metformin treatment . third , different dosage forms between our study and other studies . in most previous study , they prescribed patients with metformin plus placebo or metformin plus rosiglitazone . in our study , we prescribed patients only one tablet with avandamet or metformin . what 's more , study duration in this trial was 48-week , which is a longer duration for us to evaluate the efficacy of avandamet treatment . according to the result concluded from this study in chinese type 2 diabetes patients , avandamet treatment led to a higher proportion of patients achieving hba1c < 7% compared with metformin although the superiority was not reached . clinical significance for this result might indicate that for poorly controlled chinese type 2 diabetes patients with metformin alone , avandamet treatment instead of up titrated metformin may be a good choice for glycemic control and insulin resistance improvement . reasons for that might be the combination mechanisms of rosiglitazone and metformin , the possible better adherence of avandamet treatment than up titrated metformin . comparable results concluded from this study in chinese type 2 diabetes patients also indicated that there may be no ethnicity difference in avandamet treatment . first , patients who lost follow - up in avandamet group and metformin group were 23.23% and 24.00% respectively , the rate of which exceeded the expected lose rate ( abscission rate up to not more than 15% ) , which may be the reasons for this study that failed to demonstrate the superiority of avandamet treatment with respect to the higher dose of metformin monotherapy . but there was no significant difference in the abscission rate between groups with the p value of 0.9063 , and the baseline characteristics of patients completed the trial as well as those of patients withdrawn did not show any significant difference between the avandamet group and metformin group either ( data was shown in supplement material ) , which might indicate that the higher loss rate was not resulted from different treatment group . secondly , baseline characteristics of patients between avandamet treatment group and metformin treatment group were comparable except that the average duration of diabetes in avandamet group was significantly longer than that in metformin group ( 3.56 3.49 years vs. 2.73 3.10 years , p = 0.01 ) . however , this difference at baseline did not seem to be associated with the efficacy difference between groups , just because patients in avandamet group had a longer duration of diabetes which may indicate poorer insulin secretion and therefore poorer effect in hypoglycemic treatment . controversely , at the end of the study , patients in avandamet group had a higher decrease in hba1c and a better control of glycemic treatment , which indicated that the baseline difference did not affect the final results . in conclusion , results from this randomized , open label , parallel group study indicated that compared with up titrated metformin treatment , the efficacy of avandamet treatment in patients uncontrolled with metformin alone was better , the proportion of patients who reached the target hba1c was higher in chinese type 2 diabetes patients .

background : at present , china has listed the compound tablet containing a fixed dose of rosiglitazone and metformin , avandamet , which may improve patient compliance . the aim of this study was to evaluate the efficacy and safety of avandamet or uptitrated metformin treatment in patients with type 2 diabetes inadequately controlled with metformin alone.methods:this study was a 48-week , multicenter , randomized , open - labeled , active - controlled trial . patients with inadequate glycaemic control ( glycated hemoglobin [ hba1c ] 7.59.5% ) receiving a stable dose of metformin ( 1500 mg ) were recruited from 21 centers in china ( from 19 november , 2009 to 15 march , 2011 ) . the primary objective was to compare the proportion of patients who reached the target of hba1c 7% between avandamet and metformin treatment.results:at week 48 , 83.33% of patients reached the target of hba1c 7% in avandamet treatment and 70.00% in uptitrated metformin treatment , with significantly difference between groups . the target of hba1c 6.5% was reached in 66.03% of patients in avandamet treatment and 46.88% in uptitrated metformin treatment . the target of fasting plasma glucose ( fpg ) 6.1 mmol / l was reached in 26.97% of patients in avandamet treatment and 19.33% in uptitrated metformin treatment . the target of fpg 7.0 mmol / l was reached in 63.16% of patients in avandamet treatment and 43.33% in uptitrated metformin treatment . fasting insulin decreased 3.24 0.98 u / ml from baseline in avandamet treatment and 0.72 1.10 u / ml in uptitrated metformin treatment . overall adverse event ( ae ) rates and serious ae rates were similar between groups . hypoglycaemia occurred rarely in both groups.conclusions:compared with uptitrated metformin , avandamet treatment provided significant improvements in key parameters of glycemic control and was generally well tolerated . registration number : chictr - trc-13003776 .

You are an expert at summarizing long articles. Proceed to summarize the following text: if it were possible to evaluate the loss , which this country annually suffers through the avoidable waste of valuable human material and the lowering of human efficiency through malnutrition and preventable morbidity , we feel that the result would be so startling that the whole country would be aroused and would not rest until a radical change had been brought about - bhore committee report 1946 . bhore committee report laid down the foundation of primary care - based healthcare delivery system in india long back in 1946 . the committee also recommended for abolition of licentiate in medical practice system and its replacement with single medical qualification of an mbbs degree as the requirement to become a doctor . however , primary care remains the pending agenda for implementation since india 's independence in 1947 . the recently concluded 2 national conference of family medicine and primary care ( fmpc 2015 ) organized at india habitat centre new delhi , witnessed enthusiastic participation of primary care providers from all over india representing various service sectors . the delegates included medical students , trainees , practitioners , experts , faculty as well as citizen . the conference brought indian and international experts in primary care and facilitated a genuine discussion on healthcare delivery system . stakeholders such as healthcare professionals , educationalists , journalists , public health experts , policy makers , citizens , members of civil society , patient help groups , consumer right activists , and political leaders come together to discuss and find solutions to healthcare - related challenges . remarkably the majority of the delegates at fmpc 2015 were in their twenties and thirties contrary to popular perception that young medical graduates and healthcare professionals are not interested in primary care vocation [ figure 1 ] . milkha singh india is undergoing a rapid transformation in terms of governance , administrative reforms , policy development and social movements and is also considered one of the most vibrant economies in the world . the current discourse in public space is dominated by issues such as economic development , corruption , and women safety . healthcare though remains a pressing need of population seems to have taken a backseat . in the era of decreasing subsidies and cautious investment in social , the 2 national conference on fmpc 2015 brought a focus on healthcare in india . the theme of this conference was healthcare is primary . the sub theme youth for universal health coverage captured the youthful environment and dominant sentiment of the conference . the conference fostered a debate on why healthcare should be a national priority and why strong primary care should remain a focused area of healthcare delivery system . india stands to lose $ 4.58 trillion before 2030 due to ncds and mental health conditions . cardiovascular diseases , accounting for $ 2.17 trillion , and mental health conditions ( $ 1.03 trillion ) , will lead the way in economic loss - world economic forum report november 2014 . with a huge population to cater and profound morbidity in the undeserved ; providing healthcare for all is indeed a challenge . however developing countries with large youth populations could see their economies soar , provided they invest heavily in young people 's education and health and protect their right . acting pro actively on the skewed doctor population ration ( ref world health organization recommended standard ) , india has doubled the number of medical graduates ( mbbs ) during past five years . the second most populated country in the world is geared to accumulate a pool of additional one million newly qualified medical graduates to the healthcare workforce by 2030 . however , the biggest challenge would be to engage this large number of professionals with the community - based services . in the backdrop of universal health coverage , several policy documents and directives of government of india have called for rapid revival of the concept of family doctor . according to government estimates , multi - skilled specialists in family medicine are best suited to be recruited at specialist posts at community health centers and subdivisional hospitals where almost 75% of the posts are lying vacant in public sector . the concept of family medicine has received a strong emphasis in several policy discussions of government of india including the national health policy 2002 . the theme of family medicine has also been supported by mehta committee report , prime minister 's national knowledge commission , nrhm taskforce on human resource development , mci vision 2015 , planning commission 's steering committee on health in 12 national plan ( 20122017 ) . according to a planning commission paper , indian need to produce 15,000 family doctors ( family medicine specialists ) per year by 2030 . as the traditional old family doctors have started to disappear from society , people have often a compulsion to visit large crowded public hospitals for their basic medical needs . with health care costs rapidly spiraling up , there has been growing discomfort among people of india . in spite of the availability of the best technologies , element of trust and personalized care is missing somewhere . the doctor - patient relationship is deteriorating in the absence of traditional family doctors - the trusted primary care provider . j. p. nadda , who inaugurated the conference , noted that family medicine practitioners can play a primary role in preventive and promotive health care and especially in the rural and peri - urban areas where a substantial portion of the population resides j. p. nadda delivering the inaugural speech at 2 national conference of family medicine and primary care ( 2015 ) restructuring and innovation hold key to success in the area of primary care while we are moving toward implementation of universal health coverage . family medicine practitioner is the best person to lead the primary care teams and is capable of providing comprehensive range of clinical services at primary and secondary levels of health facilities . these include family physicians , general practitioners , medical officers ( mo ) in public sector and family medicine specialists . one of the major barriers towards availability of trained medical doctors in primary care sector is the lack of academic process within community setting and almost no career progression ( academic and professional ) for primary care physicians as compared to their specialist counterparts working at the hospitals . fmpc 2015 highlighted the importance of development of primary care academics ( family medicine ) and implementation of national health policy 2002 in this regard . a relatively young population is india 's dividend , but how is the country going to benefit from it if the same population is crippled with disease , illness , and sickness and simultaneously burdened with low quality or costly healthcare . india must strive to develop a vision to reap economic benefits of a healthy citizenry . healthcare should be a national priority and strong primary care remains the center of healthcare delivery system . currently the agenda of universal health coverage is being steered by international health agencies , chambers of industry , global philanthropists and public health experts . now it is the time that citizens and professionals both take responsibility and steer the future direction healthcare in india . one million additional young doctors shall be available by 2030 in india . not engaging them under universal health coverage ( uhc ) for working in community setting by providing a full career path ( academic as well as professional ) would be a strategic and tragic mistake . continued investment in healthcare but in a design which strengthens the general health system of the country is the way forward . the opinions expressed in this article are solely of the author and should not be attributed as position of any institution / organization ; he has been affiliated in the past or at present . the opinions expressed in this article are solely of the author and should not be attributed as position of any institution / organization ; he has been affiliated in the past or at present .

india is undergoing a rapid transformation in terms of governance , administrative reforms , newer policy develoment , and social movements . india is also considered one of the most vibrant economies in the world . the current discourse in public space is dominated by issues such as economic development , security , corruption free governance , gender equity , and women safety . healthcare though remains a pressing need of population ; seems to have taken a backseat . in the era of decreasing subsidies and cautious investment in social sectors , the 2nd national conference on family medicine and primary care 2015 ( fmpc ) brought a focus on healthcare in india . the theme of this conference was healthcare is primary . the conference participants discussed on the theme of why healthcare should be a national priority and why strong primary care should remain at the center of healthcare delivery system . the experts recommended that india needs to strengthen the general health system instead of focusing on disease based vertical programs . public health system should have capacity and skill pool to be able to deliver person centered comprehensive health services to the community . proactive implementation of policies towards human resource in health is the need of the hour . as the draft national health policy 2015 is being debated , family medicine ( academic primary care ) , the unfinished agenda of national health policy 2002 , remains a priority area of implementation .

You are an expert at summarizing long articles. Proceed to summarize the following text: the major reactive aldehyde produced during peroxidation of polyunsaturated fatty acids , malondialdehyde ( mda ) , reacts with nucleophilic sites of dna and protein to form oxopropenyl adducts . reaction of mda with dna produces primarily 3-(2-deoxy--d - erythro - pentofuranosyl)pyrimido[1,2-]purine-10(3h)-one ( m1dg ) and lesser amounts of 2-oxopropenyl - deoxyadenosine ( figure 1 ) . m1dg is mutagenic in vitro and in vivo , and 2-oxopropenyl - deoxyadenosine alters dna polymerase activity . both species can react with da or dg , resulting in oxypropenylation of the base . the reaction of mda with protein occurs predominantly at lysine residues under physiological conditions . protein adduct formation is rudimentary , as the exact targets and sites of adduction are largely unknown . however , a particularly interesting effect of mda exposure in human cells is the inhibition of nucleotide excision repair ( ner ) , which is associated with increased sensitivity to the mutagenicity of ultraviolet light and benzo[a]pyrene dihydrodiolepoxide . ner is the primary process for repair of bulky dna adducts , and in humans , ner deficiencies result in xeroderma pigmentosum , a spectrum of disorders characterized by hypersensitivity to sunlight , neurological degeneration , and a greatly increased incidence of cancer . although not verified experimentally , inhibition of ner by mda was proposed to arise from loss of function of mda - modified ner proteins . a potential mda target is the ner scaffold protein , xeroderma pigmentosum complementation group a ( xpa ) , which binds to the damaged dna substrate via a c - terminal basic cleft comprising multiple lysine residues . xpa coordinates recruitment and assembly of the enzymes that repair the damaged dna , and mutations in its dna - binding domain are associated with the most severe clinical xp phenotypes . oxopropenyl adducts to dna and protein can also be formed through reaction with base propenal , a reactive aldehyde produced by oxidant - mediated hydrogen abstraction from the 4-position of dna bases ( figure 1 ) . base propenals are approximately 100-fold more reactive to dna than mda , and experiments in which escherichia coli strains of varying membrane composition were exposed to oxidants demonstrated that base propenals are more important than mda as a source of m1dg . currently , very little is known about potential protein targets of base propenal adduction ; however , as a highly reactive form of dna damage , base propenals are ideally situated to oxopropenylate dna - binding proteins such as xpa . this has led us to hypothesize that base propenal - mediated protein damage contributes to toxicity and mutagenicity associated with oxidative or electrophile stress . to test this hypothesis , a comprehensive evaluation of base propenal s ability to directly damage proteins adenine propenal is known to react with glutathione via michael addition to form glutathionylpropenal and a glutathione adenine propenal cross - link , but , to date , no detailed investigation of the reaction of any base propenal with amino acids or proteins has been reported . one approach to evaluate the protein adduction potential of an electrophile is to identify all sites of modification and the structures of those modifications using a model protein . a frequently used target for this purpose is human serum albumin ( hsa ) . albumin is highly abundant and has affinity for a broad range of ligands , a relatively long half - life , and the potential for noninvasive sampling . thus , it is an ideal candidate for the global qualitative and quantitative evaluation of exposure to electrophiles of endogenous or exogenous origin ( the exposome ) . in fact , in a large multilaboratory comparison of biomarkers of in vivo oxidant generation , the level of carbonylated plasma protein ( i.e. , albumin ) was one of only two markers that correlated with oxidant exposure and tissue pathology , and it was the only marker that was effective longer than 6 h after exposure . to exploit albumin s potential as a biomarker , however , requires a more complete understanding of its major sites of adduction and determinants of their reactivity to a range of electrophiles . for example , whereas much attention has been directed to hsa s highly reactive cys-34 as a sensor of oxidant damage , the major site of oxopropenylation by mda is lys-525 . here , we report the application of a recently described mass spectrometric approach to identify adenine propenal modifications of hsa and xpa . our data demonstrate that , like mda , adenine propenal primarily reacts at protein lysine residues ; however , the major site of attack on hsa is distinct from that of mda . we also report that adenine propenal modifies lysine residues of xpa , including residues within its dna - binding domain and residues reported to be sites of regulation via sirt1-mediated deacetylation . biophysical analysis confirms that modification of xpa by adenine propenal decreases its affinity for damaged dna . n--acetyllysine , trichloroacetic acid ( tca ) , dithiothreitol , iodoacetate ( sigma ultra ) , and nacnbh3 were obtained from sigma - aldrich ( st . nmr experiments were acquired using a 14.0 t bruker magnet equipped with a bruker av - iii console operating at 600.13 mhz . all spectra were acquired in 3 mm nmr tubes using a bruker 5 mm tci cryogenically cooled nmr probe . chemical shifts were referenced internally to d2o ( 4.70 ppm ) , which also served as the h lock solvent . for 1d h nmr , experiments were acquired with presaturation in order to suppress the residual h2o signal , and typical experimental conditions included 32k data points , 13 ppm sweep width , a recycle delay of 1.5 s , and 32 scans . for 2d h h cosy , presaturation was also performed , and experimental conditions included a 2048 1024 data matrix , 13 ppm sweep width , recycle delay of 1.5 s , and 8 scans per increment . the data were processed using squared sinebell window function , symmetrized , and displayed in magnitude mode . c hsqc experiments were acquired using a 1024 128 data matrix , a j(c h ) value of 145 hz , which resulted in a multiplicity selection delay of 34 ms , a recycle delay of 1.5 s , and 80 scans per increment along with garp decoupling on c during the acquisition time ( 150 ms ) . the data were processed using a p/2 shifted squared sine window function and displayed with ch / ch3 signals phased positive and ch2 signals phased negative . c hmbc experiments were acquired using a 2048 128 data matrix , a j(c h ) value of 9 hz for detection of long - range couplings resulting in an evolution delay of 55 ms , j1(c h ) filter delay of 145 hz ( 34 ms ) for the suppression of one - bond couplings , a recycle delay of 1.5 s , and 144 scans per increment . the hmbc data were processed using a p/2 shifted squared sine window function and displayed in magnitude mode . compounds were greater than 90% pure , and mass spectral analysis was accomplished on an applied biosystems 3200 q trap mass spectrometer ( mds sciex ) . the mass spectrometer was equipped with an electrospray source and operated in positive ion mode . h nmr ( dmso - d6 ) : ( ppm ) 7.17 ( dd , j1 = 7.88 hz , j2 = 14.4 hz , 1h ) , 7.55 ( br s , 2h ) , 8.27 ( s , 1h ) , 8.35 ( d , j = 14.4 hz , 1h ) , 8.63 ( s , 1h ) , 9.67 ( d , j = 7.88 hz , 1h ) . c nmr ( dmso - d6 ) : ( ppm ) 119.2 , 120.5 , 136.4 , 142.8 , 147.6 , 151.4 , 158.2 , 190.8 . h nmr ( d2o ) : ( ppm ) 9.15 ( d , j = 10.0 hz , 2h ) , 5.73 ( t , j = 10.0 hz , 1h ) . the sodium salt of malondialdehyde ( mda ) ( 100 mg , 1.06 mmol ) was added to a solution of n--acetyllysine ( 200 mg , 1.06 mmol ) in 5 ml of ammonium acetate buffer ( ph 4.5 ) . the reaction was then stirred at room temperature for 15 h. the reaction mixture was lyophilized , and the residue was purified by column chromatography ( etoac / meoh , 5:1 ) on silica gel ( 60 porosity , 4063 m particle size ) . h nmr ( d2o ) : ( ppm ) 1.33 ( m , 2h ) , 1.561.61 ( m , 3h ) , 1.71 ( m , 1h ) , 1.93 ( s , 3h ) , 2.91 ( t , j = 7.3 hz , 2h ) , 4.05 ( m , 1h ) , 5.31 ( m , 1h ) , 7.44 ( d , j = 13.0 hz , 1h ) , 8.59 ( d , j = 8.5 hz , 1h ) . c nmr ( d2o ) : ( ppm ) 22.0 , 23.4 , 27.2 , 32.0 , 39.3 , 55.3 , 86.6 , 163.7 , 173.7 , 179.1 , 191.2 . the sodium salt of mda ( 60 mg , 0.319 mmol ) was added to a solution of n--acetyllysine ( 15 mg , 0.159 mmol ) in 2 ml of anhydrous methanol . the mixture was heated at reflux , and the progress of the reaction was monitored by uv vis spectroscopy . the product was then purified by column chromatography ( etoac / meoh , 5:1 ) on silica gel ( 60 porosity , 4063 m particle size ) and hplc . hplc chromatography was carried out on a luna c18 column ( 250 4.60 mm , 5 m ) at a flow rate of 1.25 ml / min . the eluting solvents included solvent a ( 10 mm ammonium acetate ) and solvent b ( acetonitrile ) . the following solvent gradient was used : 010.5 min linear gradient from 5% b to 20% b , followed by a 2 min linear gradient to 80% b , hold for 6.50 min at 80% b , followed by a 1 min linear gradient to the initial conditions of 5% b. the product was observed with a retention time of 6.1 min . h nmr ( d2o ) : ( ppm ) 1.30 ( m , 4h ) , 1.591.61 ( m , 6h ) , 1.73 ( m , 2h ) , 1.88 ( s , 6h ) , 3.22 ( m , 2h ) , 3.30 ( t , j = 7.3 hz , 2h ) , 4.08 ( m , 2h ) , 5.45 ( m , 1h ) , 7.49 ( d , j = 11.5 hz , 1h ) , 7.56 ( d , j = 11.5 hz , 1h ) . c nmr ( d2o ) : ( ppm ) 21.3 , 21.8 , 25.7 , 30.2 , 42.0 , 53.7 , 88.5 , 158.9 , 160.5 , 177.5 , 178.9 . n--acetyllysine ( various concentrations ) was mixed with 10 mm adenine propenal in 50 l reaction mixtures containing 10 mm nacl and 10 mm 4-morpholinepropanesulfonic acid ( mops ) ( ph 6.5 ) . at 1 h intervals , aliquots of each reaction mixture were injected onto a waters hplc system equipped with a 717 plus autosampler , 1525 binary hplc pump , and 2996 photodiode array detector . analytes were separated using a phenomenex polar - rp synergi hplc column , 75 cm 2 mm with 4 m particle size , at a flow rate of 0.6 ml / min . the mobile phase solvents were h2o + 0.05% acetic acid ( v / v , solvent a ) and 3:1 meoh / acn + 0.05% acetic acid ( v / v , solvent b ) delivered in a 19 min gradient consisting of the following : 010.5 min , 520% b ; 10.512.5 min , 2080% b ; 12.516 min , 80% b ; 1619 min , 5% b. data were analyzed using empower software , and peak areas were manually integrated . reactions were performed as described above and analyzed using a thermo accela hplc pump ( thermo fisher scientific ) and htc pal autosampler ( leap technologies ) in - line with a thermo quantum triple quadrupole mass spectrometer ( thermo fisher scientific ) . the quantum was equipped with an electrospray source operated in q1 full scan , positive ion mode . q1 was scanned from 100600 amu in 0.45 s. analytes were chromatographically separated on a synergi polar - rp hplc column ( phenomenex , 7.5 0.2 cm , 4 m particle size ) using the following gradient : 010.5 min , 520% b ; 10.512.5 min , 2080% b ; 12.516 min , 80% b ; 1617 min , 5% b. the mobile phase solvents were h2o + 0.05% acetic acid ( v / v , solvent a ) and acetonitrile + 0.05% acetic acid ( v / v , solvent b ) , and they were delivered at a flow rate of 0.6 ml / min . all data were acquired and analyzed using thermo xcalibur software . solutions containing known concentrations of synthetic 3 and 4 were used to measure extinction coefficients of each compound . the value obtained for both compounds ( 33 600 200 mcm ) was the same within experimental error ; however , the wavelengths of maximal absorbance were different ( 280 nm for 3 and 300 nm for 4 ) ( figure s1 ) . adenine propenal ( 10 mm ) was incubated with increasing concentrations of n--acetyllysine ( 1 , 2 , 5 , 10 , 50 , and 100 mm ) in reaction mixtures containing 10 mm nacl and 10 mm mops ( ph 6.5 ) . the mixtures were incubated for 2 h at room temperature and then diluted 1:1000 in h2o . the absorbance at 300 nm of each dilution was then obtained using a du800 spectrophotometer ( beckman coulter ) , and the experimental extinction coefficient of 4 was used to estimate its concentration in the reaction mixture . note that , for reaction mixtures containing > 10 mm n--acetyllysine , complete consumption of adenine propenal eliminates concerns of its contribution to the absorbance of the final reaction mixture . the adenine product does not absorb significantly at 300 nm ( figure s1 ) . on the basis of its full uv spectrum ( figure s1 ) , the extinction coefficient of 3 at 300 nm is estimated to be 7.8 10 m cm . the presence of this product at a concentration equal to approximately 10% of the concentration of 4 , as found in the reaction mixtures , indicates that its contribution to the absorbance at 300 nm will be no more than 3% . consequently , the absorbance at 300 nm can be used to estimate the concentration of 4 with reasonable accuracy . n--acetyllysine ( 10 mm ) was incubated with adenine propenal ( 10 mm ) in 10 mm mops ( ph 6.5 ) containing 10 mm nacl in a 200 l reaction mixture for 30 min . after incubation , 50 mm nacnbh3 ( in h2o ) ( sigma - aldrich ) was added for an additional 30 min , and samples were then analyzed using lc - ms as described below . lc - ms analysis was performed on the thermo quantum triple quadrupole mass spectrometer . here , the instrument was operated in q1 full - scan negative ion mode using electrospray ionization . q1 was scanned over the range 100400 amu over 0.5 s. chromatography was carried out on a synergi max - rp column ( phenomenex , 7.5 0.2 cm , 5 m particle size ) using the following gradient : 05 min linear gradient from 2% b to 50% b , 57 min at 50% b , 710 min 50% b to 2% b. the mobile phase solvents were h2o + 0.05% formic acid ( v / v , solvent a ) and 3:1 ch3cn / meoh + 0.05% formic acid ( v / v , solvent b ) , and they were delivered at a flow rate of 400 l / min . all data were acquired and analyzed using thermo xcalibur software . using this chromatographic system , the reduced intermediate eluted at approximately 2.9 min . n - acetylcysteine ( 200 m ) was combined with 50 m adenine propenal in 50 mm sodium phosphate buffer , ph 7.4 , and incubated for 6 h at 37 c . nabh4 ( 50 mm ) ( sigma - aldrich ) was used to reduce samples as indicated . analytes were separated on a supelco ascentis c18 column ( 50 2.1 mm , 3 m ) with buffers a and b comprising 0.1% formic acid in water and 0.1% formic acid in acetonitrile , respectively . the gradient was as follows : 13 min , 1% b ; 37 min , 98% b ; 711 min , 98% b ; 1117 min , 1% b. samples were analyzed on a thermofinnigan tsq quantum mass spectrometer with esi source interfaced to a thermofinnigan ms pump plus and autosampler plus ( thermo , san jose , ca ) . n - acetylcysteine - adducted species were analyzed with data - dependent scanning enabled in negative ion mode , scanning from m / z 150650 over 0.5 s. the top two m / z peaks from each ms scan were fragmented with 10 ev collision energy for 0.5 s. hsa ( 15 m ) ( abcam , cambridge , ma ) was incubated with increasing amounts of adenine propenal ( 0.15 , 0.38 , 1.5 , 3 , and 7 mm ) , representing a molar excess of adenine propenal to hsa of 10 , 25 , 100 , 250 , and 500 , respectively . reactions were incubated for 6 h at room temperature in a buffer containing 10 mm nacl and 10 mm mops ( ph 6.5 ) . following incubation , samples were precipitated with 25% trichloroacetic acid ( sigma - aldrich ) on ice for 1 h , washed with cold acetone , dried , and reconstituted in 50 mm tris ( ph 8.0 ) containing 50% 2,2,2-trifluoroethanol ( acros organics , pittsburgh , pa ) . samples were reduced with dtt ( sigma - aldrich ) , carbamidomethylated with iodoacetamide ( sigma - alrich ) , and diluted 5-fold with 100 mm tris ( to obtain a final solution containing 10% 2,2,2-trifluoroethanol ) . following dilution , samples were digested with sequencing - grade trypsin ( promega , madison , wi ) overnight , acidified , and diluted in 0.1% formic acid . the resulting solutions of trypsin - generated peptides were loaded onto a capillary reverse - phase analytical column ( 360 m o.d . 100 m i.d . ) using an eksigent nanolc ultra hplc and autosampler . the 20 cm analytical column was directly packed into a laser - pulled emitter tip using jupiter c18 reverse - phase medium ( 3 m beads , 300 pore size , phenomenex ) . mobile phase solvents consisting of 0.1% formic acid in water ( solvent a ) and 0.1% formic acid in acetonitrile ( solvent b ) at a flow rate of 500 nl / min were used to elute the peptides . the 90 min gradient consisted of the following : 010 min , 2% b ; 1050 min , 235% b ; 5060 min , 3595% b ; 6065 min , 95% b ; 6570 min 952% b ; 7090 min , 2% b. mass analysis of eluting peptides was performed on an ltq orbitrap xl mass spectrometer ( thermo scientific ) , equipped with a nanoelectrospray ionization source with detection in positive ion mode . the ltq orbitrap was operated using a data - dependent method , enabling dynamic exclusion . full scan ( m / z 4002000 ) spectra were acquired with the orbitrap ( resolution 60 000 ) , and the five most abundant ions in each ms scan were selected for fragmentation in the ltq . an isolation width of 2 m / z , 30 ms activation time , and collision energy normalized to 35% were used to generate ms spectra . dynamic exclusion settings allowed for a repeat count of 2 within a 10 s duration , with exclusion duration time set to 15 s. for identification of modified peptides , tandem mass spectra were searched with sequest ( thermo fisher scientific ) against a human subset database created from the uniprotkb protein database ( www.uniprot.org ) . variable modifications of + 57.0214 on cys ( carbamidomethylation ) , + 15.9949 on met ( oxidation ) , and + 54.0105 on lys or cys ( oxypropenylation ) were included for database searching . search results were assembled with scaffold 3.0 ( proteome software ) using threshold filtering criteria consisting of 95% peptide probability to achieve a peptide false discovery rate estimate of 0.2% . sites of modification were validated by manual interrogation of tandem mass spectra using xcalibur 2.1 qual browser software ( thermo scientific ) . calculations of mass errors ( in ppm ) of precursor ions mass analyzed in the orbitrap were performed using the following equation : ( ( theoretical mass observed mass)/theoretical mass ) 10 . to obtain theoretical masses , analysis of cross - links was performed in a similar manner with inclusion of + 36 on lys for database searching . purified hsa ( 0.75 m ) was incubated with increasing concentrations of adenine propenal in reaction mixtures containing 10 mm nacl and 10 mm mops ( ph 6.5 ) for 6 h at room temperature . following incubation , the protein was heated at 95 c for 10 min , cooled to room temperature , and then treated with 1 mg of pronase ( calbiochem , gibbstown , nj ) per mg of protein at 37 c for 24 h. pronase was inactivated by heating at 95 c for 10 min , followed by cooling to room temperature , and treating with 1 l of aminopeptidase m ( calbiochem , gibbstown , nj ) at 37 c for 24 h. a final incubation at 95 c for 10 min inactivated the aminopeptidase m , and the samples were then cooled to room temperature in preparation for adduct purification . for use as an internal standard , [ h]-[c]-4 was prepared by reaction of mda with [ h]-lysine containing [ c]-lysine as a tracer and quantified using a method similar to that described for the [ h]-[c]-lysine - lactam internal standard as described . an oasis hlb cartridge ( 1 cm ) ( waters , milford , ma ) was equilibrated with 2 ml of methanol followed by 2 ml of h2o . following addition of [ h]-[c]-4 , the sample was loaded onto the cartridge using gravity flow . the cartridge was washed with 1 ml of h2o , and 4 was eluted with 3 ml 1:1 methanol / ethyl acetate and dried to 100 l under n2 gas . the sample was then diluted in 0.1% formic acid solution to a final volume of 1 ml and filtered using a 0.22 m nylon spin - x centrifuge tube spun at 6000 rpm for 5 min . samples were purified using a thermo scientific aquasil c18 5 m reverse - phase column using liquid scintillation counting to monitor elution of the radioactive [ h]-[c]-lysine lysine cross - link standard . the internal standard [ h]-[c]-lysine lysine cross - link was prepared by reaction of mda with [ h]-lysine containing [ c]-lysine as a tracer and quantified using a method similar to that described for the [ h]-[c]-lysine - lactam internal standard . for quantitation , the transition between m / z 341 and m / z 306 was monitored ; it corresponds to the loss of one molecule of water and one molecule of ammonia . portions of samples containing the standard were then concentrated using 1 cc oasis hlb columns and dried under nitrogen . the purified samples were analyzed using a thermo scientific tsq vantage quadrupole mass spectrometer equipped with xcalibur software for data collection and manipulation . all measured mda - adduct signal in each sample was divided by the signal for the [ h]-[c]-lysine lysine cross - link standard of known concentration to quantify experimental results . xpa was expressed and purified as described . to modify xpa , 3.2 m of purified protein was incubated with 500 ( 1.6 mm ) of adenine propenal for 6 h at room temperature in a buffer containing 10 mm nacl and 10 mm mops ( ph 6.5 ) . a high - throughput fluorescence anisotropy assay was used to measure the dna - binding activity of xpa . the substrate for this assay was a fluorescein - labeled y - shaped ssdna dsdna junction substrate containing 8 base pairs of duplex and 12 nucleotide noncomplementary ssdna overhangs at both the 3 and 5 ends . xpa was modified with nhs biotin as described previously . modified or mock - treated xpa protein and the dna substrate were diluted in binding buffer ( 20 mm hepes , ph 7.9 , 75 m kcl , 5 mm mgcl2 , 5% glycerol , 1 mm dtt ) . fluorescence anisotropy was measured using a synergy h1 plate reader ( ex = 485 nm , em = 528 nm ) . apparent dissociation constants ( kd ) were determined for each individual titration by plotting fluorescence anisotropy against protein concentration and fitting to a simple two - state binding model with kaleidagraph ( v4.03 ) software . adenine propenal was reacted with n--acetyllysine , n--acetylhistidine , n--acetylarginine , or n--acetylcysteine in 10 mm nacl buffered with 10 mm mops ( ph 6.5 ) . reaction progress was monitored hourly by hplc using a c18 reverse - phase column for product separation . adenine propenal eluted at 8 min and displayed a maximum absorbance of 260 nm ( figures 2 and s1 ) . reaction with n--acetyllysine resulted in the appearance of three new chromatographic peaks at 1.0 , 4.8 , and 5.3 min , which were analyzed by uv / vis , nmr , and ms ( figures 2 and s1 ) . the peak eluting at 1 min displayed a uv absorbance maximum at 260 nm and an m / z of 136 , corresponding to protonated adenine ( [ m + h ] ) ( 1 ) . on the basis of nmr analysis , this product was identified as 3 , and lc - ms analysis gave an m / z of 243 , which corresponds to the protonated species ( [ m + h ] ) . the 5.3 min peak , with a maximum absorbance at 300 nm and an m / z of 413 , which corresponds to the protonated species ( [ m + h ] ) , was identified as 4 by nmr analysis . the total amount of product formed was unaffected by variations in ph over a range of 6.5 to 9.5 . n--acetyllysine ( 50 mm ) was incubated with adenine propenal ( 10 mm ) in a 50 l reaction mixture for 2 h at room temperature . the column eluate was monitored at 260 nm ( a ) or 300 nm ( b ) . analytes present in each peak were subjected to ms , uv , and nmr spectrometry . chemical synthesis of 3 and 4 yielded standards that verified the product structure assignments . the molar extinction coefficients of the pure compounds ( = 33.6 10 m cm at 280 nm for 3 and = 33.6 10 m cm at 300 nm for 4 ) were similar to that of adenine propenal ( = 32.5 10 m cm at 260 nm ) . hplc analysis of reaction mixtures of n--acetyllysine and adenine propenal using diode - array detection enabled direct comparison of peak areas for each compound measured at its optimal wavelength ( figure 3 ) . the essentially identical absorbance coefficients of 3 and 4 allowed peak areas to be used to estimate relative product quantity . these comparisons indicated that the major product formed from the reaction was 4 , with much lower quantities of 3 . hplc analysis of product formation in the reaction of adenine propenal and n--acetyllysine . the indicated amounts of n--acetyllysine ( nal ) were incubated with 10 mm adenine propenal , and reactions were monitored hourly for 910 h. peaks corresponding to 3 and 4 were monitored at 280 and 300 nm , respectively , by diode - array detection . variation of the amount of n--acetyllysine ( from 2 to 100 mm ) in reaction mixtures while holding the amount of adenine propenal ( 10 mm ) fixed demonstrated that the amount of 3 formed increased with n--acetyllysine concentrations from 2 to 10 mm and then decreased somewhat at the higher concentrations . in contrast , the amount of 4 produced increased with n--acetyllysine concentrations up to 50 mm . on the basis of the relative peak area , the ratio of 4 to 3 in most reaction mixtures was approximately 10:1 . estimation of the concentration of 4 using absorbance at 300 nm indicated a maximum of 9 mm formed in reaction mixtures containing 50100 mm n--acetyllysine ( figure s2 ) . our initial hypothesis for the production of 4 was that it arose by reaction of n--acetyllysine with 3 , but this reaction did not occur under conditions comparable to those used for the reaction of adenine propenal with n--acetyllysine . an alternative reaction scheme , in which an enaminoimine cross - link between adenine propenal and n--acetyllysine is first formed and then reacts with h2o to produce 3 or another equivalent of n--acetyllysine to form 4 , is shown in figure 4 . if this scheme is correct , then our data indicate that , at the concentrations of n--acetyllysine and adenine propenal used here , reaction of the proposed intermediate with another molecule of n--acetyllysine is more favorable than its reaction with water . hplc analysis with uv or in - line nmr was unable to detect the putative intermediate 5 ( figure 4 ) . therefore , we attempted to trap it by reduction with nacnbh3 . adenine propenal was incubated with n--acetyllysine in 10 mm nacl/10 mm mops ( ph 6.5 ) in the presence of nacnbh3 . we utilized lc - ms analysis of the reaction mixture to detect ions with m / z 360 , which corresponds to the partially reduced intermediate ( 6 ) . a peak corresponding to this mass eluted at 2.9 min , consistent with the transient formation of the adenine propenal adduct to n--acetyllysine ( figure 5 ) . ( a ) representative lc - ms chromatogram of 6 . in this example , 5 mm n--acetyllysine was reacted with 10 mm adenine propenal for 30 min followed by reduction with 50 mm nacnbh3 . ( b ) mass spectrum of the parent ion of the reduced intermediate displaying m / z 360 with detection in negative ion mode . reactions of adenine propenal with n--acetylhistidine and n--acetylarginine did not result in the formation of new chromatographic peaks . reaction with n--acetylcysteine resulted in the formation of an oxopropenylated product , which displayed m / z 216 , corresponding to the deprotonated molecular ion , and its major fragmentation product , m / z 86.9 . treatment of the reaction mixture with nabh4 yielded the partially reduced product ( m / z 218 ) and its major fragmentation product ( m / z 89 ) ( figure s3 ) . to ascertain adenine propenal s ability to react with protein , we incubated increasing amounts of the electrophile with a fixed amount of purified hsa for 6 h , and the samples were prepared for lc - ms / ms by trichloroacetic acid precipitation , resolubilization of the precipitated protein pellet , reduction and carbamidomethylation of cysteine residues , and proteolytic digestion with sequencing - grade trypsin . the resultant proteolytic peptides were analyzed via lc - ms / ms using an ltq - orbitrap velos mass spectrometer with collision - induced dissociation . sequence coverage for unmodified hsa was found to be 90% , but exposure to increasing concentrations of adenine propenal reduced coverage to a minimum value of 62% ( table s1 ) . hsa peptides were interrogated for the presence of a + 54.0105 mass increase , as would be expected from the addition of an oxopropenyl group . to verify positively identified residues , extracted ion chromatograms were generated from precursor peptide masses , and theoretical masses calculated from protein prospector were compared to observed masses to calculate ppm mass error . for modified precursor peptides displaying a ppm mass error less than 10 , ms / ms spectra were interrogated with xcalibur software . at least 40% of each theoretical b- and y - product ion series was present in the observed product ion spectra of positively identified peptides , and 50% sequence coverage was obtained for each peptide validated . to validate the site of adduction , at least two ions within a product ion series with a + 54.0105 adduction mass shift were required . multiple lysine residues were found to be modified in adenine propenal - exposed hsa , including lys26 , lys36 , lys161 , lys183 , lys214 , lys219 , lys236 , lys249 , lys257 , lys347 , lys375 , lys402 , lys413 , lys438 , lys549 , lys569 , and lys598 . residues verified to have a + 54.0105 adduction mass were mapped to the crystal structure of hsa ( pdb i d : 1ao6 ) and were found to be largely confined to the protein surface ( figure 6a ) . the 17 modified lysine residues represented 28% of the total lysines within the protein ( table 1 ) . although we determined that adenine propenal can also form oxopropenylated cysteine , searching for adducts on cysteine residues within hsa did not result in the identification of any modified sites . s - oxopropenal - n - acetylcysteine was stable to treatment with tca as well a dtt , which are reagents used for proteomic analysis , so any oxopropenylated cysteine residues on hsa - derived peptides should have survived the workup prior to mass spectrometry . therefore , adenine propenal is acting as a lysine - specific modifier of hsa . ( a ) modified lysine residues identified in table 1 were mapped to the crystal structure of hsa ( 1ao6 ) . ( b ) the most highly modified residues by individual electrophiles are highlighted with the modifying electrophile noted . hsa was treated at the indicated molar ratios of adenine propenal and analyzed for lysine residues modified with + 54.0105 . the presence of each modified lysine in a sample is indicated with . the modified lysine in each peptide sequence is indicated with an asterisk . equivalent lysine residues within the crystal structure of hsa are provided in parentheses . the use of hsa as a biomarker has primarily been described in the context of electrophilic modifications at cys34 . adenine propenal did not modify cys34 , so we sought to identify the most reactive lysine residue(s ) that might be used as a biomarker for modification by adenine propenal . we reduced the levels of adenine propenal relative to protein to a ratio of 10:1 , which was the lowest ratio at which modification was observed . using the interrogation methods described above to verify adduction sites , two lysine residues , k190 and k351 , displayed the highest reactivity ( table 1 ) . mapping of those residues to the crystal structure of hsa revealed that both are located within domain ii , a recognized binding region for many compounds ( figure 6a ) . decreased hsa sequence coverage observed with increasing concentrations of adenine propenal suggested that adducts impede protein digestion and/or fragmentation required for peptide identification . lysine cross - links are formed from the reaction of adenine propenal with n--acetyllysine , we hypothesized that at high concentrations of adenine propenal , lysine lysine cross - links may be induced in hsa . to investigate the presence of cross - links , we interrogated previously acquired proteomics data for a + 36 adduct mass , corresponding to an unreduced 3-carbon linkage between lysine residues . lysine cross - links , which was not surprising considering the decreased sequence coverage and potential hindrance of peptide fragmentation by cross - links . although cross - linked sites were not identified with these algorithm - based data searching methods , we manually interrogated the data to look for the presence of precursor peptides containing cross - linked residues . to predict lysine residues likely to participate in cross - link formation , we performed in silico analysis of the hsa crystal structure ( 1ao6 ) . carbon bond is approximately 1.5 in length , we hypothesized that the 3-carbon cross - link would be 57 long . flexible , dynamic protein movements in solution may result in cross - link formation between lysines at a distance greater than 7 . we therefore examined the crystal structure to identify lysine residue pairs separated by a distance of less than or equal to 20 as potential sites of cross - link formation . following identification of these residues , tryptic peptide sequences were determined from the primary sequence , and theoretical peptide masses containing the cross - link mass of + 36 were calculated using protein prospector . we then thoroughly interrogated the data manually for the presence of ions of the theoretical precursor peptide masses . no evidence for the presence of cross - link - containing peptides was obtained . as proteomics - based mass spectrometric analyses were unsuccessful , we employed a different analytical approach to search for lysine lysine cross - links , in which modified hsa was degraded to the level of amino acids , and the resultant hydrolysate was analyzed by ms . this methodology employed selected reaction monitoring to identify analytes exhibiting a mass transition from m / z 329 to m / z 294 , as exhibited by analysis of the lysine lysine cross - link standard . addition of a [ h]-[c]-4 internal standard ( m / z 341 to m / z 306 transition ) enabled identification of analyte - containing fractions during purification by scintillation counting and quantification by stable isotope dilution . application of this approach to hsa that had been incubated with adenine propenal resulted in the identification of 30 12 ng cross - link / mg protein in vehicle - treated hsa and 57 17 ng cross - link / mg protein in adenine propenal - treated hsa . these differences were not statistically significant , supporting the conclusion that adenine propenal did not induce intramolecular cross - links in hsa . having confirmed adenine propenal s capacity to modify lysine residues in hsa , we investigated its reaction with xpa . adenine propenal was incubated with xpa for 6 h at room temperature , and the samples were prepared for and analyzed by lc - ms / ms using the same methods as described for hsa . as for hsa , peptides were interrogated for the presence of a + 54.0105 mass addition , and rigorous criteria were applied to peptide and site of adduction identification . of note , three of these , k145 , k183 , and k204 , are located in the proposed dna - binding domain of xpa ( figure 7a ) , and two , k63 and k67 , are known sites of acetylation that reduces xpa s interaction with replication protein a. adenine propenal modifies xpa and reduces its dna - binding activity . ( a ) lysine residues modified with an adduct mass of + 54.0105 were mapped to the xpa nmr solution structure ( 1d4u ) . ( b ) plots of the change in fluorescence anisotropy for a y - shaped 8/12 ssdna dsdna junction substrate ( 50 nm ) versus added protein treated with dmso , adenine propenal , or nhs - biotin . purified xpa was incubated with a 500-fold molar excess of adenine propenal and analyzed for lysine residues modified with + 54.0105 . modification of residues within the xpa dna - binding domain has the potential to affect dna - binding activity . using a plate - based fluoresence anisotropy assay , the effect of adenine propenal - mediated oxopropenylation on xpa s affinity for a y - shaped ssdna fitting of the data for binding of unmodified xpa to the fluorescein - labeled 20-nucleotide substrate provided a dissociation constant ( kd ) of 300 30 nm ( figure s4 ) . binding affinities for the 20-nucleotide substrate were measured for purified xpa incubated with vehicle ( dmso ) , adenine propenal , or nhs biotin ( biotin n - hydroxysuccinimide ester ) ( table 3 ) . as expected , incubation of xpa with dmso had no effect on its dna - binding activity . in contrast , exposure to nhs biotin , which efficiently modifies lysine residues and disrupts the dna - binding activity of many proteins , resulted in a nearly complete loss of xpa s dna - binding affinity . xpa modified with adenine propenal bound to the substrate , but with a greater than 3-fold reduction in affinity as compared to that of the unmodified protein ( figure 7b ) . in fact , oxopropenylation of the protein reduced the affinity to such an extent that it could not be accurately measured ; thus , the kd value reported in table 3 ( 1 0.1 m ) is an estimate . dissociation constants ( kd ) were determined by fitting fluorescence anisotropy data to a simple two - state binding model . the biotin - modification of xpa causes such a large loss of dna - binding affinity that there is no significant change in fluorescence anisotropy ; hence , a kd value could not be determined . covalent modifications of dna and proteins by electrophiles produced during oxidative stress have multiple consequences on cellular function , including mutagenesis , stress responses , cellular dysfunction , and ultimately cell death . all of these may contribute to pathological processes such as carcinogenesis , neurodegeneration , atherosclerosis , and chronic inflammation . however , elucidation of the exact mechanisms by which specific macromolecular damage leads to pathology requires a better understanding of the sites and nature of that damage . the most frequently used biomarker of electrophile damage to protein during oxidative stress is the change in global protein carbonylation . although useful as a general indicator that stress has occurred , this approach does not identify the exact type of modification or the modifying electrophile . recent developments in highly sensitive ms - based proteomics techniques have allowed for expansion of this approach to the investigation of the specific types of modifications induced and the impact of these modifications on protein activity . the resultant increased ability to identify specific protein modifications induced by a single electrophile enables the search for biomarkers that distinguish between different mechanisms of oxidant damage . the generation of adenine propenal occurs predominantly in intact dna , suggesting that most of its targets will likely be dna - associated proteins in the nucleus or mitochondria . nevertheless , we initiated our investigation of adenine propenal s protein - modifying profile , using hsa as the model protein . hsa s reactivity with electrophilic agents has been studied extensively in the past , allowing us to place adenine propenal - dependent modifications in the context of those existing data . for example , teucrin a was found to preferentially modify lys351 and lys545 , while 4-hydroxynonenal modifies lys195 , lys199 , lys233 , and lys525 , and polycyclic aromatic hydrocarbon epoxides modify lys137 . mda has been shown to modify multiple lysine residues including lys136 , lys174 , lys240 , lys281 , lys525 , and lys541 . as mda and adenine propenal both produce oxopropenyl adducts on lysine residues , it is interesting to note that the major sites of adduction for the two electrophiles are different : lys190 and lys351 for adenine propenal versus lys525 for mda . these findings suggest that distinct hsa modification patterns may be used as markers for different electrophiles ( figure 6b ) . clearly , the use of hsa as a biomarker of electrophile damage is attractive , given its high concentration in the blood and ease of sampling . however , as noted above , adenine propenal generation is largely confined to intact dna , so it remains to be seen if enough of the electrophile reaches the circulation to allow the modification of hsa to serve as a biomarker of exposure . the impact of electrophiles has long been studied in the context of covalent modification of dna and its potential to lead directly to mutations . however , adenine propenal produced in the nucleus also has the potential to modify dna - associated proteins , including those involved in dna repair . we report here that adenine propenal covalently modifies the ner protein xpa in vitro and that this modification leads to a reduction in xpa s dna - binding activity . oxopropenylation of residues known to be acetylated further suggests that adenine propenal - dependent modification could result in failure of regulation of xpa s activity through sirt-1-dependent deacetylation . xpa is a critical component of the ner machinery , without which repair activity ceases . mutations in xpa , particularly in the dna - binding domain , are associated with severe xp clinical phenotypes . thus , it is possible that decreased xpa - binding activity resulting from adenine propenal - dependent modification could result in reduced ner activity in cells and increased potential for mutagenesis and carcinogenesis . it should be noted that , in this model , the modification of repair proteins may have a synergistic effect on mutagenesis by preventing the repair of the original dna lesion . in this case , even moderate reductions in the activity of the repair proteins have the potential to result in significant increases in genomic instability . further analysis will be required to determine whether reactive base propenal species modify dna repair proteins in cells under oxidative stress and to characterize the effects of modification on dna repair activity in vivo .

base propenals are products of the reaction of dna with oxidants such as peroxynitrite and bleomycin . the most reactive base propenal , adenine propenal , is mutagenic in escherichia coli and reacts with dna to form covalent adducts ; however , the reaction of adenine propenal with protein has not yet been investigated . a survey of the reaction of adenine propenal with amino acids revealed that lysine and cysteine form adducts , whereas histidine and arginine do not . n-oxopropenyllysine , a lysine lysine cross - link , and s - oxopropenyl cysteine are the major products . comprehensive profiling of the reaction of adenine propenal with human serum albumin and the dna repair protein , xpa , revealed that the only stable adduct is n-oxopropenyllysine . the most reactive sites for modification in human albumin are k190 and k351 . three sites of modification of xpa are in the dna - binding domain , and two sites are subject to regulatory acetylation . modification by adenine propenal dramatically reduces xpa s ability to bind to a dna substrate .

You are an expert at summarizing long articles. Proceed to summarize the following text: the metalcatalysed dehydrocoupling of amineboranes is an important methodology for the production of polyaminoboranes that are isoelectronic analogues of polyolefins . the parent compound h3bnh3 is also of significant interest with regard to its ability to act as a chemical hydrogen store , due to its high weight % h ( 19.6 % ) and the ability to release h2 for subsequent utilization in a fuel cell.16 such catalytic methodologies offer control of kinetics , product distributions and the temperatures of h2 loss when compared to simple thermal activation . cyclic amineboranes7 such as 1,2bn cyclohexanes ( e.g. , 13 , scheme 1 a),8 , 9 bnmethylcyclopentane ( i , scheme 1 c)10 , 11 and bisbn cyclohexane ( ii , scheme 1 c)12 are attractive candidates for h2 storage applications as they release h2 on heating to form welldefined molecular species ( scheme 1 b and c ) for which viable regeneration routes can be developed.8 , 10 h2 loss that is promoted by a transitionmetalbased catalyst offers a significant reduction in the temperature of release ( scheme 1 c ) , and heterogeneous ( e.g. , fecl2 precatalyst)10 and homogeneous ( rubased)12 systems have been developed for use with cyclic amineboranes . related bsubstituted acyclic systems also undergo dehydrogenation using cocl2 as a precatalyst to form bsubstituted borazines.13 however , the nature of likely intermediates in these dehydrocoupling processes have not been determined , either because of the thermal conditions required in the absence of catalyst ( e.g. , 150 c ) , the generally heterogeneous nature of the catalyst system , or lack of observable intermediates in homogeneous systems ( ru catalysts).1 cyclic bn compounds and their subsequent dehydrogenation . sigmaamineborane complexes14 , 15 are key intermediates in innersphere transitionmetalcatalysed amineborane dehydrocoupling;1 and they are now wellestablished in terms of both fundamental coordination chemistry , b h / n h activation processes and , increasingly , b n coupling events.1 of particular relevance to this work are those complexes that arise from interaction of either an { ir(pcy3)2(h)2 } or a { rh(chelatingdiphosphine ) } fragment with amineboranes . the former promotes dehydrogenation of the coordinated amineboranes rather slowly , but leads to the isolation of metal bound intermediates ( scheme 2 a ) , while the latter promotes dehydrogenation much more rapidly , leading to the use of low catalyst loadings ( e.g. , scheme 2 b).2 welldefined h3bnr3 sigma complexes ( r3=mexh3x ; x=13 ) and catalysed dehydrocoupling . [ bar 4 ] anions are not shown . as far as we are aware , the coordination chemistry of cyclic amineboranes has not been explored , although rhodium sigmacomplexes of the cyclic aminoborane oligomers [ h2bnme2]2 21 and [ h2bnmeh]3 22 have been described . the dehydrogenative cyclization of diaminemonoboranes has been reported to form cyclic diaminoboranes using a [ ru(pcy3)2(h2)2(h)2 ] catalyst;23 , 24 the metalcatalysed dehydrocoupling of basestabilised diborane(6 ) [ h2b(hpp)]2 to give [ hb(hpp)]2 ( hpp=1,3,4,6,7,8hexahydro2hpyrimido[1,2a]pyrimidinate ) has been reported , alongside subsequent coordination chemistry;25 , 26 and there is an early report of sigma complexes formed from cyclic diboranes.27 shore and coworkers have developed the coordination chemistry and reactivity of related cyclic anionic organohydroborates of the early transition metals.28 in this contribution we report the coordination chemistry of various nsubstituted cyclic 1,2bncyclohexanes , using { ir(pcy3)2(h)2 } or { rh(chelatingdiphosphine ) } fragments , to afford the resulting sigmacomplexes . we also comment on their subsequent dehydrogenation / dehydrocoupling that leads to insight into both : 1 ) the active species involved , and 2 ) the metalfree cyclic aminoborane intermediates formed during these transitionmetalcatalysed routes , which operate at a significantly lower temperature than noncatalysed or heterogeneously catalysed alternatives . to provide a comparison of the effect of increasing substitution at nitrogen with regard to both coordination chemistry and subsequent dehydrogenation , three 1,2bncyclohexanes were prepared ( scheme 1 a ) : 2,2h21,2b , nc4h10 ( 1 ) , 2,2h , me1,2b , nc4h10 ( 2 ) and 2,2me21,2b , nc4h10 ( 3 ) . the synthesis of compound 1 has recently been reported by hydroboration of a bistrimethylsilylsubstituted homoallylamine by one of us.9 compound 2 is , to our knowledge , unreported in the open literature as an isolated compound29 while compound 3 was originally reported by wille and goubeau in 1972.30 we have isolated compounds 2 and 3 ( see experimental section ) as an analytically pure powder or liquid , respectively ( scheme 3 ) . the b and h bh nmr chemical shifts for these three compounds are also given for later comparison with their coordination complexes.3 synthesis of the 1,2bncyclohexanes and key nmr spectroscopic data [ j(bh ) in parenthesis in cd2cl2 ] . addition of one equivalent of cyclic amineborane 1 to a c6h5f solution of in situ generated [ ir(pcy3)2(h2)2(h)2][bar 4 ] , iii ( a source of the { ir(pcy3)2(h)2 } fragment),16 , 17 resulted in the formation of the complex [ ir(pcy3)2(h)2(h2bnh2c4h8)][bar 4 ] ( 4)31 in quantitative yield as measured by h , b and p nmr spectroscopies ( ar 4=3,5(cf3)2c6h3 , scheme 4 ) . complex 4 can be characterised as a shimoitype sigmaamineborane complex.14 , 15 , 32 analytically pure , crystalline , material was isolated by recrystallisation at low temperature from c6h5f / pentane solution.4 synthesis of cyclic amine borane complexes of the { ir(pcy3)2(h)2 } fragment . the solidstate structure of complex 4 is shown in figure 1 , and confirms the formulation . the ir the irb [ 2.217(4 ) ] , b1c1 [ 1.588(6 ) ] and b1n1 [ 1.605(6 ) ] distances are all consistent with an amineborane taking part in two irh b 3 center2 electron interactions , comparing closely with sigma complexes of h3bnme3 [ irb , 2.207(7 ) ],17 h3bnmeh2 [ 2.210(7 ) ]33 and h3bnh3 [ 2.209(5 ) ]18 with the same metal fragment . 2.6 or longer)34 , 35 and shorter m b distances ( less than 2.1 ) , respectively.36 , 37 the cyclic amineborane adopts a chair conformation ( figure 1 b ) , meaning there is no plane of symmetry in the molecule in the solid state.1 solidstate structure of the cationic portion of complex 4 , side ( a ) and plan ( b ) view . displacement ellipsoids are shown at the 30 % probability level . selected bond lengths [ ] and angles [ ] : ir1b1 , 2.217(4 ) ; ir1p1 , 2.3145(11 ) ; ir1p2 , 2.3244(10 ) ; b1c1 , 1.588(6 ) ; b1n1 , 1.605(6 ) ; p1ir1p2 , 155.87(4 ) . in solution ( cd2cl2 ) , the b nmr spectrum of 4 shows a diagnostic,38 , 39 and significant , downfield shift on coordination with the metal , =19.8 ppm , when compared to free ligand , =11.3 ppm . this signal is broad ( fwhm=350 hz ) masking the expected reduction in j(bh).15 the h nmr spectrum displays a single ir h environment at =20.53 ppm [ t , j(ph)=16 hz ] and a single ir b environment at =6.23 ppm ( br ) that sharpens on decoupling of b and is shifted 8.04 ppm upfield from 1 . finally , the h nmr spectrum shows a single n h environment at =4.07 ppm ( confirmed by h / h cosy and hsqc experiments ) . the p{h } nmr spectrum displays two environments that show mutual p p coupling , consistent with a trans orientation : j(pp)=268 hz . these solution data are consistent with a sigmaamineborane complex , interacting through two b hir interactions , in which the cyclic amineborane is undergoing a fluxional process that gives a timeaveraged mirror plane that makes the two sets of hydride ligands equivalent . a simple ringflip is suggested , rather than a rotation around the b1ir1 vector that would also make the phosphine ligands equivalent,40 and for the free amineborane this ringflip has been shown to proceed through a low barrier ( 8.8(0.2 ) kcal mol).9 the corresponding sigma complex of 2 , [ ir(pcy3)2(h)2(h2bnhmec4h8)][bar 4 ] ( 5 ) , can be prepared in a manner similar to 4 . the synthesis of 5 by displacement of the dihydrogen ligand in iii takes longer than for 4 : 90 min compared to on time of mixing , respectively . the solidstate structure of complex 5 is shown in figure 2 , which shows it to be very similar to that of 4 , with the amineborane also adopting a chair conformation . unlike 4 , the bncyclohexane ligand is disordered , occupying four chemically identical , but crystallographically different sites ( see the supporting information ) . the irb distance measured using this model , 2.230(4 ) , is within error the same as for 4 , as is the p1irp2 angle of 155.13(3).2 solidstate structure of the cationic portion of complex 5 . selected bond lengths [ ] and angles [ ] : ir1b1 , 2.230(4 ) ; ir1p1 , 2.3269(7 ) ; ir1p2 , 2.3266(7 ) ; b1c1 , 1.588(5 ) ; b1n1 , 1.566(6 ) ; p1ir1p2 , 155.13(3 ) . despite repeated attempts , only a few crystals of complex 5 were produced , with the complex forming as an oil on attempts to recrystallise , meaning that analytically pure material for microanalysis was not available . nevertheless , nmr spectroscopy demonstrates the formulation of 5 in the bulk . in the h nmr spectrum the ir h groups are now observed as two relative 1h signals , at =20.58 and 20.82 ppm , due to the asymmetry now imposed by the nme group on the cyclic amineborane that would not be removed by a low energy ringflip . b signals are observed ( =6.24 , 6.35 ppm ) , and a more complicated aliphatic region compared with 4 is noted , as all the methylene c h groups are now inequivalent . the b nmr spectrum shows a signal at =22.4 ppm , similar to that measured for complex 4 and shifted downfield from free ligand ( =6.5 ppm ) . as with 4 , there are two environments observed in the p{h } nmr spectrum that show trans j(pp)coupling [ j(pp)=276 hz ] . addition of 3 to a c6h5f solution of [ ir(pcy3)2(h2)2(h)2][bar 4 ] resulted in no reaction to the detection limit of p{h } nmr spectroscopy ( ca . however , the h nmr spectrum showed a very small peak at =4.06 ppm ( less than 5 % ) that might be assigned to a sigma complex by comparison with the wellcharacterized examples 4 and 5 . this might suggest an initial equilibrium is established between the starting bisdihydrogen complex and a corresponding bncyclohexane sigmacomplex that favours the starting material ( presumably due to the steric clash between the pcy3 and the nme2 groups ) . with the same metal fragment we have previously commented upon similar relative differences in the strength of the ir b sigma interaction when comparing h3bnr3 ( r = h or me ) . over time ( 8 h ) , decomposition to [ ir(pcy3)2h5]41 and [ ir2{(pcy3)2}2h5][bar 4]17 is observed . when prepared pure , complexes 4 and 5 are stable for at least 24 h in 1,2f2c6h4 solution with no significant change observed by nmr spectroscopy . however , addition of five additional equivalents of the cyclic amineborane 1 to complex 4 ( i.e. , 20 mol % ) results in the slow ( 72 h , tof 0.07 h , sealed nmr tube ) dehydrocoupling to form the final aminoborane derived tricyclic borazine product [ bnc4h8]3 6 [ =34.5 ppm , s ; lit . inspection of the b nmr spectrum after 2 h shows compound 1 and a significant proportion of a new signal assigned to the new monomeric aminoborane hbnhc4h8 , 7 [ =41.1 ppm , d , j(bh ) 124 hz ] . this chemical shift and coupling pattern is similar to other , transient , aminoboranes,17 , 42 , 43 as well as stable hbnmec4h8 8 ( vide infra ) . after 24 h the signal due to 7 had essentially disappeared , with 6 now observed as a significant product . also apparent after 24 h is a set of broad peaks centred around =5 ppm that also show j(bh ) coupling . over a further 48 h ( 72 h in total ) these signals reduce in intensity at the overall gain of 6 , and the temporal behaviour of the system suggests they are due to intermediates that follow 7 and precede 6 . the final organometallic product observed is the pentahydride [ ir(pcy3)2h5].41 reformation of compound 1 was not observed during these later processes ; the observation of which would point to hredistribution processes.42 , 44 , 5 dehydrocoupling of 1 catalysed by 4 . b nmr spectrum ( ppm scale ) at 2 , 24 and 72 h. due to their transient nature , overlapping signals , and lack of charge , we have not been able to use detailed nmr spectroscopic or esims techniques to determine the identity of these intermediate species . the chemical shift / coupling constant data suggest fourcoordinate bh groups that are not metalbound , possibly due to a cycloborazane species ( dimers and/or trimers , e.g. , n=0 or 1 , scheme 5 ) and isomers thereof . in order to put the structures of these intermediates on a firmer footing we have used dft geometry optimization coupled with giao b chemical shift calculations to help in their identification . table 1 shows selected examples , with full details given in the supporting information . the chemical shifts of compounds 7 [ exptl =41.1 ppm , calcd =38.4 ppm ] and 6 [ exptl =34.5 ppm , calcd =31.9 ppm ] are reproduced well , with a consistent small , approximately 2.5 ppm , difference between experiment and calculation ( table 1 ) . based on these calculations diborazane and triborazane species would be expected to show signals between =0 to 7 ppm and =2 to 9 ppm , respectively , in the experimentally determined spectrum as is observed ( scheme 5 ) . partially dehydrogenated trimers would be expected to show an additional signal about =+37 ppm , very similar to 6 , and thus might be obscured . the oligomerisation of aminoboranes to form cyclic borazane products is wellknown , and these can , in certain cases , be further dehydrogenated by a transition metalcatalyst to form cyclic borazines.22 , 45 , 46 , 1 the publisher did not receive permission from the copyright owner to include this object in this version of this product . please refer either to the publisher 's own online version of this product or the printed product where one exists . addition of 5 equivalents of 2 to a 1,2f2c6h4 solution of iii ( as a precursor to 5 ) in a sealed nmr tube results in dehydrogenation and the formation of the monomeric cyclic aminoborane hbnmec4h8 8 ( scheme 6 ) after 24 h ( tof 0.2 h ) . compound 8 was initially reported by wille and goubeau,30 and has been independently prepared by intramolecular hydroboration of the nmethylhomoallylamineborane adduct and subsequent onepot thermal dehydrogenation ( see experimental section ) . compound 8 does not cyclotrimerise or cyclodimerise and remains monomeric in solution , as evidenced by a characteristic downfield chemical shift in the b nmr spectrum =40.8 ppm [ j(bh ) 125 hz ] , very similar to 7 . the final organometallic species observed were 5 and ir(pcy3)2h5 as identified by h and p{h } nmr spectroscopy , in a 0.6:1 ratio , respectively . b nmr spectrum after 24 h ( ppm scale ) . * : assigned to trace 1oh2me1,2b , nc4h8 30 ( confirmed by eims ) . the signal at =6.1 ppm is assigned to residual [ bar 4 ] . the { ir(pcy3)2(h)2 } fragment thus acts as a slow catalyst ( or precatalyst ) for the dehydrogenation of these cyclic amineboranes , as found for their acyclic counterparts.17 , 18 , 42 that the onward dehydrogenation does not occur in 4 or 5 in the absence of additional amineborane is a further demonstration of the promotional role that amineborane plays in dehydrogenation chemistry . n dihydrogen bonds,47 , 48 which are commonplace in amineborane chemistry , and have been shown by computational techniques to play an important role in lowering the barrier to b h and n h activation steps.18 , 4951 we have not explored the mechanism for the dehydrogenation process in 4 and 5 in detail , but other studies using this iridium fragment have shown that n h activation.18 , 49 interestingly , in this context , addition of d2 to complex 4 in c6h5f solution results in the loss of the ir b and n h resonances in the h nmr spectrum , and the appearance of corresponding signals in the h nmr spectrum while the p{h } nmr spectrum remains unchanged ( scheme 7 ) . dissolved hd and h2 were also observed [ =4.47 ppm , t , j(hd)=43 hz ; =4.50 ppm , respectively ] . this points to both rapid ir h / d2 exchange,40 and that sequential n h or b h activation ( in either order ) are of approximately similar energies and reversible . an alternative mechanism would be a concerted and reversible nh and bh activation that leads to aminoborane , 7 that then readds d2 . that no free aminoborane 7 , or the final cyclic trimer 6 , were observed argues against a mechanism involving such reversible dehydrogenation.52 , 7 reversible h / d exchange in complex 4 . addition of d2 followed by h2 reestablishes the n h ( =4.07 ppm ) , irh b ( =6.23 ppm ) and ir h ( =20.53 ppm ) signals , showing that this process is reversible . h activation in cationic systems.1 , 17 , 53 , 54 for example , addition of d2 to [ ir(pcy3)2(h)2(h3bnmeh2)][bar 4 ] results in h / d exchange only at ir h and b h.33 however , products that arise from formal n h activation over b h activation have been isolated55 , 56 or postulated57 , 58 for neutral systems and are also proposed as intermediates in amineborane dehydropolymerisation.20 , 59 it thus appears likely that the cyclic nature of the amineborane in 5 results in more levelled b n h activation may be additionally assisted by intramolecular hydrogen bonding.57 , 60 related acyclic phosphidoborane complexes have been isolated and shown to undergo rapid and reversible p h / b h bond activation as probed by h / d scrambling experiments.61 as significant d incorporation into the pcy3 ligand is also observed , we can not discount more complicated mechanisms for h / d exchange that involve cyclometallated phosphine ligands . addition of 2 equivalents of the cyclic amineborane 2 to [ rh(ipr2pch2ch2ch2pipr2)(c6h5f)][bar 4 ] , v,62 in 1,2f2c6h4 solution and monitoring in situ using p{h } and b nmr spectroscopy showed that after 5 min a new complex was formed [ rh(ipr2pch2ch2ch2pipr2)(h2bnhmec4h8)][bar 4 ] ( 10 ; scheme 8) , alongside unreacted v and 2 . v and 2 are consumed , so that after 8 h 10 and 8 remain . over this time period a small amount of dimer [ rh2(ipr2pch2ch2ch2pipr2)2h5][bar 4 ] ( 12 ) also forms ( 5 % by p{h } and h nmr spectroscopy ) , vide infra . complex 10 can be produced as a red , analytically pure , crystalline material in moderate ( 4045 % ) yield by recrystallization of the reaction mixture from 1,2f2c6h4/pentane at 35 c . when isolated pure , 10 is relatively stable , as is the case with the iridium complexes . after 2 days , isolated samples of 10 in c6h5f solution decompose to give only v and an unidentified borane species [ (b)=5.17 ppm ( s ) ] . the observation of both the starting material , v , and aminoborane , 8 , under conditions of excess 2 suggests that initial substitution of the fluorobenzene ligand is slower than subsequent amineborane promoted dehydrogenation in 10 ( scheme 8).8 b nmr spectra ( ppm scale ) showing the temporal evolution of the dehydrogenation of 2 ( 2 equivalents ) by v to form [ rh(ipr2pch2ch2ch2pipr2)(h2bnhmec4h8)][bar 4 ] ( 10 ) and aminoborane 8 . the room temperature h nmr spectrum of 10 shows a set of broadened environments for the chelating ligand and amineborane that give little further information . two highfield signals at =4.9 ppm and =5.4 ppm are assigned to the rh although two signals are observed , showing that the amineborane lacks a plane of symmetry due to the nme group , only one signal is observed in the p{h } nmr spectrum at room temperature [ =57.9 ppm , j(rhp)=162 hz ] . cooling to 190 k reveals two signals [ =57.8 ppm , dd , j(pp)=56 hz , j(rhp)=160 hz ; =56.9 ppm , dd , j(pp)=56 this suggests a fluxional process that makes equivalent the two phosphine groups . a mechanism that invokes a bidentate to monodentate change in amineborane binding and then a rotation around the remaining rh h bond is suggested.40 the b nmr spectrum shows a broad signal at =32.1 ppm , downfield shifted from free 2 by 38.6 ppm , consistent with a bidentate binding mode of the amineborane at a rh centre.21 figure 3 shows the solidstate structure of the cationic portion of complex 10 , demonstrating that the cyclic amineborane , 2 , interacts with the rh centre in a bidentate manner through two rh although the bridging hydrogen atoms were located in the final difference map they were ultimately placed in calculated positions . the amineborane is equally disordered over two positions , which can be modelled as either the nme pointing axial or equatorial with respect to the rhp2 plane . the rhb distance measured from this model at 2.150(6 ) is slightly shorter , but still similar , to that in closely related [ rh(ph2pch2ch2ch2pph2)(h3bnme3)][bar 4 ] , 2.199(3 ) .19 the cyclic amineborane adopts a chair conformation in 10 .[link ] chemical structure image solidstate structure of the cationic portion of complex 10 ( side and top view ) . only hydrogen atoms associated with the nh and rhhb interaction are shown , and only one disordered component is shown . selected bond lengths [ ] and angles [ ] : rh1b1 , 2.150(6 ) ; rh1p1 , 2.2167(12 ) ; rh1p2 , 2.2030(12 ) ; b1n1 , 1.518(8 ) ; p1rh1p2 , 92.95(5 ) . addition of 2 equivalents of 1 to v results , after only 30 min , in the formation of the new complex [ rh(ipr2p ch2ch2ch2pipr2)(h2bnh2c4h8)][bar 4 ] ( 9 ) and the complete consumption of the amineborane to form the aminoborane 7 ( scheme s2 , supporting information ) . over 8 h , this mixture evolves by further dehydrocoupling to give cyclotriborazine 6 and complex 9 as the organometallic product . at the early stages of the reaction , nmr signals due to amineborane and the sigmacomplex 9 are too broad to be observed in the h and b nmr spectra , but the p{h } nmr spectrum is sharper , thus suggesting a rapid exchange between bound and free amineborane . in support of this rapid exchange hypothesis , when all of 1 is consumed , and the opportunity for exchange is reduced , sigmacomplex 9 is observed as a characteristic broad signal at =29.3 ppm in the b nmr spectrum while the rh b groups are observed at =4.83 ppm in the h nmr spectrum as a broad signal ( relative integral of 2 h ) . the p{h } nmr spectrum shows a single environment that couples to rh [ =57.1 ppm , j(rhp)=160 hz ] . as this rapid exchange is not observed in 10 or 11 , we suggest that the increasing levels of substitution on nitrogen slow down this process , which might indicate an associative mechanism for ligand substitution . recrystallisation of the reaction mixture from 1,2f2c6h4/pentane resulted in a small number of red crystals of complex 9 that required mechanical separation from cocrystallised orange v. the solidstate structure of complex 9 is shown in figure 4 , and is closely related to 10 . in particular , the rhb and b n distances are the same within error or very similar , respectively : 2.155(5 ) and 1.588(6 ) . as complex 9 can not be isolated pure in bulk , we have not pursued the h / d exchange experiments.4 solidstate structures of the cationic portion of complexes 9 and 11 . only hydrogen atoms associated with the rhhb interaction are shown . displacement ellipsoids are shown at the 30 % probability level . selected bond lengths ( ) and angles ( ) ( 9 ) : rh1b1 , 2.155(5 ) ; rh1p1 , 2.2174(12 ) ; rh1p2 , 2.2170(12 ) ; b1n1 , 1.588(6 ) ; p1rh1p2 , 93.52(5 ) . ( 11 ) rh1b1 , 2.172(3 ) ; rh1p1 , 2.2204(8 ) ; rh1p2 , 2.2182(8 ) ; b1n , 1.599(4 ) ; p1rh1p2 , 94.14(3 ) . addition of cyclicamineborane 3 to v in 1,2f2c6h4 solution results in the slow ( 24 h ) substitution of the arene and the formation of [ rh(ipr2pch2ch2ch2pipr2)(h2bnme2c4h8)][bar 4 ] ( 11 ) which can be recrystallised by addition of pentane . complex 11 has been characterized by nmr spectroscopy and singlecrystal xray diffraction , and shows very similar data to that of 9 and 10 . the h nmr spectrum shows a single nme2 environment at =2.85 ppm ( 6 h ) and a single rh b environment at =5.17 ppm , while the b nmr spectrum shows a downfield shifted signal at =34.4 ppm . the solidstate structure ( figure 4 ) also reflects these similarities with the pseudosquare planar rh centre coordinated with the cyclic amineborane in a bidentate manner . comparing 9 , 10 , and 11 , there is no change in the rhb bond distances [ 2.155(5 ) , 2.150(6 ) , 2.172(3 ) , respectively ] within the experimental error . there is a slight change in chemical shift of the boron atom when compared with free ligand [ =+40.6 , + 38.6 , + 37.4 ppm ] , which suggests a trend in that increasing n substitution leads to a decreasing mb interaction that is not captured by an associated change in bond lengths.38 , 63 we have explored the catalytic dehydrogenation / dehydrocoupling of the cyclic amineboranes 1 and 2 using the { rh(ipr2pch2ch2ch2pipr2 ) } fragment . using 10 mol % v slow ( 4 days , sealed system , tof 0.1 h ) dehydrocoupling of 1 occurs to ultimately afford the tricyclicborazine 6 . as with catalyst 4 , intermediate species centred around =5 ppm are observed in the b nmr spectrum ( scheme 9 , table 1 ) . at the end of catalysis complexes 9 and dimeric 12 [ rh2(ipr2pch2ch2ch2pipr2)2h5][bar 4 ] are observed as the organometallic species.9 b nmr spectra ( ppm scale ) showing the temporal evolution of the dehydrogenation of 1 by v ( 10 mol % ) to ultimately form 6 . dehydrogenation of methylsubstituted amineborane 2 using v ( 10 mol % ) results in the formation of aminoborane 8 , taking 17 h ( tof 0.6 h ; scheme 10 ) in a sealed nmr tube . following the catalyst speciation by p{h } nmr spectroscopy showed that v was replaced by 10 and then 12 , the ratio of which changed over time , to finally give a ratio of 10:12 of 1:9 after 17 h. dehydrocoupling of 2 using catalyst v to afford aminoborane 8 . the formation of the dimer [ rh2(ipr2pch2ch2ch2pipr2)2h5][bar 4 ] ( 12 ) is interesting , and to explore its role further it was synthesized independently by addition of [ h(oet2)2][bar 4]64 to fryzuk s dinuclear complex 12 can be isolated in good yield as a microcrystalline material and has been characterized by h , p nmr spectroscopy and microanalysis ( scheme 11 ) . a single crystal xray diffraction study demonstrated the gross structure , but the hydrides were not located ( see supporting information ) . complex 12 is similar to previously reported [ rh2(bisphosphine)2h5 ] cations that are formed by hydrogenation of [ rh(bisphosphine ) ] precursors , through dimerisation / deprotonation.6668 it is stable to h2 loss under vacuum ( 10 torr ) in the solidstate and in solution . we did not observe any evidence for the formation of boronium cations ( e.g. , [ lbhnhme(ch2)4 ] ) which might indicate a hydride abstraction route to form intermediate monocationic systems with odd numbers of hydrides.69 , 11 synthesis and reactivity of complex 12 . complex 12 is a competent catalyst itself for the dehydrogenation of compound 2 , taking approximately 2 h to effect complete conversion ( [ rh]=10 mol % , sealed nmr tube , tof=5 h ) . when comparing 10 and 12 as catalysts ( 10 mol % [ rh ] ) both follow an overall firstorder profile ( k=1.18(3)10 s ; 2.16(7)10 s , respectively ) with dimeric 12 much faster than monomeric 10 . no induction period was observed.19 , 20 as these are sealed conditions , inhibition by h2 may well be occurring , complicating a detailed kinetic analysis , as observed previously for rh systems.20 , 70 unfortunately , we have been unable to reliably measure the rate in an open system ( under ar ) due to partial decomposition of 8 upon sampling.30 addition of a hindered base ( 2,6ditertbutylpyridine , 5 equivalents relative to catalyst ) to the mixture with 10/2 resulted in faster catalysis ( k=1.4(1)10 s ) and the observation of 12 as the only organometallic species at the end of catalysis . addition of [ h(oet2)2][bar 4]/10 equivalents of 2 to dimer 12 resulted in the formation of 10 and catalysis at a slower rate , similar to starting from 10 ( k=2.3(1)10 s ) . addition of [ h(oet2)2][bar 4]/ch3cn to dimer 12 resulted in the formation of [ rh(ipr2pch2ch2ch2pipr2)(ncme)2][bar 4 ] ( 13 ; scheme 11 ) . complex 13 was also independently synthesized by the addition of ch3cn to v. these , and our previous observations , suggest : 1 ) dimeric 12 is a more active ( pre)catalyst than monomeric 10 ; 2 ) under catalytic conditions , 12 forms from 10 by slow dehydrogenation of 2 , subsequent oxidative addition of h2 and dimerization to form intermediate b , which adds further h2 and is reversibly deprotonated to form [ h(solvent)x][bar 4 ] and 12 ( scheme 12 ) ; 3 ) h inhibits catalysis presumably by channelling the resting state away from 12 ; 4 ) addition of base promotes the formation of 12 . suggested relationships between 12 and 10 . that dimeric 12 is an active catalyst or precatalyst for amineborane dehydrogenation has resonance with previous reports of dimeric { rh(l2)}2 being implicated in dehydrocoupling of acyclic amineboranes,19 , 58 , 70 , 71 although in some systems dimers have been discounted on the basis of computational analysis.49 the likely involvement of potential dimer / monomer equilibria during catalysis using 12 as a precursor was probed using the method of initial rates , monitoring over the first 5 % of turnover in the pseudozeroorder regime of catalysis ( figure 5).5 initial rate versus concentration for the dehydrogenation of 2 mediated by 12 in a sealed nmr tube . this is consistent with a rapid dimer / monomer equilibrium in which the dimer is dominant but sits off the cycle and a monomer is the active species . such equilibria have been suggested before for arene alkylations,72 alkene hydrogenation65 and hydroboration,73 amineborane dehydrogenation,58 c s bond activations,74 and arylation of bcl1,2azaborines,75 amongst others . perhaps most closely related to the system under discussion here are dimer / monomer equilibria operating for shvo s catalyst in both amineborane dehydrogenation and hydrogen transfer reactions.76 , 77 in these cases a dimer is suggested to be in equilibrium with two , different , monomers ( of equal relative concentration ) ; one of which is active in catalysis . for the system here we speculate a rapid equilibrium is established between 12 and cationic ( c ) and neutral ( d ) monomers , for which one of the latter is the active catalyst ( scheme 13 ) . we discount the alternative reason for halforder dependence that involves dissociation of either chelating phosphine or h2 from 12 78 as this does not fit with other experimental observations . reversible monomer / dimer equilibria for [ rh(l2)h5 ] species involving reversible protonation have previously been noted,66 , 67 but we suggest that this is not occurring due to the positive effect that exogenous base has on the observed rate when starting from 10 , conditions that favour the formation of 12 . consistent with the rapid equilibrium proposed , addition of mecn ( 10 equivalents ) to 12 resulted in the immediate formation of the monomeric mecnadduct 13 plus gas evolution ( h2 ) , which could arise from c. also formed are uncharacterised hydride products [ h nmr : =11.79 and 17.45 ppm ] that decompose after 1 h , suggestive of a reactive neutral species such as d.13 suggested dimer / monomer equilibrium for 12 . presented here is the first study of the coordination chemistry , and subsequent dehydrogenation , of bncyclohexanes . perhaps unsurprisingly the sigmaamine borane complexes formed with the [ ir(pcy3)2(h)2 ] and [ rh(pipr2(ch2)3pipr2 ) ] fragments are broadly similar to those that result from coordination of acyclic amineboranes , such as h3bnme3 , although there are interesting differences in reactivity ( e.g. , the more levelled b the real insight that comes from these systems is their ability to mediate ( albeit slowly ) the dehydrogenation of the coordinated cyclicamine boranes at room temperature that allows for intermediate species to be observed in the dehydrocoupling of the parent 2,2h21,2b , nc4h10 ; as well as ( for the rh system ) the kinetics of dehydrogenation to be probed , which show halforder behaviour for the catalyst , suggesting a rapid dimer such insight is valuable in both determining dehydrocoupling pathways of cyclic amineboranes and determining the speciation of the active catalyst species . glassware was oven dried at 130 c , overnight , and flamed under vacuum prior to use . pentane and mecn were dried using a grubbstype solvent purification system ( mbraun sps800 ) and degassed by successive freezepumpthaw cycles.79 c6h5f and 1,2f2c6h4 were dried over cah2 , vacuum distilled and stored over 3 molecular sieves . [ irhpcy2(c6h9)pcy2(c6h8)][bar 4],16 [ rh(pipr2(ch2)3pipr2)(c6h5f)][bar 4],62 na[bar 4],80 rh(pipr2(ch2)3pipr2)]2(h)2 65 and [ h(oet2)2][bar 4]64 were prepared by literature methods . bncyclohexane ( 1 ) , was prepared as described by luo et al.9 nmr spectra were recorded on a bruker aviii500 spectrometer at room temperature , or a varian unity / inova 300 spectrometer 500 spectrometer . in c6h5f and 1,2c6h4f2 solvents h nmr spectra were referenced to the centre of the downfield solvent multiplet , =7.11 and 7.07 ppm , respectively . p and b nmr spectra were referenced against 85 % h3po4 ( external ) and bf3oet2 ( external ) , respectively . the spectrometer was prelocked and preshimmed to the solvent mixture of 0.3 ml of 1,2c6h4f2 and 0.1 ml of c6d6 . chemical shifts ( ) are quoted in ppm and coupling constants ( j ) in hz . esims were recorded on a bruker microtof instrument interfaced with a glovebox.81 electron impact highresolution mass spectrometry ( eihrms ) was performed at the mass spectrometry facilities and services core of the environmental health sciences center at oregon state university . microanalysis was performed by elemental microanalysis ltd . for hydrogenation reactions a high pressure nmr tube equipped with a j. young s valve and the dissolved compound of interest was cooled to 77 k. the tube was evacuated and h2 admitted ( 1 atm ) . the tube was sealed and warmed to 298 k , resulting in a pressure of approximately 4 atm ( 298/77 4 ) . n methyl1,2azaborinane 2 : bclnme1,2bncyclohexene was prepared as described by chrostowska and liu.82 in a glovebox , a fischer porter tube was charged with the starting material ( 4.00 g , 30.5 mmol ) and palladium on carbon ( 64 mg , 10 wt % pd metal , 0.061 mmol , 0.2 mol % palladium ) . the vessel was sealed and flushed with hydrogen before pressurizing to 45 psi with hydrogen . the reaction was heated for 16 h with monitoring of the internal pressure and refilling as often as required . the reaction was then cooled to room temperature , and the solids were filtered off giving 1.68 g crude product ( 41 % crude yield , 12.8 mmol ) . this crude product was dissolved in thf , and lithium aluminum hydride ( 1.12 g , 29.5 mmol , 2.3 equiv ) was added carefully at room temperature . the reaction was stirred for 24 h at room temperature , and the solids were filtered off in the glovebox . the filtrate was cooled to 78 c , and methanol ( 10 ml ) was added dropwise to quench excess lialh4 and to install the proton on the product . the reaction was warmed to room temperature over 30 min , and the volatiles were removed in vacuo . the residue was extracted with hexane ( 480 ml ) , and the hexane was removed using a rotary evaporator . this residue was rinsed with cold pentane to furnish 374 mg of desired product ( 12 % yield overall ) . h nmr ( 500 mhz , c6d6 ) : =2.932.07 ( m , bh signals ) , 1.93 ( m , 3 h ) , 1.72 ( brs , 3 h ) , 1.54 ( brs , 2 h ) , 1.35 ( brs , 1 h ) , 1.23 ( brs , 1 h ) , 0.87 ( brs , 1 h ) , 0.59 ppm ( brs , 1 h ) ; c nmr ( 126 mhz , c6d6 ) : =55.1 , 42.4 , 28.8 , 26.2 , 16.6 ppm ( br ) ; b nmr ( 96 mhz , c6d6 ) : =6.5 ppm ( t , j(bh)=96.4 hz ) ; hrms ( ei+ ) : m / z calcd for c5h13nb [ m ] 98.114105 , found 98.114265 . n , n dimethyl1,2azaborinane 3 : the preparation of this compound was adapted from that of wille and goubeau.30 in a glovebox , a 300 ml pressure vessel was charged with tetrahydrofuran ( 100 ml ) and n , ndimethylhomoallylamine ( 3.00 g , 30.3 mmol , 1 equiv ) . boranetetrahydrofuran solution ( 36 ml , 1 m in thf , 36 mmol , 1.2 equiv ) was added dropwise . the pressure vessel was sealed , and the reaction was heated to 100 c for 18 h. the reaction was cooled to room temperature then opened in the air . the resulting residue , a viscous , colourless liquid , was subjected to silica gel chromatography in the air with 2:3 ch2cl2/hexane as the eluent system to furnish a colourless , viscous liquid ( 102 mg , 3 % ) . h nmr ( 300 mhz , c6d6 ) : =2.962.13 ( m , overlapping bh signals ) , 2.06 ( app t , 2 h ) , 1.95 ( s , 6 h ) , 1.76 ( brs 2 h ) , 1.341.16 ( m , 2 h ) , 0.92 ( brs , 2 h ) . c nmr ( 126 mhz , c6d6 ) : =62.4 , 50.3 , 26.4 , 25.0 , 14.8 ( br ) . b nmr ( 96 mhz , c6d6 ) : =3.0 ( t , j=96.8 hz ) . hrms ( ei+ ) m / z calcd for c6h15nb [ m ] 112.12976 , found 112.12923 . [ ir(h)2(pcy3)2(h2bnh2(ch2)4)][bar 4 ] ( 4 ) : in a young s flask , [ irhpcy2(c6h9)pcy2(c6h8)][bar 4 ] ( 44 mg , 2.710 mmol ) in c6h5f was hydrogenated at 4 atm as described in the general procedures . it was stirred for 20 min to produce a colourless solution of [ ir(h)2(pcy3)2(h2)2][bar 4 ] which was rapidly transferred under argon to a schlenk flask containing 1 ( 2.3 mg , 2.710 mmol ) . the resulting colourless solution was stirred for 2 min at 25 c , then layered with pentane and held at 30 c for 72 h to afford the product as colourless crystal . h nmr ( 500 mhz , cd2cl2 ) : =7.76 ( s , 8 h , [ bar 4 ] ) , 7.60 ( s , 4 h , [ bar 4 ] ) , 4.07 ( br , 2 h , nh2 ) , 3.23 ( br , 2 h , ch2 next to nh2 ) , 1.931.4 ( m , 35 h , pcy3 ( 33 h ) and ch2 ( 2 h ) ) , 1.361.29 ( m , 33 h , pcy3 ) , 0.92 ( m , 4 h , ch2 ) , 6.23 ( br , 2 h , bh2 ) , 20.53 ppm ( t , j hp=16 hz , irh2 ) . the nh2/ch2 resonances were identified on the basis of the number of crosspeaks in the h / h cosy spectrum . furthermore the hsqc spectrum shows no cross peak between the signal at =4.07 ppm , while the signal at =3.23 ppm is coupled to a c nmr signal at 48 ppm . p{h } nmr ( 202 mhz , cd2cl2 ) : =37.12 ( d , j pp=268 hz , 1p ) , 35.26 ppm ( d , j pp=268 hz , 1p ) ; b nmr ( 160 mhz , cd2cl2 ) : =19.8 ( br , bound bh2 ) , 6.63 ppm ( s , [ bar 4 ] ) ; esims ( 1,2c6h4f2 , 60 c ) positive ion : m / z 840.5431 [ m+ ] ( calcd 840.5492 ) ; elemental microanalysis : calcd [ c72h92b2f24irnp2 ] ( 1703.28 g mol ) : c 50.77 , h 5.44 , n 0.82 ; found : c 50.32 , h 5.33 , n 1.03 . [ ir(h)2(pcy3)2(h2bnmeh(ch2)4)][bar 4 ] ( 5 ) : in a high pressure nmr tube equipped with a j. young s valve , [ irhpcy2(c6h9)pcy2(c6h8)][bar 4 ] ( 16 mg , 110 mmol ) in c6h5f was hydrogenated at 4 atm as described in the general procedures . it was stirred for 20 min to produce a colourless solution of [ ir(h)2(pcy3)2(h2)2][bar 4 ] which was rapidly transferred under argon to another high pressure nmr tube containing 2 ( 1 mg , 110 mmol ) . gentle inversion of nmr tube for 1.5 h resulted in the colourless solution of 5 and ir(h5)(pcy3)2 in 20:1 ratio . a few single crystals suitable for xray diffraction studies was obtained by diffusion of pentane at 35 c . h nmr ( 500 mhz , c6h5f ) : =8.34 ( s , 8 h , [ bar 4 ] ) , 7.67 ( s , 4 h , [ bar 4 ] ) , 4.01 ( br , 1 h , nh ) , 3.13 ( m , 1 h , ch2 ) , 2.69 ( m , 1 h , ch2 ) , 2.46 ( s , 3 h , nme ) , 1.931.56 ( m , 37 h , pcy3 ( 33 h ) and ch2 ( 4 h ) ) , 1.391.21 ( m , 33 h , pcy3 ) , 0.87 ( m , 1 h , ch2 ) , 0.67 ( br , 1 h , ch2 ) , 6.24 ( br , 1 h , bh2 ) , 6.35 ( br , 1 h , bh2 ) , 20.58 ( br , 1 h , irh2 ) , 20.82 ppm ( br , 1 h , irh2 ) ; p{h } nmr ( 202 mhz , c6h5f ) : =36.47 ( d , j pp=276 hz , 1p ) , 33.22 ppm ( d , j pp=276 hz , 1p ) ; b nmr ( 160 mhz , c6h5f ) : =22.4 ( br , bound bh2 ) , 6.10 ppm ( s , [ bar 4 ] ) ; esims ( 1,2c6h4f2 , 60 c ) positive ion : m / z 854.5533 [ m+ ] ( calcd 854.5649 ) . n methyl1,2azaborinene 8 : this material has been reported by wille and goubeau , who invoke the intermediacy of the aminoborane 2 ( which was not isolated in their study ) . nmethylhomoallylamine ( 6.63 g , 77.9 mmol , 1 equiv ) was cooled to 0 c in 30 ml ether . boranetetrahydrofuran solution ( 0.9 m in thf , 103 ml , 93.4 mmol , 1.2 equiv ) was added slowly via cannula . after the addition was completed , the ice bath was removed and the reaction was allowed to warm for 20 min before the solvent was removed in vacuo . the clear , colourless residue was rinsed with pentane ( 3 50 ml ) in a glovebox , and the remaining insoluble residue was dissolved in benzene and heated to reflux ( 90 c ) for 24 h. after cooling to room temperature , the benzene solvent was distilled off under n2 , and the residue was submitted to vacuum transfer to a liquid nitrogencooled schlenk flask . this procedure yielded 325 mg of a 1.25:1 molar ratio mixture of product / benzene ( 2 % yield assuming equal density of benzene and product ) . h nmr ( 300 mhz , cd2cl2 ) : =2.922.80 ( m , 5 h , overlapping large singlet ) , 1.731.62 ( m , 2 h ) , 1.491.37 ( m , 2 h ) , 0.84 ( brs , 2 h ) bh proton visible at 5.03.75 ppm ( q , 1 h ) ; b nmr ( 96 mhz , cd2cl2 ) : =40.62 ppm ( d , j=125 hz ) ; h nmr ( 300 mhz , cd2cl2 ) : =2.85 ( m , overlapping with a singlet 5 h ) , 1.66 ( m , 2 h ) , 1.44 ( m , 2 h ) , 0.84 ppm ( m , 2 h ) ; b nmr ( 97 mhz , cd2cl2 ) : =40.0 ppm ( d , j=125 hz ) . [ rh(pipr2(ch2)3pipr2)(h2bnh2c4h8)][bar 4 ] ( 9 ) : 1,2f2c6h4 ( 0.5 ml ) was added to a highpressure nmr tube equipped with a j. young s valve and charged with compound 1 ( 1.2 mg , 1.410 mmol , 1.2 equivalents ) and v ( 16 mg , 1.2 x 10 mmol ) . gentle rotation of nmr tube for 30 min resulted in reddish orange solution consisting of 9 , aminoborane 7 and v as measured by nmr spectroscopy . diffusion of pentane at 35 c gave mixture of crystals corresponding to 9 ( red ) and v ( orange ) . h nmr ( 500 mhz , 1,2c6h4f2 ) : =8.33 ( s , 8h [ bar 4 ] ) , 7.69 ( s , 4 h , [ bar 4 ] ) , 4.54 ( m , nh2 ) , 3.28 ( br , ch2 ) , 3.18 ( br , ch2 ) , 2.99 ( br , ch2 ) 1.76 ( m , ch ) , 1.231.16 ( m , ch3 ) , 1.06 ( br , ch2ch2ch2 ) , 4.83 ppm ( br , bh2 ) ; p{h } nmr ( 202 mhz , 1,2c6h4f2 ) : =57.08 ppm ( d , j rhp=160 hz ) ; b nmr ( 160 mhz , 1,2c6h4f2 ) : =29.3 ( br , bh2 ) , 6.19 ppm ( s , [ bar 4 ] ) ; esims ( 1,2c6h4f2 , 60 c ) positive ion : m / z 464.2284 [ m+ ] ( calcd 464.2248 ) . [ rh(ipr2pch2ch2ch2pipr2)(h2bnhmec4h8)][bar 4 ] ( 10 ) : 1,2f2c6h4 ( 0.5 ml ) was added to a young s flask charged with 2 ( 4.5 mg , 4.5 x 10 , 2.5 equivalent ) and v ( 25 mg , 1.810 mmol ) . the resulting orange solution was stirred for 30 min to obtain a red solution . diffusion of pentane into this solution at 35 c for 72 h afforded 10 as red crystals . h nmr ( 500 mhz , cd2cl2 ) : =7.76 ( s , 8 h , [ bar 4 ] ) , 7.60 ( s , 4 h , [ bar 4 ] ) , 3.94 ( br , 1 h , nh ) , 3.33 ( br d , 1 h , ch2 ) , 2.91 ( d , j hh=5 hz , 3 h , nme ) , 2.76 ( m , 1 h , ch2 ) , 2.37 ( br , 1 h , ch2 ) , 1.991.92 ( br , 6 h , ch ( 4 h ) and ch2 ( 2 h ) ) , 1.65 ( m , 1 h , ch2 ) , 1.51.0 ( br m , 26 h , ch3 ( 24 h ) and ch2 ( 2 h ) ) , 0.52 ( br , ch2ch2ch2),4.9 ( br , 1 h , bh2 ) , 5.38 ppm ( br , 1 h , bh2 ) ; p{h } nmr ( 202 mhz , cd2cl2 ) : =57.87 ppm ( d , j rhp=162 hz ) ; p{h } nmr ( 202 mhz , cd2cl2 , 190 k ) : =57.75 ( overlapping dd , 1p , j rhp=160 hz , j pp=56 hz ) , 56.85 ppm ( overlapping dd , 1p , j rhp=160 hz , j pp=56 hz ) ; b nmr ( 160 mhz , cd2cl2 ) : =32.1 ( br , bh2 ) , 6.60 ppm ( s , [ bar 4 ] ) ; esims ( 1,2c6h4f2 , 60 c ) positive ion : m / z 478.2417 [ m+ ] ( calcd 478.2408 ) ; elemental microanalysis : calcd [ c52h60b2f24np2rh ] ( 1341.49 g mol ) : c 46.56 , h 4.51 , n 1.04 ; found : c 46.17 , h 4.16 , n 0.68 . [ rh(ipr2pch2ch2ch2pipr2)(h2bnme2c4h8)][bar 4 ] ( 11 ) : to a high pressure nmr tube equipped with a j. young s valve and charged with 3 ( 0.69 m in 1,2f2c6h4 , 0.04 ml , 2.610 mmol , 2 equivalent ) and v ( 18 mg , 1.3 x 10 mmol ) was added 1,2f2c6h4 ( 0.4 ml ) . the nmr tube was gently inverted at 25 c and the reaction was followed by periodic nmr spectroscopy . after 24 h the reaction was complete and the resulting red solution was layered with pentane and kept at 25 c for 72 h to afford the product as red crystals . h nmr ( 500 mhz , cd2cl2 ) : =7.76 ( s , 8 h , [ bar 4 ] ) , 7.60 ( s , 4 h , [ bar 4 ] ) , 2.99 ( br , 2 h , ch2 ) , 2.85 ( s , 6 h , nme2 ) , 1.92 ( m , 4 h , ch ) , 1.79 ( br , 2 h , ch2 ) , 1.65 ( br , 2 h , ch2 ) , 1.50 ( br , 2 h , ch2 ) , 1.23 ( br , 24 h , ch3 ) , 0.5 ( br , 6 h , ch2ch2ch2 ) , 5.17 ppm ( br , 2 h , bh2 ) ; p{h } nmr ( 202 mhz , cd2cl2 ) : =58.03 ppm ( d , jrhp=163 hz ) ; b nmr ( 160 mhz , cd2cl2 ) : =34.4 ( br , bh2 ) , 6.6 ppm ( s , [ bar 4 ] ) ; esims ( 1,2c6h4f2 , 60 c ) positive ion : m / z 492.2548 [ m+ ] ( calcd 492.2565 ) ; elemental microanalysis : calcd [ c53h62b2f24np2rh ] ( 1355.52 g mol ) : c 46.96 , h 4.61 , n 1.03 ; found : c 46.65 , h 4.10 , n 0.62 . [ { rh(pipr2(ch2)3pipr2)}2(h)2(h)3][bar 4 ] ( 12 ) : [ rh(pipr2(ch2)3pipr2)]2(h)2 ( 23 mg , 0.03 mmol ) and [ h(oet2)2][bar 4 ] ( 30 mg , 0.03 mmol ) were added to a young s flask . addition of 1 ml of 1,2f2c6h4 led to the formation of a dark red solution which was immediately hydrogenated at 4 atm as described in the general procedures . the resulting solution was stirred for 1 h to obtain a dark orange solution . the solution was filtered into a crystallisation tube , layered with pentane and kept at 18 c for 24 h from which dark red crystals were obtained in 70 % yield ( 34 mg ) . this complex decomposes in ch2cl2 solution ( 12 h ) to give unidentified products , but shows greater stability in 1,2f2c6h4 ( no decomposition after 24 h ) . see the supporting information for a solidstate structure as determined by single crystal xray diffraction . h nmr ( 400 mhz , cd2cl2 ) : =7.76 ( s , 8 h , [ bar 4 ] ) , 7.60 ( s , 4 h , [ bar 4 ] ) , 1.96 ( m , 8 h , ch ) , 1.561.1 ( m , 60 h , ch3 ( 48 h ) and ch2 ( 12 h ) ) , 8.85 ( br , 3 h ) , 18.87 ppm ( br , 2 h ) ; h nmr ( 500 mhz , 1,2c6h4f2 ) : =8.34 ( s , 8 h , [ bar 4 ] ) , 7.70 ( s , 4 h , [ bar 4 ] ) , 1.96 ( m , 8 h , ch ) , 1.551.11 ( m , 60 h , ch3 ( 48 h ) and ch2 ( 12 h ) ) , 8.25 ( br , 3 h ) , 18.90 ppm ( br , 2 h ) ; h nmr ( 500 mhz , 1,2c6h4f2 , 250 k ) : =8.34 ( s , 8 h , [ bar 4 ] ) , 1.93 ( m , 8 h , ch ) , 1.400.91 ( m , 60 h , ch3 ( 48 h ) and ch2 ( 12 h ) ) , 7.91 ( br , 2 h ) , 9.52 ( br , 1 h ) , 18.71 ppm ( br , 2 h ) ; p{h } nmr ( 162 mhz , cd2cl2 ) : =65.71 ( br ) , 62.68 ppm ( br ) ; p{h } nmr ( 202 mhz , 1,2c6h4f2 ) : =66.49 ( br ) , 62.22 ( br).p{h } nmr ( 202 mhz , 1,2c6h4f2 , 250 k ) : =66.36 ( br d , j rhp=100 hz ) , 60.00 ppm ( br d , j rhp=100 hz ) ; b nmr ( 128 mhz , cd2cl2 ) : =6.63 ppm ( s , [ bar 4 ] ) ; b nmr ( 160 mhz , 1,2c6h4f2 ) : =6.19 ppm ( s , [ bar 4 ] ) ; elemental microanalysis : calcd [ c62h85bf24p4rh2 ] ( 1626.34 g mol ) : c 45.77 , h 5.27 ; found : c 45.33 , h 4.84 . [ rh(ipr2p(ch2)3pipr2)(ncme)2][bar 4 ] ( 13 ) : v ( 20 mg , 1.4 10 mmol ) was dissolved in 1,2f2c6h4 ( 1 ml ) in a schlenk flask to which ch3cn ( 16 l , 0.28 mmol , 20 equivalents ) was added . 1,2f2c6h4 and unreacted ch3cn were removed in vacuo to obtain pale yellow solid of 13 . h nmr ( 500 mhz , cd2cl2 ) : =7.76 ( s , 8 h , [ bar 4 ] ) , 7.61 ( s , 4 h , [ bar 4 ] ) , 2.25 ( s , 6 h , ncch3 ) , 1.97 ( br , 6 h , ch2 ) , 1.33 ( m , 16 h , ch3 ( 12 h ) and ch ( 4 h ) ) , 1.19 ppm ( m , 12 h , ch3 ) ; p{h } nmr ( 202 mhz , cd2cl2 ) : =42.51 ppm ( d , jrhp=167 hz ) ; esims ( 1,2c6h4f2 , 60 c ) positive ion : m / z 461.1748 [ m+ ] ( calcd 461.1722 ) ; elemental microanalysis : calcd [ c51h52bf24n2p2rh ] ( 1324.62 g mol ) : c 46.24 , h 3.96 , n 2.11 ; found : c 46.13 , h 3.95 , n 1.98 . the geometries were optimized at the density functional theory ( dft)83 level with the hybrid b3lyp84 , 85 exchangecorrelation functional and the dftoptimized dzvp2 basis set for all atoms.86 vibrational frequencies were calculated to show that the structures were minima . the nuclear magnetic shielding tensors were calculated using the gaugeindependent atomic orbital ( giao ) approach.87 , 88 the nmr calculations were carried out with the tzvp basis set and b3lyp exchangecorrelation functional.89 all calculations were carried out with gaussian 09.90

abstractthe coordination chemistry of the 1,2bncyclohexanes 2,2r21,2b , nc4h10 ( r2=hh , meh , me2 ) with ir and rh metal fragments has been studied . this led to the solution ( nmr spectroscopy ) and solidstate ( xray diffraction ) characterization of [ ir(pcy3)2(h)2(22h2bnr2c4h8)][barf 4 ] ( nr2=nh2 , nmeh ) and [ rh(ipr2pch2ch2ch2pipr2)(22h2bnr2c4h8)][barf 4 ] ( nr2=nh2 , nmeh , nme2 ) . for nr2=nh2 subsequent metalpromoted , dehydrocoupling shows the eventual formation of the cyclic tricyclic borazine [ bnc4h8]3 , via aminoborane and , tentatively characterized using dft / giao chemical shift calculations , cycloborazane intermediates . for nr2=nmeh the final product is the cyclic aminoborane hbnmec4h8 . the mechanism of dehydrogenation of 2,2h , me1,2b , nc4h10 using the { rh(ipr2pch2ch2ch2pipr2)}+ catalyst has been probed . catalytic experiments indicate the rapid formation of a dimeric species , [ rh2(ipr2pch2ch2ch2pipr2)2h5][barf 4 ] . using the initial rate method starting from this dimer , a firstorder relationship to [ amineborane ] , but halforder to [ rh ] is established , which is suggested to be due to a rapid dimer monomer equilibrium operating .

You are an expert at summarizing long articles. Proceed to summarize the following text: details of the penn diabetes heart study ( pdhs ) ( 16,17 ) and the study of inherited risk of coronary atherosclerosis ( sirca ) ( 1820 ) have been reported previously . in brief , both are contemporary , single - center , cross - sectional community - based studies of subjects without clinical evidence of chd ( defined as myocardial infarction , coronary revascularization , angiographic disease , or positive stress test ) recruited at the university of pennsylvania that used the same clinical research center , research staff , electron beam computed tomography scanner , and lipid laboratory . exclusion criteria included clinical chd , elevated creatinine , and , in sirca , the presence of diabetes . this report focuses on unrelated , white subjects ( diabetic participants n = 611 , nondiabetic participants n = 803 ) . participants were evaluated at the general clinical research center at the university of pennsylvania medical center after a 12-h overnight fast . apob and plasma lipids were measured in penn 's center for disease control certified lipid laboratory . standard lipid panels and apob were measured enzymatically ( cobas fara ii ; roche diagnostic systems , somervile , nj ) in lipoprotein fractions after ultracentrifugation ( -quantification technique ) in pdhs ( 21 ) and in whole serum in sirca in a penn 's center for disease control certified lipid laboratory ( 21 ) . analyses use ldl cholesterol calculated by the friedewald formula ; direct ldl cholesterol measurement was available for diabetic subjects and produced essentially identical results ( data not shown ) . for apob and c - peptide response ( high sensitivity ) , immunoturbidimetric assays were used ( 16,19 ) . laboratory test results were generated by personnel blinded to the clinical characteristics and cac scores of research subjects . clinical parameters , including blood pressure and waist circumference , were assessed as previously reported ( 16,18 ) . framingham risk scores , using calculated ldl cholesterol ( similar results using total cholesterol ) , were determined as described by wilson et al . subjects were classified as having the metabolic syndrome using the revised national cholesterol education program definition ( glucose cut point 100 mg / dl ) ( 23 ) . global cac scores were quantified as described ( 18 ) according to the method of agatston et al . data are reported as median ( interquartile range [ iqr ] ) or mean sd for continuous variables and as proportions for categorical variables . the crude association of apob and ldl cholesterol with lipid , metabolic , and inflammatory parameters was examined by spearman correlation . multivariable analysis of cac scores was performed using tobit conditional regression of natural log ( cac+1 ) . tobit conditional regression is particularly suited to the unusual distribution of cac data ( many zero scores but also a marked right skew ) ( 18,25 ) . it combines two regression approaches : first , a logistic regression of the presence of cac ( any cac present versus cac zero score ) and second , a linear regression ( of log - transformed cac ) when cac is present . we present tobit ratios for cac score increment for a 1-sd increase in a lipid parameter , which allows a similarly scaled comparison of different lipid parameters . a tobit ratio of 1.30 means that there is a 30% increase in the cac score for every sd increase in a lipid parameter . our modeling is based on the assumption that current lipoprotein measures reflect prior levels and exposures that contributed to atherosclerosis over time . the association of apob , ldl cholesterol , and non - hdl cholesterol levels with cac was assessed in incremental models with increasing numbers of confounding risk factors : model 1 was adjusted for age , sex , and medications ; model 2 was additionally adjusted for atherosclerotic risk factors including hypertension , tobacco use , alcohol use , exercise , family history of premature chd , c - reactive protein , and metabolic syndrome ; whereas for apob , model 3 was further adjusted for total cholesterol . interaction of apob and ldl cholesterol with type 2 diabetes was tested by likelihood ratio testing , and stratified results are presented when appropriate . finally , we applied likelihood ratio testing in nested models to assess the incremental value of apob over cholesterol parameters and clinical risk assessments ( framingham risk score , metabolic syndrome ) , and vice versa , in predicting cac scores . statistical analyses were performed using stata 10.0 software ( stata , college station , tx ) . details of the penn diabetes heart study ( pdhs ) ( 16,17 ) and the study of inherited risk of coronary atherosclerosis ( sirca ) ( 1820 ) have been reported previously . in brief , both are contemporary , single - center , cross - sectional community - based studies of subjects without clinical evidence of chd ( defined as myocardial infarction , coronary revascularization , angiographic disease , or positive stress test ) recruited at the university of pennsylvania that used the same clinical research center , research staff , electron beam computed tomography scanner , and lipid laboratory . exclusion criteria included clinical chd , elevated creatinine , and , in sirca , the presence of diabetes . this report focuses on unrelated , white subjects ( diabetic participants n = 611 , nondiabetic participants n = 803 ) . participants were evaluated at the general clinical research center at the university of pennsylvania medical center after a 12-h overnight fast . apob and plasma lipids were measured in penn 's center for disease control certified lipid laboratory . standard lipid panels and apob were measured enzymatically ( cobas fara ii ; roche diagnostic systems , somervile , nj ) in lipoprotein fractions after ultracentrifugation ( -quantification technique ) in pdhs ( 21 ) and in whole serum in sirca in a penn 's center for disease control certified lipid laboratory ( 21 ) . analyses use ldl cholesterol calculated by the friedewald formula ; direct ldl cholesterol measurement was available for diabetic subjects and produced essentially identical results ( data not shown ) . for apob and c - peptide response ( high sensitivity ) , immunoturbidimetric assays were used ( 16,19 ) . laboratory test results were generated by personnel blinded to the clinical characteristics and cac scores of research subjects . clinical parameters , including blood pressure and waist circumference , were assessed as previously reported ( 16,18 ) . framingham risk scores , using calculated ldl cholesterol ( similar results using total cholesterol ) , were determined as described by wilson et al . subjects were classified as having the metabolic syndrome using the revised national cholesterol education program definition ( glucose cut point 100 mg / dl ) ( 23 ) . global cac scores were quantified as described ( 18 ) according to the method of agatston et al . data are reported as median ( interquartile range [ iqr ] ) or mean sd for continuous variables and as proportions for categorical variables . the crude association of apob and ldl cholesterol with lipid , metabolic , and inflammatory parameters was examined by spearman correlation . multivariable analysis of cac scores was performed using tobit conditional regression of natural log ( cac+1 ) . tobit conditional regression is particularly suited to the unusual distribution of cac data ( many zero scores but also a marked right skew ) ( 18,25 ) . it combines two regression approaches : first , a logistic regression of the presence of cac ( any cac present versus cac zero score ) and second , a linear regression ( of log - transformed cac ) when cac is present . we present tobit ratios for cac score increment for a 1-sd increase in a lipid parameter , which allows a similarly scaled comparison of different lipid parameters . a tobit ratio of 1.30 means that there is a 30% increase in the cac score for every sd increase in a lipid parameter . our modeling is based on the assumption that current lipoprotein measures reflect prior levels and exposures that contributed to atherosclerosis over time . the association of apob , ldl cholesterol , and non - hdl cholesterol levels with cac was assessed in incremental models with increasing numbers of confounding risk factors : model 1 was adjusted for age , sex , and medications ; model 2 was additionally adjusted for atherosclerotic risk factors including hypertension , tobacco use , alcohol use , exercise , family history of premature chd , c - reactive protein , and metabolic syndrome ; whereas for apob , model 3 was further adjusted for total cholesterol . interaction of apob and ldl cholesterol with type 2 diabetes was tested by likelihood ratio testing , and stratified results are presented when appropriate . finally , we applied likelihood ratio testing in nested models to assess the incremental value of apob over cholesterol parameters and clinical risk assessments ( framingham risk score , metabolic syndrome ) , and vice versa , in predicting cac scores . statistical analyses were performed using stata 10.0 software ( stata , college station , tx ) . diabetic subjects were older , predominantly male , more obese , and had lower total and ldl cholesterol as well as apob levels ( p < 0.001 for all ) , likely reflecting greater use of statin therapy . fifteen percent of those with diabetes were on insulin , and median a1c was 6.8% . defined metabolic syndrome was present in over 75% of type 2 diabetic and 25% of nondiabetic patients . the correlation of apob with ldl cholesterol was similar in diabetic ( r = 0.67 ) and nondiabetic ( r = 0.64 ) subjects . spearman correlations revealed associations of apob and ldl cholesterol with other chd risk parameters that were broadly similar across diabetes status ( table 2 ) . characteristics of the study sample data are median ( iqr ) or percent , unless otherwise noted . spearman correlations of lipid , metabolic , and inflammatory variables with plasma apob and ldl cholesterol in type 2 diabetic whites ( table 3 , left columns ) , apob [ tobit ratio for 1-sd increase , 1.36 ( 95% ci 1.061.75 ) , p = 0.016 ] , but not ldl cholesterol [ 1.09 ( 0.851.41 ) ] , was associated with cac after adjusting for age , sex , and lipid - lowering and diabetes medications . in nondiabetic patients ( table 3 , right columns ) , both apob [ 1.65 ( 1.381.96 ) , p < 0.001 ] and ldl cholesterol [ 1.56 ( 1.301.86 ) , p < 0.001 ] were associated with cac in this simple model . after further adjusting for multiple cardiovascular risk factors , this pattern of cac association persisted ( table 3 ) . even after adjusting for total cholesterol , apob continued to have a strong association with cac in diabetic subjects [ 1.83 ( 1.172.85 ) ] , whereas in nondiabetic subjects , this was attenuated [ 1.22 ( 0.901.65 ) ] . in combined analysis of diabetic and nondiabetic subjects , interaction analysis suggested a consistent cac association for apob ( diabetes interaction p = 0.25 ) , but a difference by diabetes status in the relationship of ldl cholesterol with cac ( interaction p = 0.02 ) . results of logistic regression of the presence of cac were similar to that for tobit modeling ( see appendix table 1 , available online at http://diabetes.diabetesjournals.org/cgi/content/full/db08-1794/dc1 ) . to explore the effect of greater statin use in the diabetic versus nondiabetic samples these analyses yielded analogous findings to the full sample for the pattern of apob , ldl cholesterol , and other lipid relationships with cac ( appendix table 2 in the online appendix ) . association of plasma levels of apob and cholesterol parameters with cac results of tobit conditional regression are presented as the ratio of increase in cac score for 1-sd increase in apob ( 17.84 mg / dl in diabetic subjects ; 22.83 mg / dl in nondiabetic subjects ) , ldl cholesterol ( 31.63 mg / dl in diabetic subjects ; 35.08 mg / dl in nondiabetic subjects ) , or non - hdl cholesterol ( 36.91 mg / dl in diabetic subjects ; 38.79 mg / dl in nondiabetic subjects ) . * tobit ratio of 1.36 means that for every 17.84 mg / dl ( 1-sd ) increase in apob , there is a 36% increase in the cac score . medications included statins , niacin , fibrates , insulin , metformin , thiazolidinediones , sulfonylureas , and hormone replacement therapy . risk factors included hypertension , tobacco use , alcohol use , exercise , family history of premature cardiovascular disease , c - reactive protein , and metabolic syndrome . in diabetic participants , plasma levels of non - hdl cholesterol had stronger cac association than ldl cholesterol but less than that for apob . in contrast , non - hdl cholesterol had almost identical cac association as apob in nondiabetic whites ( table 3 ; appendix tables 1 and 2 in the online appendix ) . we combined data across diabetic and nondiabetic subjects and assessed the incremental value of apob over cholesterol parameters ( table 4 , top rows ) . apob added value in predicting cac scores when added to ldl cholesterol and total cholesterol . in fact , it also added value to the total cholesterol / hdl cholesterol and triglyceride / hdl cholesterol ratios and marginally to non - hdl cholesterol . in contrast , adding ldl cholesterol , total cholesterol , and non - hdl cholesterol to apob failed to provide additional value ( table 4 , bottom rows ) . as expected , because they contain hdl data , the total cholesterol / hdl cholesterol and triglyceride / hdl cholesterol ratios added value to apob in predicting cac score . notably , apob provided incremental value in predicting cac beyond framingham risk scores , suggesting utility beyond current approaches in clinical practice . in secondary analyses , stratified by diabetes status , apob also added value to ldl cholesterol in those with and without type 2 diabetes ( appendix table 3 ) . apob 's additive value to non - hdl cholesterol and hdl cholesterol containing parameters was attenuated , however , likely because of reduced power in the smaller strata . relative value of apob and cholesterol parameters in predicting cac scores in diabetic and nondiabetic subjects likelihood ratio testing was applied in nested tobit models to assess the incremental value of apob over cholesterol parameters , and vice versa , in predicting cac scores . all models included age , sex , medications , and diabetes status . diabetic subjects were older , predominantly male , more obese , and had lower total and ldl cholesterol as well as apob levels ( p < 0.001 for all ) , likely reflecting greater use of statin therapy . fifteen percent of those with diabetes were on insulin , and median a1c was 6.8% . defined metabolic syndrome was present in over 75% of type 2 diabetic and 25% of nondiabetic patients . the correlation of apob with ldl cholesterol was similar in diabetic ( r = 0.67 ) and nondiabetic ( r = 0.64 ) subjects . spearman correlations revealed associations of apob and ldl cholesterol with other chd risk parameters that were broadly similar across diabetes status ( table 2 ) . characteristics of the study sample data are median ( iqr ) or percent , unless otherwise noted . spearman correlations of lipid , metabolic , and inflammatory variables with plasma apob and ldl cholesterol in type 2 diabetic whites ( table 3 , left columns ) , apob [ tobit ratio for 1-sd increase , 1.36 ( 95% ci 1.061.75 ) , p = 0.016 ] , but not ldl cholesterol [ 1.09 ( 0.851.41 ) ] , was associated with cac after adjusting for age , sex , and lipid - lowering and diabetes medications . in nondiabetic patients ( table 3 , right columns ) , both apob [ 1.65 ( 1.381.96 ) , p < 0.001 ] and ldl cholesterol [ 1.56 ( 1.301.86 ) , p < 0.001 ] were associated with cac in this simple model . after further adjusting for multiple cardiovascular risk factors , this pattern of cac association persisted ( table 3 ) . even after adjusting for total cholesterol , apob continued to have a strong association with cac in diabetic subjects [ 1.83 ( 1.172.85 ) ] , whereas in nondiabetic subjects , this was attenuated [ 1.22 ( 0.901.65 ) ] . in combined analysis of diabetic and nondiabetic subjects , interaction analysis suggested a consistent cac association for apob ( diabetes interaction p = 0.25 ) , but a difference by diabetes status in the relationship of ldl cholesterol with cac ( interaction p = 0.02 ) . results of logistic regression of the presence of cac were similar to that for tobit modeling ( see appendix table 1 , available online at http://diabetes.diabetesjournals.org/cgi/content/full/db08-1794/dc1 ) . to explore the effect of greater statin use in the diabetic versus nondiabetic samples these analyses yielded analogous findings to the full sample for the pattern of apob , ldl cholesterol , and other lipid relationships with cac ( appendix table 2 in the online appendix ) . association of plasma levels of apob and cholesterol parameters with cac results of tobit conditional regression are presented as the ratio of increase in cac score for 1-sd increase in apob ( 17.84 mg / dl in diabetic subjects ; 22.83 mg / dl in nondiabetic subjects ) , ldl cholesterol ( 31.63 mg / dl in diabetic subjects ; 35.08 mg / dl in nondiabetic subjects ) , or non - hdl cholesterol ( 36.91 mg / dl in diabetic subjects ; 38.79 mg / dl in nondiabetic subjects ) . * tobit ratio of 1.36 means that for every 17.84 mg / dl ( 1-sd ) increase in apob , there is a 36% increase in the cac score . medications included statins , niacin , fibrates , insulin , metformin , thiazolidinediones , sulfonylureas , and hormone replacement therapy . risk factors included hypertension , tobacco use , alcohol use , exercise , family history of premature cardiovascular disease , c - reactive protein , and metabolic syndrome . in diabetic participants , plasma levels of non - hdl cholesterol had stronger cac association than ldl cholesterol but less than that for apob . in contrast , non - hdl cholesterol had almost identical cac association as apob in nondiabetic whites ( table 3 ; appendix tables 1 and 2 in the online appendix ) . we combined data across diabetic and nondiabetic subjects and assessed the incremental value of apob over cholesterol parameters ( table 4 , top rows ) . apob added value in predicting cac scores when added to ldl cholesterol and total cholesterol . in fact , it also added value to the total cholesterol / hdl cholesterol and triglyceride / hdl cholesterol ratios and marginally to non - hdl cholesterol . in contrast , adding ldl cholesterol , total cholesterol , and non - hdl cholesterol to apob failed to provide additional value ( table 4 , bottom rows ) . as expected , because they contain hdl data , the total cholesterol / hdl cholesterol and triglyceride / hdl cholesterol ratios added value to apob in predicting cac score . notably , apob provided incremental value in predicting cac beyond framingham risk scores , suggesting utility beyond current approaches in clinical practice . in secondary analyses , stratified by diabetes status , apob also added value to ldl cholesterol in those with and without type 2 diabetes ( appendix table 3 ) . apob 's additive value to non - hdl cholesterol and hdl cholesterol containing parameters was attenuated , however , likely because of reduced power in the smaller strata . relative value of apob and cholesterol parameters in predicting cac scores in diabetic and nondiabetic subjects likelihood ratio testing was applied in nested tobit models to assess the incremental value of apob over cholesterol parameters , and vice versa , in predicting cac scores . we report that apob , but not ldl cholesterol , was associated with cac scores in type 2 diabetic whites . this was true despite relatively high correlations of these two lipid parameters in diabetic subjects . in contrast , both apob and ldl cholesterol were equally associated with cac in nondiabetic patients . although non - hdl cholesterol was superior to ldl cholesterol , we found that apob added incremental value to total cholesterol and ldl cholesterol and even tended to add to non - hdl cholesterol in cac prediction , whereas the reverse was not true . overall , these findings support the concept that apob levels may be stronger predictors of atherosclerotic burden than ldl cholesterol and other cholesterol parameters in type 2 diabetes . robust evidence from large primary and secondary prevention clinical trials established the standard practice of ldl cholesterol lowering for chd prevention ( 26 ) . contemporary data have refined our interventions toward more aggressive therapeutic targets ( 27 ) , yet the majority of chd events are not prevented . one potential means of improving outcomes is through more precise estimation of atherogenic lipoprotein parameters , beyond cholesterol content , that more fully capture chd risk . apob , a measure of ldl particle number ( ldl - p ) , as well as total atherogenic particle number , may represent such a parameter . in most ( 210 ) , but not all ( 2830 ) , prior reports , including several large , prospective epidemiological studies and clinical trials , apob surpassed ldl cholesterol and other cholesterol parameters , as a predictor of new and recurrent chd events and marker of residual risk on therapy . concordantly , apob is the top performer in our study , relative to ldl cholesterol , and even to non - hdl cholesterol , which , unlike apob , loses significance in the diabetic group after adjustment for age , sex , medications , and risk factors ( table 3 , p = 0.07 ) . although our sample was relatively small , large clinical studies also favor apob over non - hdl cholesterol . ( 4 ) compared apob head to head against ldl cholesterol and non - hdl cholesterol in a nested case - control study of 18,225 asymptomatic men in the health professionals follow - up study , apob emerged the leading predictor of incident chd . although , non - hdl cholesterol was equal to apob in chd prediction in type 2 diabetes ( 31 ) and healthy women ( 28 ) , the majority of clinical evidence , contemporary expert reviews , and consensus statements ( 1,5,32,33 ) as well measurement characteristics ( 5 ) favor apob over non - hdl cholesterol . however , debate continues as to the optimal choice and application in clinic ( 33 ) . the interheart study ( 34 ) extended the generalizability of apob 's utility in chd risk prediction across a 30,000-person , ethnically diverse population , spanning every major continent . interheart , along with other reports , support value in the apob / apoa1 ratio , though data are mixed on whether apoa1 is superior , or even equal , to hdl cholesterol , as discussed in a recent review by sniderman and marcovina ( 32 ) . consistent with these findings , we found that plasma apob , but not ldl cholesterol levels , were independently associated with cac scores in type 2 diabetes . in fact , other than hdl cholesterol parameters , no cholesterol data added value to apob . hdl cholesterol captures separate , anti - atherogenic effects ( 35 ) , but may also provide information because of its inverse association with insulin resistance and positive correlation with ldl particle size ( 36 ) . our findings further support apob 's superiority over ldl cholesterol , as well as other cholesterol - based measures , and break new ground in relating apob to subclinical coronary atherosclerosis , particularly in type 2 diabetes . among the laboratory methods that currently exist for determination of ldl - p , apob is the most mature and cost - effective . it is broadly equivalent to ldl - p because each ldl particle , independent of density , contains exactly one apob and the vast majority ( 90% ) of apob is carried on ldl particles ( 32 ) . in this way , apob is not affected by heterogeneity of particle cholesterol content . such heterogeneity is greater in type 2 diabetes because insulin resistance drives vldl cholesterol production that depletes ldl particles of their cholesterol content via cetp , producing cholesterol - poor small , dense ldl particles ( 11 ) . remarkably , the remainder of apob is carried on chylomicrons , vldl cholesterol , intermediate - density lipoprotein , and lipoprotein(a ) and thus also captures information on residual non - ldl atherogenic particles . apob measurement is standardized ( 37 ) and automated , yielding cost , time , and precision advantages over other modalities . it is available in most large commercial laboratories and does not require a fasting state . thus , apob has several measurement - related advantages as a marker of lipid risk . nuclear magnetic resonance ( nmr ) is an alternative means of measuring ldl - p ; however , its clinical utility is currently limited because it is expensive and not widely available across laboratories . nmr - measured ldl - p improved cardiovascular risk estimation over ldl cholesterol in several cross - sectional ( 38 ) and prospective studies ( 3943 ) . cross - sectional studies of healthy individuals showed that ldl - p was associated with cac in postmenopausal women ( 44 ) and carotid intima - media thickness in the 5,538-person multi - ethnic study of atherosclerosis study ( 38 ) . prospectively , ldl - p predicted incident chd in healthy ( 39,41,43 ) and at - risk ( 42 ) populations , as well as progression of chd ( 40 ) . in a nested case - control analysis of 2,888 subjects from the european prospective investigation into cancer and nutrition - norfolk , ldl - p outperformed ldl cholesterol as a predictor of future coronary artery disease beyond the framingham risk score , but not triglycerides and hdl cholesterol ( 43 ) . although nmr has the capacity to estimate ldl particle size as well as particle number ( 43 ) , there is limited evidence that nmr - estimated lipid data add value beyond the more simple measurement of apob ( 33,41,42 ) . patients with type 2 diabetes tend to have increased circulating ldl particles but normal concentrations of ldl cholesterol because their particles have low cholesterol content ( 45 ) . despite elevated triglycerides and low hdl cholesterol , this normal ldl cholesterol has led to underappreciation of the risk associated with dyslipidemia in diabetes . indeed , in type 2 diabetic subjects , apob and non - hdl cholesterol were favored over ldl cholesterol as predictors of chd risk in the health professional 's follow - up study ( 31 ) . our data also shows apob and non - hdl cholesterol capture information beyond ldl cholesterol in type 2 diabetes . we go further , in agreement with the recent casale monferrato study ( 46 ) and collaborative atorvastatin diabetes study ( 47 ) , in suggesting utility of apob measurement over cholesterol parameters , including non - hdl cholesterol . casale monferrato looked at 11-year chd mortality in 1,565 mediterranean subjects with type 2 diabetes and found apob predicted outcome independent of non - hdl cholesterol . cards followed 2,627 type 2 diabetic participants for 108 primary chd end points over 3.9 years . apob carried a very similar hazard ratio to non - hdl cholesterol [ adjusted hazard ratio ( 95% ci ) for 1-sd increment : 1.20 ( 1.041.38 ) vs. 1.17 ( 1.021.34 ) , respectively ] , but apob was the stronger predictor ( 6.61 ; p = 0.01 vs. 4.71 ; p = 0.03 ) . in receiver operating characteristic analysis , the area under the curve for apob versus non - hdl cholesterol was significantly greater ( p = 0.01 ) . overall , our data support others ' in suggesting that apob is likely to be an enhanced measure of subclinical coronary atherosclerosis and lipid - associated chd risk beyond traditional lipid risk factors in type 2 diabetes . analyses were cross - sectional ; thus , causal and longitudinal relationships were not addressed . apob 's stronger association with cac might reflect less variability in its measurement , especially over time , relative to ldl cholesterol . however , we can not differentiate this possibility from a true stronger apob association with cac in our cross - sectional study . we also did not examine clinical outcomes , although our data are consistent with large clinical outcomes studies . moreover , given lipid ( 48 ) and cac ( 49 ) variability by race , our findings can not be generalized beyond whites . in addition , cac is an estimate ( 14,50 ) and not a direct measure of coronary atherosclerosis ; thus , it may fail to detect some coronary atherosclerotic plaques . despite this limitation , cac scores are clinically relevant because they are strong , independent predictors of chd ( 14,15 ) , including in diabetic subjects ( 13 ) . in our study , there was also extensive and differential statin use between diabetic and nondiabetic participants . in fact , we found that apob predicted cac even after controlling for differences in statin use and in subgroup analysis of nonstatin users . ours is the first study to show that plasma apob , but not ldl cholesterol , levels are associated with cac beyond traditional risk factors in type 2 diabetic whites . these results for subclinical coronary atherosclerosis agree with clinical outcomes data supporting apob as a predictor of cardiovascular events . our findings are broadly consistent with a recent joint consensus statement from the american diabetes association and american college of cardiology that recommends incorporating apob in managing patients with cardiometabolic risk ( 33 ) . we advance previous apob literature by addressing its relationship to subclinical coronary atherosclerosis in type 2 diabetic patients free of clinical chd and we provide data that apob may warrant greater use in risk assessment beyond ldl cholesterol in these asymptomatic individuals at higher cardiometabolic risk .

objectiveevidence favors apolipoprotein b ( apob ) over ldl cholesterol as a predictor of cardiovascular events , but data are lacking on coronary artery calcification ( cac ) , especially in type 2 diabetes , where ldl cholesterol may underestimate atherosclerotic burden . we investigated the hypothesis that apob is a superior marker of cac relative to ldl cholesterol.research design and methodswe performed cross - sectional analyses of white subjects in two community - based studies : the penn diabetes heart study ( n = 611 type 2 diabetic subjects , 71.4% men ) and the study of inherited risk of coronary atherosclerosis ( n = 803 nondiabetic subjects , 52.8% men ) using multivariate analysis of apob and ldl cholesterol stratified by diabetes status.resultsin type 2 diabetes , apob was associated with cac after adjusting for age , sex , and medications [ tobit regression ratio of increased cac for 1-sd increase in apob ; 1.36 ( 95% ci 1.061.75 ) , p = 0.016 ] whereas ldl cholesterol was not [ 1.09 ( 0.851.41 ) ] . in nondiabetic subjects , both were associated with cac [ apob 1.65 ( 1.381.96 ) , p < 0.001 ; ldl cholesterol 1.56 ( 1.301.86 ) , p < 0.001 ] . in combined analysis of diabetic and nondiabetic subjects , apob provided value in predicting cac scores beyond ldl cholesterol , total cholesterol , the total cholesterol / hdl cholesterol and triglyceride / hdl cholesterol ratios , and marginally beyond non - hdl cholesterol.conclusionsplasma apob , but not ldl cholesterol , levels were associated with cac scores in type 2 diabetic whites . apob levels may be particularly useful in assessing atherosclerotic burden and cardiovascular risk in type 2 diabetes .

You are an expert at summarizing long articles. Proceed to summarize the following text: in acquired immunodeficiency syndrome ( aids ) , ocular manifestations have been reported to occur in up to 100% of patients and less commonly in patients with earlier , symptomatic hiv ( human immunodeficiency virus ) infection . noninfectious retinopathy refers to cotton - wool spots , retinal hemorrhages , and microvascular abnormalities that do not progress , enlarge , or cause visual symptoms . we herein report a case of a patient with acquired immunodeficiency syndrome who presented retinal arterial plaques in both eyes . to the best of our knowledge a 32-year - old female with a history of chronic diarrhoea , oral candidiasis and hiv seropos - itivity was examined in the medical ophthalmology services at our centre with complaint of decreased vision in both eyes of two months duration . her best corrected visual acuity was 6/60 and 6/12 in the right and left eye respectively . on ophthalmoscopic examination , ocular media in both eyes was clear . in the right eye there was diffuse pallor of the optic nerve head and generalized attenuation of the retinal arterioles ( figure 1a ) . in the left eye , also , in both eyes , there were multiple , discrete , dirty white and slightly elongated plaques along the retinal arteriolar wall . these plaques were predominantly situated in the initial ramifications of the central retinal artery and more clearly evident in the left eye ( figures 1b and 1c ) . the only abnormality evident on fluorescein angiography was narrowing of the retinal arterioles in the right eye ( figure 1d ) . at presentation to us , the patient was on treatment with oral zidovudine 200 mg twice daily and oral lamivudine 150 mg twice daily . figure 1a ) fundus photograph of the right eye showing generalized attenuation of the retinal arteriolar tree and diffuse disc pallor . b ) fundus photograph of the left eye showing multiple , whitish plaques along several branches of the central retinal artery . c ) magnified view of the left fundus showing the retinal arterial plaques more clearly . d ) fluorescein angiographic image of the left eye showing no obstruction to dye circulation within the retinal vasculature . a ) fundus photograph of the right eye showing generalized attenuation of the retinal arteriolar tree and diffuse disc pallor . b ) fundus photograph of the left eye showing multiple , whitish plaques along several branches of the central retinal artery . c ) magnified view of the left fundus showing the retinal arterial plaques more clearly . d ) fluorescein angiographic image of the left eye showing no obstruction to dye circulation within the retinal vasculature . two forms of retinal involvement have been described in acquired immunodeficiency syndrome , non - infectious and infectious retinopa - thy . non - infectious retinopathy is characterized by the presence of cotton - wool spots , retinal hemorrhages and microvascular abnormalities . cotton - wool spots are considered as the most common manifestation of non - infectious hiv retinopathy and are reported to occur in 50% of patients with aids . in the patient described here , there were multiple , dull white , slightly elongated lesions along several arteriolar branches in both eyes . in the right eye there was associated generalized narrowing of the entire retinal arterial tree and diffuse disc pallor indicating possible decreased retinal blood flow . in literature , correlation between the number of cotton - wool spots and decreased cerebral blood flow has been reported earlier in patients with symptomatic hiv infection . however no cotton - wool spots were evident in our patient and the only manifestation was the presence of the arterial plaques . these plaques may have probably resulted in arteriolar narrowing and decreased retinal blood flow in the right eye . although the left eye did not show significant arterial narrowing despite the presence of the plaques , it is possible that the same may occur over time . as patient was lost to follow up we could not identify the natural course in the left eye . kyereileis plaques seen in toxoplamosis was also considered but this patient had no other evidence of ocular toxoplasma infection . one report has indicated that there is a 1.3% risk of non - infectious retinal vascular occlusion in patients infected with hiv . in this study the authors found central retinal vein occlusion to the most common with a very low possibility of arteriolar occlusion ( in about 3% ) . the retinal arteriolar plaques seen in our patient , clinically seems like platelet fibrin emboli , which are known to cause branch retinal artery or central retinal artery occlusion . these plaques however did not cause any obstruction of dye passage on fluorescein angiography . in our patient however , cardiology evaluation was found to be normal . in particular , there was no evidence of carotid atheromas , acute mitral valve insufficiency or thrombocytopenia that is usually seen in patients with platelet fibrin emboli . it has been suggested that the cause for cotton - wool spots in aids patients could be deposition of immune complexes in the retinal blood vessels . we presume that the plaques seen in our patient are probably a manifestation of such immune - complex deposition . despite a computerized search using medline , we could not find any previous reports of the association of retinal arteriolar plaques in a patient with acquired immunodeficiency syndrome . one limitation of this report is that we were unable determine if these plaques were transient or permanent as patient did not return for longer term follow up .

the authors report the unusual observation discrete plaque like excrescencies along the retinal arterial wall in a young patient with acquired immunodeficiency syndrome . though bilateral , in the right eye there was severe arteriolar narrowing and so these plaques were less identifiable . fluorescein angiography did not reveal any arteriolar occlusion or areas of capillary occlusion in both eyes . there were no other signs of hiv associated microangiopathy and the patient did not have any concurrent cardiovascular or hematological abnormality . the cause of these plaques remains unexplained and we conjecture that they could represent macro immune - complex deposition along the arteriolar walls .

You are an expert at summarizing long articles. Proceed to summarize the following text: esophageal perforation is a relatively uncommon disease with high rate of mortality and morbidity [ 1 , 2 ] . the most common cause of this lethal disease is iatrogenic due to endoscopic procedures [ 3 , 4 ] . it seems that the prevalence of esophageal perforation is increasing worldwide because of widespread use of endoscopy for diagnosis and treatment of esophageal diseases . the importance of early diagnosis and prompt surgical treatment of perforated esophagus can not be overstated . considering the rarity of this condition and its nonspecific presentations , delay in the diagnosis and treatment occurs in more than 50% of cases . the mortality rate rises up from 40% to 60% if there is delay in diagnosis and initiation of optimal treatment , but this rate decreases to 10%25% if treatment is carried out within 24 hours of perforation [ 7 , 8 ] . despite decades of clinical experiences and surgical innovations , the management of esophageal perforations remain challenging especially for late - diagnosed or missed esophageal ruptures , and there is no gold standard for the surgical treatment of choice [ 5 , 9 ] . the aim of this study was to analyze the characteristics , treatment , and outcome of patients with esophageal perforation referred to our hospital during a 4-year duration . between october 2004 and march 2009 , 11 patients with esophageal perforations referred to our tertiary referral hospital were evaluated . demographic data , etiology , primary false diagnosis , cause of perforation , presentation , type of operation , postoperative complication , hospital stay , and outcome for each patient were analyzed to evaluate the management . in eight patients two patients had cervical esophageal perforation , and one patient was referred with boerhaave 's syndrome in the first 24 hours of diagnosis ( table 1 ) . seven patients were males and four were females with the age range of 10 to 88 years . the causes of perforation were foreign bodies in two ( chicken and fish bones ) , endoscopic instrumentation in five , trauma in one , and spontaneous in three patients . the etiologies were instrumentation in four patients , cancer in three cases , and peptic stricture in one case . in the first patient , the primary diagnosis was acute myocardial infarction with three - day ccu stay after detection of hydropneumothorax in chest x - ray following development of respiratory distress . in three patients endoscopically perforated patients , the endoscopist suspected a tracheoesophageal fistula aside from the tumor in mid - esophagus and consulted with pulmonologist for fiber optic bronchoscopy . he was febrile at the time of examination by pulmonologist ; chest x - ray was taken which showed right - sided hydropneumothorax . after insertion of chest tube and oral methylen blue administration diagnosis was confirmed in the 3rd day after endoscopy . in another patient the primary diagnosis was pancreatitis , and on the 4th day of admission , chest x - ray was taken due to suboptimal response to pancreatitis treatment and revealed pneumomediastinum . review of history revealed that she had upper endoscopy a week before referring to emergency department . in the remaining two , diagnosis was delayed due to the distance between the village and the local hospital and from the local hospital to the referral hospital . in the three patients that were presented in the first 24 hours diagnosis in two patients with cervical esophageal perforation was confirmed with contrast study in one patient and direct exploration in another . two patients with cervical esophagus perforation were treated with primary repair and drainage and postoperative period was eventless . in one patient with thoracic perforation who presented in the first 24 hours , in one of the patients with the diagnosis of complicated empyema , after tube thoracostomy in the local hospital , due to patient 's disagreement , we only placed feeding jejunostomy , and the patient died after 2 weeks . in the second patient in this group who did not have obstructive pathology , and whose esophagus tissues seemed to be suitable for primary repair , we performed a primary repair and reinforcement with intercostal muscle flap , and he died with sepsis and leakage . in the remaining six patients we carried out trans - thoracic esophagectomy , mediastinal debridement when necessitated , and gastropharyngostomy in the neck . there was no hospital mortality in these cases ( table 2 ) . in two patients with late - diagnosed perforation , two patients died after 18 and 24 months followup not due to surgical complication but due to underlying disease . the etiology of esophageal perforation in the majority of patients ( 76% ) is either diagnostic or therapeutic instrumentation of the esophagus [ 1 , 2 ] . spontaneous perforation ( boerhaave 's syndrome ) accounts for 15% , foreign bodies 14% , and trauma 10% of cases . despite continuing advances in the intensive care support , the mortality ranges from 9% to 41% [ 5 , 11 ] . there is little controversy over the importance of early diagnosis and initiation of optimal treatment of esophageal perforation [ 1 , 9 , 10 , 12 ] . however , due to relative rarity and its nonspecific presentations , delay in the diagnosis and treatment occurs in more than 50% of esophageal perforations . treatment of esophageal perforation , especially in late - diagnosed or missed ruptures still is a challenge , with controversy surrounding its optimal management [ 1 , 5 , 9 ] . the major problem is generally the reluctance of the surgeon to adopt an aggressive policy in the management of these injuries . at present , most surgeons recommend immediate surgical intervention once the patient 's condition is stabilized , except under unusual circumstances when nonoperative strategy may be used . cameron proposed three criteria for nonoperative management : firstly perforation must be contained in the mediastinum and should be drained back into the esophagus , secondly there are mild symptoms , and thirdly there should be minimal evidence of clinical sepsis [ 3 , 10 , 13 ] . none of our patients matched with these criteria , and we did not manage any patient with this option . operative strategies can be further subdivided into primary repair with or without reinforcement , simple drainage of thoracic cavity , exclusive diversion operation , occlusion of perforation site with a prosthesis , and esophageal resection with or without reconstruction [ 9 , 10 , 14 ] . the choice of operative strategy depends on the cause , location of injury , underlying esophageal diseases , and time interval after perforation , extension of spillage , edge of wound , the age , and presence of any comorbidity [ 1 , 14 ] . although many believe that primary repair is gold standard for patients who present within the first 24 hours following perforation , primary repair can be done regardless of time interval between perforation and treatment if esophageal tissue is repairable and wound edges are viable after necrosectomy , there is no distal obstruction , and the size of defect is not greater than one - third of the circumference of the esophagus [ 14 , 15 ] . importantly , the greater the delay in the diagnosis of perforation , the more edematous and necrotic is the esophageal wall . in this circumstance , identification of the esophageal wall can be extremely challenging during dissection and attempt at direct repair frequently fails [ 14 , 16 ] . we used this method in four patients , two with cervical and two with thoracic perforations . the latter case which was our first patient among late - diagnosed thoracic esophageal perforations , treated with primary repair and reinforcement with intercostals - muscle flap was complicated with leakage and died from multiorgan failure and ongoing sepsis . even in more specialized centers , leaks at the site of primary repair have occurred in 2030% of cases . we believe that primary repair has no place in the treatment of late - diagnosed thoracic esophageal perforation in the presence of established mediastinitis , edematous esophagus , and fibrin deposition . the major shortcoming of conservative treatment of the esophageal perforation including drainage , endoprosthesis insertion and various forms of esophageal diversion or exclusion in late - diagnosed thoracic esophageal perforations and established mediastinitis is leaving necrotic esophagus and infected periesophageal tissues , and continuous soilage is a perplexing problem . in addition , an often - difficult reconstructive surgery is inevitable [ 1 , 14 ] . an alternative to exclusion and diversion is t - tube drainage of the perforation , creating a controlled esophagocutaneous fistula . t - tube placement can be used in high - risk patients , but continuous leakage can progress to sepsis and is often not recommended as routine procedure . although esophageal resection is a major intervention , it is safe and reliable treatment option for complicated perforation of the thoracic esophagus . during the procedure , intrathoracic sepsis can be eliminated confidently , as its source , the leaking esophagus , is removed [ 14 , 16 ] . primary esophageal resection is indicated in the following circumstances : concurrent obstructive esophageal disease is detected , the injury is relatively extensive and associated with mediastinal or intrapleural sepsis , the viability of the wound edges , principally the mucosa , is in doubt , primary over swing of the perforation would result in at least 50% narrowing of the esophageal lumen , and generalized sepsis has already developed [ 1 , 5 , 9 , 14 , 16 ] . after resection of necrotic esophagus , an important question is carrying out immediate or delayed reconstruction . delayed reconstruction advocates claim that delaying the reconstruction reduces the time it takes to complete the first surgical procedure and facilitates the resolution of the septic state . we believe that resection of the thoracic esophagus with delayed reconstruction necessitates the exploration of the neck for cervical esophagostomy , laparotomy for decompressive gastrostomy , feeding jejunostomy , and ligature of the cardia . in reconstructive operation , instead of gastrostomy and ligature of the cardia , we did gastrolysis and an anastamosis in the clean cervical region . from time point of view , maximum difference between ligature of cardia , gastrostomy and creation of cervical esophagostomy and gastrolysis and cervical anastamosis in six consecutive cases was about 30 minutes . ( instead of stomach act as vascularized flap in mediastinum , second operation is very difficult due to adhesion in abdomen and conduit must be transpositioned in non physiologic route : substernal or transthoracic . ) we have done this aggressive option in eight cases of late - diagnosed ( > 48 hours ) thoracic esophageal perforation without mortality . it is our routine approach to the esophageal perforation that except in preterminal patients , we explore every thoracic esophageal perforation regardless of elapsed time between perforation and diagnosis and if criteria are not suitable for primary repair we do esophagectomy and debridement of necrotic tissues and decortication of lung if needed and in the same time reconstruct gastrointestinal tract with cervical gastropharyngostomy .

introduction . esophageal perforation is a relatively uncommon and lethal disease usually resulting from endoscopic procedures . delay in the diagnosis and treatment occurs in more than 50% of cases , leading to a mortality rate of 40% to 60% , but this rate decreases is 10%25% if treatment is carried out within 24 hours of perforation . case presentation . to analyze the characteristics , etiology , site of perforation , presentation , time interval till diagnosis , treatment and outcome of patients with esophageal perforation . over a five - year period , from october 2004 through march 2009 , 11 patients with esophageal perforation were referred to the division of thoracic surgery of a tertiary referral hospital . in eight patients , perforations were thoracic with delayed diagnosis for at least 48 hours . two patients had cervical esophageal perforation , and one patient had early - diagnosed boerhaave 's syndrome . eight patients are alive after followup for a period ranging from eight months to five years . in the remaining three patients , cancer was the underlying disease and the reason of death . conclusion . no patient with esophageal perforation should be deprived from surgical repair due to delayed diagnosis . all , except preterminal patients , should undergo exploration after resuscitation , and appropriate treatment should be carried out depending on the findings during operation . aggressive treatment is necessary in the case of established mediastinitis .

You are an expert at summarizing long articles. Proceed to summarize the following text: this anion is essential for intracellular signalling , cell proliferation , regulation of metabolism , and bioenergetics to name just part of its functions . energy production in oxidative phosphorylation requires availability of phosphates within a cell.1 intracellular phosphorus concentration is three to four times higher than that in extracellular fluids.2 energy - consuming membrane na / k / atpase maintains electrochemical sodium gradient , which is the primary driving force for the uphill transport of phosphate by sodium - dependent phosphorus channels.3 in cellular energy - starving states such as in heart failure ( hf ) , a reduction of transmembrane sodium gradient may impede intracellular transport of phosphorus with a consequent increase of phosphorus in serum . also , hypoxia - induced disintegration of cells such as in tumour lysis syndrome may release intracellular content , increasing serum levels of phosphorus.4 in hf , limited oxygen delivery and energy starvation at tissue levels induce hypoxia , catabolism , progressive cell damage , and multiorgan failure.5 weight loss after hf onset indirectly proves catabolic dominance.6 modern treatment is associated with reduction of wasting or may even induce weight gain , indirectly documenting anabolic advantage.7,8 the net weight change after hf onset is a fingerprint of global catabolic / anabolic balance ( cab ) . higher , but still within normal boundaries , serum phosphorus is associated with increased morbidity and mortality even in subjects with normal renal function.9,10 majority of determinants remains unknown . the impact of cab on serum phosphorus has never been examined in hf . our aim was to assess the association of cab with different levels of serum phosphorus . for the purpose of the current study , we selected patients with hf and reduced left ventricle ejection fraction ( lvef ) 40% , diagnosed according to criteria published by the european society of cardiology,11 with age > 18 years and hf duration of more than 6 months , included into the prospective registry of hf undertaken in our department since 2003 and studies investigating co - morbidities aggravating hf ( sica - hf).12 patients were recruited in an outpatient clinic between january 2004 and march 2013 . we included those who reached maximal tolerated dosages of recommended drugs , in whom the onset of hf could be identified with 1 month precision and records on body weight before first diagnosis of hf and on minimal weight during hf were available . the onset of hf was defined as a month when medical records prepared by cardiologist in ambulatory settings showed coexistence of lvef 40% with typical signs and/or symptoms of hf . the maximal body weight was defined based on medical records of the outpatient clinic as the highest weight within a year , but not later than 2 months before diagnosed hf . the lowest weight , afterwards , was defined as minimal hf oedema - free body weight , when the attending cardiologist neither changed diuretic therapy nor recorded signs and/or symptoms of fluid retention on clinical examination . duration of maximal unchanged therapy had to be longer than 1 month before index date . we excluded patients treated with glucocorticosteroids , bisphosphonates , vitamin d preparations , or calcium or phosphorus salts ; those having active infection , liver disease with enzymes four times higher than normal levels , active bleeding , known neoplasm , or granulomatous disease ; and patients who had undergone bariatric surgery or procedures reducing gut absorptive capacity . out of 1168 registry or sica - hf participants , this group was used for a cross - sectional , retrospective , and single - centre study . medical records were reviewed , and co - morbidities such as hypertension , diabetes mellitus , and hypercholesterolaemia were recognized based on clinical history , current medication , or actual measurements of respective variables . blood samples were taken in a standardized fashion in the morning ( between 8 and 10 a.m. , at least 8 h fasting ) and after 30 min resting in a supine position in a quiet , environmentally controlled room . all procedures were undertaken in accordance with the helsinki declaration , and protocol was reviewed and accepted by the ethics committee of silesian medical university . body mass and height were measured at a day of blood sampling ( index date ) using a certified scale ( b150l , redwag , zawiercie , poland ) . by dividing weights in kilograms and by height in metres squared , we have calculated body mass indexes ( bmi ) for maximal , minimal , and index weight as pre - hf bmi , min hf bmi , and index bmi , respectively . we have calculated weight loss and weight gain using the following formulations : we used a sonos-5000 hewlett - packard ultrasound scanner ( hewlett - packard , andover , ma , usa ) to measure lvef from the apical four - chamber view and calculated it with the following formula : bone mineral density was measured using dual x - ray absorptiometry with a pencil beam lunar drx - l device ( general electric , brussels , belgium ) . commercially available reagents ( roche diagnostics , switzerland ) allowed measurements of serum creatinine , albumin , alkaline phosphatase , n - terminal fragment of pro - brain - type natriuretic peptide ( ntprobnp ) , high - sensitivity c - reactive protein , phosphorus , and calcium . we have calculated the glomerular filtration rate ( gfr ) using the known modification of diet in renal disease ( mdrd ) formulation : in case of serum albumin < 40 g / l , we have corrected calcium using the following formulation : catabolic / anabolic balance was calculated as an algebraic sum of negative weight change ( loss ) after hf onset and positive weight change ( gain ) occurring afterwards . in patients who never lost any weight , a null value for the catabolic phase was applied . similarly , a null value for weight gain was taken as representation for the anabolic phase in patients who never displayed any weight gain . values of cab were split into quintiles , and for further calculations , quintile 4 in which cab was close to zero was taken as a reference . based on published data showing increased risk of all - cause mortality,9,10,1319 we have selected four serum phosphorus levels : 1.15 , 1.20 , 1.25 , and 1.30 mmol / l . for each quintile of cab , we have calculated raw and adjusted odds of serum phosphorus level above selected thresholds . continuous variables were presented as mean values and standard deviations , and categorical variables as percentages . for parameters with a skewed distribution , median value and interquartile range were given . in order to assure normal distribution for highly skewed variables [ ntprobnp and high - sensitivity c - reactive protein estimated glomerular filtration rate using mdrd formulation ( egfrmdrd ) ] , logistic regression analysis was utilized to assess the risk of serum phosphorus level above selected thresholds and to adjust for potential confounders . significance level was set at 0.05 ( two tailed ) , and all calculations were performed using software packages of for the purpose of the current study , we selected patients with hf and reduced left ventricle ejection fraction ( lvef ) 40% , diagnosed according to criteria published by the european society of cardiology,11 with age > 18 years and hf duration of more than 6 months , included into the prospective registry of hf undertaken in our department since 2003 and studies investigating co - morbidities aggravating hf ( sica - hf).12 patients were recruited in an outpatient clinic between january 2004 and march 2013 . we included those who reached maximal tolerated dosages of recommended drugs , in whom the onset of hf could be identified with 1 month precision and records on body weight before first diagnosis of hf and on minimal weight during hf were available . the onset of hf was defined as a month when medical records prepared by cardiologist in ambulatory settings showed coexistence of lvef 40% with typical signs and/or symptoms of hf . the maximal body weight was defined based on medical records of the outpatient clinic as the highest weight within a year , but not later than 2 months before diagnosed hf . the lowest weight , afterwards , was defined as minimal hf oedema - free body weight , when the attending cardiologist neither changed diuretic therapy nor recorded signs and/or symptoms of fluid retention on clinical examination . duration of maximal unchanged therapy had to be longer than 1 month before index date . we excluded patients treated with glucocorticosteroids , bisphosphonates , vitamin d preparations , or calcium or phosphorus salts ; those having active infection , liver disease with enzymes four times higher than normal levels , active bleeding , known neoplasm , or granulomatous disease ; and patients who had undergone bariatric surgery or procedures reducing gut absorptive capacity . out of 1168 registry or sica - hf participants , this group was used for a cross - sectional , retrospective , and single - centre study . medical records were reviewed , and co - morbidities such as hypertension , diabetes mellitus , and hypercholesterolaemia were recognized based on clinical history , current medication , or actual measurements of respective variables . blood samples were taken in a standardized fashion in the morning ( between 8 and 10 a.m. , at least 8 h fasting ) and after 30 min resting in a supine position in a quiet , environmentally controlled room . all procedures were undertaken in accordance with the helsinki declaration , and protocol was reviewed and accepted by the ethics committee of silesian medical university . body mass and height were measured at a day of blood sampling ( index date ) using a certified scale ( b150l , redwag , zawiercie , poland ) . by dividing weights in kilograms and by height in metres squared , we have calculated body mass indexes ( bmi ) for maximal , minimal , and index weight as pre - hf bmi , min hf bmi , and index bmi , respectively . we have calculated weight loss and weight gain using the following formulations : we used a sonos-5000 hewlett - packard ultrasound scanner ( hewlett - packard , andover , ma , usa ) to measure lvef from the apical four - chamber view and calculated it with the following formula : bone mineral density was measured using dual x - ray absorptiometry with a pencil beam lunar drx - l device ( general electric , brussels , belgium ) . commercially available reagents ( roche diagnostics , switzerland ) allowed measurements of serum creatinine , albumin , alkaline phosphatase , n - terminal fragment of pro - brain - type natriuretic peptide ( ntprobnp ) , high - sensitivity c - reactive protein , phosphorus , and calcium . we have calculated the glomerular filtration rate ( gfr ) using the known modification of diet in renal disease ( mdrd ) formulation : in case of serum albumin < 40 g / l , we have corrected calcium using the following formulation : catabolic / anabolic balance was calculated as an algebraic sum of negative weight change ( loss ) after hf onset and positive weight change ( gain ) occurring afterwards . in patients who never lost any weight , a null value for the catabolic phase was applied . similarly , a null value for weight gain was taken as representation for the anabolic phase in patients who never displayed any weight gain . values of cab were split into quintiles , and for further calculations , quintile 4 in which cab was close to zero was taken as a reference . based on published data showing increased risk of all - cause mortality,9,10,1319 we have selected four serum phosphorus levels : 1.15 , 1.20 , 1.25 , and 1.30 mmol / l . for each quintile of cab , we have calculated raw and adjusted odds of serum phosphorus level above selected thresholds . continuous variables were presented as mean values and standard deviations , and categorical variables as percentages . for parameters with a skewed distribution , median value and interquartile range were given . in order to assure normal distribution for highly skewed variables [ ntprobnp and high - sensitivity c - reactive protein estimated glomerular filtration rate using mdrd formulation ( egfrmdrd ) ] , logistic regression analysis was utilized to assess the risk of serum phosphorus level above selected thresholds and to adjust for potential confounders . significance level was set at 0.05 ( two tailed ) , and all calculations were performed using software packages of clinical and laboratory characteristics of study participants and comparison between quintiles of catabolic / anabolic balance data are expressed as mean values standard deviation , as medians and interquartile range or as percentages . a , anabolism ; acei / arb , angiotensin converting enzyme inhibitor / angiotensin ii receptor blocker ; c , catabolism ; cab , catabolic / anabolic balance ; egfrmdrd , estimated glomerular filtration rate using mdrd formulation ; hscrp , high - sensitivity c - reactive protein ; index bmi , body mass index at inclusion to the study ; lvef , left ventricle ejection fraction ; min hf bmi , minimal body mass index between the onset of heart failure and index date ; ntprobnp , n - terminal fragment of pro - brain - type natriuretic peptide ; nyha , new york heart association class ; pre - hf bmi , maximal body mass index within a year before diagnosis of heart failure . & per cent of treated patients / mean percentage of recommended dose standard deviation . the catabolic and anabolic components of weight change from the hf onset till index date for consecutive quintiles of cab were shown in figure 2 . catabolic and anabolic components of weight change from heart failure onset till index date in consecutive quintiles of catabolic / anabolic balance . on univariate analysis , serum phosphorus was positively associated with sex ( female ) : r = 0.137 ( p < 0.0001 ) , new york heart association class : r = 0.224 ( p < 0.0001 ) , alkaline phosphatase : r = 0.168 ( p < 0.0001 ) , high - sensitivity c - reactive protein : r = 0.08 ( p = 0.009 ) , ntprobnp : r = 0.258 ( p < 0.0001 ) , loop diuretics treatment : r = 0.147 ( p < 0.0001 ) , and percentage of recommended dosage of aldosterone blockers : r = 0.111 ( p < 0.0001 ) . negative correlations were found between serum phosphorus and age : r = 0.128 ( p < 0.0001 ) , min hf bmi : r = 0.09 ( p = 0.005 ) , index bmi : r = 0.128 ( p < 0.0001 ) , mean blood pressure : r = 0.246 ( p < 0.0001 ) , cab : r = 0.1530 ( p < 0.0001 ) ( figure 3 ) , serum sodium : r = 0.266 ( p < 0.001 ) , gfrmdrd : r = 0.163 ( p < 0.0001 ) , lvef : r = 0.174 ( p < 0.0001 ) , and percentage of recommended dosage of angiotensin - converting enzyme inhibitor or angiotensin ii receptor blocker : r = 0.113 ( p = 0.0005 ) . ci , confidence interval . in a multivariable model , only age , sex , gfrmdrd , serum sodium , ntprobnp , and multivariable predictors of serum phosphorus cab , catabolic / anabolic balance ; egfrmdrd , estimated glomerular filtration rate using mdrd formulation ; ntprobnp , n - terminal fragment of pro - brain - type natriuretic peptide ; ci , confidence interval . in comparison with neutral cab represented by quintile 4 , for most catabolic profile in quintile 1 , the risk of serum phosphorus above all selected thresholds was the highest . in none of the selected thresholds , the odds for higher phosphorus were substantially modified by adjustment for age , sex , index bmi , hf aetiology , and gfrmdrd , and the risk remained highly significant for quintile 1 ( table 3 , figure 3 ) . even after most robust adjustment including the new york heart association class , ntprobnp , and serum sodium , the risk of phosphorus above all thresholds in most catabolic quintile 1 of cab was still highly significant . mmol / l was also significantly higher in less catabolic quintiles 3 and 2 in comparison with quintile 4 ( table 3 , figure 4 ) . mmol / l and remained significant for cab quintile 3 in case of phosphorus > 1.25 mmol / l ( table 3 , figure 5 ) . the unadjusted and multivariable adjusted odds for serum phosphorus above selected thresholds in quintiles of catabolic / anabolic balance a , anabolism ; acei / arb , angiotensin converting enzyme inhibitor / angiotensin ii receptor blocker ; c , catabolism ; egfrmdrd , estimated glomerular filtration rate using mdrd formulation ; hscrp , high - sensitivity c - reactive protein ; lvef , left ventricle ejection fraction ; ntprobnp , n - terminal fragment of pro - brain - type natriuretic peptide ; nyha , new york heart association class . model 1 : adjusted for age , sex , index bmi , heart failure aetiology and egfrmdrd . model 2 : adjusted for age , sex , index bmi , heart failure aetiology , duration of heart failure , nyha class , alkaline phosphatase , hscrp , serum sodium , ntprobnp , total bone density , egfrmdrd , lvef , diabetes , history of smoking , beta - blockers , acei / arb , aldosterone antagonists , loop diuretics , and thiazides use . odds for serum phosphorus above selected thresholds for quintiles of catabolic / anabolic balance after adjustment for age , sex , heart failure ( hf ) aetiology and glomerular filtration rate ( gfr)mdrd . odds for serum phosphorus above selected thresholds for quintiles of catabolic / anabolic balance after full adjustment . bmi , body mass index ; hf , heart failure ; gfr , glomerular filtration rate ; nyha , new york heart association ; hscrp , high - sensitivity c - reactive protein ; ntprobnp , n - terminal fragment of pro - brain - type natriuretic peptide ; acei , angiotensin converting enzyme inhibitor ; arb , angiotensin ii receptor blocker . in an unadjusted model and after correction for age , sex , index bmi , hf aetiology , and egfrmdrd , there was significant gradual risk increase from lowest to highest selected phosphorus thresholds ( p = 0.026 and p = 0.022 , respectively ) . in fully adjusted model 2 , this increase was no longer significant ( p = 0.08 ) . in anabolic cab quintile 5 , the risk of phosphorus above none of the selected thresholds was different as compared with neutral cab in quintile 4 . on univariate analysis , serum phosphorus was positively associated with sex ( female ) : r = 0.137 ( p < 0.0001 ) , new york heart association class : r = 0.224 ( p < 0.0001 ) , alkaline phosphatase : r = 0.168 ( p < 0.0001 ) , high - sensitivity c - reactive protein : r = 0.08 ( p = 0.009 ) , ntprobnp : r = 0.258 ( p < 0.0001 ) , loop diuretics treatment : r = 0.147 ( p < 0.0001 ) , and percentage of recommended dosage of aldosterone blockers : r = 0.111 ( p < 0.0001 ) . negative correlations were found between serum phosphorus and age : r = 0.128 ( p < 0.0001 ) , min hf bmi : r = 0.09 ( p = 0.005 ) , index bmi : r = 0.128 ( p < 0.0001 ) , mean blood pressure : r = 0.246 ( p < 0.0001 ) , cab : r = 0.1530 ( p < 0.0001 ) ( figure 3 ) , serum sodium : r = 0.266 ( p < 0.001 ) , gfrmdrd : r = 0.163 ( p < 0.0001 ) , lvef : r = 0.174 ( p < 0.0001 ) , and percentage of recommended dosage of angiotensin - converting enzyme inhibitor or angiotensin ii receptor blocker : r = 0.113 ( p = 0.0005 ) . ci , confidence interval . in a multivariable model , only age , sex , gfrmdrd , serum sodium , ntprobnp , and multivariable predictors of serum phosphorus cab , catabolic / anabolic balance ; egfrmdrd , estimated glomerular filtration rate using mdrd formulation ; ntprobnp , n - terminal fragment of pro - brain - type natriuretic peptide ; ci , confidence interval . in comparison with neutral cab represented by quintile 4 , for most catabolic profile in quintile 1 , the risk of serum phosphorus above all selected thresholds was the highest . in none of the selected thresholds , the odds for higher phosphorus were substantially modified by adjustment for age , sex , index bmi , hf aetiology , and gfrmdrd , and the risk remained highly significant for quintile 1 ( table 3 , figure 3 ) . even after most robust adjustment including the new york heart association class , ntprobnp , and serum sodium , the risk of phosphorus above all thresholds in most catabolic quintile 1 of cab was still highly significant . the risk for phosphorus > 1.25 and > 1.20 mmol / l was also significantly higher in less catabolic quintiles 3 and 2 in comparison with quintile 4 ( table 3 , figure 4 ) . the significance was lost after full adjustment in case of threshold > 1.20 mmol / l and remained significant for cab quintile 3 in case of phosphorus > 1.25 mmol / l ( table 3 , figure 5 ) . the unadjusted and multivariable adjusted odds for serum phosphorus above selected thresholds in quintiles of catabolic / anabolic balance a , anabolism ; acei / arb , angiotensin converting enzyme inhibitor / angiotensin ii receptor blocker ; c , catabolism ; egfrmdrd , estimated glomerular filtration rate using mdrd formulation ; hscrp , high - sensitivity c - reactive protein ; lvef , left ventricle ejection fraction ; ntprobnp , n - terminal fragment of pro - brain - type natriuretic peptide ; nyha , new york heart association class . model 1 : adjusted for age , sex , index bmi , heart failure aetiology and egfrmdrd . model 2 : adjusted for age , sex , index bmi , heart failure aetiology , duration of heart failure , nyha class , alkaline phosphatase , hscrp , serum sodium , ntprobnp , total bone density , egfrmdrd , lvef , diabetes , history of smoking , beta - blockers , acei / arb , aldosterone antagonists , loop diuretics , and thiazides use . odds for serum phosphorus above selected thresholds for quintiles of catabolic / anabolic balance after adjustment for age , sex , heart failure ( hf ) aetiology and glomerular filtration rate ( gfr)mdrd . odds for serum phosphorus above selected thresholds for quintiles of catabolic / anabolic balance after full adjustment . bmi , body mass index ; hf , heart failure ; gfr , glomerular filtration rate ; nyha , new york heart association ; hscrp , high - sensitivity c - reactive protein ; ntprobnp , n - terminal fragment of pro - brain - type natriuretic peptide ; acei , angiotensin converting enzyme inhibitor ; arb , angiotensin ii receptor blocker . in an unadjusted model and after correction for age , sex , index bmi , hf aetiology , and egfrmdrd , there was significant gradual risk increase from lowest to highest selected phosphorus thresholds ( p = 0.026 and p = 0.022 , respectively ) . in fully adjusted model 2 , this increase was no longer significant ( p = 0.08 ) . in anabolic cab quintile 5 , the risk of phosphorus above none of the selected thresholds was different as compared with neutral cab in quintile 4 . our study is the first to demonstrate the independent association of higher serum phosphorus with higher catabolic rate in patients with hf . in various populations free of kidney impairment , higher mortality was associated with serum phosphorus values between 1.15 and 1.30 mmol / l or higher.9,10,1319 in models adjusted for potential confounders including kidney function , we consistently found serum phosphorus levels exceeding all predefined thresholds only in patients with weight loss but no detectable weight gain during hf . beyond kidney function , determinants of serum phosphorus are weakly understood . in general population , only 12% of serum phosphorus variation can be explained by nutritional , demographic , and cardiovascular risk factors profile and kidney function variables.20 to the best of our knowledge , no studies so far assessed serum phosphorus determinants in hf . our data confirmed association of serum phosphorus with age , gender , and kidney function but not with body mass . instead , we found independent correlation of serum phosphorus with cab , serum ntprobnp , and sodium . reasons for higher serum phosphorus in more catabolic patients are not clear . here , we point out several potential mechanisms to be explored in dedicated studies . this was not the case in our study , because even in the most catabolic patients , the mean estimated gfr = 78 ml / min/1.73 m was far above the threshold below which phosphorus retention is usually detected.21 bone loss is a part of general body wasting in hf.22 liberation of phosphorus from skeleton might have elevated its serum level . however , as opposed to patients with normal bone mineral content , higher serum phosphorus has never been shown in hf patients with reduced bone mineral density . in our study , we have not found differences in bone mineral densities between groups with various phosphorus levels . this effect is likely due to the phosphaturic action of parathyroid hormone excess frequently found in hf.23 it is commonly accepted that reduced tissue perfusion with excessive neuroendocrine activation , oxidative stress , inflammation , and multiple anabolic deficits are all responsible for cellular energy starvation , catabolism in hf , progressive tissue damage , and death.24 the intracellular transport of phosphorus is coupled to energy - consuming sodium pumping in the opposite direction , and this gives a primary force to intracellular transport of phosphorus.3 both sodium and phosphorus use common sodium / phosphate type iii channels known as pit-1 and pit-2.25 as a result of active transportation to all metabolizing cells , the intracellular phosphorus content is far higher than that outside . tissue hypoxia and energy starvation might have resulted in the slowing of intracellular pumping of phosphorus , leaving part of the mineral outside . for example , hypobaric hypoxia is associated with reduction of phosphorus content within the brain.26 shortage of bioavailable phosphorus within a cell may have impeded atp production as was recently shown in case of chondrocytes and may have closed circulus vitiosus of detrimental events.27 furthermore , in more profound hypoxia or because of toxic drug effect , cell disintegration with release of intracellular content into the blood may occur . this effect is observed in tumour lysis syndrome where hyperphosphatemia associated with hyperuricaemia and inflammation is a typical laboratory finding.4 it is not known if mild forms of this syndrome may occur in hf , although similarities of biochemical profiles between tumour lysis and acute hf are striking . in mammalian cells , part of phosphorus is stored as linear polymers of several to hundreds of phosphate units known as polyphosphates.28 the synthesis of these molecules was shown to be energy dependent and linked to membrane transport and cell integrity.29 reduction of energy provision may have limited the synthesis of these molecules , thus leaving more unpolymerized phosphorus in the blood . recently , hyponatraemia was found to be associated with hypoparathyroidism.30 relative insufficiency of parathyroid function may be responsible for reduced phosphaturia and phosphorus retention . in our cohort , we noticed negative correlation between serum sodium and phosphorus . additionally , sodium concentration was an independent predictor of serum phosphorus . the absence of anabolic component of weight change in patients in whom we observed higher serum phosphorus speaks in favour of cellular energy starvation state as a potential common denominator . regardless of the mechanism(s ) responsible for elevation of phosphorus in more catabolic states of hf , its presence in circulation may have significant consequences . animal and human studies show causative involvement of excessive serum phosphates in endothelial dysfunction,31 smooth muscle cell apoptosis,32 and vascular calcifications,33 and all of these are implicated in vascular remodelling , arterial stiffness , and clinical events . independent of toxic effects of excessive serum phosphorus on cardiovascular structures , phosphorus is known to stimulate lipolysis , a finding that opens a new area for potential metabolic consequences of elevated phosphorus in hf.34 taking all these in mind , we believe that it is prudent to study phosphorus as a likely and important player in hf pathophysiology . our study identified metabolic status as an important and independent determinant of serum phosphorus in hf . we showed an association between catabolism in hf and elevation of serum phosphorus above thresholds known to increase the risk of mortality in various populations . the study extends our knowledge on non - renal determinants of serum phosphorus in hf , pointing out to long - term metabolic status change as a potential important modulator . the most important limitation is that we can not rule out some fluid retention as a contributor to maximal body weight . also , clinical judgement of freedom from fluid overload might not have been sensitive enough to establish true oedema - free weight at minimum in hf and at index date . as a consequence , the determination of anabolic and catabolic components of weight change might have been subjected to significant bias . finally , we did not differentiate between catabolism - driven and intentional weight loss in our patients . interpretation is also impeded by the lack of data on serum parathyroid hormone , phosphatonines , and vitamin d. our study identified metabolic status as an important and independent determinant of serum phosphorus in hf . we showed an association between catabolism in hf and elevation of serum phosphorus above thresholds known to increase the risk of mortality in various populations . the study extends our knowledge on non - renal determinants of serum phosphorus in hf , pointing out to long - term metabolic status change as a potential important modulator . the most important limitation is that we can not rule out some fluid retention as a contributor to maximal body weight . also , clinical judgement of freedom from fluid overload might not have been sensitive enough to establish true oedema - free weight at minimum in hf and at index date . as a consequence , the determination of anabolic and catabolic components of weight change might have been subjected to significant bias . finally , we did not differentiate between catabolism - driven and intentional weight loss in our patients . interpretation is also impeded by the lack of data on serum parathyroid hormone , phosphatonines , and vitamin d.

backgrounda higher serum phosphate level is associated with worse outcome . energy - demanding intracellular transport of phosphate is needed to secure anion bioavailability . in heart failure ( hf ) , energy starvation may modify intracellular and serum levels of phosphate . we analysed determinants of serum phosphates in hf and assessed if catabolic / anabolic balance ( cab ) was associated with elevation of serum phosphate.methodswe retrospectively reviewed data from 1029 stable patients with hf and have calculated negative ( loss ) and positive ( gain ) components of weight change from the onset of hf till index date . the algebraic sum of these components was taken as cab . the univariate and multivariable predictors of serum phosphorus were calculated . in quintiles of cab , we have estimated odds ratios for serum phosphorus above levels previously identified to increase risk of mortality . as a reference , we have selected a cab quintile with similar loss and gain.resultsapart from sex , age , and kidney function , we identified serum sodium , n - terminal fragment of pro - brain - type natriuretic peptide , and cab as independent predictors of serum phosphorus . the odds for serum phosphorus above thresholds found in literature to increase risk were highest in more catabolic patients . in most catabolic quintile relative to neutral balance , the odds across selected phosphorus thresholds rose , gradually peaking at 1.30 mmol / l with a value of 3.29 ( 95% confidence interval : 2.005.40 , p < 0.0001 ) in an unadjusted analysis and 2.55 ( 95% confidence interval : 1.382.72 , p = 0.002 ) in a fully adjusted model.conclusionsmetabolic status is an independent determinant of serum phosphorus in hf . higher catabolism is associated with serum phosphorus above mortality risk - increasing thresholds .

You are an expert at summarizing long articles. Proceed to summarize the following text: the goal of the cervical surgery is to relieve the compression on the nerves and/or spinal cord , and anterior or posterior cervical approach is used to access the cervical spine depend on the type of surgery required6 ) . the anterior approach can allow the surgeon access to almost the entire cervical spine , and often helps maintain the normal curvature of the spine4 ) . the textbook of korean spinal neurosurgery society provide that general external landmarks : the hyoid bone corresponds to c3 ; the thyroid cartilage corresponds to c4 - 5 ; and the cricothyroid membrane identifies the c6 vertebral level3 ) . cervical spine level estimation according to the external landmarks is useful , quick and less exposable to radiation , but , sometimes cervical level confusion to the target cervical level could be happen . herein , the authors reviewed the corresponding between the neck external landmarks and cervical levels . between january and december 2013 , the authors retrospectively reviewed cervical lateral radiographs which were taken in single university hospital by various cervical problems . all radiographs and the patient 's information such as sex , age , and heights were collected using the retrograde medical chart review . the neck external landmarks were defined as mandible angle , hyoid , thyroid , and cricothyroid in radiographs : mandible angle as the posterior border at the junction of the lower border of the ramus of the mandible ; hyoid as the superior surface of anterior margin of hyoid ; thyroid as the inferior margin of laryngeal incisures ; and crocithyroid as the lower border of the laryngeal prominence which connected to median cricothyroid ligament . these landmarks and horizontally lined to cervical spine were corresponded in radiographs , and each reference level were measured as cervical vertebral body level or cervical disc level ( fig . 1 ) . for example , if the horizontal line were corresponded to c3 vertebral level , it was measured as " c3 " , and if the line were corresponded to the disc level between c5 and c6 , it was measured as " c5.5 " . the authors used the imaging programs for horizontal line drawing between landmarks and cervical level . the results are expressed as the meanstandard deviation . paired student t - test was used to assess the statistical differences using sas software for windows ( sas institute inc . , the average reference levels of cervical landmarks were c2.13 with mandible angle , c3.54 with hyoid , c5.12 with thyroid , and c6.01 with cricothyroid ( table 1 , fig . 2 and 3 ) . the reference levels of cervical landmarks were differently observed by sex , age , and height accordingly mandible from disc level of c1 and c2 to c3 , hyoid from disc level of c2 and c3 to c5 , thyroid from disc level of c3 and c4 to c7 , and cricothyroid from c4 to disc level of c7 and t1 . the reference levels were statistically differently observed according to the sex , age , and height ( p<0.05 ) , but the average difference were not meaningful to clinics because of its minimal actual differences ( within 0.5 cervical level ) . the male group showed more wide variety of thyroid cervical reference level ( c4-c7 ) compared to female group ( c3.5-c6 ) . indeed , taller subjects ( > 180 cm ) showed more narrowed cervical reference level of mandible , hyoid , thyroid , and cricothyroid compared to others ( < 180 cm ) . the age also contributed the range of cervical reference level , and the range were slightly narrowed accordingly the ages of subjects ( for example , the cricothyroid reference level was narrower from c4-c7.5 in 1 decades to c5.5-c7 in 7 decades . the mandible was comparatively observed in constant level ( c2 - 3 ) , but , the hyoid , thyroid , and cricothyroid showed relatively wider variation of reference cervical level according to the sexes with statistical differences ( p<0.05 ) . cervical anterior approach is one of most common procedures to treat the cervical pathology . during the performing this technique , the general cervical spine estimation by external landmarks is useful , quick and less exposable to radiation techniques . so , most textbooks advert about the external landmarks for cervical operation . yoomans neurosurgery5 ) commented that " the cricothyroid membrane identifies the c6 vertebral level . the thyroid cartilage corresponds to c3 - 4 , and the space halfway between these two points corresponds to c4 - 5 . a distance of two finger - breaths above the clavicle usually to c6 - 7 , and a distance of three fingerbreadths corresponds to c4 - 5 . the c6 anterior tubercle can be palpated in thin patients . " , lu et al . summarized that the external landmarks as hard palate to arch of atlas , lower border of mandible to c2 - 3 , hyoid to c3 , thyroid cartilage to c4 - 5 , cricoid cartilage to c6 , and carotid tubercle ( anterior transverse process ) to c65 ) . the textbook of korean spinal neurosurgery society provide that general external landmarks : the hyoid bone corresonds to c3 ; the thyroid cartilage corresponds to c4 - 5 ; and the cricothyroid membrane identifies the c6 vertebral level3 ) . these provided references were similar but slightly different references were observed according to different authors . in this study also different reference levels as our result indicated : c2.13 with mandible , c3.54 with hyoid , c5.12 with thyroid , and c6.01 with cricohyoid . but , the more important information is that the reference levels of cervical landmarks were differently observed by sex , age , and somatometric measurement ( height ) accordingly mandible from c1 to c3 , hyoid from disc level of c2 and c3 to c5 , thyroid from disc level of c3 and c4 to c7 , and cricohyoid from c4 to disc level of c7 and t1 . this result were similar to previous other study which investigated the vertebral levels of the hard palate , hyoid bone , thyroid cartilage , cricoid cartilage , and bifurcation of the common carotid artery using computed tomography8 ) . only the vertebral level of the hard palate ( c1 ) was consistent with contemporary descriptions . other landmarks were located most frequently at the following vertebral levels : the center of the body of the hyoid bone at c4 ( 54% of cases ) ; the superior limit of the laminae of the thyroid cartilage at c4 in women ( 60% ) and c5 in men ( 52% ) ( p=0.02 ) ; the inferior border of the cricoid cartilage in the midline anteriorly at c6 in women ( 37% ) and c7 in men ( 47% ) ( p=0.008 ) ; and the bifurcation of the left and right common carotid arteries at c3 ( left 56% , right 62% ) . vertebral levels of key bony / cartilaginous structures in the neck differ from standard descriptions but in the absence of a standardized cervical axial plane have limited value and clinical utility . while performing the anterior approach to the cervical vertebral bodies , injury to important anatomic structures in the vicinity of the dissection represents a serious risk5 ) . the midportion of the recurrent laryngeal nerve and the external branch of the superior laryngeal nerve are encountered in the anterior approach to the lower cervical spine . avoiding injury to the recurrent laryngeal nerve and superior laryngeal nerve is a major consideration in the anterior approach to the lower cervical spine . the sympathetic trunk is situated in close proximity to the medial border of the longus colli at the c6 level . indeed , the spinal accessory nerve ( embedded in fibroadipose tissue in the posterior triangle of the neck ) is prone to injury . its damage will result in an obvious shoulder droop , loss of shoulder elevation , and pain . prevention of inadvertant injury to the accessory nerve is critical in the neck dissection , so , the surgical level should be minimized eorros during the cervical anterior approach . in this study , the average reference levels of cervical landmarks were c2.13 ( c1.5 - 3 ) with mandible , c3.54 ( c2.5 - 5 ) with hyoid , c5.12 ( c3.5 - 7 ) with thyroid , and c6.01 ( c4-c7.5 ) with cricohyoid as it showed in table 1 and figures . the reference levels were statistically differently observed according to the sex , age , and height , but these difference were not meaningful to clinics within 0.5 cervical level . the male group showed more wide variety of thyroid cervical reference level ( c4-c7 ) compared to female group ( c3.5-c6 ) . indeed , taller subjects ( > 180 cm ) showed more narrowed cervical reference level of mandible , hyoid , thyroid , and cricohyoid compared to others ( < 180 cm ) . the age also contributed the range of cervical reference level , and the range were slightly narrowed accordingly the ages of subjects ( for example , the cricohyoid reference level was narrower from c4-c7.5 in 1st decades to c5.5-c7 in 7 decades . the mandible was comparatively observed in constant level ( c2 - 3 ) , but , the hyoid , thyroid , and cricothyroid showed relatively wider variation of reference cervical level according to the sexes with statistical differences ( p<0.05 ) . surface landmarks did not correspond to exact levels of the cervical spine , and only provide general reference points .

objectivea general orientation along the cervical spine could be estimated by external landmarks , and it was useful , quick and less exposable to radiation , but , sometimes it gave reference confusion of target cervical level . the authors reviewed the corresponding between the neck external landmarks and cervical levels.methodstotally 1,031 cervical lateral radiographs of different patients were reviewed in single university hospital . its compositions were 534 of males and 497 females ; 86 of second decades ( 10 - 19 years - old ) , 169 of third decades , 159 of fourth decades , 209 of fifth decades , 275 of sixth decades , and 133 of more than seventh decades ( > 60 years - old ) . reference external landmarks ( mandible , hyoid bone , thyroid cartilage , and cricothyroid membrane ) with compounding factors were reviewed.resultsthe reference levels of cervical landmarks were c2.13 with mandible angle , c3.54 with hyoid bone , c5.12 with thyroid cartilage , and c6.01 with cricothyroid membrane . the reference levels of cervical landmarks were differently observed by sex , age , and somatometric measurement ( height ) accordingly mandible angle from c1 to c3 , hyoid bone from disc level of c2 and c3 to c5 , thyroid cartilage from disc level of c3 and c4 to c7 , and cricothyroid membrane from c4 to disc level of c7 and t1.conclusionsurface landmarks only provide general reference points , but not correspond to exact levels of the cervical spine . intraoperative fluoroscopy ensures a more precise placement to the targeted cervical level .

You are an expert at summarizing long articles. Proceed to summarize the following text: the discovery of neural stem cells ( nscs ) at the beginning of the nineties led many people to consider definitively broken the dogma of the central nervous system ( cns ) as made up of nonrenewable elements [ 13 ] . this finding , along with the characterization of adult neurogenesis in the olfactory bulb and hippocampus [ 35 ] triggered new hopes for brain repair . yet , twenty years after , we realize that the dream of regenerative medicine applied to brain / spinal cord injuries and neurodegenerative diseases is still very far [ 6 , 7 ] . as a matter of fact , adult neurogenesis in mammals occurs mainly within two restricted areas known as neurogenic sites [ 3 , 8 ] : the forebrain subventricular zone ( svz ) , reviewed in ; and the hippocampal dentate gyrus ( subgranular zone , sgz ) , reviewed in . as a direct consequence of such topographical localization , most of the cns parenchyma out of the two classic neurogenic sites remains substantially a nonrenewable tissue . an indirect proof of this statement resides in the fact that most of the traumatic / vascular injuries and neurodegenerative diseases , which actually occur in regions , have still not found efficacious therapies capable of restoring cns structure and functions through cell replacement . thus , two decades after the discovery of nscs and the reaching of a satisfactory characterization of adult neurogenic sites , a gap remains between the occurrence of stem / progenitor cells in the cns of adult mammals and their effective capability to serve in brain repair . several aspects do converge in explaining this gap and , partly , in accounting for the heterogeneity of cns structural plasticity in mammals ( summarized in table 1 ) . during the last decade , new heterogeneity has been revealed by studies showing a substantial and widespread gliogenic [ 1216 ] , and to a lesser extent , neurogenic potential [ 1719 ] within the cns parenchyma , namely , in those areas previously considered as nonneurogenic . this new field of investigation revealed many unexpected potentialities for de novo cell genesis in the cns , although most aspects of parenchymal neurogliogenesis remain quite obscure and ill - defined . in particular , several unresolved aspects make parenchymal neurogenesis a difficult territory to be explored : ( i ) the contrast between a wide range of potentialities displayed by parenchymal progenitors isolated in vitro and far more restricted potentialities which can be observed in vivo [ 20 , 21 ] , ( ii ) the existence of studies reporting neurogenesis in parenchymal regions which have been denied or not confirmed by other researchers [ 2224 ] , and ( iii ) the real origin of progenitors which are induced to proliferate / migrate in different lesion models ( either mobilized from neurogenic sites or activated locally within the parenchyma ; see boxes 1 and 2 ) [ 2528 ] . in this paper the in vivo neurogenic / gliogenic potential of the mammalian brain parenchyma will be analyzed with particular reference to variables involved in its heterogeneity ( see figure 1 and table 1 ) . in order to avoid one of the most common misunderstandings , namely , the confusion between occurrence of de novo cell proliferation in the cns tissue and existence of true gliogenic / neurogenic processes ( see box 1 ) , the attention should be focused on the outcome(s ) of the newly generated progeny . before addressing in detail the heterogeneity of mammalian cns structural plasticity and cell genesis , a brief summary of comparative adult neurogenesis and progenitor cell developmental origin will be given . indeed , evolutionary explanations can provide an understanding of the logic followed ( or not ) by neurogenic processes through phylogeny , also accounting for the failure in cns repair / regeneration and scarce usefulness of adult neurogenesis as a possible solution for brain repair in mammals . in parallel , since developmental changes account for loss of cns reparative / regenerative capacities and neuro - glio - genic potential , it is also important to know the real origin of different types of progenitor cells . as a matter of fact , failure in mammalian brain repair after traumatic , vascular , and neurodegenerative injuries is due to ( i ) a substantial lack of cns reparative / regenerative capacity , ( ii ) a strong reduction in the extension of neurogenic regions within the whole cns , ( iii ) the fact that adult neurogenic sites serve specific physiological functions rather than brain repair ; for review , see [ 11 , 40 , 43 ] . it is important to note that if the occurrence of good neurogenic potentials would generally favor brain repair ( at least by making available stem / progenitor cells ) there is not a direct , linear relationship between occurrence of stem / progenitor cells and repair / regeneration , the latter processes strongly depending on the tissue environment and/or tissue reactions ( for selected examples of neurogenesis and regeneration see ) . comparative studies on adult neurogenesis in the animal world show that neurogenic processes are detectable in wide regions of the cns in invertebrates and nonmammalian vertebrates [ 29 , 44 , 45 ] . by contrast , in mammals neurogenic processes are restricted to two privileged areas ( neurogenic sites ) and the remaining cns is largely made up of nonrenewable tissue [ 32 , 46 , 47 ] . the state of substantial general plasticity and cell renewal existing in the oldest living metazoans , so that all cell types , including neurons , are balanced in their production and loss [ 48 , 49 ] , is progressively reduced in vertebrates , although fish and amphibians still maintain remarkable regenerative capacities [ 50 , 51 ] . then , in birds and mammals a transition between regeneration permissive and nonpermissive stages occurs soon after birth , and highly - restricted spots of adult neurogenesis serve homeostatic functions in specific neural circuits [ 52 , 53 ] . the decrease in neurogenic abilities occurs in parallel with topographical / numerical restriction of germinal layer - derived stem cell niches , whereas the decrease in regenerative abilities occur in parallel with other aspects : the impossibility to re - access to embryonic developmental programs during adulthood , the lack of differentiated cells capable of dedifferentiation , the development of a strong immune surveillance and the consequent tissue reactions which are detrimental ( reviewed in [ 11 , 41 ] ) . in some cases , the stem cells found in the cns of nonmammalian vertebrates are deployed for postnatal development of parts of the brain until the final structure is reached . in other cases , postnatal neurogenesis continues into adulthood leading to a net increase of the number of neurons with age ( reviewed in ) . an example is the cerebellar granular layer , which actually functions as a protracted development in postnatal mammals , whereas it becomes a persistent neurogenesis in adult teleosts , by continuously growing so that no definite adult cerebellar size is reached . in addition , when considering mammals , the failure in cns repair is a result of evolutionary constraints in which the injured tissue would not favor a strategy of regeneration but rather one of minimizing further damage ( e.g. , gliotic reaction ) . in conclusion , as a consequence of multiple converging aspects , cns regenerative capacity in mammals could have reached a point of nonreturn , in parallel with the persistence of some neurogenic processes which remain mainly focused on physiological functions ( e.g. , cell renewal / addition in selective neural circuits linked to learning / memory tasks [ 52 , 53 ] ) . an increased consciousness of the fact that scarce cns reparative capacity in mammals depends on multiple aspects should indicate that it is very unlikely that the finding of a single molecular factor or pharmacological treatment capable of eliciting repair / regeneration . comparative results from vertebrate species of different classes have demonstrated that adult neurogenesis is widespread among vertebrates but is employed by different species in different functional contexts [ 53 , 58 , 59 ] . in addition , a growing number of reports show remarkable heterogeneity even among mammals [ 1719 ] . this variability concerns both neurogenic sites and parenchymal neurogenesis ( reviewed in ; see below ) . this fact , along with a still incomplete knowledge of adult neurogenesis in humans ( especially within the parenchyma ) , partially hampers the reaching of well - established common rules which might be used in the translation of experimental preclinical data to human medicine . hence , dealing with mammalian cns structural plasticity , at least two levels of heterogeneity should be taken into account : that involving different types of neurogenic processes ( addressed in the next paragraph ) and that of interspecies differences ( mainly developed in the paragraph on parenchymal neurogenesis ) . detailed investigations carried out on the cellular , molecular , and functional outcomes of classic neurogenic sites revealed they are consistently present in all mammals studied , although with some differences . particularly when the outcome(s ) of the neurogenic process are involved , the differences could be remarkable . the occurrence of a rostral migratory stream which is active throughout life in rodents but temporally restricted to the postnatal period in humans is a prototypical example of variability among mammals . indeed , in humans this neurogenic process seems to fall in the category of delayed developmental processes rather than adult neurogenesis ( see below ) . in addition to differences in neurogenic sites , studies carried out during the last two decades revealed the presence of local , parenchymal progenitors which retain some proliferative capacity in most of the mature mammalian cns [ 12 , 14 , 15 , 1719 , 61 ] . this fact suggests that structural plasticity involving de novo cell genesis in the cns could be more widespread than previously thought , but also different when occurring in neurogenic sites or in the parenchyma ( table 2 ) . as a consequence of the increasing number of reports investigating adult neurogenesis in mammals , our perception of this biological process has gained new perspectives and nuances ( for deeper analysis see [ 29 , 3234 ] ) . what was previously thought as the genesis of new neurons in restricted brain areas endowed with nscs , can now be intended as a highly heterogeneous phenomenon ( summarized in figure 1 ) , whose heterogeneity depends on several variables ( see table 1 ) . the main elements of heterogeneity can be summarized as follows : ( i ) the location of progenitors : gathered within restricted neurogenic sites or widely spread out in the parenchyma ; ( ii ) the nature of the progenitors : bona fide nscs versus different types of progenitors ; ( iii ) the genetic and molecular features of the progenitors : cell lineage ( neuronal - like versus glial - like ) ; identification of differentiative stages ( dependent on the available markers ) ; ( iv ) the existence or not of well - characterized neurogenic niches : absence of niches or occurrence of atypical / non - identified niches in the parenchyma ; ( v ) the extension in time after birth : protracted , transient , persistent neurogenesis ; ( vi ) the ultimate fate of the progeny in terms of cell lineage : neuronal versus glial , astrocytic versus oligodendrocytic ; ( vii ) the ultimate fate of the progeny in terms of cell integration into circuits : complete versus incomplete neurogenesis ; ( viii ) the spontaneous occurrence of the process versus its injury - induced appearance ( briefly addressed in paragraphs 5 and 6 ) . this latter point could be considered a further step beyond the so - called constitutive neurogenesis , namely , the spontaneous , continuous genesis of new neurons as part of a physiologic , homeostatic process . due to multifaceted aspects of the above mentioned processes , some problems of terminology can also be raised ( summarized in box 1 ) . neurogenesis , which can be intended either as genesis of neurons or as genesis of neural cells , embryonic neurogenesis , namely , the process of building up the whole cns , involves both neuro- and gliogenesis , occurring in largely overlapping and strictly intermingled phases , whereas neurogenesis and gliogenesis can occur separately in the adult . the landscape is even more complex , since research on adult neurogenesis brought developmental neuroscience within the mature brain , and the intermix of structurally plastic changes involving cell genesis / differentiation with the fully assembled adult tissue is accompanied by a previously unexpected intermix of cell lineages ( e.g. , newly formed neuroblasts arising from astrocytic - like stem cells in vivo ) . for this reason , in this paper , when not speaking of well - characterized cell lineages , the notion of cell genesis instead of neurogenesis will be used , since in most neurogenic processes different cell types can be considered among the progenitors , and different progenies can be generated . hence , apart from detailed knowledge gathered around the activity of svz and sgz neurogenic sites , many aspects of parenchymal cell genesis remain obscure and/or unexplored , as a consequence of the heterogeneity depicted above . in the last few years , parenchymal neurogliogenesis was among the most studied yet less known issues , due to the widespread location of the progenitor cells and to the substantial lack of markers which specifically identify their real origin as well as the stage - specific steps of their differentiation . as a consequence , the presence / absence of neurogenic processes within different cns parenchymal regions in different mammalian species is still quite controversial and debatable . in most cases , furthermore , in some cases it is very difficult to show its final outcome(s ) , most of the parenchymal neurogenesis appearing incomplete as to the final differentiation / integration of the progeny ( figure 1 ) . finally , to correctly classify both germinal layer - derived and parenchymal neurogenesis some other aspects should be taken into account , such as the temporal extension of a further aspect is that of potential / lesion - induced neurogliogenesis , namely , the genesis of new cells as a consequence of different types of cns injury [ 25 , 26 , 28 , 63 ] or altered homeostasis . the latter issue will not be addressed in detail in this paper mainly focused on spontaneous / physiological states one of the features making possible the remarkable neurogenesis occurring in the neurogenic sites is their direct origin from embryonic , germinal layers which retain stem / progenitor cells along with the niche environment allowing their activity [ 10 , 65 ] . the svz and sgz actually are remnants of their embryonic counterpart , from which they maintain several cellular and molecular aspects in parallel with an adaptation to the changing anatomy of the postnatal and adult brain [ 66 , 67 ] . during development , the cns originates from the neuroepithelium , pseudostratified epithelial cells that maintain contact with both the ventricular and pial surfaces . as brain thickness increases , neuroepithelial cells transform into radial glia [ 65 , 68 ] . beside their classic role as scaffolding for migrating neurons during embryogenesis and their subsequent transformation into parenchymal astrocytes of the mature cns [ 69 , 70 ] , more recent studies have shown that radial glia cells behave as stem cells , leading to the genesis of astrocytes , neurons [ 71 , 72 ] , and , to a lesser extent , oligodendrocytes . thus radial glia cells not only serve as progenitors for many neurons and glial cells soon after birth , but also give rise to adult svz stem cells that continue to produce neurons throughout life . the origin of astrocytes that function as neural progenitors in the adult hippocampus has not been determined experimentally . a connection to radial glia cells has been suggested even in the hippocampal sgz [ 74 , 75 ] . the relationship of adult nscs to their developmental precursors offers clues to the unique characteristics that distinguish these germinal astrocytes from other astroglial cells in the brain parenchyma . indeed , parenchymal astrocytes lose very early their stem cell potential ( around postnatal day 10 in mice ) , although they can still proliferate in the severe gliosis induced after lesion , and resume multipotentiality in vitro . on the other hand , gliogenesis persists throughout the cns in the form of parenchymal cell genesis capable of creating new oligodendrocytes and , to a lesser extent , astrocytes , throughout life [ 12 , 15 ] . most of this gliogenic activity is attributed to synantocytes / polydendrocytes ( ng2 + cells ; see paragraph 6 ) which are widespread in the cns and whose origin is still partially obscure . oligodendrocytes originate from migratory and mitotic embryonic precursors which progressively mature into postmitotic myelin - producing cells . the sequential expression of developmental markers defines distinct phenotypic stages in the oligodendrocyte lineage , characterized by proliferative capacities , migratory abilities , and changes in morphology . the first oligodendrocyte - committed cell appears at embryonic day 12 ( e12 ) in two columns in the ventral ventricular zone of the motor neuron progenitor domain , which is defined by the expression of olig2 . the embryonic oligodendrocyte precursors are identified by their expression of platelet - derived growth factor alpha receptor ( pdgfr ) . the appearance of the oligodendrocyte lineage - associated markers olig2 ( essential for oligodendrocyte specification and differentiation ) and pdgfr ( which permits the expansion of the original precursor population ) is dependent on the concentrations of sonic hedgehog ( shh ) [ 81 , 82 ] . one or two days after their appearance , pdgfr+ cells exit the ventricular zone and expand by local proliferation and migration first in the ventral spinal cord region and then dorsally . finally , they occupy the entire parenchyma by the time of birth . a dorsal source of oligodendrocyte precursors was also shown to contribute to oligodendrogenesis in the spinal cord and hindbrain [ 84 , 85 ] . fate mapping experiments revealed a double source of oligodendrocyte precursors in the forebrain : cells expressing oligodendrocyte lineage markers , such as olig1 , olig2 , sox10 , and pdgfr , first appear ventrally , in the neuroepithelium of the medial ganglionic eminence , and then migrate laterally and dorsally into all parts of the developing forebrain by e16 to birth . however , several studies have provided evidence for a dorsal source of oligodendrocyte precursors in the lateral and/or caudal ganglionic eminence(s ) , which constitute a second wave of cells invading the cortex only by e18 [ 85 , 87 ] . nevertheless , adult oligodendrocytes derive only by dorsal precursors , since medial ganglionic eminence - derived precursors were demonstrated to completely disappear after birth . on the whole , it is thought that a unique oligodendrocyte population can derive from progenitor domains defined by different signaling molecules , in contrast to what has been established for neuronal specification during embryonic development , where different parts of the ventricular zone generate distinct types of neurons . in the rodent cns , once pdgfr+ cells have left the ventricular zone , they start to be termed oligodendrocyte progenitor cells ( opcs ) and acquire their most typical marker : an integral membrane chondroitin sulphate proteoglycan named ng2 ( nerve / glial antigen 2 ) . ng2 expression becomes detectable only at e14 , thus , from e17 to adulthood all pdgfr+ cells are ng2 + , and , conversely , all the parenchymal ( nonvascular ) ng2 + cells are pdgfr+ [ 88 , 89 ] . early embryonic ng2+/pdgfr+ opcs are small , undifferentiated , proliferative and motile cells . during embryogenesis , their morphology changes rapidly from a simple oval or polygonal cell body with few unbranched processes to a more differentiated and branched shape with a smaller cell soma [ 88 , 91 ] . coming back to comparative adult neurogenesis , nonmammalian vertebrates including fish , amphibians , and reptiles harbor a more widespread genesis of neurons in the parenchyma . such processes , due to their location , are apparently independent from the primitive germinal layers . nevertheless , recent studies which analysed in more detail the origin of adult neurogenesis in fish show that all neurogenic processes likely originate from remnants of the germinal layers ( reviewed in ) . teleost proliferation zones reflect a general proliferation pattern along the ventricular walls of the brain , distinctly localized in all its subdivisions along the rostrocaudal axis . between 12 and 16 distinct proliferation zones hence , across different animal classes , most stem cell populations retain contact to the ventricular system , and they appear as neuroepithelial cells , radial glia , or astroglial cell types . the different shapes of these progenitors have been suggested to be a secondary consequence of the architecture of the developing parenchyma overlying the ventricular stem cell zone of the embryo . this common pattern across animal species , along with data reported above on the origin of cycling glial progenitors in mammals , indirectly suggests that adult parenchymal neurogliogenesis ultimately derives from embryonic germinal layers , yet being able to persist independently in some cases . spontaneous ( constitutive ) parenchymal neurogenesis can be considered as a very rare phenomenon in mammals , and its regional location has been shown to be dependent on the animal species , age , and physiological / pathological states . different examples of neurogenesis occurring outside the two neurogenic sites have been described in rodents [ 19 , 61 ] , rabbits [ 17 , 18 ] , and monkeys [ 92 , 93 ] . remarkable differences can be observed between closely related orders ( e.g. , rodents and lagomorphs [ 17 , 18 ] ) , between species ( e.g. , rat and mouse [ 19 , 23 , 93 , 94 ] ) , and even different strains [ 95 , 96 ] . most parenchymal neurogenesis described in adult rodents seems to occur spontaneously at very low levels , rather being elicited / enhanced after specific physiological or pathological conditions [ 19 , 61 , 63 , 64 ] ( see below ) . dayer and colleagues showed the occurrence of new neurons in the deep layers of the rat cerebral cortex . by labelling newlyborn cells with multiple intraperitoneal injections of 5-bromo-2-deoxyuridine ( brdu ) and using markers of both immature and mature neurons to characterize the new cells through a detailed confocal analysis at different survival times , they demonstrated genesis of new gabaergic interneurons in both neocortex and striatum . at 4 - 5 weeks survival time , the 0.4 + / 0.13% of the brdu+ cells were mature neun+ neurons in the neocortex . interestingly , although several brdu+/dcx+/tuc4 + neuroblasts were identified close to the svz periventricular region , the great majority of cortical brdu+ cells were positive for ng2 . from these data the authors suggested that adult cortical newborn interneurons might originate from in situ progenitors . newly generated neurons are spontaneously produced in other regions of the adult brain starting from local , parenchymal progenitors . in the caudate nucleus , newly formed neuroblasts form longitudinally arranged doublecortin ( dcx ) and psa - ncam immunoreactive striatal chains similar to the svz chains . these neuroblasts are generated from clusters of proliferating cells which express the astroglial marker brain lipid binding protein ( blbp ) , and about 1/6 of surviving cells differentiate into calretinin striatal interneurons . always in rabbits , in sharp contrast with our common knowledge concerning the cns of other mammals studied so far , a remarkable genesis of cells is detectable in the peripuberal , and to a lesser extent , adult cerebellar cortex . systemically administered brdu detected at different postinjection survival times ( up to two months ) reveals newly generated psa - ncam+/dcx+/pax2 + interneurons of neuroepithelial origin homogeneously distributed in the cerebellar cortex . thus , in the striatal and cerebellar parenchyma of lagomorphs new neurons are generated independently from the remnants of germinal layers , yet their final outcome and their role in the adult neural circuits remains obscure ; reviewed in . the heterogeneity in parenchymal neurogenesis adds to that described for neurogenic processes occurring in adult neurogenic sites , which have been related to adaptation to ecological pressures . at present , this is one of the most satisfactory functional explanations for adult neurogenesis in the entire phylogenetic tree , along with multiple , genetically determined variables spanning from the brain anatomy / developmental history to the animal lifespan . this range of possibilities can also be increased by nongenetic variables , such as experience - dependent cues [ 58 , 59 ] . among the unsolved issues of parenchymal neurogenesis are the numerous reports which have not been confirmed by further studies or by other laboratories [ 22 , 23 , 26 , 98100 ] , along with a series of data which have been denied in studies trying to reproduce the same results [ 24 , 36 , 101 , 102 ] . without entering in the scientific and technical discussion about these controversies , it is evident that we still did not grasp the real limits of parenchymal neurogenesis and that further studies are required before finally accepting , or denying the existence of some neurogenic processes . on the other hand , what appears clear is that some stem / progenitor cells in the parenchyma are able to give rise to new neurons in experimental and/or pathological conditions [ 28 , 63 , 64 ] . various examples of reactive beside neurogenesis induced from adjacent neurogenic sites [ 25 , 27 ] , some neurogenic / gliogenic processes are also thought to start from local , parenchymal progenitors [ 28 , 63 , 103 , 104 ] . for instance , local progenitors in layer i of the rat cerebral cortex , which in normal conditions seem to be rather quiescent , are activated after ischemia giving rise to new cortical interneurons . also in a slow and progressive model of striatal neuronal degeneration , besides activation of svz progenitors , genesis of neuroblasts has been found to occur also from local progenitors in mice . this suggests that certain pathological states can stimulate either migration of progenitors from the adult svz or activation of local neuronal progenitors . yet , one of the issues which remain poorly investigated is whether the adult brain parenchyma belonging to spontaneously nonneurogenic areas could be endowed with quiescent progenitor cells which can be stimulated to awake under specific environmental conditions , independently from the contribution of germinal layers . in other words , what remains irresolute is whether spontaneous and lesion - induced neurogenesis follow the same pathways and/or involve the same progenitors . then , another intriguing possibility to be explored is that lesion - induced neuroblasts occurring in multiple forms of brain injury are committed to transient neuronal types , which contribute to restorative rather than replacement mechanisms . a case placed in between the spontaneous and experimentally - induced neurogenesis is that of the hypothalamus . several publications based on experiments carried out on rodents have been reporting data on this brain region as a new site for adult constitutive neurogenesis in mammals ( for review see ) . under physiological conditions , both in rats and mice [ 108 , 109 ] , proliferative activity does occur in the ependymal layer of the third ventricle and within the surrounding parenchyma . in rats , xu and collaborators using electron microscopy and immunohistochemistry showed that tanycytes lining the third ventricle proliferate and express molecules usually found in glial , stem - like progenitor cells , such as blbp and nestin . the presence of putative neural progenitors was further supported by the isolation of cells able to give rise to neurospheres from the hypothalamus . one month after brdu injection , proliferating cells , some of which expressing hu protein , were detected in the surrounding parenchyma . similar results were obtained in mice , yet in both rodent species no clear evidence has supported constitutive and complete hypothalamic adult neurogenesis under physiological conditions . a significant increase in hypothalamic proliferating cells delivery of brdu ( 350% more positive nuclei , in comparison to i.p . treated animals ) , nevertheless , in spite of such cell proliferation the level of neurogenesis in the intact hypothalamus seems to be arrested at a very premature stage . on the other hand , growth factor infusion [ 61 , 107 , 110 ] or certain experimental conditions / models , such as prolonged heat exposure and the agrp - tfam mutant mice ( with agouti - related peptide neuronal degeneration ) investigated by pierce and xu , seem to increase neurogenesis in the hypothalamus . intracerebroventricular infusion of insulin growth factor i in rats triggered an intense proliferation along the third periventricular area and in the parenchyma of the caudal hypothalamus . treatment with bfgf in rats and cntf in mice , it was shown that proliferation induced by growth factors can be followed by genesis of newborn neurons . detailed morphological and molecular analyses of the third periventricular region of these animals showed interesting architectural similarities with the svz neurogenic niche ( e.g. , proliferating astroglial cells contacting the ventricle by an apical process bearing a single cilium ) , with tanycytes as primary proliferating elements lining the third ventricle . yet , additional studies are necessary to clearly demonstrate / confirm whether hypothalamic newborn neurons generated after physiological / pathological stimulation actually become part of the preexisting circuits playing a role in energy - balance mechanisms . taking into account the multifaceted aspects dealing with parenchymal neurogenesis , difficulties encountered in such type of research are not only technical . they are also linked to the occurrence of processes placed in the middle between two well - characterized extremes of structural plasticity , such as synaptic plasticity and complete adult neurogenesis . in a recent review article five levels have been dissected in the neurogenic processes in order to critically evaluate / compare different parenchymal neurogenic events ( a graphic representation of the five levels is given in figure 1 ) . the subsequent steps span from cell division to possible integration of specified / differentiated elements into the cns tissue , and according to this view , only when any of the five steps are filled the neurogenic process should be classified as as a result , all the parenchymal neurogenic processes described until now can actually be considered as incomplete . this could explain why many claims of neurogenic processes were subsequently refuted because not sustained by experimental evidence . the piriform cortex is one of those regions in which results reported by different researchers are quite controversial ; see , for example , references [ 92 , 112114 ] . since long time , this cortical region is known to harbor a population of neurons immunoreactive for psa - ncam and dcx [ 114116 ] , which are two markers highly expressed in newly generated neurons but also present in nonnewly generated cells . indeed , deeper investigations have shown that the piriform cortex contains a population of immature , nonnewly generated neurons which display very few ( or no ) synapses and are frequently sheathed by glial lamellae . these cells , by remaining in an immature state for indeterminate time , can represent a reservoir of neurons that could possibly be recruited into the preexisting neural circuits although not generated ex novo . in conclusion , alternative and multiple forms of plasticity involving neurons can overlap within the so - called nonneurogenic tissue , affecting preexisting cells / circuits and increasing the complexity of the whole picture of brain structural remodeling . in the past , neurogenesis and gliogenesis had always been kept separate , the latter being considered less important than the former . in recent years , adult gliogenesis has been reevaluated as many populations of progenitor cells with glial - like features and proliferative capacity have been shown to exist in the mature mammalian cns [ 13 , 15 ] . as a matter of fact , parenchymal cell genesis in the so - called nonneurogenic regions is mainly gliogenic . in most regions of the cns , parenchymal progenitors assure a slow process of constitutive gliogenesis leading to renewal of oligodendrocytes and , to a lesser extent , astrocytes [ 12 , 15 , 118 ] . in rodents , the major population of cycling progenitors located outside the germinal niches are ng2 + cells morphologically , antigenically , functionally distinct from mature astrocytes , oligodendrocytes , and microglia [ 12 , 14 , 15 ] . these cells are also called polydendrocytes to highlight their stellate morphology and lineal relationship to oligodendrocytes , synantocytes for their contiguity to neurons , or oligodendrocyte progenitor cells ( opcs ) because they were found able of generating myelinating oligodendrocytes [ 12 , 119 , 120 ] . nevertheless , many polydendrocytes remain as a resident cell population of ng2-expressing cells in the mature white and grey matter after oligodendrocytes are generated . thus it is widely accepted they represent the fourth cns major glial population , representing 29% of total cells . in the last decade , ng2 + cells have generated a lot of interest among neuroscientists , because they show a series of features quite unusual in opcs . these include ( i ) an almost uniform distribution in both grey and white matter ; ( ii ) a stellate morphology ; ( iii ) an intimate association with neurons from which they receive synapses [ 13 , 14 ] ; ( iv ) proliferative capacity in the adult brain [ 13 , 121 , 122 ] ( v ) a potential for giving rise to astrocytes and neurons that may be recruited to areas of lesion in the context of brain injury or pathology . at present , it is generally accepted that polydendrocytes are opcs , even if the demonstration that polydendrocytes differentiate into mature myelinating oligodendrocytes in vivo is challenging , because ng2 expression is lost before the terminal differentiation of these cells and the appearance of mature oligodendrocyte antigens . for instance , they coexpress the pdgfr , and during the first postnatal week , in the corpus callosum and cortex , they start expressing the immature oligodendrocyte antigen o4 . polydendrocytes also express the basic helix - loop - helix ( bhlh ) transcription factors olig1 and olig2 , which are required for oligodendrocyte specification and differentiation as well as sox9 and sox10 transcription factors [ 122 , 124 ] . moreover , pulse - chase labeling of proliferating cells using brdu revealed that the number of brdu+ng2 + cells decreases while that of brdu+ oligodendrocytes increases over time [ 12 , 125 ] . cell - grafting experiments have shown that polydendrocytes give rise to myelinating cells when they are transplanted into an environment free of endogenous myelinating cells . recently , more direct evidence for the oligodendroglial fate of polydendrocytes was obtained from cell fate - mapping experiments using transgenic mice that express cre recombinase ( cre ) in ng2-expressing cells or that express inducible cre ( creer ) , under the regulation of the cspg4 , pdgfr , or olig2 genes , which enable determination of the fate of polydendrocytes at a given time during development [ 99 , 127 ] . early cell - culture studies showed that opcs purified from rat optic nerves differentiate not only into oligodendrocytes but also into process - bearing type-2 astrocytes in the presence of serum factors , which led to the concept of bipotential oligodendrocyte type-2-astrocyte ( o-2a ) progenitor cells . there are now controversial observations suggesting that bipotentiality of polydendrocytes might be real or an in vitro artifact [ 126 , 128 , 129 ] , and most likely these cells are inherently capable of differentiating into astrocytes but are prevented from fulfilling their astroglial fate in the normal in vivo environment . on the whole , while all of these studies consistently support the oligodendrocyte lineage of the ng2 + cells , the genesis of astrocytes from ng2 + cells is confirmed only during postnatal ages . all these different and sometimes controversial results may be explained by some methodological / technical differences , but may also reflect heterogeneity in progenitor cell populations / subpopulations ( mostly not yet identified ) , which is far to be elucidated . in this context , we have recently identified a population of multipolar glial cells immunoreactive for the microtubule associated protein 5 ( map5 ) , which share features but also differences with ng2 + progenitor cells . these multipolar , map5 + cells are newly generated , parenchymal elements of the oligodendroglial lineage , which represent a stage - specific population of polydendrocytes ( crociara et al . another issue which remains unresolved not only for adult glial progenitors but also for parenchymal neurogenic progenitors , is their way of cell division . in other words , what it is still not clear is the real nature of adult cns cycling cells in terms of stem or progenitor elements . using lineage tracing by retroviral infection , brdu labeling in vivo , and transgenic mice expressing tamoxifen - inducible ng2creer and fluorescent cre reporter alleles to study the fate of single ng2 + cells has revealed that age and neuroanatomical location determine whether these cells can either self - renew , generate mature oligodendrocytes , or both [ 101 , 131 , 132 ] . adult ng2 + progenitors have a very long cell cycle and many of them can divide at least twice , only a limited proportion of the progeny differentiating into mature oligodendrocytes . after stab wound injury , many of these progenitors reenter the cell cycle very fast , whereas voluntary physical exercise shows the opposite effect with increased exit of the cell cycle followed by an enhanced and fast differentiation into mature oligodendrocytes . the authors of this study observed that proteoglycan ng2 segregates asymmetrically during mitosis to generate opc cells of distinct fate , and a decrease in such asymmetry coincides with premalignant , abnormal self - renewal rather than differentiation . on the whole , the data available on proliferative dynamics of parenchymal progenitors still need further investigation but strongly suggest that adult cns parenchymal cell populations are subject to profound modulation by environmental stimuli and can be involved in pathology . a better knowledge of adult neurogenesis and gliogenesis and of its relative underlying mechanisms is considered fundamental in order to figure out new efficacious therapies for brain repair . under pressure of this statement , studies on this topic have increased exponentially during the last two decades , sometimes leading to excessive emphasis about theoretical correlations between neuro - glio - genic processes and brain repair . focusing on the real neurogenic / gliogenic potential of the mammalian cns should avoid to turn an exciting biological discovery into a therapeutic illusion . the existence of nscs opened the intriguing perspective of cell replacement - aimed therapeutic strategies for neurodegenerative diseases , yet , twenty years later , this approach is still hampered by overwhelming problems concerning the final integration of both transplanted and endogenously induced cells . at the basis of this failure are evolutionary constraints and the fact that cell renewal occurring in adult neurogenic sites is primarily involved in tissue homeostasis , being hardly useful in response to external injury and neurodegenerative brain damage affecting the parenchyma [ 11 , 40 ] . in this context , the discovery of parenchymal cell genesis represents a new plastic potential to be explored within wide regions of the cns , including those areas affected by different neurodegenerative diseases and traumatic injuries . nevertheless , a vast number of reports currently published in the domain of parenchymal cell genesis ( references in ) , although accurate and carried out with multiple technical approaches , do suggest that in most cases newly formed elements barely survive and do not fully integrate . in addition , the extreme heterogeneity of parenchymal neurogliogenesis makes the mammalian cns parenchyma a harsh territory for neuroscience studies and for brain repair , in which new unanswered questions are continuously opened ( see box 2 ) .

during the last two decades basic research in neuroscience has remarkably expanded due to the discovery of neural stem cells ( nscs ) and adult neurogenesis in the mammalian central nervous system ( cns ) . the existence of such unexpected plasticity triggered hopes for alternative approaches to brain repair , yet deeper investigation showed that constitutive mammalian neurogenesis is restricted to two small neurogenic sites hosting nscs as remnants of embryonic germinal layers and subserving homeostatic roles in specific neural systems . the fact that in other classes of vertebrates adult neurogenesis is widespread in the cns and useful for brain repair sometimes creates misunderstandings about the real reparative potential in mammals . nevertheless , in the mammalian cns parenchyma , which is commonly considered as nonneurogenic , some processes of gliogenesis and , to a lesser extent , neurogenesis also occur . this parenchymal cell genesis is highly heterogeneous as to the position , identity , and fate of the progenitors . in addition , even the regional outcomes are different . in this paper the heterogeneity of mammalian parenchymal neurogliogenesis will be addressed , also discussing the most common pitfalls and misunderstandings of this growing and promising research field .

You are an expert at summarizing long articles. Proceed to summarize the following text: war wounds caused by firearms , represent damage to the body , whose features are extensive destruction of the tissue , primary contamination with polymorphic bacterial flora and altered reactivity of the organism ( 1 ) . war trauma injuries are usually injuries to the extremities ( about 70% ) , out of which about 40% is accompanied with comminuted fracture . they occur due to the force of projectiles from firearms or a piece of grenade , land mines or other explosive devices . it is most frequently conducted in two continuous phases . in the first phase , not later than 8 hours after the injury , primary treatment of a gunshot wound is conducted . this is the most important surgical operation , after which the gunshot wound should be sterile ( 1 , 2 ) . the stabilization of broken bones is about 90% stabilized with an external fixator and delayed primarily closure of the wound . in the second phase , usually 7 to 10 days after the primary treatment , the war gunshot wound is definitely closed or covered ( 3 ) . in the time of the bone tissue processing , it is difficult to estimate the vitality of fragments , as there are no specific indicators for intraoperative assessment of the bone vitality ( 4 ) . the most common indicators are : bleeding from the exposed ends of the bones , a state of periosteal of bone fragments and the size of bone fragments . after infections , the most serious complications of gunshot injuries of extremities are pseudarthrosis and bone defects whose treatment represents a complex problem in reconstructive surgery . when it comes to the choice of methods for treating these complications , there is no unanimous attitude ( 2 - 4 ) . the methods of treatment are : osteoplasty with a cast or external fixator immobilization , osteoplasty and ao plate osteosynthesis and corticotomy and distraction osteogenesis according to ilizarov . grafts and hemotransplants from the bone bank are most commonly used for compensation of bone defects . specialized institutions compensate the bone defect with vascularized grafts , fibula , ribs , radius , iliac , etc . the aim was to present the experience and methods gained during the treatment of diaphyseal bone defect as a consequence of gunshot fractures of war trauma . furthermore , to identify the advantages of one method over another in the treatment of bone defects . total amount of 2,462 wounded with injuries of the musculoskeletal system were primarily taken care of at the clinic of orthopedic and traumatology in banja luka in the period from 1991 to 1995 . after the primary treatment of the war wound , external fixator was used in 1573 ( 64% ) patients . 116 patients with the bone defect were treated at the same time . in order to compensate the bone defect , we used a bone graft and method of bilocal synchronous ilizarov apparatus for compressive - distraction osteosynthesis . we could not use the bone homotransplants because we did not have the so - called bone bank . we also did not use vascularized grafts because we did not have qualified professional team capable of using the above mentioned method . the diagnosis was set on the basis of preoperative radiographic and intraoperative findings during the primary treatment of gunshot fractures . the appearance of the wound , swab taken on the eighth day and laboratory findings : erythrocyte sedimentation rate , complete blood count and leukocyte count were the parameters for the assessment of the presence of infection and decision regarding the day of surgical intervention . the order of work in primary spongioplasty was the following : cleaning and garnishing the operational field of the bone defect and donor sites . preparation of the spongioplasty anchorage was done as follows : wound was staged , skin firmed and rinsed with up to 8 liters of saline . spongious graft up to 1 cm , that is , cortico - spongious bone according to phemister , was taken from the selected donor site which was determined by the size of the bone defect . by applying this method , osteocytes from the grafts were the least exposed to weather and other non - physiological conditions , which may accelerate osteocytes withering from the graft . the bone defect was filled with a sufficient amount of bone grafts and the wound was closed in layers . when the coverage by muscles was not technically feasible , healthy skin was used . upon the completion of graftation , the donor s site was closed in layers , along with the wound drainage . on the first postoperative day , a physical therapy and static exercises of the operated limb were done in bed . on the third postoperative day , the patients began to walk with the help of crutches under their armpits , depending on the stability and size of the bone defect . the decision to walk without support , with a touch support or support from 5 to 10 kg was made on the basis of the size of the defect and the stability of the bone fragments . on the average , the patients were sent to home treatment on the 10 day . initial controlling radiography was conducted 6 weeks later . most frequently , the patient or family member ( educated at the clinic by the physiotherapist ) , did kinesitherapy or hydrotherapy at home . the clinical examination monitored the dynamics of the repair of soft tissue and gave an insight into required maintenance around the pins of external fixators . radiographic control conducted every 30 days enabled the evaluation of the fracture rehabilitation , assessment of the load degree and the establishment of a full functional use of the extremities . the evaluation of final results was conducted in relation to major complications : nonunion , infection , neurovascular and functional results . criteria for the result assessment of the phemister s spongioplasty good : nonunion , osteomyelitis , neurovascular disturbance , limb - length discrepancy no and joint mobility normal . result satisfactory nonunion and osteomyelitis no , neurovascular disturbance moderate , joint mobility to 70% , limb - length discrepancy to 3 cm . poor results : nonunion and osteomyelitis yes , neurovascular disturbance severe , joint mobility under 70% limb - length discrepancy over 3 cm . early autogenous spongioplasty ( primary spongioplasty ) was performed for the first time in 1994 . it was performed in 18 males with the bone defects that occurred due to projectiles or shrapnel of high initial velocity . the primary surgical treatment was performed , on the average , 5.53 hours after the wounding . the average size of the bone defect , formed after the wounding and primary surgical treatment of the war wound was 2.01 ( 4 cm -1 cm ) cm . compensation of bone defect was made 12.22 days after the surgical treatment of the war wound . earliest compensation of the bone defect was done on the 7 day and not later than 15 days after the primary surgical treatment . the average number of surgeries was 2.2 and the treatment duration was 13.3 months ( 4 - 18 months ) . the external fixator was a final solution in 14 cases , while in 4 cases , re - osteoplastic and ao plates were used . in 5 patients , out of 18 , primary graft was taken from both iliac crests . complications of primary spongioplasty of war wounds were manifested as follows : pseudoarthrosis in 4 patients , transient infections around the pins in 12 , joint contractures in 3 , and the lower limb - length discrepancy of 2.5 cm in 2 patients . ( table 1 . ) results of primary spongioplasty of war wounds in treatment of 18 patients in our sample 76 patients , that is , 72 ( 95% ) males and 4 ( 5% ) females , average age 31.79 ( 19 58 ) years , were included in the clinical research of diaphyseal gunshot fractures that had been treated , at the stage of secondary surgery , with ao plate osteosynthesis and the delayed phemister s spongioplastics . after the primary surgical treatment of the war wound , in 60 ( 79% ) patients the above mentioned fractures were stabilized with the external fixator and in 16 ( 21% ) patients with the plaster splint . the area affected by fractures of the bones was as follows : femur in 28 ( 37% ) patients , humerus in 19 ( 25% ) , tibia in 9 ( 12% ) , both forearm bones in 4 ( 5% ) , radius in 11 ( 14% ) and ulna in 5 ( 7% ) patients . all patients underwent the first phase of treatment : the wound was closed or covered with high - quality skin ; fracture rehabilitation did not occur , nor there were any chances for healing ; there was a bone defect to 4 cm in length and clinical or laboratory signs of infection were not manifested . after the primary treatment , the war wounds of long bones fragments were stabilized with the external fixators to keep the length of the limbs , quick mobility and proper repair of the soft tissue . there were cases when the intraoperative findings suggested that a proper rehabilitation of the bone would be achieved , but clinical and radiographic findings after 3.6 months on the average ( 2.1 to 5.8 months ) renounced it . normal general and local examination was usually conducted on the 10 day , after which the secondary surgery compensation of the bone defect was performed using the phemister s spongioplastics and ao osteosynthesis plate . the average number of surgeries was 3.6 and treatment duration was 32.5 months ( 9.33 - 48.83months ) . the fracture healing was achieved in 67 ( 88% ) patients and in 9 ( 12% ) patients a rehabilitation did not occur ( table 2 ) the latter was managed with re - osteosynthesis . re - osteosynthesis and re- osteoplastic were conducted in 3 femur bones , 3 tibia bones , 2 ulna bones and 1 humerus bone . functional results of osteosynthesis and ao plate and phemisters spongioplasty in treatment of 76 patients fibulargraft has established itself to bevery successfulin thetreatmentof bone defectshigher than 5 cm . averagely , the fibulais30 cm long3 cm in diameter , and hence is very suitablefor largeforearms bone defects . gilbert s modification of the original taylor s posterior approach is the most suitable method to apply when taking the fibular graft . femur defect recovered by the fibular graft result after 17 years 8 patients , 7 males and 1 female , average age 29.97 ( 1945 ) years were included in the clinical research of diaphyseal gunshot fractures which had been treated , at the stage of secondary surgery , with fibular graft . after the primary surgical treatment of the war wound , the above mentioned fractures were stabilized with the external fixator . the area affected by fractures of the bones was as follows : femur in 5 patients , humerus in 2 and ulna in 1 patient . the fracture healing was achieved in 6 patients while in 2 patients the rehabilitation of the bone did not occur . the fibular graft ingrowth was not achieved in 2 patients treated for bone defects in the ulna and humerus . functional results of bone defects treated with fibular graftin treatment of 8 patients compensation of the tibia bone defect in 14 patients , that is , 12 ( 86% ) males and 2 ( 14% ) females , average age 30 years ( 22 - 42 years ) , was performed using the ilizarov technique of extension of one of the fragments in order to reconstruct the tibia bone defect . the average length of the tibia defect was 5.6 cm ( 3.5 to 8.5 cm ) . the tibia defects were accompanied with various neurological and vascular damage and injuries of tendons and muscles of the lower leg . all patients had a flexion - extension contracture of the knee and / or ankle joint equinus , as well as the significant soft tissue defect due to the initial injury or debridement . averagely , the rehabilitation was 10 months long ( 4 - 17 months ) . in 10 patients , the average bone defect was 4.7 cm ( 3.5 to 6.0 cm ) , with interfragmentary diastasis of 1.5 cm ( 1 - 2.5 cm ) and anatomical discrepancy of 3.1 cm ( 2 , 0 - 5,0 cm ) . in 4 patients with the average length of the defect of 6.4 cm ( 4.0 to 8.5 cm ) and interfragmentary diastasis of 5.5 cm ( 4.5 - 7.5 cm ) and anatomical discrepancy of 1.6 cm ( 1- 2 cm ) , the bilocal alternating distraction and compressive - distraction osteosynthesis was used ( figure 2 ) . compensation of bone defect of 7.6 cm with the usage of distraction osteosynthesis mitkovi external fixator , 2a 15 days , 2b 35 days and 2c 14 months after the corticotomy in 13 patients , the osteotomy was performed in the proximal and in 1 patients in the distal fragment of the tibia . radiographic evaluation was performed every 2 weeks during the distraction phase and every 4 weeks during the consolidation phase . we evaluated the results of treatment according to the classification of the association for the study and application of the ilizarov method , graded as : excellent , good , fair and poor . monitoring of the patients lasted about 32 months ( 18 - 48 months ) . during the treatment , the mean distraction index value was 10.6 ( 10 - 11 ) , maturation index was 39.8 ( 36 - 45 ) , and external fixation index was 52.5 ( 49 to 57.4 ) . the average duration of wearing the external fixator was 8.5 months ( from 6.0 to 12.0 months ) . the healing of points of contact of the fragments was registered in 11 patients . in 3 patients , there was no healing ( pseudoarthrosis was formed ) and they underwent the additional surgical treatment , which involved the application of the ilizarov apparatus for the compression osteosynthesis along with opening and processing of the contact . upon this surgical intervention , the average healing of the points of contact of the fragments was 4.6 months ( 4 - 5 months ) . in 3 patients , angular deformity of the tibia of 100 was established . postoperative leg length discrepancy did not occur in 3 patients , while 8 patients had the average discrepancy of 1.6 cm ( 1 - 3 cm ) . subsequent surgical correction of the shin length was recommended to 3 patients with the discrepancy of 3 cm , and they rejected it . on the last medical check - up , we found an infection in 2 patients . in 9 patients , significant postoperative limping occurred in 6 patients , 4 of them had fixed contractures of the knee and ankle , and 2 of them had atrophy of the shin muscles of mild degree . 8 patients did not complain of pain , while 5patients reported moderate pain , and only 1 patient suffered from acute pain . taking these criteria into consideration , the functional outcome was excellent in 8 , good in 3 , and fair in 3patients . the most common complication , which occurred in 8 patients , was inflammation and maceration of soft tissue around the needle . in 1 patient , after the above mentioned treatment , the inflammatory process was not repaired and it extended along with the formation of abscesses . during needle placement in 2 patients , due to termonecrosis of the bone , sequestration ring that was the cause of osteomyelitis needles was created . the needles were drawn out and the needle canal expanded and drained which led to remediation of the infection . during the treatment , the acute exacerbation of chronic osteomyelitis occurred in 2 patients , and in 3 patients the wound did not heal and pseudoarthrosis occurred . all 5 patients were subjected to the additional surgical treatment . in the treatment process , dermatitis occurred in 1 patient . in their study , atesalpa et al . analyzed the results of treatment of 43 patients with a bone defect . the average length of the defect was 10.1 cm ( 2 - 15 cm ) ( 6 ) . the authors annotated this with an aggressive debridement of necrotic and infected bone , as well as with the increase of the intramedullary circulation by the osteotomy of one of the fragment of the tibia ( 6 ) . in his experimental studies , albreht discovered that local administration of antibiotics up to three hours after the injury may provide a 72-hours delay of the primary surgical management of the wound without increasing the incidence of local infection . 7 the results showed that there were no septic complications when the antibiotics were administered three hours after the wounding , because they inhibited the growth of bacteria in the gunshot wounds ( 7 ) . during the treatment of 1.361 patients with gunshot fractures of long bones in angola , karapetjen and petrov adopted the attitude that the internal osteosynthesis can be performed with previous administration of antibiotics . apart from the above mentioned osteosynthesis , after 21 days the tibial or fibular bone grafting was performed in 17 patients . the result of treatment was satisfactory in 11 patients and poor in 8 ( 8) . mironov used the property of spongiosis resistance to infection , and laminated the osteomyelitic defects using the spongiosis parts and leaving the wound open after the lamination . mironov called this method the open spongioplastics 89 ) . on the basis of the experiences in the afghanistan war regarding the treatment of bone defects , gricanov et al . preferred the external fixators and insisted on compressive and distraction external fixators with hinged joints ( 10 ) . jovanovic submitted criteria for treatment of the bone defect in long bones with autogenous bone grafts and stabilization of bone fragments with the compressive ao plates ( 11 ) . the application of early autogenous spongioplasty in bone defects of war wounds proved to be successful and possible in the primary stage of treatment . rigid osteosynthesis with ao plate along with delayed spongioplstic proved to be very successful in the secondary treatment of large number of samples taken from the above mentioned war . the extension of one of the fragments using the ilizarov method can successfully compensate for the bone defect of 11.5 cm and equalize the limb in one act .

introduction : results of the treatment of open fractures primarily depend on the treatment of connected soft tissue injuries.objective:the aim was to present the experience and methods gained during the treatment of diaphyseal bone defects as a consequence of gunshot fracture soft war trauma.patients and methods : the study consisted of 116 patients with the diaphyseal bone defect who were treated with the usage of primary and delayed autotransplantation of bones , transplants of the fibula and ilizarov distraction osteogenesis.results:the results of compensation of bone defect less than 4 cm and conducted by an early cortico - spongioplastics were as follows : good in 8 respondents ( 45% ) , satisfactory in 6 ( 34% ) and poor in 4 respondents ( 21% ) . in cases of delayed cortico - spongioplastics , the above mentioned results were : good in 36 ( 41% ) respondents , satisfactory in 24 ( 34% ) and poor in 16 ( 25% ) respondents . the results of compensation of bone defect greater than 4 cm with the usage of fibular transplant were as follows : good in 3 ( 38% ) respondents , satisfactory in 3 ( 38% ) and poor in 2 ( 24% ) , and with the usage of using the ilizarov method , the results were as follows : good in 8 ( 57% ) respondents , satisfactory in 3 ( 21.5% ) and poor in 3(21.5% ) respondents.conclusion:the results showed that , in cases of compensation of bone defects less than 4 cm , the advantage is given to the primary spongioplastics over the delayed one . in cases of compensation of bone defects greater than 4 cm , the advantage is given to the ilizarov distraction osteogenesis when compared to the fibular transplant .

You are an expert at summarizing long articles. Proceed to summarize the following text: romania is one of the south - eastern european countries with a high prevalence of chronic hepatitis b virus ( hbv ) infection as 5.59% in 2010 , and a larger number of hbsag positive people ( 2 ) . it is estimated that 15 - 40% of chronic hepatitis b patients would progress to cirrhosis and hcc ( 2 ) . the reasons why some patients with chronic hbv infection progress to hcc are under debates . host factors such as immune response to hbv , genetic predisposition to hcc development , high hbv replication rates , as well as certain mutations within the hbv genome have been related to hcc development . a dual mutation in the basal core promoter ( bcp ) region of the hbv genome involving an a t substitution at nucleotide 1762 and a g a substitution at nucleotide 1764 has been associated with hcc development . moreover , a mutation in the precore ( pc ) region of the hbv genome involving a g a substitution at nucleotide 1896 has been described in hbeag - negative patients . however , the role of these mutations in hcc pathogenesis is not well established ( 3 ) . the pc region mutations prevent the production of hepatitis b e antigen ( hbeag ) by introducing a premature stop codon into the open reading frame of the precore region . another common mutation is a double mutation in bcp region ( a1762t / g1764a ) , which aborts the transcription of precore mrna , but does not seriously affect the viral pregenome rna , resulting in a decrease of hbeag expression up to 70% and enhanced viral genome replication . although the frequencies of precore and bcp mutations vary between hbv genotypes , they are associated with fulminant hepatitis b and hepatocellular carcinoma , in quite a few cases ( 4 ) . the level of circulating viremia is a risk factor for development of cirrhosis and hcc , and is used to diagnose hepatitis b infection and define response to antiviral therapy . since chronic hepatitis , cirrhosis and hcc have been found in patients with low serum hbv dna - levels , the current cutoff value of 20.000 iu / ml is still debatable . further understanding of virological characteristics in patients with low hbv - dna levels would be helpful for clinical decisions in management of patients with low circulating viremia . many studies have demonstrated that hbv genotype , precore and bcp mutations have a substantial impact on progression of chronic hepatitis b toward hcc ( 4 ) . currently , ten genotypes of hbv ( a - j ) have been identified , based upon a divergence of 8% or more across the entire nucleotide sequence ( 4 , 5 ) . sequence differences between hbv genotypes can lead to structural differences at the level of pregenome and can lead to important differences at the translational level when specific and common mutations occur ( 6 , 7 ) . it is of great interest to study romanian hbv variants , to investigate the precore - core promoter mutations to have a personalized viral diagnosis , for a better response to therapy and clinical outcome . in addition , to sequence hbv genome of nonresponders romanian patients to antiviral therapy to see if there is a link between hbv mutations and lack of both , biochemical and virological responses in these patients . therefore , it would be important to sequence hbv - dna from hbv chronic carriers , hbv chronic carriers coinfected with hdv , hcc patients ' tissue and serum samples to investigate mutations in the core promoter region of the hbv genome . this cross - sectional investigation was performed in fundeni clinical institute , bucharest , romania during january 2005 and august 2010 . hbsag positive patients with chronic hbv infection admitted to fundeni clinical institute were randomly enrolled in the study . randomly , we obtained the following patient diagnosis status : 375 hbv chronic carriers , 94 hcc and 15 hbv chronic carriers coinfected with hdv . all hbv chronic carriers and all hbv chronic carriers coinfected with hdv were detected by serum analysis . nonetheless , regarding hcc patients , the first 73 were described by tissue hbv sequencing and the last 21 by serum analysis . diagnosis of hcc was confirmed by biopsy of the mass lesion in the liver , and by typical computed tomography or magnetic resonance imaging findings for hcc . the ethics committee of the fundeni clinical institute , bucharest , romania approved the study ( 2010.08.30 ) . were tested for hbsag and hbeag and anti - hbs , anti - hbe and total anti - hbc antibodies using automated architect i2000sr ( abbott ) by chemiluminescence . for anti - hdv antibodies hbv - dna was quantified by a real - time polymerase chain reaction assay in the linear range from 10 to 10 copies / ml using cobas taqman hbv test ( roche ) . detection of bcp mutations , pc mutations and hbv genotypes was performed using revers hybridization line probe assays - inno - lipa hbv dr v2 and inno - lipa hbv precore - core ( innogenetics , ghent . for all patients , we performed hbv sequencing : for 73 hcc patients tissue hbv sequencing , 21 hcc patients serum hbv - sequencing and for chronic patients serum sequencing . in chronic patients , viral dna was obtained from sera . for 73 hbv pearson 2 test was used to verify the independence of two discrete variables in contingency tables . to compare the distribution of serum dna hbv for considered factors ( diagnosis , hbv genotype and mutation ) we used a univariate general linear model and one - way anova test with tamhane test . in testing and graph representation , this cross - sectional investigation was performed in fundeni clinical institute , bucharest , romania during january 2005 and august 2010 . hbsag positive patients with chronic hbv infection admitted to fundeni clinical institute were randomly enrolled in the study . randomly , we obtained the following patient diagnosis status : 375 hbv chronic carriers , 94 hcc and 15 hbv chronic carriers coinfected with hdv . all hbv chronic carriers and all hbv chronic carriers coinfected with hdv were detected by serum analysis . nonetheless , regarding hcc patients , the first 73 were described by tissue hbv sequencing and the last 21 by serum analysis . diagnosis of hcc was confirmed by biopsy of the mass lesion in the liver , and by typical computed tomography or magnetic resonance imaging findings for hcc . the ethics committee of the fundeni clinical institute , bucharest , romania approved the study ( 2010.08.30 ) . for indirect diagnosis , sera obtained for all patients were tested for hbsag and hbeag and anti - hbs , anti - hbe and total anti - hbc antibodies using automated architect i2000sr ( abbott ) by chemiluminescence . for anti - hdv antibodies hbv - dna was quantified by a real - time polymerase chain reaction assay in the linear range from 10 to 10 copies / ml using cobas taqman hbv test ( roche ) . detection of bcp mutations , pc mutations and hbv genotypes was performed using revers hybridization line probe assays - inno - lipa hbv dr v2 and inno - lipa hbv precore - core ( innogenetics , ghent . belgium ) . for all patients , we performed hbv sequencing : for 73 hcc patients tissue hbv sequencing , 21 hcc patients serum hbv - sequencing and for chronic patients serum sequencing . in chronic patients , for indirect diagnosis , sera obtained for all patients were tested for hbsag and hbeag and anti - hbs , anti - hbe and total anti - hbc antibodies using automated architect i2000sr ( abbott ) by chemiluminescence . for anti - hdv antibodies hbv - dna was quantified by a real - time polymerase chain reaction assay in the linear range from 10 to 10 copies / ml using cobas taqman hbv test ( roche ) . detection of bcp mutations , pc mutations and hbv genotypes was performed using revers hybridization line probe assays - inno - lipa hbv dr v2 and inno - lipa hbv precore - core ( innogenetics , ghent . we performed hbv sequencing : for 73 hcc patients tissue hbv sequencing , 21 hcc patients serum hbv - sequencing and for chronic patients serum sequencing . in chronic patients pearson 2 test was used to verify the independence of two discrete variables in contingency tables . to compare the distribution of serum dna hbv for considered factors ( diagnosis , hbv genotype and mutation ) we used a univariate general linear model and one - way anova test with tamhane test . in testing and graph representation , we detected two genotypes of a and d in our study population , as follows : a ( i.e. patient has only genotype a ) , d ( i.e. patient has only genotype d ) , a+d ( i.e. patient has both genotypes a and d , higher concentration of genotype d ) . the decreasing order of hbv genotypes prevalence was d , a+d , a. in our sample , the prevalence rates were 60.5% , 31.4% and 8.1% for d , a+d and a , respectively . the differences were significant ( p < 0.001 for pearson test ; see last column of table 1 ) . hbv genotype and diagnosis were dependent variables ( p < 0.001 for pearson test ) . the minimum value of the prevalence of genotype d reached 54.4% for chronic carriers , which was significantly smaller than other diagnoses ( p < 0.050 for pearson test ) . conversely , for chronic carriers the genotype combination a+d had the highest prevalence ( 37.6% , compared to about 10% , for other diagnoses ) . while , the prevalence of genotype a was not significantly dependent on diagnosis ( table 1 ) . in 152 patients we detected both genotypes a and d , with a higher prevalence in chronic carriers ( 141 patients , 37.6% ) , followed by hcc - tissue sample hbv sequencing group ( 7 patients , 9.6% ) , hcc - serum hbv sequencing group ( 3 patients , 14.6% ) and chronic carriers with hdv coinfection ( one patient , 6.7% ) . hbv genotype and diagnosis were dependent ( p < 0.001 for pearson test ) . definitely , distribution of hbv genotype for chronic carriers was significantly different from the distribution of hcc - tissue hbv sequencing ( p < 0.001 for pearson test ) and chronic carriers + hdv ( p = 0.012 for pearson test ) . to be more specific , the prevalence of a+d was 37.6% for chronic carriers , but significantly smaller for hcc - tissue hbv sequencing ( 9.6% ) and chronic carriers + hdv ( 6.7% ) . conversely , d prevalence was higher for hcc - tissue hbv sequencing ( 82.2% ) and chronic carriers + hdv ( 93.3% ) , compared to chronic carriers ( 54.4% ) ( see table 1 ) . abbreviations : hcc , hepatocellular carcinoma ; hbv , hepatitis b virus ; hdv , hepatitis d virus ; wt , wild type ; bcp , basal core promoter . we next analyzed the presence of bcp and pc mutations ( see last column of table 1 ) . bcp mutations were reported for 34.9% ( 12.8% + 22.1% ) of patients and pc mutations for 36.4% ( 14.3% + 22.1% ) . bcp and pc mutations were dependent ( p < 0.001 for pearson test of independence ) . definitely , patients having both or non - bcp and pc mutations were 22.1% and 50.8% , respectively ( higher than expected based on the hypothesis of independence ) . distribution of bcp and pc mutations were significantly linked to the viral diagnosis , excepting hcc - serum hbv sequencing and chronic carriers + hdv , which seem to have the same distribution of mutations ( to be more specific , see table 1 ) . wt was mainly associated with chronic carriers ( 64% of patients had wt ) ; bcp a1762 t , g1764a and pc g1896a were significantly associated with hcc - tissue hbv sequencing ( 75.3% ) ; pc g1896a was mainly associated with hcc - serum hbv sequencing and chronic carriers + hdv ( 66.7% and respectively 73.3% of patients had pc g1896a ) . we had 39 patients with genotype a , 293 patients with genotype d and 152 with genotypes a+d . patients with genotype bcp mutation was detected in 12 patients ( 30.8% ) , both bcp and pc mutation in six patients ( 15.4% ) and no pc mutation alone ( see table 2 ) . distribution of bcp and pc mutations were significantly linked to genotypes ( p < 0.001 for pearson test of independence ) . a+d genotypes combination was mainly associated with wt ( 80.9% of patients with a+d had wt ) ; d genotype was mainly associated with presence of pc g1896a ( 50.1% from d - patients present pc g1896a or bcp a1762 t , g1764a - pc g1896 ) ; a genotype was mainly associated with presence of wt and bcp ( the occurrence percentages were 53.8% and 30.8% , respectively ) . abbreviations : wt , wild type ; bcp , basal core promoter ; hbv , hepatitis b virus data are presented as mean sd or no . cells are frequencies . from a total of 39 patients with genotype a , 21 ( namely 53.8% ) had wt sequence . comment : boxplot for mutation reveals that , in spite of central tendency , the values of serum hbv dna for mutations could be similar to wt . one hundred and two patients ( 34.8% ) with genotype d had wt sequence , 44 ( 15.0% ) had bcp mutation only , 64 ( 21.8% ) had pc mutation only and 83 ( 28.3% ) had both bcp and pc mutations . analysis of variance was performed to study the dependence of the level of hbv dna by factors genotype , diagnosis and mutation . we used the glm univariate procedure unianova of spss , which is able to consider both balanced and unbalanced models ( our model was unbalanced and we lost test power ) . using this glm procedure , interactions between our factors were not significant but the effects of each individual factor were significant ( for each factor f test had p < 0.001 ) . hence , we authorized to use post hoc one - way anova procedure for each factor ( we would apply tamhane test ) . the mean serum hbv dna values for the hcc - tissue hbv sequencing patients were significantly higher compared to chronic carriers ( 16.14 vs. 10.49 ; p < 0.001 for tamhane test ; see ( table 1 ) . furthermore , hbv dna values for the hcc - serum hbv sequencing group were lower than the hcc - tissue sequencing group ( 16.14 vs. 13.47 , p = 0.004 ; see table 1 ) . genotypes a+d was associated with lower mean of serum hbv dna compared to genotypes d and a ( 8.89 vs. 12.82 and 13.01 ; figure 1 ) . the mean and median of serum hbv dna were practically equal for genotypes d and a , but significantly higher compared to a+d ( p < 0.001 ) . we detected significantly higher level of hbv dna in serum of patients with both bcp a1762t / g1764a , pc g1896a mutation ( 15.23 ) and bcp a1762t / g1764a mutations ( 14.44 ) compared to patients with pc g1896a mutation alone ( 12.75 ) and patients with wt sequence ( 8.99 ) ; p < 0.001 . characteristics of chronic carriers were smallest dna - hbv , predominance of wt and important percent of d presence , but also an important percent of a+d presence . characteristics of chronic carriers + vhd were high level of dna - hbv , predominance of pc g1896a mutation and highest percent of genotype d presence . hcc characteristics were high level of dna - hbv and high percent of d presence . as it concerns mutations , there was an important difference between serum and tissue sequencing . indeed , for serum sequencing pc g1896a was predominant , while for tissue sequencing bcp a1762t we aimed to investigate genotype and mutations in core promoter region of hbv genome in romanian hbv clinical infected patients with chronic hbv hepatitis and hcc patients , for a better understanding of the presence of hbv genotypes and bcp / pc mutations in this population . hbv genotyping was not performed in romania in a group of patients of this size . this study helps to understand the evolution of hbv in patients with hepatitis b and provides information about hbv genotypes and mutations . previous studies have shown that patients infected with hbv genotype a had a higher sustained response to interferon therapy compared to hbv genotype d. genotype d was predominant in romania and previous studies have shown that patients with hepatitis b genotype d respond well to treatment with nucleoside analogue reverse transcriptase inhibitor ( 8 , 9 ) . our study showed that knowing the genotype could be useful to predict the outcome of antiviral therapy in patients with chronic hepatitis b , but further studies are required to include a more rigorous selection of patients . recent studies have shown a link between the presence of bcp / pc mutations and hepatitis b - related acute - on - chronic liver failure . patients infected with genotype b and both mutations bcp / pc are more prone to hepatitis b - related acute - on - chronic liver failure and have a fatal outcome ( 10 ) . in hcc patients from asia and africa , basal core mutations were detected . in asia and the pacific ocean , bcp a1762 t and g1764a mutations were more common . precore mutations are common in the mediterranean region and romania is located close to this region . genotype d shows frequently precore mutations and is prevalent in the mediterranean region and southern europe ( 11 ) . in patients with hcc in romania , we detected both core and precore mutations in tissue samples . genotype d presents both bcp and pc mutations ( 28.3% ) more frequently compared to the mutation presenting pc only ( 21.8% ) , in romanian patients according to our study . the genotype d was detected in 60.5% of our hbv patients , and we observed that genotype d was associated with both bcp and pc mutations . previous studies indicated that high circulating hbv dna levels are predictive of liver disease progression . moreover , studies have recently reported that elevated hbv dna levels in patients with cirrhosis increase the probability of mortality from non - hcc - related liver complications than low hbv dna values ( 12 ) . high - circulating hbv dna levels were predictive of hcc development ( 4 , 13 , 14 ) . in the present study , 60.53% of chronic carriers had an hbv dna level of 10 iu / ml . however , only three patients from 73 with hcc had hbv dna level 10 iu / ml . in chronic b hepatitis patients with negative hbeag these patients have continuous synthesize of hbv dna at sufficient levels to cause constant liver damage with progression to cirrhosis ( 15 - 17 ) . patients with hbv load 10 iu / ml and infected with bcp and pc mutations have an increased risk of developing hcc , compared to those infected with wt . detecting hbv viremia level is a criterion to assess infection risk progression to cirrhosis and hcc , and is used to detect patients requiring antiviral therapy to evaluate response to treatment and emergence of resistant mutants ( 11 ) . both bcp and pc mutations were detected in the tissue samples ( 75.3% ) , and only pc mutation in the serum samples of our hcc patients ( 66.7% ) , suggesting that bcp / pc mutant or hepatocytes harboring this mutant may be under immune selection and that such mutations may facilitate integration and tumor development . the presence of precore escape mutants should be considered in individuals who exhibit hbeag negativity , hbsag positivity , anti - hbe positivity , hbv dna positivity , and elevated serum aminotransferase levels . however , precore variant is not uniformly pathogenic ; thus , co - mutations or host factors presumably explain more virulent forms of precore mutant - associated disease ( 18 , 19 ) . another common hbeag variant is the core promoter mutant , characterized by point mutations in the promoter of both hbeag mrna and core protein mrna . the most frequent core promoter mutation is the double a1762 t and g1764a nucleotide exchange , which results in a substantial decrease in hbeag expression but enhanced viral genome replication . reduction of hbeag expression is apparently mediated by reduced precore rna transcription ; whereas , the mechanism of enhanced replication is unclear . enhanced replication capacity and reduced virion secretion may increase viral load in the liver , which triggers liver damage directly or indirectly through the immune response . damage during chronic infection increases hepatocyte turnover , induces fibrosis , and increases the chance of hepatocellular transformation and malignancy ( 20 - 22 ) . our study limitations were lack of long - term follow - up of subjects and liver biopsies were not performed in chronic carriers , a single baseline measurement for hbv dna in chronic carriers and hcc patients . although some mutations statistically associated with hcc were found in this study , further studies are necessary to see whether these mutations predict the development of hcc in those who carry the mutation but do not yet have the associated disease . future studies should also consider other viral mutations and the genetic makeup of the host . association of core promoter mutations and liver cancer is also controversial ; carefully conducted epidemiologic studies are needed to demonstrate a link between core promoter mutations and hepatocellular carcinogenesis ( 23 , 24 ) . in summary , genotype d was the main genotype detected in romanian patients with chronic hbv and is associated with bcp a1762t / g1764a mutation , followed by the pc g1896a mutation and high hbv dna load , suggesting an association between bcp mutations , high viral dna load and hepatocarcinogenesis , consistent with previous reports . in our hcc - tissue hbv sequencing group we detected an increased number of both bcp and pc mutations , correlated with a high value of hbv dna .

background : accurate and personalized molecular virological diagnosis of hepatitis b virus ( hbv ) infection is crucial for individualized selection of patients for antiviral therapy in romania.objectives:we aimed to investigate hbv mutations in romanian patients with chronic hbv infection , also to match hbv genotypes with hbv mutations identified and clinical outcomes.patients and methods : this was a cross - sectional study . a total of 484 romanian patients with chronic hbv infection and hepatocellular carcinoma ( hcc ) were investigated . this was performed in fundeni clinical institute , bucharest , romania during january 2005 to august 2010 . hbsag positive patients with chronic hbv infection admitted to fundeni clinical institute were randomly enrolled in the study . analysis was performed in the centre for immunogenetics and virology , fundeni clinical institute , bucharest , romania . indirect diagnosis was performed with enhanced chemiluminescence method using architect i2000sr and hbv - dna was quantified with cobas taqman hbv pcr . direct sequencing of the pcr - products was performed with the pcr - product sequencing kit . hbv genotyping was performed with inno - lipa dr amplification and inno - lipa hbv precore-core.results:we detected two hbv genotypes ; a ( 8.1% ) and d ( 60.5% ) , and a mixture of genotypes a and d ( 31.4% ) ( p < 0.001 ) . basal core promoter ( bcp ) a1762t / g1764a and precore ( pc ) g1896a mutations were detected in these romanian patients with chronic hbv infection . hbv chronic carriers had mainly genotype d ( 54.4% ) and hbv wt ( 64.0% ) . bcp a1762 t , g1764a and pc g1896a were significantly associated with hcc - tissue hbv sequencing ( 75.3% ) ( p < 0.001 ) . pc g1896a alone was detected in hcc - serum hbv sequencing group ( 66.7%).conclusions : genotype d was the main genotype detected in romanian patients with chronic hbv infection . genotype d presented both bcp and pc mutations more frequently .

You are an expert at summarizing long articles. Proceed to summarize the following text: osteoporosis is a major health problem for roughly 55% of the us population of 50 years of age or older . it is characterized by low bone mass and structural deterioration which leads to increased fragility and risk of fracture . fifty percent ( 50% ) of women and 25% of men over age 50 will have an osteoporosis - related bone fracture . the most typical fractures occur in the hip , spine , wrist , and ribs , of which the hip and vertebral fractures can require long - term care and even cause death in as many as 24% of hip fracture cases . this dynamic aspect of bone physiology may facilitate the use of dielectric interrogation as a means of imaging bone health . assessing bone health may be a particularly good opportunity to exploit dielectric properties for screening , diagnosis , and in the overall management of bone treatment . in parallel with previous broadband tissue dielectric property studies [ 211 ] for instance , clinicians have used electrical currents to stimulate bone growth for several decades [ 1215 ] . with such treatment it is essential to both understand the reaction of the bone to electrical stimulation as well as understand the tissue dielectric properties for guiding the therapy . in addition , the dielectric properties , themselves , may provide clinically useful information with respect to assessing overall bone health as in the case of osteoporosis and monitoring osteogenic response to treatment . these properties have been studied extensively up to 5 mhz [ 1619 ] ; however , tests beyond this frequency have not proved useful to date . at lower frequencies , electrical impedance spectroscopy ( eis ) techniques , including parallel plate capacitance cells , in fact , measurements have been made using conventional open - ended coaxial dielectric probes at frequencies as high as 3 ghz , but remain unpublished . the primary reason is that the dielectric probe technique is inherently ill - suited to this type of measurement . while researchers have performed experiments to determine the proximal limits of heterogeneities when testing homogeneous materials and liquids using these probes , first - hand experience suggests that measurements with these probes on inhomogeneous targets are dominated by the tissue in direct contact with the probe . given the heterogeneous nature of trabecular bone samples and the potential for property and texture variations between the less disturbed internal zones and the bone surfaces because of the extensive manipulation involved in preparing the samples , it is not surprising that these probe measurements have been inconclusive . indicate that dramatic dielectric property changes occur with age in bone ( not seen in other tissue types ) . this dynamic aspect of bone physiology may facilitate exploitation of dielectric interrogation as a means of bone health imaging . [ 57 ] and others have proved useful in establishing nominal , frequency - dependent property ranges for different tissue types and have set the stage for further investigation of whether variations in individual tissue dielectric properties can be predictive of various maladies . [ 25 , 26 ] have explored whether tumors exhibit dielectric properties distinct from their normal organ . additionally , at frequencies below 2 ghz where the ionic flow dominates the overall conductivity effect [ 27 , 28 ] , tissue conductivity has been shown to vary linearly with temperature , and this mechanism has been utilized in investigations of noninvasive temperature monitoring in conjunction with thermal therapy [ 29 , 30 ] . similar work has been performed in other fields to look at tissue property variations based on physiological phenomena other than cancer . [ 31 , 32 ] showed that the speed of sound and broadband attenuation varied considerably for liver samples depending on overall fat and tumor content . given that the only substantive variations in the tissues tested in that study were the fat and water content levels , dielectric mixture laws such as the maxwell - fricke relationships would also naturally predict similar variations . in the area of ultrasound , researchers have performed numerous studies of the effect of bone density on the speed of sound and broadband attenuation , and several devices have been developed and approved by the fda for testing bone health . for instance , the lunar achilles system produced by ge healthcare ( waukesha , wi , usa ) and the sahara clinical bone sonometer manufactured by hologic ( bedford , ma , usa ) are both fda approved and used routinely in clinical situations . in the ultrasound experiments performed by wu et al . , trabecular bone samples were tested with both dual x - ray absorptiometry ( dxa ) and ultrasound transmission techniques to assess whether correlations exist between bone mineral density ( bmd ) and the ultrasound metrics speed of sound and broadband attenuation . the samples were tested at a baseline with both techniques and at several subsequent times after demineralization through submersion in acidic solvents . the ultrasound measurements were performed with the bone specimens placed in water to assess overall bulk property changes as the hydroxyapatite was progressively removed and artificially replaced by the water . ( note that hydroxyapatite is the main constituent of the mineralized portion of the bone and is generally referred to as bone mineral . ) we have followed a similar path for this dielectric property study except the dxa x - ray tests have been replaced with more exact x - ray micro - ct measurements to determine the bone sample constituent proportions . these tissue samples do not readily lend themselves to standard dielectric probe measurements because the trabecular bone samples are fragile and their surfaces are uneven given their intricate architecture . instead , we have applied a newly developed microwave tomographic approach utilizing a soft prior regularization that is well suited for testing the bulk properties of small samples of known geometries [ 34 , 35 ] . the samples were placed in a test tube filled with saline of known size in a predetermined location within the illumination zone of our microwave tomographic system . prior knowledge of the sample shape , size , and location was applied in the regularization scheme as part of the standard image reconstruction process to recover estimates of the specimen dielectric properties . this measurement approach is not unlike the ultrasound ct technique described by schreiman et al . for isolated tissue samples where while replacement of the bone marrow with saline does not perfectly mimic the process that normal bone undergoes during aging and/or unnatural bone loss , it does validate the overall notion that tissue bulk dielectric properties are functions of the individual properties and volume fractions of its constituents . in situ dielectric changes will likely occur in more complicated patterns , but these measurements may still provide important information on tissue pathology and health . in this paper we describe the process used in these experiments including the tissue preparation , x - ray ct , and microwave imaging approaches . we illustrate the technique of applying the microwave tomographic method with soft prior regularization to recover accurate values of the dielectric properties of the bone tissue samples and the associated tools used to assess the radiographic bone properties from the micro - ct data . finally , we present results demonstrating the correlation between the bone dielectric properties and the x - ray data metrics . we acquired several intact , porcine femurs from the surgical labs at dartmouth hitchcock medical center from animals that had been euthanized according to iacuc ( institutional animal care and use committee ) approved protocols . the bones were mechanically stripped of all flesh using surgical blades and then mounted in a bench vise under a ventilation hood . two 2 cm diameter by roughly 3 cm long cylindrical specimens were recovered from both femur ends using a hole saw to extract only trabecular bone samples . the remaining cortical shells at either end were cut off with a simple coping saw . figure 1 shows a schematic diagram of one end of a long bone illustrating the trabecular bone in relation to the other components . we applied a standard protocol used in the anatomy department at dartmouth medical school for removing the embedded marrow . this involved soaking each sample in commercially available ammonia ( 3% solution ) baths for two weeks , followed by full - week immersions in 75% , 50% , 25% and 0% ammonia solutions ( percentages with respect to the original 3% solution ) . during each week , the solutions were repeatedly refreshed to maximize the solvent effect . the progressive decrease in ammonia concentrations was designed to dissolve all of the marrow ( high concentration of fatty material ) even within the deepest portions of the trabecular bone specimens while also minimizing potential damage to the intricate trabecular structure . the first set of micro - ct images at the start of the experiments verified that the marrow had been completely removed . the flow graph in figure 2 illustrates the procedures used for testing and processing the demarrowed bone samples . ( 1 ) removal of all water from the samplesthis involved placing the samples in a custom desicator attached to an in - house vacuum source for a minimum of 4 days . we also documented the weight , length , and diameter of each sample at this step . this involved placing the samples in a custom desicator attached to an in - house vacuum source for a minimum of 4 days . we also documented the weight , length , and diameter of each sample at this step . ( 2 ) micro - ct of each bone samplewe used a ge explore locus sp micro - ct system with ge microview 2.1.2 software for reconstructing and analyzing the images . the protocol included using an 80 kev/80 mamp x - ray source , and data was acquired with a 0.5 increment between views . photographs were taken of all samples in the x - ray chamber to note the various physical landmarks ( growth plate and uneven height features ) for registration with the microwave imaging tests . the baseline resolution for this configuration was 28 microns ; however , because we applied a 2 2 binning strategy during the reconstruction process to reduce noise , the effective resolution was reduced to 56 microns . in this case , we chose cylindrical regions of interest because of the sample shape ( figure 3 ) . the ge analysis algorithms have the capability of calculating values for : bmd - bone mineral density , bmc - bone mineral content , tmd - tissue mineral density , tmc - tissue mineral content , and bone volume fraction ( bvf ) , where bvf = ( ( bone volume)/(total sample volume ) ) 100% . according to the manufacturer , both bmd and bmc use parameters set by the user - selected region of interest ( roi ) , and the resulting bone values are affected by factors other than bone ( e.g. , soft tissue , air ) . having air included in the roi has particularly deleterious effects ; therefore , the tmc and bvf parameters are more biologically meaningful . the data acquisition time was roughly 2.5 hours for full scans while the associated micro - ct image reconstruction process required 10 minutes for each sample . we used a ge explore locus sp micro - ct system with ge microview 2.1.2 software for reconstructing and analyzing the images . the protocol included using an 80 kev/80 mamp x - ray source , and data was acquired with a 0.5 increment between views . photographs were taken of all samples in the x - ray chamber to note the various physical landmarks ( growth plate and uneven height features ) for registration with the microwave imaging tests . the baseline resolution for this configuration was 28 microns ; however , because we applied a 2 2 binning strategy during the reconstruction process to reduce noise , the effective resolution was reduced to 56 microns . in this case , we chose cylindrical regions of interest because of the sample shape ( figure 3 ) . the ge analysis algorithms have the capability of calculating values for : bmd - bone mineral density , bmc - bone mineral content , tmd - tissue mineral density , tmc - tissue mineral content , and bone volume fraction ( bvf ) , where bvf = ( ( bone volume)/(total sample volume ) ) 100% . according to the manufacturer , both bmd and bmc use parameters set by the user - selected region of interest ( roi ) , and the resulting bone values are affected by factors other than bone ( e.g. , soft tissue , air ) . having air included in the roi has particularly deleterious effects ; therefore , the tmc and bvf parameters are more biologically meaningful . the data acquisition time was roughly 2.5 hours for full scans while the associated micro - ct image reconstruction process required 10 minutes for each sample . ( 3 ) immersion of bone samples in salinefor microwave imaging purposes , the samples were submerged in a 0.9% saline solution in an 18 mm diameter plastic test tube with 0.5 mm wall thickness for 24 hours . the dielectric properties of the plastic over the range of 9001300 mhz were r = 2.8 and = 0.01 s / m . after this , the test tubes were placed in a pressure chamber with a vacuum applied for 10 minutes . this was followed by 10 minutes in the same chamber with 45 lbs / inch of applied pressure . this two - step procedure was repeated three times as a way of minimizing any trapped air bubbles within the samples . for microwave imaging purposes , the samples were submerged in a 0.9% saline solution in an 18 mm diameter plastic test tube with 0.5 mm wall thickness for 24 hours . the dielectric properties of the plastic over the range of 9001300 mhz were r = 2.8 and = 0.01 s / m . after this , the test tubes were placed in a pressure chamber with a vacuum applied for 10 minutes . this was followed by 10 minutes in the same chamber with 45 lbs / inch of applied pressure . this two - step procedure was repeated three times as a way of minimizing any trapped air bubbles within the samples . ( 4 ) microwave measurementsfor the dielectric property study , the test tubes were placed at a position 3 cm offset from the center within the illumination chamber ( figure 4 ) . the tank consisted of 16 monopole antennas suspended in an 80 : 20 mixture of glycerin and water which surrounded the bone samples . the dielectric properties of the liquid mixture were r = 28.0 , 24.9 , 22.5 , and = 1.01 , 1.19 , 1.35 s / m for 900 , 1100 , and 1300 mhz , respectively . each antenna individually broadcasts a single - frequency , continuous wave signal with the remaining 15 antennas acting as receivers . this process was repeated for all 16 antennas acting as the transmitter and at 11 frequencies ( 5002500 mhz at a step size of 200 mhz ) to produce 2640 measurements ( 16 transmitters 15 receivers 11 frequencies ) . this data was then used in our gauss - newton 2d imaging algorithm while applying our soft prior regularization to extract accurate reconstructions of the properties within the test tube zone . the soft prior reconstruction mesh ( figure 5 ) illustrates the isolation of the test tube region from the remaining homogeneous coupling bath . ( the test tube region was on the left , instead of on the right in figure 4 because the reconstruction software is oriented for viewing from the bottom of the tank to the top . ) this mesh information is then included with the reconstruction algorithm to provide nearly homogeneous values for the target zone ( note , the properties of the surrounding zone are known from direct measurements ) . single - frequency images were recovered in under 2 minutes while allowing the algorithm to converge for 20 iterations . the bone samples were then rinsed for 10 minutes in tap water before the next process . for the dielectric property study , the test tubes were placed at a position 3 cm offset from the center within the illumination chamber ( figure 4 ) . the tank consisted of 16 monopole antennas suspended in an 80 : 20 mixture of glycerin and water which surrounded the bone samples . the dielectric properties of the liquid mixture were r = 28.0 , 24.9 , 22.5 , and = 1.01 , 1.19 , 1.35 s / m for 900 , 1100 , and 1300 mhz , respectively . each antenna individually broadcasts a single - frequency , continuous wave signal with the remaining 15 antennas acting as receivers . this process was repeated for all 16 antennas acting as the transmitter and at 11 frequencies ( 5002500 mhz at a step size of 200 mhz ) to produce 2640 measurements ( 16 transmitters 15 receivers 11 frequencies ) . this data was then used in our gauss - newton 2d imaging algorithm while applying our soft prior regularization to extract accurate reconstructions of the properties within the test tube zone . the soft prior reconstruction mesh ( figure 5 ) illustrates the isolation of the test tube region from the remaining homogeneous coupling bath . ( the test tube region was on the left , instead of on the right in figure 4 because the reconstruction software is oriented for viewing from the bottom of the tank to the top . ) this mesh information is then included with the reconstruction algorithm to provide nearly homogeneous values for the target zone ( note , the properties of the surrounding zone are known from direct measurements ) . single - frequency images were recovered in under 2 minutes while allowing the algorithm to converge for 20 iterations . the bone samples were then rinsed for 10 minutes in tap water before the next process . we investigated whether orientation of the test tube had any deleterious effect on our measurements . for several test cases , the test tube containing the bone specimen was rotated 0 , 90 , 180 , and 270 and scanned with the microwave tomographic imaging ( mti ) system . the standard deviations for relative permittivity and conductivity were 0.35 and 0.026 s / m , respectively . even with this low level of variation , orientation was taken into consideration during the process . each bone specimen was marked with ink and maintained in the same direction for all scans . ( 5 ) acid treatmentthe bone samples were suspended in a 5% nitric acid ( bone decalcifier ) solution for approximately 2 hours to remove a controlled percentage of the mineralization . we determined that most bone samples typically began with roughly 40% mineral density and that each 2.1-hour acid treatment decreased the density in increments of approximately 10% . the protocol of acid treatment allowed us to recover 5 measurements for each sample at different mineral densities . all samples were rinsed in tap water for 10 minutes after each session to terminate the oxidation process . the bone samples were suspended in a 5% nitric acid ( bone decalcifier ) solution for approximately 2 hours to remove a controlled percentage of the mineralization . we determined that most bone samples typically began with roughly 40% mineral density and that each 2.1-hour acid treatment decreased the density in increments of approximately 10% . the protocol of acid treatment allowed us to recover 5 measurements for each sample at different mineral densities . all samples were rinsed in tap water for 10 minutes after each session to terminate the oxidation process . as described above , each sample was immersed in a 0.9% saline solution within an 18 mm diameter test tube . the reconstruction mesh ( figure 5 ) only encompasses the sample domain since the properties of the surrounding liquid are known and are not reconstructed . the minimization statement for the gauss - newton reconstruction utilizing the soft prior regularization approach is given as ( 1)min||mc(k2)||2+||mc(k2)||2+l{k2kbk2 } , where and are the measured and computed log magnitude values , and are the measured and computed phase values , k is the complex wave number squared distribution at the current iteration , kbk is the wave number squared for the surrounding background coupling medium , is the soft prior regularization parameter and l is the soft prior matrix . k comprises the permittivity and conductivity images through the relationship k = + j , where is the frequency in radians , is the magnetic permeability , and and are the electrical permittivity and conductivity , respectively . note that the first two terms are essentially the implementation of our log transformation in the gauss - newton algorithm which is described in detail in meaney et al . . ( all of the details of this approach are described in more detail in golnabi et al . . ) the critical aspect of the soft prior regularization is the composition of the matrix l ( 2 ) r1{[11n11n100111n11n11n1100 ] r2{[0011n21n21n211n211n2001n21n21 ] equation ( 2 ) shows the l matrix constructed with regions r1 and r2 grouped accordingly . as shown in figure 5 , r1 is the background region ( blue ) , and r2 is the region that has the bone specimen ( red ) . there are n1 and n2 nodes in regions r1 and r2 , respectively . based on the formation of the regularization matrix l , ll can be viewed as an approximation of a second - order laplacian smoothing operator inside each region that limits the smoothing across the boundary of distinct regions . we used six bone specimens in this experiment , and each was scanned by both the micro - ct and microwave tomography systems between intervening demineralization treatments . for all samples , the dry mass and diameters decreased 50.90% and 12.17% on average , respectively , with associated standard deviations of 5.88% and 2.72% , respectively . figure 7 shows representative 1100 mhz soft prior permittivity and conductivity images at the ( a ) first , ( b ) second , and ( c ) final imaging scans . the bath was the same for all sessions as illustrated by the backgrounds of each image being identical to the others . it is interesting to note that while the dry diameters shrunk slightly from the acid treatments , when the samples were immersed in the saline , they expanded to fit snuggly against the test tube walls . the properties of the recovered targets demonstrated a clear increasing trend from the first to the last imaging session . the data for the six samples were pooled and analyzed . figure 8 shows the scatter plots for the dielectric properties versus bvf at three frequencies ( 0.9 , 1.1 , and 1.3 ghz ) . overall , both properties show a distinct downward trend with respect to bone volume fraction for all frequencies . the p values for both relative permittivity and conductivity at all three frequencies are less than the 0.05 threshold for significance . these relationships are further confirmed with the pearson product - moment correlation coefficients ( pmcc ) summarized in table 1 . ( the pearson coefficients are a measure of the strength of linear dependence between two variables and are defined as the covariance of the two variables divided by the product of their standard deviations . ) the correlation coefficients for the relative permittivity and conductivity with respect to bvf are above the threshold ( in terms of their absolute values ) for statistical significance with n = 30 . the conductivity pearson coefficients are consistently higher than those for the permittivity suggesting a higher level of correlation . we have successfully applied our microwave imaging system to assess the dynamic dielectric properties of bone tissue samples . this is particularly important in the setting of measuring bone samples where other techniques such as open - ended dielectric probes have failed . the results are consistent with what would be predicted by maxwell - fricke mixture laws ; that is , with the decreased mineralization ( low dielectric property values ) and increased saline ( higher properties ) , the bulk dielectric properties of the saline - saturated bone sample increased . they are consistent with the findings from chakkalakal et al . in that the variations in dielectric properties are determined by the content in the pore holes , although the operating frequencies and variation mechanisms of dielectric property dispersions differ . the results further confirm the flexibility and strength of the soft prior regularization strategy in the context of microwave imaging . in addition , these results suggest a mechanism to explain the correlation between bone dielectric properties and age observed by peyman et al . . while these relationships were hypothesized because of the dynamic nature of bone tissue and the heavy dependence of tissue dielectric properties on water content , it was essential that these results be confirmed in direct investigations . the measurement conditions for these experiments were suboptimal with respect to assessing the natural property variations as functions of bone density . in the body , a future study should extend these measurements to in vivo or freshly excised bones to determine the contribution of these materials in the pore holes to the dielectric properties . the bone density variations could be induced directly by varying the animal diets , especially the mineral content , to provide more realistic controls . notwithstanding , these results are a promising first step towards understanding the relationship between dielectric properties and bone density metrics and set the stage for exploiting this mechanism for microwave bone imaging as a clinical diagnostic tool .

a critical need exists for new imaging tools to more accurately characterize bone quality beyond the conventional modalities of dual energy x - ray absorptiometry ( dxa ) , ultrasound speed of sound , and broadband attenuation measurements . in this paper we investigate the microwave dielectric properties of ex vivo trabecular bone with respect to bulk density measures . we exploit a variation in our tomographic imaging system in conjunction with a new soft prior regularization scheme that allows us to accurately recover the dielectric properties of small , regularly shaped and previously spatially defined volumes . we studied six excised porcine bone samples from which we extracted cylindrically shaped trabecular specimens from the femoral heads and carefully demarrowed each preparation . the samples were subsequently treated in an acid bath to incrementally remove volumes of hydroxyapatite , and we tested them with both the microwave measurement system and a micro - ct scanner . the measurements were performed at five density levels for each sample . the results show a strong correlation between both the permittivity and conductivity and bone volume fraction and suggest that microwave imaging may be a good candidate for evaluating overall bone health .

You are an expert at summarizing long articles. Proceed to summarize the following text: metabolic syndrome ( ms ) is characterized by the presence of insulin resistance , low - degree inflammation , dysglycemia , low plasma high - density lipoprotein cholesterol ( hdl - c ) , increased triglycerides ( tg ) , elevated blood pressure , and abdominal obesity . ms has been associated with an increased risk of type 2 diabetes mellitus ( dm2 ) and cardiovascular diseases ( cvds ) [ 1 , 2 ] . the prevalence of ms varies between 15% and 40% , being greater in the population of hispanic origin . abdominal obesity is considered a key characteristic of ms , which is related to decreased insulin - mediated glucose uptake . adipose tissue is known to express and secrete a variety of adipokines , including leptin , adiponectin , resistin , and visfatin , as well as cytokines and chemokines such as tumor necrosis factor - alpha ( tnf- ) , interleukin-6 ( il-6 ) , and monocyte chemoattractant protein-1 ( mcp-1 ) [ 58 ] . the release of adipokines by either adipocytes or adipose tissue - infiltrated macrophages plays a key role in the development of insulin resistance and dm2 , as well as the increased risk of cardiovascular disease associated with obesity . renin - angiotensin system components are also activated in adipose tissue , leading to hypertension and insulin resistance . adiponectin is considered to be a protective protein with antidiabetic , anti - inflammatory , and antiatherogenic effects . reduced plasma adiponectin levels have been reported in obese individuals , particularly in those with visceral obesity , and have been negatively correlated with insulin resistance . furthermore , decreased adiponectin levels were found to be associated with a higher incidence of dm2 . leptin was shown to promote the development of atherosclerosis by inducing oxidative stress in endothelial cells , increasing platelet aggregation , and hypertrophy and proliferation of vascular smooth muscle cells . additionally , it was shown that a high leptin level predicts subsequent development of dm2 . thus , leptin / adiponectin imbalance has a key role in the metabolic alterations associated with obesity [ 510 ] . multiple therapeutic approaches such as renin - angiotensin system blockers and inhibitors , statins as well as nutrient and dietary interventions [ 1114 ] , have been proposed to reduce metabolic and cardiovascular risk in patients with ms . garlic ( allium sativum l. ) has been used as a nutrient with beneficial cardiovascular effects . however , the beneficial effects of garlic are offset by the fact that fresh garlic causes indigestion and that its pungent odor lingers on breath and skin . an alternative source of garlic that is odorless and rich in antioxidants is aged garlic extract ( age ) . age has shown beneficial effects in several alterations related to the development of cardiovascular diseases , such as antioxidant and antithrombotic properties [ 1820 ] . thus , in the present study we aimed to investigate the effects of age on adipokines , inflammatory substances , endothelial function , and metabolic risk factors that constitute the cluster of metabolic syndrome in an urban colombian population . double - blind , crossover , randomized , placebo - controlled clinical trial to assess the effect of age ( kyolic ) on the cardiovascular risk factors of subjects with ms . men and women over 18 years old with diagnosis of ms , attending primary health care clinics from the metropolitan area of bucaramanga , colombia . the ms diagnosis was based on the presence of central obesity ( waist circumference 90 cm ( male ) , 80 cm ( female ) ) and two of the following criteria : tg 150 mg / dl , hdl - c < 40 mg / dl ( male ) , < 50 mg / dl ( female ) , blood pressure 130/85 mmhg , and fasting plasma glucose 100 mg / dl . the exclusion criteria were ( 1 ) allergies to garlic ; ( 2 ) current treatment with lipid - lowering drugs , antihypertensive drugs , and/or hypoglycemic medications ; ( 3 ) psychiatric disorders that prevent proper decision making ; ( 4 ) patients with infections or inflammatory assets ; ( 5 ) presence of coronary artery disease , with a current or past ischemic event ; ( 6 ) presence of severe chronic or terminal illnesses ; and ( 7 ) presence of diseases that compromise the immune system . the study was approved by the ethical committee of the cardiovascular foundation in bucaramanga , colombia . patients were randomly assigned by blocks to receive either 1.2 g / day of age ( kyolic ) or placebo , and after 12 weeks of supplementation , the treatment was invested for another 12 weeks ( figure 1 ) . each treatment was provided in an identical capsule that was taken twice daily with breakfast and dinner ( 2 capsules of each ) . all subjects received routine recommendations of lifestyle changes ( having a diet lower in fat and sugar and increasing physical activity with 30 minutes / day of moderate walking ) . participants were followed up every four weeks with clinical evaluations and registration of potential undesirable effects and use of any other medication . during the baseline and at the end of each phase of treatment ( week 12 and week 24 ) , the following were determined . weight , height , body mass index ( bmi ) , waist ( wc ) and hip circumferences ( hc ) , and blood pressure . routine clinical tests were processed in the clinical research laboratory from the ophthalmological foundation of santander - foscal , floridablanca , colombia . measurements of adipokines and inflammatory factors were performed at the department of physiology , faculty of medicine , complutense university of madrid , spain . glycemia and lipid profile were quantified by using a routine colorimetric method ( biosystem bts-303 photometric , barcelona , spain ) . interleukin-6 , adiponectin , and c - reactive protein were measured using an immunoassay ( r&d systems , mn , usa ) . the fmv was performed using a high - resolution doppler ultrasound , measuring the changes in diameter of the brachial artery in response to increased blood flow ( reactive hyperemia ) . the averages and proportions obtained in a descriptive analysis for all clinically relevant variables measured during the baseline evaluation were compared . then , the treatment effect of the crossover design was evaluated through the difference in change between baseline versus posttreatment according to the intervention phase . based on the frequencies distribution of the outcome variables , the student 's t - test or wilcoxon signed - ranks test was used . in outcome variables where significant differences were observed , further analysis of changes was performed using analysis of covariance ( ancova ) , adjusting by phase , treatment , and their interaction ( treatment phase ) to determine if changes were due to a carryover effect . all analyses were conducted using stata statistical software , release 11.0 ( stata corporation , college station , tx , usa ) . the 46 patients included in the study were distributed in two sequences of treatment : age - placebo and placebo - age . three subjects ( all of them of the first group ) voluntarily discontinued the treatment during the phase 1 . demographic , anthropometric , and biochemical characteristics obtained in the 43 participants who completed the study are shown in table 1 . a significant difference in age was found between the age - placebo and the placebo - age groups at the baseline . at the end of the study the crossover analysis was conducted , and a significant difference in the adiponectin delta was found comparing age versus placebo , : 313.79 ( 95%ic : 48.34~675.92 ) versus : 271.88 ( 95%ic : the ancova confirmed that the significant difference in adiponectin was due to the treatment , not the phase of the study ( no carryover effect ) as no significant changes were observed in the interaction treatment phase ( table 3 ) . no significant changes were observed in any of the other anthropometrical measurements , endothelial function , and biochemical variables ( table 2 ) . the present study demonstrates for the first time that the administration of age to subjects with ms for 12 weeks increased adiponectin plasma concentrations . our group previously reported that in dyslipidemic subjects , the presence of coronary artery disease is associated with an elevation of certain inflammatory markers but not with further endothelial dysfunction . in the present study , after the age intervention there were no significant changes either in endothelial function or in inflammation , which may relate both to the short period of intervention and the participation of subjects with low cardiovascular risk . however , there was a significant increase in adiponectin , an anti - inflammatory adipokine with cardioprotective properties . low adiponectin levels are observed in obese subjects with and without severe coronary atherosclerosis and in subjects with abdominal obesity [ 10 , 25 ] , and decreased adiponectin levels ( < 4 g / ml ) are associated with a twofold increase in the prevalence of coronary heart disease , independent of other cardiovascular risk factors . moreover , hypoadiponectinemia is associated with insulin resistance and dm2 [ 27 , 28 ] , as well as atherosclerosis and hypertension . adiponectin exerts an anti - inflammatory effect through activation of its three receptors ( adipor1 , adipor2 , and t - cadherin ) . the activation of adipor1 and r2 results in increased hepatic and skeletal muscle fatty acid oxidation , increased skeletal muscle lactate production , reduced hepatic gluconeogenesis , increased cellular glucose uptake , and inhibition of inflammation and oxidative stress . activation of t - cadherin is protective in vascular endothelial cells against oxidative stress - induced apoptosis . several mechanisms have been suggested to explain the anti - inflammatory effects of adiponectin , including direct actions on inflammatory cells , actions on nf-b , and interaction with tnf- . it has been demonstrated that adiponectin inhibits the expression of adhesion molecules in endothelial cells and inhibits smooth muscle cell proliferation , the differentiation of monocytes into macrophages , as well as the formation of foam cells and the secretion of tnf- by macrophages [ 3234 ] . also , increased adiponectin levels are related to improvement in the differentiation of preadipocytes into adipocytes , which is usually impaired in obese subjects . in fact , 1,2-vinyldithiin ( 1,2-dt ) , a garlic - derived organosulfur compound , has been shown to affect the differentiation of human preadipocytes into adipocytes . interestingly , a significant reduction of the expression of the two major adipogenic transcription factors , ppar2 and ccaat / enhancer binding protein ( c / ebp ) , was observed in 1,2-dt - treated preadipocytes . the 1,2-dt - mediated decrease in ppar2 expression is associated with reduced ppar activity , suggesting that the negative effect of 1,2-dt on preadipocytes differentiation could be mainly due to an inhibitory effect on ppar2 , the master regulator of adipogenesis . the role of these mechanisms of action of 1,2-dt in the beneficial effects of age increasing the levels of adiponectin remains to be elucidated . additionally , our results showing that a short period of age administration increases the adiponectin level suggest that the effect of age improving the insulin resistance could be another new interesting mechanism to explain the well - known beneficial cardiometabolic effect of garlic . another mechanism that could be associated with the adiponectin increase is the nitric oxide ( no ) pathway . adiponectin increases the stability of enos mrna and half - life , enhances the association of enos with hsp90 , and stimulates the phosphorylation of enos , which together lead to increased no production [ 38 , 39 ] . it has been suggested that age could increase no bioavailability [ 40 , 41 ] by ( a ) increasing cellular antioxidant capacity by providing cellular thiol antioxidants like cysteine and reduced glutathione , ( b ) maintaining functionally relevant levels of tetrahydrobiopterin and preventing oxidative inactivation of tetrahydrobiopterin , which prevents no synthase uncoupling and superoxide anion generation , and ( c ) maintaining no bioavailability in endothelial cells even under conditions of increased vascular oxidant stress . age is rich in water - soluble organosulfur bioactive compounds such as s - allylcysteine and s - allylmercaptocysteine which are cellular donors of thiol containing reducing equivalents and as such might explain the cardiovascular benefits of age . in summary , we showed for the first time that age administration for 12 weeks increases adiponectin levels . the importance of this observation in the prevention of cvd remains to be determined , and further and larger studies are needed .

background . garlic ( allium sativum ) has been shown to have important benefits in individuals at high cardiovascular risk . the aim of the present study was to evaluate the effects of the administration of aged garlic extract ( age ) on the risk factors that constitute the cluster of metabolic syndrome ( ms ) . methods and design . double - blind , crossover , randomized , placebo - controlled clinical trial to assess the effect of 1.2 g / day of age ( kyolic ) , for 24 weeks of treatment ( 12 weeks of age and 12 weeks of placebo ) , on subjects with ms . results . the administration of age increased the plasma levels of adiponectin ( p = 0.027 ) . no serious side effects associated with the intervention were reported . conclusion . the present results have shown for the first time that the administration of age for 12 weeks increased plasma adiponectin levels in patients with ms . this suggests that age might be a useful , novel , nonpharmacological therapeutic intervention to increase adiponectin and to prevent cardiovascular ( cv ) complications in individuals with ms .

You are an expert at summarizing long articles. Proceed to summarize the following text: it is generally believed that a large number of people suffering from alcohol use disorders either do not seek treatment or do so very late in the course of their illness . moreover there is limited literature that has explored pathways to care among individuals with substance dependence globally ( 2 ) . while majority failed to include individuals with alcohol dependence , others have included individuals with alcohol dependence as a small proportion of the overall sample . the proportion of subjects with alcohol dependence in such studies has varied from 0% - 16% ( 3 , 4 ) . we could come across only one study that has reported pathways to care exclusively among individuals with alcohol use disorder ( 5 ) . commander et al . ( 5 ) studied the pathways to psychiatric care for alcohol use disorders using the goldberg - huxley model ( 6 ) as the framework in a district in england . community ( level 1 ) ; primary care : total morbidity ( level 2 ) ; at primary care : conspicuous morbidity ( level 3 ) , specialist service use ( levels 4 ) ; and in - patient care ( level 5 ) . on analyzing the ratios of patients moving upwards to a higher level ( in other words , the function of filters ) , it turned out that about half progress at the first two filters and about one - tenth progress at the last two filters each . the study demonstrated that even in developed countries , only half of those with alcohol use problems ever seek even primary care help . the figures given above demonstrated that only a miniscule proportion of these patients receive specialist attention . need to study pathway to care in indian settings among patients with mental disorders has been expressed by researchers earlier as well ( 7 ) . however , there is no published literature that has specifically explored pathway to care among individuals with alcohol use disorder in india . in the present study , the authors explored pathways to care traversed by patients with alcohol use disorders seeking help at a tertiary care substance use disorder treatment center . patients fulfilling dsm - iv - tr criteria for alcohol dependence were recruited from a tertiary care de - addiction center . patients in age range of 18 - 60 years , seeking treatment at the substance use disorder treatment center , willing to provide a written informed consent were recruited . while those with any other comorbid substance use fulfilling dsm - iv - tr criteria for dependence or abuse ( other than nicotine ) , in state of intoxication and those refusing to provide informed consent were excluded from the study . information on socio - demographic profile of the patients was collected using a semi - structured proforma . data on pathways to care were collected using the encounter form used in who pathway study and thereafter extensively used in pathway to care studies across different settings and countries ( 3 , 8) . it is a culture neutral questionnaire designed to systematically assess sources of care used by patients before consulting mental health professional . the items included in the questionnaire gather information on profession of each previous carer , length of time since the patient was first seen and the main problem , source of referral , main treatment offered and duration of the patient 's journey to see the carer . the data obtained were analyzed using spss version 21 ( ibm spss statistics for windows , version 21.0 . the kolmogorov - smirnov test ( lilliefors significance criterion ) was used to determine the normality of the data . the t - test was used to compare continuous data with normal distribution whereas the mann - whitney test was used where the distribution was found to be nonnormal . the level of statistical significance was kept at p < 0.05 for all the tests . information on socio - demographic profile of the patients was collected using a semi - structured proforma . data on pathways to care were collected using the encounter form used in who pathway study and thereafter extensively used in pathway to care studies across different settings and countries ( 3 , 8) . it is a culture neutral questionnaire designed to systematically assess sources of care used by patients before consulting mental health professional . the items included in the questionnaire gather information on profession of each previous carer , length of time since the patient was first seen and the main problem , source of referral , main treatment offered and duration of the patient 's journey to see the carer . information on socio - demographic profile of the patients was collected using a semi - structured proforma . data on pathways to care were collected using the encounter form used in who pathway study and thereafter extensively used in pathway to care studies across different settings and countries ( 3 , 8) . it is a culture neutral questionnaire designed to systematically assess sources of care used by patients before consulting mental health professional . the items included in the questionnaire gather information on profession of each previous carer , length of time since the patient was first seen and the main problem , source of referral , main treatment offered and duration of the patient 's journey to see the carer . the data obtained were analyzed using spss version 21 ( ibm spss statistics for windows , version 21.0 . the kolmogorov - smirnov test ( lilliefors significance criterion ) was used to determine the normality of the data . the t - test was used to compare continuous data with normal distribution whereas the mann - whitney test was used where the distribution was found to be nonnormal . the level of statistical significance was kept at p < 0.05 for all the tests . the patients were mostly young , married and more often than not from joint families . there were no statistically significant differences between those seeking help from the tertiary level substance use disorder treatment center directly for the first time ever in their lives when compared to those who have had multiple previous help seeking attempts from other treatment facilities except for the travelling time ( from their homes ) to our center . those seeking help for the first time lived closer to the tertiary care de - addiction center with a median travelling time of 0.5 hours ( iqr = 1.77 ) whereas those with prior help seeking attempts from other health services lived farther with a median travelling time of 1.5 hours ( iqr = 2.75 ) from the center . abbreviation : sd , standard deviation . there were no significant differences in the substance use characteristics between those seeking help at a tertiary care center at first level of contact and those seeking tertiary care at second or subsequent contacts . the patients consulted a number of care providers with several consulting more than one provider . first point of contact was with a tertiary care addiction psychiatrist , 15.5% with a secondary level psychiatrist and 8.6% with a general practitioner . traditional healers were consulted by about 5.2% of the patients seeking help for the first time . at all levels of contact with health services , the largest group comprised those consulting a tertiary care addiction psychiatrist , followed by a secondary care psychiatrist with some exceptions . the pathway to care followed by the study subjects has been represented in figure 2 . the mean duration of main problem due to alcohol use was 5.82 4.95 years . the temporal pattern and travel time for various help seeking attempts are shown in table 3 . the first contact tended to be at place nearer to the patient s residence while further contacts tended to be farther away . a comparison of the travelling times of those seeking tertiary care de - addiction service consultation at first level of contact ( median = 0.5 hours , iqr = 1.68 ) vis - a - vis consultations from other health services at first level of contact ( median = 1.00 hours , iqr = 1.75 ) revealed no statistically significant differences ( p = 0.22 ) . there were no differences between above two groups on any socio - demographic or clinical parameters . family , friends and neighbours together constituted the single largest group suggesting care to be sought ( or referring ) by the patients except at the third contact , where a marginally larger number of patients referred themselves . the patients were mostly young , married and more often than not from joint families . there were no statistically significant differences between those seeking help from the tertiary level substance use disorder treatment center directly for the first time ever in their lives when compared to those who have had multiple previous help seeking attempts from other treatment facilities except for the travelling time ( from their homes ) to our center . those seeking help for the first time lived closer to the tertiary care de - addiction center with a median travelling time of 0.5 hours ( iqr = 1.77 ) whereas those with prior help seeking attempts from other health services lived farther with a median travelling time of 1.5 hours ( iqr = 2.75 ) from the center . abbreviation : sd , standard deviation . there were no significant differences in the substance use characteristics between those seeking help at a tertiary care center at first level of contact and those seeking tertiary care at second or subsequent contacts . the patients consulted a number of care providers with several consulting more than one provider . first point of contact was with a tertiary care addiction psychiatrist , 15.5% with a secondary level psychiatrist and 8.6% with a general practitioner . traditional healers were consulted by about 5.2% of the patients seeking help for the first time . at all levels of contact with health services , the largest group comprised those consulting a tertiary care addiction psychiatrist , followed by a secondary care psychiatrist with some exceptions . the pathway to care followed by the study subjects has been represented in figure 2 . the mean duration of main problem due to alcohol use was 5.82 4.95 years . the temporal pattern and travel time for various help seeking attempts are shown in table 3 . the first contact tended to be at place nearer to the patient s residence while further contacts tended to be farther away . a comparison of the travelling times of those seeking tertiary care de - addiction service consultation at first level of contact ( median = 0.5 hours , iqr = 1.68 ) vis - a - vis consultations from other health services at first level of contact ( median = 1.00 hours , iqr = 1.75 ) revealed no statistically significant differences ( p = 0.22 ) . there were no differences between above two groups on any socio - demographic or clinical parameters . family , friends and neighbours together constituted the single largest group suggesting care to be sought ( or referring ) by the patients except at the third contact , where a marginally larger number of patients referred themselves . this is the first study from india to systematically assess the pathways to care among patients diagnosed with alcohol dependence syndrome . in spite of the experts opinions on need for pathway to care study in indian setting for individuals with mental disorders the current study found that the help - seeking attempt at a tertiary care center varied from a median of 9 years ( direct contact ) to a median of 14 years ( indirect contact ) after the onset of alcohol use . ( 5 ) regarding the unsatisfactory help seeking behaviour as well as the abysmally small number of patients availing appropriate health services . interestingly though , in the current study , well over half the sample had consulted a tertiary level addiction psychiatrist at first level of contact with health services and a sizeable number had consulted a secondary level psychiatrist . about one - fourth of the sample had consulted a tertiary level addiction psychiatrist at second contact . the number of patients consulting general practitioners , traditional healers and pharmacists was pretty low in the current study . even prior to the contact at our center , these findings , in a sense , appear to contradict those of commander et al . ( 5 ) this discrepancy could possibly be partly attributed to the fact that this sample was recruited from a tertiary care center and may have preferably picked those patients , who , for various reasons , may have had an inclination to consult a specialist . however , a closer scrutiny of previous literature suggests alternative explanation as discussed subsequently . although no previous studies from india have explored pathways to care exclusively among individuals with alcohol use disorder , there are a few that have focused on other psychiatric disorders ( 9 - 11 ) . a multi - national study ( 12 ) with one center in india also included subjects with substance use disorders ( 18% of sample ) . all these studies have been conducted among clinical populations in tertiary care teaching hospitals from india . ( 10 ) reported that only around nine percent of the patients in their study sought help directly from a psychiatrist . ( 9 ) also observed that only a small fraction of the patients with mental disorders sought help directly from a psychiatrist . on the contrary , more than seventy percent of the subjects sought help directly from a psychiatrist in the current study . the findings of these previous studies which were also recruited from tertiary care centers indicate that the nature of the sample alone can not explain the discrepant findings of the current study . thus , the observation in the current study is contrary to the earlier expressed views highlighting limited direct access to psychiatric services after the onset of illness in india ( 7 ) . this observation from the current study possibly implies that in case of substance use disorders ( alcohol dependence ) , the rate of nonspecialist help seeking may actually be much less than that observed for other psychiatric disorders . interestingly around two - third ( 6/9 ) of the subjects with substance use disorders as compared to only 27% of subjects with other psychiatric disorders from the indian site in the multinational study by hashimoto et al . a possible explanation could be the lack of service providers who are willing to treat substance use problems , which might have forced these patients to seek help at a specialized center such as ours . possibility of difference in pathways to care based on the psychiatric diagnosis has been expressed earlier as well . a study from northern part of the country reported psychiatrist to be the first doctor consulted by 58% of the patients ( 13 ) . additionally , almost one - third of them sought help from faith healers at first contact . about 90% of the sample in the study was constituted by psychotic and mood disorders explaining the nature of help - seeking . another study from a tertiary care setting ( that did not include patients with substance use disorders ) reported a high rate ( 44% ) of first contact with a nonpsychiatrist physician ( 11 ) . around 43% of the sample ( constituting the largest subset ) had a diagnosis of somatoform disorder explaining this help - seeking pattern . the authors argued that the difference in psychiatric diagnoses across these studies and the earlier studies from the country could explain the difference in the preferred first point of contact in help seeking pathway . hence , it is important to study pathway to care separately for individuals diagnosed with different psychiatric disorders including substance use disorders . another common observation across previous indian studies has been a high rate of help seeking from faith healers and religious healers . ( 9 ) also observed that there was a very high rate of help seeking from faith healers , traditional medicine practitioners and quacks for mental disorders other than substance use disorders . however , as mentioned earlier , these studies did not include patients with substance use disorders . direct help seeking from faith healer in the current study was low at five percent . interestingly , a similar low rate of 11% among patients with substance use disorders ( as compared to 19% for other psychiatric disorders ) was observed at the indian site of the study by hashimoto et al . ( 12 ) this observation also lends support to possibility of different pathways to care among patients with different psychiatric disorder including substance use disorders . only a small proportion of subjects ( 5% ) visited a practitioner of alternate system of medicine in the current study . this is comparable to the low rates observed in the earlier studies ( 9 , 10 ) . it seems that most of the patients with psychiatric disorders ( including substance use disorders ) do not seek treatment from alternate systems of medicine in these regions of the country . this observation has important policy implication as over the past few years there has been a growing emphasis on promotion of alternate systems of medicine across the country . ( 5 ) could be explained by the vast differences in the health care system of india and england . it is possible that the treatment provided by nonspecialists for substance use disorders in india may have been perceived as unattractive or ineffective by patients ; or that nonspecialists might prefer treating other disorders rather than substance use disorders . for instance , in case of psychotic disorders , the various socio - cultural beliefs regarding its causation make consulting a faith healer an obvious choice for a large number of people but the same is not true for substance use disorders . yet another possibility could be that there may have been underreporting of prior help seeking attempts in this population . another important finding of the current study was that the only significant difference between patients visiting tertiary care center directly and those visiting indirectly was the distance from the center . all other parameters including the age at onset and duration of substance use ( and therefore possibly the severity ) were not significantly different . it is likely that the utilization of specialized services is likely to be high if such services are made available closer to the place of stay . the fact that the mean travel duration even for the first contact was about 1.55 hours reflects limited availability and poor accessibility of treatment services for substance use disorders . although developing more centers for treatment of substance use disorders ( and thereby decreasing distance to the center ) seems like a logical option , building of such stand - alone services may not be cost effective . therefore , integration of substance use disorder treatment to primary health care services seems to be a better option . effectiveness and feasibility of community - based service delivery for substance use disorder has been documented in the indian setting previously ( 14 - 16 ) . family , friends and neighbours suggested referral in an overwhelming majority of cases , far outnumbering those by doctors or patients themselves . however , the low number of referrals by doctors probably reflects a poor referral mechanism in our health system . a related implication of this observation is an underutilization of primary and secondary care centers and consequent overburdening of tertiary care centers . in the wake of these findings , one needs to revisit the validity of the goldberg - huxley model for indian settings . as has been seen , such systematic referral system is not functional in india , at least for alcohol use disorders . the current study , besides being the first of its kind to be conducted in india , also replicates and confirms some of the findings from western studies in indian setting . more importantly , it also questions some aspects that had been widely regarded to be true in india and demonstrated in western studies . therefore , the current study also makes a larger point by reminding us of the need and importance of systematic data and also that the western data can not be directly applied to indian settings in all cases . notwithstanding the stated need for future studies , it provides an evidence - based platform for addressing the lacunae in our health care delivery system . the study reported findings from a single site that included a small sample of only male subjects . there is a need to replicate findings at other sites , with larger samples as well as to study female subjects before the results could be generalized . future research should also aim at following up these subjects as well as to determine barriers to help seeking which would be of immense help in planning effective mental health interventions . pathways to care for patients diagnosed with alcohol use disorders represent a crucial link in the overall scheme of health care delivery for these disorders . in india there is a long time lag between the onset of alcohol use related problems and the first help seeking attempt , even if it was from a nonspecialist . however , of those who do decide to seek help , the proportion of those obtaining specialist help may be higher than believed . referral by the health service providers is low and patients are mostly referred by family , friends and neighbours . distance from treatment center is a crucial factor in treatment seeking and integration of substance use disorder treatment services into primary health care services will go a long way in improving help seeking patterns . pathways to care for patients diagnosed with alcohol use disorders represent a crucial link in the overall scheme of health care delivery for these disorders . in india there is a long time lag between the onset of alcohol use related problems and the first help seeking attempt , even if it was from a nonspecialist . the patients often have to travel long distances to avail treatment . however , of those who do decide to seek help , the proportion of those obtaining specialist help may be higher than believed . referral by the health service providers is low and patients are mostly referred by family , friends and neighbours . distance from treatment center is a crucial factor in treatment seeking and integration of substance use disorder treatment services into primary health care services will go a long way in improving help seeking patterns .

backgroundno study from india has examined pathways to care in alcohol using population systematically.objectivesthe present study aimed to understand the pathways to care among alcohol - dependent individuals seeking help at a tertiary care center.patients and methodsit was a cross - sectional , observational study . a total of 58 subjects diagnosed with alcohol- dependence syndrome as per dsm - iv - tr were included in the study . pathways to care were assessed using the world health organization encounter form.resultsfor 56.9% of the subjects , first point of contact was with a tertiary care addiction psychiatrist . traditional healers were consulted by about 5.2% of the patients seeking help for the first time . the mean duration of main problems due to alcohol use was 5.82 4.95 years . the first contact tended to be at place nearer to the patient s residence while further contacts tended to be farther away . family , friends and neighbours together constituted the single largest group suggesting patients to seek care.conclusionsthere is a long time lag between the onset of alcohol use related problems and the first help seeking attempt . of those who do decide to seek help , the proportion of those obtaining specialist help is higher than commonly believed .

You are an expert at summarizing long articles. Proceed to summarize the following text: complex coronary interventions in patients with tight and severely calcified coronary stenoses and chronic total occlusions ( ctos ) are frequent in the all - comers population from the daily clinical practice.1 in such patients , dedicated guide wires , over - the - wire ( otw ) balloons , and microcatheters are often needed to treat these difficult lesions,2 but these devices are more difficult to use and more expensive . thus , the availability of workhorse rapid - exchange balloons with excellent crossing profiles , great pushability , and reduced costs can simplify the treatment of complex lesions , reducing the need for less user - friendly and more expensive equipment . mozec cto ( meril life sciences pvt . ltd . ) is a novel ptca semicompliant rapid - exchange balloon dilatation catheter manufactured with specific features to facilitate complex coronary interventions . its soft and laser - bonded distal tip of 5 mm with an entry profile of 0.016 for the 1.25 mm and 1.50 mm measures favor the deep engagement in the tight lesions or the cto microchannels with a smooth atraumatic lesion entry . moreover , a novel novalon balloon material ensures overall low wrapping profile and the short abrupt balloon shoulder design allows for crossing profiles as low as 0.022 . distal shaft coating of meriglide , a biocompatible , hydrophilic , lubricious coating of the distal balloon base up to the rapid - exchange port , is another feature that can improve trackability of the device across long , tortuous , and calcified lesions . it is less than 4 m thick and is nonthrombogenic , as it resists to fibrin adsorption and platelet adhesion . this is important to reduce thrombus formation during pci , which is strongly correlated with postprocedural neointimal proliferation and subsequent restenosis.3 the seamless single - tube transition to the hypotube improves pushability allowing for superior force transmission without any loss during navigation . these characteristics make the device virtually competitive , in terms of penetration power , crossing profile , and pushability , with the best available microcatheters and otw balloons . mozec cto ( meril life sciences pvt . ltd . ) is a novel ptca semicompliant rapid - exchange balloon dilatation catheter manufactured with specific features to facilitate complex coronary interventions . its soft and laser - bonded distal tip of 5 mm with an entry profile of 0.016 for the 1.25 mm and 1.50 mm measures favor the deep engagement in the tight lesions or the cto microchannels with a smooth atraumatic lesion entry . moreover , a novel novalon balloon material ensures overall low wrapping profile and the short abrupt balloon shoulder design allows for crossing profiles as low as 0.022 . distal shaft coating of meriglide , a biocompatible , hydrophilic , lubricious coating of the distal balloon base up to the rapid - exchange port , is another feature that can improve trackability of the device across long , tortuous , and calcified lesions . it is less than 4 m thick and is nonthrombogenic , as it resists to fibrin adsorption and platelet adhesion . this is important to reduce thrombus formation during pci , which is strongly correlated with postprocedural neointimal proliferation and subsequent restenosis.3 the seamless single - tube transition to the hypotube improves pushability allowing for superior force transmission without any loss during navigation . these characteristics make the device virtually competitive , in terms of penetration power , crossing profile , and pushability , with the best available microcatheters and otw balloons . the mozec cto balloon in complex coronary interventions ( mozart ) study is a prospective , nonrandomized , single - arm registry aimed to evaluate the performance of the novel mozec cto balloon dilatation catheter for the treatment of complex coronary lesions in an all - comers stable coronary artery disease ( cad ) patient population . the objective of the registry was to test the safety and the efficacy of this new device in treating stable patients with complex coronary anatomy at a single tertiary level clinical institution ( maggiore della carit hospital , novara , italy ) . key inclusion criteria were : patients > 18 years of age ; symptoms of stable angina or silent ischemia with a positive functional test for ischemia and indication to coronary angiography;presence of a type c coronary lesion , according to the acc / aha coronary stenosis classification , with one of the following characteristics : ( a ) severe calcium with narrowing > 80% and length > 15 mm at visual estimate ; ( b ) bifurcation lesion with planned two - stent treatment ( culotte or mini - crush technique ) and the need for recrossing packed struts encroaching side branch ostia ; and ( c ) cto according to the euro cto club definition1 with planned anterograde approach ; andagreement to participate in the study and in personal data management . symptoms of stable angina or silent ischemia with a positive functional test for ischemia and indication to coronary angiography ; presence of a type c coronary lesion , according to the acc / aha coronary stenosis classification , with one of the following characteristics : ( a ) severe calcium with narrowing > 80% and length > 15 mm at visual estimate ; ( b ) bifurcation lesion with planned two - stent treatment ( culotte or mini - crush technique ) and the need for recrossing packed struts encroaching side branch ostia ; and ( c ) cto according to the euro cto club definition1 with planned anterograde approach ; and agreement to participate in the study and in personal data management . pci procedure was performed according to current standard guidelines.4 pretreatment of the target lesion with any device other than the mozec cto balloon was not allowed . for this study , the mozec cto device was available in the following range of sizes : 9 mm and 15 mm in length for diameters of 1.25 mm and 1.5 mm . the device was considered successful if it was possible to track the balloon to the end of the stenosis or the occlusion . after an unsuccessful attempt to cross the lesion with the study device , angioplasty was performed with other devices according to the operator preference . a routine 12-lead electrocardiogram was obtained before procedure , immediately postprocedure , and 24 hours later . blood sample laboratory analysis included high sensitivity cardiac troponin i before procedure ( < 24 hours ) , 24 hours after procedure , and then daily thereafter until hospital discharge . during the procedure , intravenous heparin ( 70100 units / kg ) was administered after sheath insertion to maintain an activated clotting time > 250 seconds ( or > 200 seconds if glycoprotein iib / iiia inhibitors were used , at the operator s discretion ) . regarding dapt , aspirin 100325 mg was given > 24 hours prior to procedure if not already taken ; for thienopyridine ( clopidogrel ) , a loading dose of 600 mg at least two hours prior to procedure , if not already taken ( 75 mg daily ) . after the procedure , all the patients received aspirin ( 100325 mg ) daily indefinitely , and clopidogrel 75 mg was prescribed daily for at least one month in case of bare metal stent deployment and up to one year in case of drug eluting stent deployment . as a routine for our center , standard image acquisition of the treated stenosis was performed using two or more angiographic projections , intracoronary nitroglycerine to provide maximum coronary dilation , and repetition of identical angiographic projections of the lesion at baseline and final angiography . angiograms were analyzed on site by two independent reviewers ( al and ggs ) . using the contrast - filled injection catheter as the calibration source , quantitative angiographic analysis was performed using a validated automated edge detection algorithm ( qangio xa medis).5 selected images for analysis were identified using angiographic projections that demonstrated the stenosis in an unforeshortened view and minimized the degree of vessel overlap . the length , minimal lumen diameter , and the percentage of diameter stenosis at the site of intervention were evaluated for each lesion before pci . the primary safety endpoint was the rate of balloon bursting after inflation at an inflation pressure higher than the rated burst pressure ( rbp ) . the primary efficacy endpoint was the rate of successfully crossing the target lesion allowing the first lesion dilation . baseline , procedural , and clinical fu data were collected by dedicated clinical research nurse ; data monitoring was performed physically at the participating clinical site . data were presented as mean values standard deviation ( sd ) ; when non - normal distribution was evidenced , data were presented as median values with interquartile range ( 25% , 75% ) . the study was approved by the local ethical committee , and each patient signed a written informed consent to be included in the study . the mozec cto balloon in complex coronary interventions ( mozart ) study is a prospective , nonrandomized , single - arm registry aimed to evaluate the performance of the novel mozec cto balloon dilatation catheter for the treatment of complex coronary lesions in an all - comers stable coronary artery disease ( cad ) patient population . the objective of the registry was to test the safety and the efficacy of this new device in treating stable patients with complex coronary anatomy at a single tertiary level clinical institution ( maggiore della carit hospital , novara , italy ) . key inclusion criteria were : patients > 18 years of age ; symptoms of stable angina or silent ischemia with a positive functional test for ischemia and indication to coronary angiography;presence of a type c coronary lesion , according to the acc / aha coronary stenosis classification , with one of the following characteristics : ( a ) severe calcium with narrowing > 80% and length > 15 mm at visual estimate ; ( b ) bifurcation lesion with planned two - stent treatment ( culotte or mini - crush technique ) and the need for recrossing packed struts encroaching side branch ostia ; and ( c ) cto according to the euro cto club definition1 with planned anterograde approach ; andagreement to participate in the study and in personal data management . symptoms of stable angina or silent ischemia with a positive functional test for ischemia and indication to coronary angiography ; presence of a type c coronary lesion , according to the acc / aha coronary stenosis classification , with one of the following characteristics : ( a ) severe calcium with narrowing > 80% and length > 15 mm at visual estimate ; ( b ) bifurcation lesion with planned two - stent treatment ( culotte or mini - crush technique ) and the need for recrossing packed struts encroaching side branch ostia ; and ( c ) cto according to the euro cto club definition1 with planned anterograde approach ; and agreement to participate in the study and in personal data management . pci procedure was performed according to current standard guidelines.4 pretreatment of the target lesion with any device other than the mozec cto balloon was not allowed . for this study , the mozec cto device was available in the following range of sizes : 9 mm and 15 mm in length for diameters of 1.25 mm and 1.5 mm . the device was considered successful if it was possible to track the balloon to the end of the stenosis or the occlusion . after an unsuccessful attempt to cross the lesion with the study device , a routine 12-lead electrocardiogram was obtained before procedure , immediately postprocedure , and 24 hours later . blood sample laboratory analysis included high sensitivity cardiac troponin i before procedure ( < 24 hours ) , 24 hours after procedure , and then daily thereafter until hospital discharge . during the procedure , intravenous heparin ( 70100 units / kg ) was administered after sheath insertion to maintain an activated clotting time > 250 seconds ( or > 200 seconds if glycoprotein iib / iiia inhibitors were used , at the operator s discretion ) . regarding dapt , aspirin 100325 mg was given > 24 hours prior to procedure if not already taken ; for thienopyridine ( clopidogrel ) , a loading dose of 600 mg at least two hours prior to procedure , if not already taken ( 75 mg daily ) . after the procedure , all the patients received aspirin ( 100325 mg ) daily indefinitely , and clopidogrel 75 mg was prescribed daily for at least one month in case of bare metal stent deployment and up to one year in case of drug eluting stent deployment . as a routine for our center , standard image acquisition of the treated stenosis was performed using two or more angiographic projections , intracoronary nitroglycerine to provide maximum coronary dilation , and repetition of identical angiographic projections of the lesion at baseline and final angiography . angiograms were analyzed on site by two independent reviewers ( al and ggs ) . using the contrast - filled injection catheter as the calibration source , quantitative angiographic analysis was performed using a validated automated edge detection algorithm ( qangio xa medis).5 selected images for analysis were identified using angiographic projections that demonstrated the stenosis in an unforeshortened view and minimized the degree of vessel overlap . the length , minimal lumen diameter , and the percentage of diameter stenosis at the site of intervention were evaluated for each lesion before pci . the primary safety endpoint was the rate of balloon bursting after inflation at an inflation pressure higher than the rated burst pressure ( rbp ) . the primary efficacy endpoint was the rate of successfully crossing the target lesion allowing the first lesion dilation . baseline , procedural , and clinical fu data were collected by dedicated clinical research nurse ; data monitoring was performed physically at the participating clinical site . data were presented as mean values standard deviation ( sd ) ; when non - normal distribution was evidenced , data were presented as median values with interquartile range ( 25% , 75% ) . the study was approved by the local ethical committee , and each patient signed a written informed consent to be included in the study . a total of 41 consecutive patients were enrolled between november 2014 and march 2015 , 11 with a cto with planned anterograde approach , 15 with a tight and severely calcified lesion , and 15 with a 1.1.1 medina classification bifurcation intended to treat with a two - stent strategy . clinical features are summarized in table 1 , angiographic and interventional characteristics in table 2 , specific clinical and angiographic features of cto lesions in table 3 . mean age was 69.8 11.2 years , 26.8% were diabetics ( noninsulin dependent only ) , and 17.1% had previous mi or pci intervention in the six months before ( table 1 ) . right coronary artery was the most prevalent target vessel ( 48.8% ) , and all the lesions were type c according to the aha / acc stenosis classification . radial access was used in 68.3% of cases ; all the lesions were predilated , and the first dilation was attempted with a 1.25 or 1.5 mozec balloon . the mozec balloon was highly effective in crossing such very complex lesions , with an overall success rate of 95.1% ( 39/41 lesions ) and similar high success rates across different lesion types ( table 2 ) . balloon rupture was rare in the consideration of complexity of the lesions , with an overall burst rate of 7.3% ( 3/41 ) at a mean inflation pressure of 16.5 0.8 atm ( table 2 ) . in case of unsuccessful mozec balloon advance , crossing of the lesion was accomplished with other devices according to the choice and the experience of the interventionalists . only in one case ( a cto patient ) , it was not possible to cross the lesion regardless the device used . in four cases ( 9.8% ) , the procedure was completed with the aid of a guideliner catheter , and in two cases ( 4.9% ) , rotational atherectomy was employed . no patient of the study population died during the hospital stay and/or suffered from stent thrombosis . seven patients developed a small periprocedural myocardial infarction , according to the third universal definition,6 without developing new q waves . the present study demonstrates the feasibility and safety of crossing and dilating tight and complex coronary lesions with the novel mozec cto balloon , a balloon catheter engineered specifically to tackle ctos and other complex coronary interventions . ctos represent about 10% of lesions usually encountered in an all - comers cath lab population1 and other complex lesions like severely calcified stenosis are also very frequent , especially in the presence of comorbidities like diabetes , renal impairment , and peripheral vascular disease.79 moreover , these kinds of lesions are common in the elderly10 and are expected to become even more frequent with aging of patient populations . another clinical subset of patients who are difficult to treat with workhorse apparels and usually benefit from dedicated devices are those with coronary bifurcation lesions treated with a two - stent strategy . in these patients , encroachment of heavily packed stent struts can make extremely difficult the recrossing of the side branch ostium with even low profile balloon catheters.11 usually ctos require dedicated devices like otw balloon catheters or microcatheters,1,2 but this expensive technology is also used in the daily practice to approach complex cases of calcified or bifurcation coronary lesions . mozec cto is a novel ptca semicompliant balloon catheter engineered with specific features to facilitate complex coronary interventions . it has a distal tip of 5 mm with an entry profile of 0.016 favoring deep engagement in the tight lesions or the cto microchannels . moreover , the novel novalon hydrophilic balloon material ensures the overall low wrapping profile with crossing profiles as low as 0.022 . finally , distal shaft hydrophilic coating with meriglide polymer and the seamless single - tube transition to the hypotube improve pushability and trackability of the device across long , tortuous , and calcified lesions . these characteristics might make the device virtually competitive , in terms of penetration power , crossing profiles , and pushability , with the best available microcatheters and otw balloons . our pilot study demonstrated the feasibility of using the mozec cto balloon as a workhorse first choice device to cross and begin dilation of complex coronary lesions . to this end , we selected complex cases from an all - comers population of a tertiary center catheterization laboratory . in particular , three subsets of interest were identified : ctos , tight and calcified stenoses , and bifurcations treated with a two - stent strategy . the mozec cto balloon showed a fair performance in each of these challenging situations , with a high rate of success in engaging and crossing the target lesions . the mozec cto balloon success rates , all above 90% , are substantially similar to those reported for more costly cto dedicated catheters . obata et al reported anterograde cto treatment with a success rate of 62.5% with the finecross microcatheter12 and with a success rate of 85.3% with the corsair septal dilatators device.12,13 the even more specialized and costly tornus dilator catheter showed similar procedural success rates in antegrade ctos.1416 thus , the availability of a rapid - exchange balloon with excellent crossing profiles , great pushability , and low cost ( table 4 ) has the potential for simplifying the treatment of complex lesions reducing the need for less user - friendly and more e xpensive equipment . in fact , even when inflated with pressures far exceeding the rbp , balloon disruption was rare . this is an important safety point , because the adverse consequences of balloon rupture during coronary angioplasty are well known.17 in fact , balloon ruptures have been linked with potentially life - threatening complications like vagal baroreflexes , perforations , dissections , and embolizations leading to ischemia and hemodynamic instability.18,19 moreover , coronary ruptures might affect negatively long - term prognosis of cad patients treated with pci.20,21 however , in our series , we observed a few balloon ruptures that were not associated with perforation , temporary or permanent no - reflow , or type 4a mi . no substantial danger may origin from the use of the device as the first choice , as if the device fails to pass through the lesion it can be easily removed like other minirail devices and substituted by other microcatheters otw balloon catheters . first of all , the present study is a prospective registry , without a randomized comparison with other similar devices ; thus no conclusion about the advantage of using this balloon in complex lesions in comparison to other existing devices can be drawn from this study . moreover , in the current analysis , the relatively low number of patients precludes any definite conclusions regarding the efficacy and the safety beyond the perspective of a preliminary single - center feasibility study . however , our success rate for mozec cto balloon trended to be higher in the severely calcified stenoses and in bifurcation lesions than in ctos . this observation reflects the peculiar anatomy of cto lesions , which still leads to less favorable results even in the era of retrograde approach.1 on the other hand , we observed a few type 4a mi occurring in severely calcified lesion and in bifurcation lesions , probably related to incomplete stent expansion and apposition because of diffuse calcium deposition and unfavorable bifurcation angles , in fact in none of these cases . the novel mozec cto balloon demonstrated a good performance in approaching complex coronary lesions in stable all - comers cad patients , with a high procedural success . moreover , there were no safety concerns in this preliminary evaluation , as burst rate was rare even at pressures well further the rbp .

backgroundmozec cto is a novel semicompliant rapid - exchange ptca balloon catheter with specific features dedicated to treat complex coronary lesions like chronic total occlusions ( ctos ) . however , no data have been reported about the performance of this device in an all - comers population with complex coronary lesions.methodswe evaluated the safety and success rate of mozec cto balloon in 41 consecutive patients with chronic stable angina and complex coronary lesions ( 15 severe calcified coronary stenoses , 15 bifurcation lesions with planned two - stent intervention , and 11 ctos ) . safety was assessed reporting the balloon burst rate after inflation exceeding the rated burst pressure ( rbp ) according to the manufacturer s reference table . success was defined as the possibility to advance the device further the target lesion.resultsthe mozec cto balloon showed an excellent performance with a 93.3% success in crossing tight and severely calcified lesions ( 14/15 pts ) , a 93.3% success in engaging jailed side branches after stent deployment across bifurcations ( 14/15 pts ) , and a 90.9% success in crossing cto lesions ( 10/11 pts ) . the burst rate at rbp of the mozec cto balloon was 6.7% ( 1/15 balloons ) in the tight and severely calcified lesions , 6.7% ( 1/15 balloons ) when dilating jailed vessels , and 9.1% ( 1/11 balloons ) in ctos.conclusionsthe novel mozec cto balloon dilatation catheter showed promising results when employed to treat complex lesions in an all - comers population . further studies should clarify if this kind of balloon might reduce the need of more costly devices like over - the - wire balloons and microcatheters for complex lesions treatment .

You are an expert at summarizing long articles. Proceed to summarize the following text: a 47-year - old man was admitted to hospital due to a palpable mass in the left flank . his laboratory data were normal , but plain radiography of the abdomen showed that in the left upper quadrant , a huge mass with exuberant calcifications was present ( fig . abdominal ct revealed that the peritoneum contained a large heterogeneous soft tissue mass composed of several nodules with different components . 1b ) , whereas in the lower portion there were several non - calcified soft tissue nodules with strong peripheral enhancement and a central necrotic area ( fig . the hu of the low - density area was 42 , and this was attributed to the presence of non - fatty tissue . the mass had invaded the renal capsule , pancreas , and adrenal gland ( though not the left - side colon and spleen , which strongly adhered to it ) , and surgical resection was thus required , together with distal pancreatectomy , splenectomy , left nephrectomy and left hemicolectomy . the resected mass measured about 18 cm in its longest diameter , and was composed of several soft tissue nodules . in its upper portion , 1d ) , and the soft tissue nodules in the lower part corresponded to leiomyosarcoma ( fig . fourteen months after surgery , follow - up abdominal ct revealed a recurrent retroperitoneal mass in the left paraaortic area at the level of the inferior pole of the kidney , without evidence of calcification . the mass was surgically excised , and a resected specimen contained a mainly fibrosarcomatous component . during the subsequent 15-month period , malignant mesenchymoma , first described by stout in 1948 , is a malignant soft tissue tumor consisting of two or more distinct mesenchymal components , either or any of which might in itself be viewed as a primary malignant neoplasm ( 1 ) . nowadays strict diagnostic criteria for malignant mesenchymoma require that each component is sufficiently differentiated histogenetically ( 6 , 7 ) . for this purpose , fibrosarcoma , hemangiopericytoma , malignant fibrous histiocytoma , myxosarcoma , and malignant peripheral nerve sheath tumor are not considered as separate malignant tumor components ; those that normally fall into this category are liposarcoma , leiomyosarcoma , rhabdomyosarcoma , osteosarcoma , chondrosarcoma , and angiosarcoma ( 6 ) . the previously reported radiologic features of malignant mesenchymoma vary ( 2 - 4 ) . although none were common to all the cases they described , suzuki et al . ( 5 ) suggested that the typical findings of malignant mesenchymoma were large tumor size , a sharp margin , heterogeneous make - up , and massive calcification . the tumor in our case was also a huge heterogeneous mass with massive intratumorous calcification , but a feature different from those previously noted was also present . earlier reports described a large mass with various intermingled components , whereas in our case the components were discrete . the massive calcification we found corresponded to an osteosarcomatous component , while the non - calcified enhancing nodules were , respectively , consistent with leiomyosarcoma , liposarcoma , and fibrosarcoma . a well - differentiated liposarcomatous component can have a fatty component ( 5 ) , though in our case none was apparent at ct . the composition of a malignant mesenchymoma - whether or not it contains calcification or ossification , a fatty component , or necrotic soft tissue - seems to determine its radiological features . a malignant mesenchymoma is generally considered to be highly malignant , usually with a poor prognosis ( 7 ) , though the findings of this same study , based on clinicopatholgic analysis and long - term follow - up , suggest a more favorable prognosis . in our case , the clinical course was rather indolent ; although the mass recurred locally 14 months after initial surgery , there was no evidence of metastasis during the 29 months following initial presentation , and this seems to reaffirm a more favorable prognosis . for the proper diagnosis of malignant mesenchyoma , the radiologist must be aware of its nature ; if any of the sarcomatous components are overlooked , it might be diagnosed as single - type or predominant sarcoma with divergent differentiation . in summary , depending on its composition , malignant mesenchymoma may demonstrate various radiologic features . if a large retroperitoneal soft tissue mass is present , together with several different sarcomatous features such as prominent calcification / ossification or a fatty component , the differential diagnosis should include malignant mesenchymoma .

malignant mesenchymoma is an interesting but very rare tumor in which malignant differentiation has occurred twice or more . we report a case of retroperitoneal malignant mesenchymoma consisting of osteosarcoma , leiomyosarcoma , liposarcoma and fibrosarcoma . abdominal ct showed a large retroperitoneal mass with two separate and distinct parts , namely an area of prominent calcification and one of clearly enhancing solid components . the mass contained histologically distinct tumorous components with no histologic admixure at the interfaces . the densely calcified nodule corresponded to osteosarcoma , and the non - calcified clearly enhancing nodules to leiomyosarcoma , liposarcoma and fibrosarcoma .

You are an expert at summarizing long articles. Proceed to summarize the following text: prenatal syphilis is defined as syphilis transmitted by the infected mother to the fetus in utero . the clinical manifestations of early prenatal syphilis are a consequence of active infection with t. pallidum and the resultant inflammatory response induced in various organs and tissues . this case report is presented to recognize importance of maternal serological screening and treatment during early pregnancy and repeat screening during the final trimester or at delivery . a 2-month old female child presented with thin , watery nasal discharge along with crying on holding hands and feet since 1 month , scaling of skin over both soles and moist perianal erosions since 15 days . there was no history of swelling over wrist joint and ankle joint , fever , bullous lesions , convulsions or oral lesions . her mother was s.rpr positive and had not received any treatment for syphilis during antenatal period or at delivery . mother was clinically asymptomatic with bilateral , non tender , firm , discrete inguinal lymphadenopathy . father was a garage worker , giving history of extramarital unpaid , unprotected exposure before one and half years . cutaneous examination showed moist perianal erosions and papulosquamous lesions over both soles , dactylitis over both hands and bilateral , firm , nontender , discrete inguinal lymphadenopathy . dactylitis with papulosquamous lesions over both soles moist , erosions around perianal region laboratory examination revealed hemoglobin 8.7 gm% , total leukocyte count 17,100/mm , platelet count 3,62,000/mmand erythrocyte sedimentation rate 35 at 1 hour . radiograph of both upper limbs and lower limbs showed early periosteal changes in lower end of humerus and lower end of tibia . mucocutaneous lesions as well as periosteitis responded to above therapy and infant 's s.rpr titre dropped to 1:32 10 days post - treatment [ figure 3 ] . syphilis connata ) follows transplacental transmission of t. pallidum to fetus in utero . despite the popularity of the term congenital syphilis , pre - natal syphilis better indicates that the signs and symptoms may develop before or after delivery rather than always being present at birth . it is divided into two subtypes : early prenatal syphilis ( syphilis connata praecox ) in which lesions occur during the first two years of life ( analogous to secondary stage of acquired syphilis ) and late pre - natal syphilis(syphilis connata tarda ) where lesions occur after 2 years of age ( can be further divided into disease with active pathologic processes and stigmata ) . a case of congenital syphilis can be defined as : a confirmed case if an infant in whom t. pallidum is identified in lesions , placenta , umbilical cord or autopsy tissue.it is called a presumptive case in any infant whose mother was untreated or treated with antibiotics other than penicillin before delivery regardless of any finding in infant or any infant or child with reactive treponemal test for syphilis and any one of the following ; evidence of congenital syphilis on physical examination or x - ray of long bones , presence in cerebrospinal fluid of lymphocytosis with elevated protein(without other causes ) , reactive csf vdrl test or infant rapid plasma regain four fold higher than mother both drawn at birth or reactive immunoglobulin - m treponemal antibody test in serum.syphilitic stillbirth a fetal death in which the mother had untreated or inadequately treated syphilis at delivery of the fetus after 20 week or a fetus weighing > 500 gm . a confirmed case if an infant in whom t. pallidum is identified in lesions , placenta , umbilical cord or autopsy tissue . it is called a presumptive case in any infant whose mother was untreated or treated with antibiotics other than penicillin before delivery regardless of any finding in infant or any infant or child with reactive treponemal test for syphilis and any one of the following ; evidence of congenital syphilis on physical examination or x - ray of long bones , presence in cerebrospinal fluid of lymphocytosis with elevated protein(without other causes ) , reactive csf vdrl test or infant rapid plasma regain four fold higher than mother both drawn at birth or reactive immunoglobulin - m treponemal antibody test in serum . syphilitic stillbirth a fetal death in which the mother had untreated or inadequately treated syphilis at delivery of the fetus after 20 week or a fetus weighing > 500 gm . clinically , early prenatal syphilis manifests in descending order of frequency , as low birth - weight , hepatosplenomegaly , anemia , jaundice , thrombocytopenia , skin lesions , respiratory distress , rhinitis , and pseudoparalysis . rhinitis ( snuffles ) has been reported in as many as 73% of infants . it usually develops in the second to third week of life and may be the earliest clinical sign . manifestations of late prenatal syphilis include asymptomatic neurosyphilis ( 30 - 50% ) and interstitial keratitis ( 8.8% ) . bilateral 8nerve disease with vertigo , tinnitus , and deafness has been reported in 3 per cent to 38 per cent of patients , usually adolescents . bone manifestations such as arthritic perisynovitis , chondroosteoarthritis , epiphysitis , and periostitis , may also occur in late prenatal infection . dental abnormalities caused by treponemal invasion of the tooth buds include pathognomonic hutchinson teeth and mulberry molars. treatment of the prenatal syphilis includes aqueous crystalline penicillin g 100,000 - 150,000 units / kg / day administered as 50,000 units / kg / dose iv every 12 hours during the first 7 days of life and every 8 hours thereafter for a total of 10 days or procaine penicillin g 50,000 units / kg / dose i m in a single daily dose for 10 days . if more than one day of therapy is missed , the entire course should be restarted . the use of agents other than penicillin requires close serologic follow up to assess adequacy of therapy . in all other situations , the maternal history of infection with t. pallidum and treatment for syphilis infants who have reactive serologic tests for syphilis should have serial quantitative nontreponemal tests performed until nonreactivity is documented or the titer has decreased four - fold . follow up should be done at 2 , 4 , 6 , 12 , and 15 months . if the nontreponemal serologic titers remain stable or increase after 6 - 12 months the child should be reevaluated for syphilis , including csf examination and treated with parenteral penicillin g for 10 days .

syphilis in pregnancy still remains a challenge despite the availability of adequate diagnostic tests for serological screening and penicillin therapy . we report a case of 2 month old female infant who presented with runny nose , papulosquamous lesions over both palms and soles and perianal erosions since 1 month after birth . cutaneous examination revealed moist eroded areas in the perianal region and fine scaly lesions over palms and soles . radiograph of both upper limbs and limbs revealed early periosteal changes in lower end of humerus and lower end of tibia . diagnosis of early pre - natal syphilis was confirmed by child 's serum rapid plasma reagin antibody test [ s.rpr ] being positive with 1:64 dilution while that of mother was 1:8 .

You are an expert at summarizing long articles. Proceed to summarize the following text: chronic renal failure ( crf ) in pregnancy is relatively rare with an incidence of 0.03 - 0.12% of all pregnancies . it is associated with higher maternal and fetal complications such as pre - eclampsia , anemia , chronic hypertension and prematurity . this report describes the anesthetic management of a parturient with crf secondary to adult polycystic kidney disease ( adpkd ) who persistently refused dialysis . a 37-year - old , 34 week parturient ( weight : 60 kg ; height : 165 cm ) with singleton pregnancy was scheduled for elective cesarean delivery . she had adpkd for 15 years duration and was on oral nifedipine 20 mg daily for hypertension . she had undergone uneventful cesarean delivery under general anesthesia 10 years ago . over the past five years she was on oral calcitrol , calcium carbonate , ferrous fumarate , oral nifedipine 20 mg daily and on a low protein diet . a multidisciplinary case conference was held , which included an obstetrician , anesthesiologist , neonatologist and nephrologist to develop a management plan . at 32 weeks of gestation , she was hospitalized to monitor her blood pressure , renal function and fetal wellbeing . she persistently refused dialysis . at 34 weeks of gestation , she noted discomfort while breathing . physical examination revealed mild pallor with a respiratory rate of 20 breaths / min , pulse of 82/min and a blood pressure of 138/74 mmhg . abdominal ultrasonogram revealed bilateral cortical and medullary cysts consistent with polycystic kidney disease , singleton intrauterine pregnancy and severe polyhydramnios . preoperative laboratory results in the operating room , baseline monitors including pulse oximetry , non - invasive blood pressure , and electrocardiogram were instituted . using aseptic technique , adequate surgical blockade was achieved with a total of 15 ml of 2% lidocaine with epinephrine 5 mcg / ml , administered in fractionated doses of 3 - 5 ml each given over 15 minutes . fentanyl 100 mcg was also administered through epidural route after the local anesthetic top up . the parturient 's blood pressure was monitored every minute till the delivery of fetus , then every five min till the end of surgery as per our institutional practice . the drop in blood pressure with epidural anesthesia was managed with careful titration of intravenous crystalloids and aliquots of phenylephrine . a live neonate was delivered weighing 1800 g with apgar scores of seven and eight at 1 and 5 min , respectively . she had an uneventful stay , resumed her routine medications and was discharged on 5 postoperative day . she was advised regular follow up and dialysis with possible renal transplantation in the postoperative period . crf may complicate type i diabetes , hypertension , glomerulonephritis , and polycystic kidney disease . parturients with preexisting adpkd have higher incidence of maternal complications such as hypertension , edema and preeclampsia when compared to non adpkd parturients ( 35 vs.19% , p < 0.001 ) with 3% of them progressing to renal failure . women have amenorrhea or anovulatory menstrual cycles when their baseline plasma creatinine concentration is above 265 mol / l and do not normally conceive . our patient was unusual that she not only conceived spontaneously despite her baseline creatinine of 490 mol / l and had an uneventful course throughout pregnancy without any clinical symptoms despite a continuous rise in creatinine levels . parturients with underlying crf may need dialysis prior to elective cesarean delivery , to optimize volume status and correct electrolyte disturbances . parturients with crf , with associated pre - eclampsia , have a worsened prognosis with a successful delivery rate of only 60% versus 92.9% ( p = 0.02 ) , an extremely premature delivery rate of 77.8% versus 3.3% ( p < 0.001 ) , and lower gestational age ( p < 0.001 ) , and birth weight ( p < 0.001 ) . surprisingly , despite elevated creatinine levels throughout her pregnancy and without any dialysis , our patient delivered a baby at 34 weeks of gestation . when parturients with underlying crf , present to elective surgery the goals of management should include : preservation of renal function , maintenance of fluid balance , avoidance of nephrotoxic drugs and avoidance of drugs that depend on renal elimination . care should also be taken to preserve blood flow to fetus and to avoid drugs that cross the placenta . inhalational anesthetic technique decreases renal blood flow by decreasing renal perfusion pressure which is further exaggerated by hypovolemia , painful surgical stimuli and positive pressure ventilation . coagulation abnormalities , peripheral neuropathy secondary to crf must be ruled out prior to administration of a regional anesthetic technique . epidural anesthesia is preferred over spinal anesthesia to achieve stable hemodynamics by titration of fluids and vasopressors . the administration of epidural anesthesia suppresses cortisol release and thereby attenuates catecholamine induced renal vasoconstriction . the use of epidural epinephrine at low doses ( 75 - 100 mcg ) , as used by us , has shown to have predominant beta adrenergic effect , thereby reducing mean arterial pressure . predominance of alpha receptors in capacitance vessels causes more venoconstriction when compared to arterial constriction in a dose - related manner when phenylephrine is administered . the net effect of phenylephrine with intermittent boluses at timely intervals results in an increase in blood pressure , cardiac output and thereby preserves renal blood flow parturients with renal diseases undergoing high - risk procedures often need invasive hemodynamic monitoring with arterial and central venous catheters . we successfully managed our patient with standard non - invasive monitors though our threshold to place invasive monitoring was low . to conclude , parturients with chronic renal disease often undergo dialysis prior to elective procedure . graded epidural anesthesia with non - invasive monitoring along with titrated fluid and vasopressor administration may be considered for the successful outcome when dialysis is not possible or refused by such parturients .

chronic renal failure is rare in pregnancy and often results in significant maternal and neonatal morbidity . when possible , preoperative dialysis is useful to optimize fluid and electrolyte balance . we describe the perioperative management of a parturient who persistently refused dialysis , had an uneventful cesarean delivery under graded epidural anesthesia .

You are an expert at summarizing long articles. Proceed to summarize the following text: chronic strongyloidiasis is a lifelong parasitic infection caused by the nematode strongyloides stercoralis , which has the unique ability , among all helminths , to silently establish a cycle of autoinfection in humans and can remain undetected for many decades . chronic strongyloidiasis is an endemic infection occurring in tropical regions which include africa , asia , and south america . however , in the united states , chronic strongyloidiasis is rare but more prevalent in immigrant populations from tropical regions . it is often misdiagnosed or diagnosed with significant delay . the diagnosis of chronic strongyloidiasis should always be considered in immigrants who present with persistent respiratory , cutaneous , or gastrointestinal complaints , regardless of the number of years they have spent away from tropical regions . in addition , immigrants from tropical regions should be treated empirically for possible chronic strongyloidiasis before they undergo immunosuppressive therapy , whether they are symptomatic or not . when the immune system is compromised , a patient with chronic strongyloidiasis may develop two life - threatening and highly mortal complications : disseminated strongyloidiasis and hyperinfection syndrome . a 53-year - old african man who emigrated from mali 25 years ago complained of skin nodules in the periumbilical area and left lower quadrant which were present for the past 5 years . he also presented with a maculopapular rash over the legs , intermittent abdominal pain , nausea , and diarrhea , alternating with constipation , which were all present for the past 14 years . during this time , the patient had seen many physicians without a definitive diagnosis and without effective treatment . the patient admitted to occasionally relying on herbal medicine sent from mali , without relief of his symptoms . the physical examination was positive for two 0.5 cm diameter subcutaneous nodules in the left lower quadrant and periumbilical area and one in the gluteal region , freely movable under the skin . the patient presented a picture of a 3 cm 14 cm longitudinal desquamative maculopapular rash in the midline of his back , as shown in figure 1 . this rash appeared 2 months prior to consultation and completely cleared on its own after 2 weeks . the diagnosis of chronic strongyloidiasis was made and the patient was started on ivermectin 200 g / kg / day for 2 days and repeated after 2 weeks . two months after initial treatment , the patient became asymptomatic and the skin was completely clear of any rash and nodule . eight months after the initial diagnosis , the patient remained asymptomatic and the skin was still clear of any rash and nodule . in this case , the patient presented with chronic symptoms , which included intermittent abdominal pain and diarrhea , alternating with constipation , maculopapular rash , and subcutaneous masses . patient symptoms had a characteristic pattern that led to looking for another diagnosis : symptoms occurred from different systems . when the symptoms manifested , they were limited in time ( transient rash , intermittent abdominal pain ) . these characteristics were better explained by a parasitic cycle : an infectious agent that affects the skin and gastrointestinal tract and elicits an inflammatory response during its passage ( causing symptoms limited in time ) . inflammation , because of a parasite cycle as the origin of symptoms , was more inclusive than inflammatory bowel diseases because it provided an explanation for the presence of masses : although they were freely mobile under the skin , they were not lipomas ; rather they were inflammatory masses around the parasite in subcutaneous tissues . strongyloides stercoralis , a parasite that infects the skin and the gastrointestinal tract , was more likely the cause . the review of the patient s remote immigration history was the key element that solidified the postulation by providing a possible explanation for the origin of s stercoralis : mali 25 years ago . the inflammatory origin of the subcutaneous masses was reinforced later when they were completely cleared after ivermectin treatment . chronic strongyloidiasis results from the unique ability of s stercoralis , among all helminths , to establish a cycle of autoinfection in humans that can be lifelong . people become infected through direct skin contact with soil contaminated with the infective filariform larvae . this parasite goes from the skin , into the then pass through the blood to the lungs climb the respiratory tract and and then are swallowed and go in the gi tract .. the high concentration of s stercoralis in the lymphatic system suggests that it uses this manner of circulation to reach the lungs . once swallowed , in the jejunum , the infective filariform becomes an adult worm that excretes eggs in the feces . when the eggs hatch internally , the rhabditiform larvae may be excreted in the feces or be transformed into the infective filariform larvae that may penetrate the walls of the gut or perianal skin and restart the cycle anew . it is often asymptomatic ; however , when symptomatic , symptoms involved include the skin ( recurrent maculopapular rash ) , the respiratory tract ( cough , wheezing , tracheal irritation ) , or the gastrointestinal tract ( abdominal pain , diarrhea ) . there is a delay in the diagnosis of chronic strongyloidiasis , an average of 5 years in the united states . then , the patient experienced gastrointestinal and cutaneous symptoms for 16 years , during which the different physicians he saw did not evaluate him for possible chronic strongyloidiasis . second is the ability of s stercoralis to infect a patient outside the united states and to remain undetected and asymptomatic for many years after the patient has moved to the united states . third is the high variability in the clinical presentation of infection when s stercoralis becomes symptomatic . as a result , the clinician may not have the presence of mind to correlate the patient s symptoms with possible exposure to s stercoralis , although it may have occurred many years earlier , outside the united states . therefore , a very high clinical index of suspicion is necessary to include chronic strongyloidiasis among the differential diagnoses , when the clinician is confronted with an immigrant of tropical origin with symptoms involving the lung , skin , or gastrointestinal tract . strongyloides stercoralis is the leading cause of mortality due to helminth infections in the united states . this is attributed to the fact that most fatalities are iatrogenic with the use of corticosteroids . , rhabditiform larvae load may increase in the organs involved in the normal cycle ( gastrointestinal tract , lungs , skin ) and cause hyperinfection syndrome . immunosuppression may also cause the rhabditiform larvae to migrate to the organs that are not involved in its natural cycle , such as the brain , and cause disseminated strongloidiasis . in the development of either disseminated strongyloidiasis or hyperinfection syndrome , the rhabditiform larvae penetrate the wall of the gastrointestinal tract , causing secondary gram - negative sepsis and meningitis . acute respiratory distress from enteric bacteria may occur , with a mortality rate of 73% for disseminated strongyloidiasis and 50% for hyperinfection syndrome . unfortunately , the clinical presentation of chronic strongyloidiasis can mimic chronic obstructive pulmonary disease ( copd ) exacerbation , acute new - onset asthma , and ulcerative colitis , leading to the use of empiric corticosteroids , which will be fatal in these misdiagnoses . as a matter of fact , only 9% of us physicians consider further parasitology evaluation in an immigrant who presents with an onset of wheezing and abnormal eosinophilia instead of empiric corticotherapy . eosinophilia , which is a common finding in helminth infections , shows a sensitivity of 82.6% in infections with s stercoralis . however , the centers for disease control and prevention ( cdc ) enzyme immunoassay ( eia ) strongyloides serology proves to be highly sensitive at 94.6% . in our case , the patient s blood count did not show eosinophilia . however , the patient was positive for igg anti - strongyloides . therefore , the lack of eosinophilia in the initial diagnostic workup should not prevent the clinician from asking further investigative tests if clinical suspicion exists . the serology test can be difficult to interpret because it may show a cross - reaction with other helminths such as loa loa and ascaris lumbricoides . unlike s stercoralis , none of these helminths can establish a cycle in humans and persist for decades after exposure before causing symptoms . helminths other than s stercoralis decline progressively in a patient who has left endemic areas , and new symptoms are almost exclusively related to s stercoralis infection . multiple stool microscopic sample examinations using the baermann technique may increase the sensitivity to 85% . regarding the relative lack of sensitivity of different tests , a situation such as the initiation of an immunosuppressive treatment , which requires ruling out an infection of s stercoralis , may become a challenge for a physician . the recommended strategy for high - risk patients from southeast asia or agriculture worker is to obtain serology and initiate empiric treatment with ivermectin 200 g / kg before immunosuppressive therapy . however , its diagnosis presents several challenges , including the delayed onset of symptoms after exposure to s stercoralis , the variable clinical presentations , and the lack of sensitivity of the different diagnostic tests available . these challenges directly contribute to the high rate of misdiagnoses and delayed diagnosis . as a result , the mortality of s stercoralis infection is essentially iatrogenically induced by the use of immunosuppressive therapy in a patient who had an unknown s stercoralis infection . specifically , physicians should also consider the possibility of chronic strongyloidiasis when they are confronted with patients presenting with conditions such as asthma , copd exacerbation , or ulcerative colitis if they have once been in tropical regions . the presence of subcutaneous masses in the context of chronic strongyloidiasis suspicion should not lead to excision because they may disappear with treatment . finally , immigrants from tropical regions should be offered an empiric treatment for chronic strongyloidiasis before they receive any immunosuppressive therapy to prevent the development of hyperinfection syndrome or disseminated strongyloidiasis .

chronic strongyloidiasis is an infection of the tropical regions , caused by the nematode strongyloides stercoralis . in the united states , patients are typically immigrants . the very long asymptomatic phase followed by the clinical presentation of the disease mimics asthma , chronic obstructive pulmonary disease ( copd ) , or inflammatory bowel disease ( ibd ) as in this case report . the inconsistency of eosinophilia and the low sensitivity of microscopic stool examination make chronic strongyloidiasis a disease that is frequently misdiagnosed in the united states . the use of corticosteroids in these misdiagnosed cases transforms chronic strongyloidiasis into disseminated strongyloidiasis or hyperacute syndrome , which leads to high mortality . iatrogenic errors represent the essential cause of mortality due to chronic strongyloidiasis in the united states . we recommend a high index of suspicion of chronic strongyloidiasis when a physician approaches an immigrant presenting with symptoms mimicking asthma , copd , and ibd with subcutaneous masses .

You are an expert at summarizing long articles. Proceed to summarize the following text: over the last decade , progress observed in sub - saharan african countries in increasing pmtct service coverage and in reducing new hiv infections among children is promising . for example , in the 21 global plan priority countries in sub - saharan africa , coverage of antiretroviral medicines for pregnant women living with hiv to prevent mother - to - child transmission has nearly doubled in 2012 as compared to the 2009 level , increasing from 34% in 2009 to 65% in 2012 . this increased coverage has contributed to reducing new hiv infections among children by 38% in 2012 as compared with 2009 levels . in this regard , botswana , ethiopia , malawi , namibia and zambia have demonstrated a 50% or more decline on new hiv infections among children . on the other hand , angola , chad , cote divoire , democratic republic of congo , lesotho and nigeria showed slow declines in averting new hiv infections among children . specifically , nigeria , which accounts more than one - quarter of new hiv infections among children in the region , pmtct coverage was very low ( 17% in 2012 ) and consequently , the decline in hiv infection aversion among children has been less effective . such slow progress in high burden countries such as nigeria also affects achievement of regional targets . the main purpose of this paper is to share the evidence on a major factor that may impede scale - up of pmtct service coverage and thereby advocate for integration of pmtct and maternal and child health services , fundamental for achieving the global plan and global fast - track commitments of zero transmission and to improve maternal and child health in general . the paper specifically analyses disparities across income in the use of antenatal care services in sub - saharan african countries . it also analyses the extent to which use of antenatal care services differentiated by women s wealth status explains variations in pmtct service coverage in the region . all sub - saharan african countries that conducted demographic and health survey ( dhs ) between 2008 and 2015 have been selected for analysis . if countries conducted two or more dhs surveys , the most recent survey has been considered . the dhs are nationally - representative household surveys ( with large sample sizes ranging between 5000 and 30,000 ) that provide a wide range of data in the areas of population , health , and nutrition . the dhs surveys are normally implemented approximately every five years . from the dhs survey results , unicef pooled data on anc coverage and released the results in february 2016 . for this analysis , anc use refers to least four antenatal care visits to a health facility or health personnel during the last pregnancy . on the other hand , the most recent pmtct coverage data have been pooled from the unaids dataset released in 2016 . using spss , linear regression analysis were conducted to assess the disparity in the use of anc that are associated with income ; and to understand how much the disparity in anc use could explain pmtct service coverage . wealth quintiles , as measured by dhs , refer to household income classified into five categories using principal component analysis . thirty - one sub - saharan african countries with complete data on anc use by wealth quintile and pmtct service coverage . have been identified . the complete dataset extracted from unicef and unaids 2016 online datasets are presented in supplementary table s1 . the anc use ( at least four visits ) in the lowest and highest wealth quintiles , in their respect , average 42% and 69% . this implies that in the 31 sub - saharan african countries , women in the highest wealth quintile are about 3 times more likely to use anc services ( at least four visits ) as compared to those in the lowest wealth quartile ( 95%ci : 1.7 - 5.7 , p<0.000 ) . the pmtct service service coverage in these countries ranges between 3% in madagascar and 95% in mozambique , namibia , swaziland , togo , and uganda ; while the average pmtct coverage is about 71% ( table 1 ) . a regression analysis shows that the disparity in anc use associated with income ( i.e. , between women in the highest and lowest wealth quintiles ) is a statistically significant predictor of pmtct service coverage ( p<0.05 ) . also , the analysis shows that disparity in anc use associated with income can explain nearly a quarter of the variation on pmtct service coverage in sub - saharan african countries ( p<0.05 ) . the analysis and graph bellow show that the higher the disparity in anc use associated with income , the lower the pmtct service coverage ( figure 1 ; see also supplementary table s2 for more details on the output of the regression analysis ) . sub - saharan africa accounts the highest burden of hiv / aids world wide . in this regard , by the end of 2012 , about 69% of people living with hiv globally were in this region , where nearly 1 in every 20 adults ( 4.9% ) were living with hiv . similarly , over 90% of the children who acquired hiv infection in 2011 lived in sub - saharan africa . however , there are also encouraging results that are being observed , specifically over the last decade . in this regard , for example , new hiv infection in the region has declined by one - quarter ; i.e. , from 2.4 million in 2001 to 1.8 million in 2011 . also , in the global plan s 21 priority countries in sub - saharan africa , the number of children newly infected fell by 38% ; i.e. , from 340,000 new infections in 2009 to 210,000 in 2012 . but , achieving the global target of eliminating new hiv infections among children and keeping their mothers alive requires taking the full advantages of the advancements in the biomedical field on pmtct . advancements in biomedical interventions have created huge opportunities by reducing the risk of mother - to - child transmission ( mtct ) of hiv from 35% to 2% . however , translating such advancements into practice is faced with programmatic barriers specifically in sub - saharan africa ; one of such challenges being lack of integration of pmtct with other maternal and child health services . the world health organization strategic directions for scaling - up quality and effective pmtct calls for integration of hiv prevention , care and treatment services with maternal , new - born and child health and reproductive health programs as one of the critical approaches for reaching zero new infections among children . in most of the sub - saharan african countries , anc use ( at least four visits ) therefore , reaching women who are already using anc service is a low hanging fruit for expanding pmtct services . while maternal health and pmtct service coverage are generally low and at varying levels in sub - saharan africa , access to services by the poorest women is worse , which has major impact on national and regional level achievements . in this regard , for example , the relatively wealthiest women are three times more likely to use anc services as compared to the poorest women in the region ( p<0.05 ) ( table 1 ) . also , the higher the disparity across income in using anc services , the lower the pmtct service coverage at the national level ( p<0.05 ) . the impact of health inequality in the region is beyond pmtct and anc . in this regard , in sub - saharan african countries , while there is no association between national poverty rate and hiv prevalence , a systematic review of studies shows existence of clear and significant association between income inequality ( measured with gini coefficient ) and hiv prevalence across countries ; i.e. , countries with greater income inequality have higher hiv prevalence . the specific factors as to why women in the lower wealth quintile have lower access to health services might require further in - depth research . however , available studies on the general population might also enlighten some of the potential factors that need to be considered when designing maternal and pmtct programs . it is also important to note that the anc use disparity across income only explains about a quarter of the variation on pmtct service coverage ( supplementary table s2 ) . in this respect , there remain many other factors that determine access / utilization of pmtct and other maternal health services . for example , a study in holeta town of ethiopia shows that anc attendance is significantly associated with demographic , socio - economic and health related factors including age at last birth , literacy status of women , average monthly family income , media exposure , attitude towards pregnancy , knowledge on danger signs of pregnancy and presence of husband approval on anc . studied women s practice of disclosing their hiv status to their partners in four sub - saharan africa countries - burkina faso , kenya , malawi and uganda . disclosure has important effect for hiv positive women s desires to access pmtct services . according to hardon et al . , rates of disclosure to partners in the four countries varied between 32.7% and 92.7% ; the lowest being in malawi . a similar study in tanzania showed that six in ten hiv positive pregnant women had not disclosed their results of the hiv test to their partners . an important reason for not disclosing was women s economic dependency on their partners and hence fear of being expelled from house . such findings suggest the importance of also targeting male patterns in pmtct and maternal health programs . a cross - sectional study conducted in southeast nigeria shows limitations of women s knowledge / awareness about available maternal and child health services at the different service delivery points in their areas , which potentially leads to lack of trust and wastage of their time and other resources by unknowingly traveling to facilities where services are not available . in these regards , pmtct and maternal health program planning processes need to further look into the factors , validate those that deem most important and earmark resources on how to break the barriers for women ( especially to those in the poorest wealth category ) for accessing the services . ameur et al . emphasized on the importance of eliminating user fees for maternal health services , specifically at the time of delivery , in order to address issue of maternal health inequity . in this regards , while the study by ameur et al . focused on burkina faso , they also cited the positive outcomes in ghana after the country introduced exception policy making delivery care free . in this respect , 18 months after user fees were abolished in ghana , the greatest increase in health facility use was by the poorest segment of the population . analysis of data from 269 sites in 20 pmtct programs and 15 sub - saharan countries from 2002 to 2005 showed two important factors that can increase pmtct coverage higher knowledge about pmtct and higher government investment on health . in order to address the maternal health disparities across income through integrated service delivery , other potential areas to be considered are : introducing routine hiv testing for women and their partners ( e.g. , through provider initiated testing and counselling - pict ) ; supporting alternate models of care delivery ( such as shifting basic tasks from physicians to nurses ) ; and providing incentives for service providers as well as clients ( e.g. , incentive for health workers for agreeing to relocate to rural areas if necessary ; or outreach pregnant women in neighboring villages ; and reimbursing pregnant women for the cost of transportation to the clinic ) . the goal of the global plan was to move towards eliminating new hiv infections among children by 2015 and keeping their mothers alive . the plan focused on reaching pregnant women living with hiv and their children , from the time of pregnancy until the mother stops breastfeeding . the global fast - track commitments to end aids by 2030 also aims to eliminate hiv infections among children by 2020 . in this regards , one of the principles for reaching these goals is leveraging synergies , linkages and integration for improved sustainability , i.e. , national plans leverage opportunities to strengthen synergies with existing programmes for hiv , maternal health , new - borns and child health , family planning , orphans and vulnerable children , and treatment literacy . pmtct is more than the simple administration of arvs ; and the full set of its intervention components should be implemented as an integral component of essential maternal , neonatal and child health services . on the other hand , funding is critical , there is never enough money for global health ; never enough for any one intervention ; and this creates a double rationale for support . while the hiv / aids and maternal health challenges in sub - saharan africa are immense , the gains ( especially over that last decade ) are also promising . in these regards , achieving the global plan target and global fast - track commitments of eliminating new hiv infections among children and keeping their mothers alive would definitely require strategic approaches by building on existing health - care delivery systems / structures and specifically integrating the service deliveries with other maternal and child health services ; and with deliberate effort to reach women who are most disadvantaged .

about 69% of people living with hiv globally and over 90% of the children who acquired hiv infection are in sub - saharan africa . despite this , promising results have been observed , especially over the last decade for example , a 25% decline in new hiv infections as compared to 2001 and a 38% decline in the number of children newly infected by hiv in 2012 as compared to 2009 . however , the global plan and the global fast - track commitments of eliminating new hiv infections among children require addressing impediments to service expansion . in this regard , this paper attempts to draw attention to the extent to which disparities across income in using antenatal care ( anc ) services may constrain the prevention of mother - to - child transmission ( pmtct ) service expansion in sub - saharan africa . the analysis is based on anc service coverage data from demographic and health surveys conducted between 2008 and 2015 in 31 sub - saharan african countries ; and pmtct coverage data from unaids datasets released in 2016 . our analysis found that women in the highest wealth quintile are about three times more likely to frequently use anc services ( at least four visits ) as compared to those in the lowest wealth quintile ( 95%ci : 1.7 - 5.7 , p<0.0001 ) . a regression analysis shows that one - quarter of the pmtct service coverage can be explained by the disparity in anc use associated with income ; and the higher the disparity in anc use , the lower the pmtct service ( p<0.05 ) . the findings suggest that achieving the ambitious plan of zero new hiv infections among children while keeping their mothers alive will require on - going pmtct / anc service integration and ensuring that programs reach women who are most in need ; specifically those in the poorest income categories .

You are an expert at summarizing long articles. Proceed to summarize the following text: polycystic ovarian syndrome ( pcos ) affects approximately 2% to 7% of women in the general population ( schmidt and shinkai , 2015 ) . the pathogenesis of pcos is not well understood but current evidence indicates a multifactorial etiology that involves gonadotropic dysregulation , genetic predisposition , and environmental factors ( norman et al . , 2007 ) . the presentation of pcos is heterogeneous and typical features include chronic anovulation , biochemical or clinical signs of hyperandrogenism , polycystic ovaries , and metabolic derangement ( kosus et al . , 2012 ) . ninety - two percent of women with pcos exhibit cutaneous manifestations including signs that are associated with hyperandrogenism , which implicates an important role for dermatologists in the recognition and diagnosis of women who are suspected of having pcos ( azziz et al . , 2004 , a study of women who presented with pcos features for the first time found that 25% of the study population was referred by dermatology clinics ( sivayoganathan et al . , 2011 ) . a timely , accurate diagnosis of pcos is paramount because it may lead to a number of long - term complications such as type 2 diabetes , obesity , hypertension , infertility , macrovascular disease , thrombosis , and cancer ( ehrmann , 2005 ) . however , an accurate diagnosis of pcos is challenging due to the number of heterogeneous phenotypes in this condition including the observed ethnic variations in the presentation of pcos ( zhao and qiao , 2013 ) . hirsutism is defined as excessive terminal hair growth in an androgen - sensitive skin distribution in women and is a reliable cutaneous marker for hyperandrogenism , the most common cause of which is pcos . the primary modality to evaluate and quantify hirsutism is the modified ferriman - gallwey ( mfg ) visual four - point scale , which scores hair growth in nine androgen - dependent body areas ( ferriman and gallwey , 1961 ) . the scale rates hirsutism on a scale from 0 to 36 and clinical hirsutism is typically defined as a total mfg score of 8 or greater . the development of the mfg scoring system was based on the evaluation of primarily caucasian ( northern european ) women , making application of the instrument controversial in the assessment of hirsutism in other ethnicities ( asuncion et al . , 2004 , deugarte et al . , 2006 , ferriman and gallwey , 1961 , kim et al . , 2011 , moran et al . , 2010 , sagsoz et al . , 2004 , the androgen excess - pcos ( ae - pcos ) society has proposed the need for ethnic - specific mfg cutoff scores to define hirsutism in women with pcos ( escobar - morreale et al . how ethnic variation impacts hirsutism in the pcos population requires further investigation because current evidence stems from limited studies that examined homogeneous cohorts and compared only two or three ethnicities or variable classifications of ethnic groups . the fitzpatrick skin type ( fst ) scale categorizes patients on the basis of skin color and response to sun exposure and has been used in the evaluation of photoaging , skin cancer risk assessment , and laser hair treatment ( fitzpatrick , 1988 , roberts , 2009 , sachdeva , 2009 ) . few studies have investigated an association between skin type and hirsutism and the generalizability of existing evidence is limited by mixed methodologies in non - pcos cohorts ( dner and ekmeki , 2013 , javorsky et al . , 2014 ) . the aim of the current study is to characterize the relationship between ethnicity , fst , and the pattern and severity of hirsutism among an ethnically diverse cohort of american patients with pcos . approval by the university of california , san francisco ( ucsf ) committee for human research was granted to perform this retrospective cross - sectional study . participants were recruited consecutively from may 18 , 2006 to october 25 , 2012 from the ucsf multidisciplinary pcos clinic . any patient who was able to provide written consent was eligible to participate in the study . a diagnosis of pcos was made by joint consultation between a dermatologist and reproductive endocrinologist using the 2003 rotterdam criteria that require two of three signs or symptoms of the following : oligoovulation and/or anovulation , clinical or biochemical signs of hyperandrogenism , or presence of 12 or more antral follicles per ovary and/or ovarian volume greater than 10 ml by ultrasound ( rotterdam eshre / asrm , 2004 ) . patients were asked to discontinue any hormonal medication at least 1 month prior to the clinic visit and refrain from any hair removal for at least 1 week before the clinic visit . ethnic groups were categorized in nine subgroups : middle eastern , ashkenazi jew , other caucasian , east / southeast asian , south asian , hispanic , african american , native american , and mixed / other . skin type was determined on the basis of self - reported fitzpatrick skin type including type i ( always burns , never tans ) , type ii ( usually burns , tans minimally ) , type iii ( sometimes mild burn , tans uniformly ) , type iv ( burns minimally , always tans well ) , type v ( very rarely burns , tans very easily ) , and type vi ( never burns , never tans ) . for the analysis , fsts were classified into three skin type groups : fsts i and ii ( group 1 ) , fsts iii and iv ( group 2 ) , and fsts v and vi ( group 3 ) . the evaluation of hirsutism was conducted with the mfg visual scoring method that assesses androgen dependent hair growth in nine body areas : upper lip , chin , chest , upper and lower back , upper and lower abdomen , thighs , and upper arms . a dermatologist rated and recorded each site using the mfg visual scoring method on a scale of 0 ( absence of hair ) to 4 ( extensive terminal hair growth ) . site - specific , regional ( facial , truncal , and extremity ) , and total mfg scores were reported . all analyses were performed with sas software ( sas institute , cary , nc ) . wallis and tests were used to compare demographics and mfg scores between the pcos diagnosis status , and ethnic and fst groups . ethnic groups were categorized in nine subgroups : middle eastern , ashkenazi jew , other caucasian , east / southeast asian , south asian , hispanic , african american , native american , and mixed / other . skin type was determined on the basis of self - reported fitzpatrick skin type including type i ( always burns , never tans ) , type ii ( usually burns , tans minimally ) , type iii ( sometimes mild burn , tans uniformly ) , type iv ( burns minimally , always tans well ) , type v ( very rarely burns , tans very easily ) , and type vi ( never burns , never tans ) . for the analysis , fsts were classified into three skin type groups : fsts i and ii ( group 1 ) , fsts iii and iv ( group 2 ) , and fsts v and vi ( group 3 ) . the evaluation of hirsutism was conducted with the mfg visual scoring method that assesses androgen dependent hair growth in nine body areas : upper lip , chin , chest , upper and lower back , upper and lower abdomen , thighs , and upper arms . a dermatologist rated and recorded each site using the mfg visual scoring method on a scale of 0 ( absence of hair ) to 4 ( extensive terminal hair growth ) . site - specific , regional ( facial , truncal , and extremity ) , and total mfg scores were reported . all analyses were performed with sas software ( sas institute , cary , nc ) . kruskal wallis and tests were used to compare demographics and mfg scores between the pcos diagnosis status , and ethnic and fst groups . a total of 341 women met the study inclusion criteria and 276 patients met the rotterdam criteria for pcos . there was no difference in the ethnic backgrounds between women who were diagnosed with pcos and those who failed to meet the diagnostic criteria or in the deferred diagnosis group ( p = .250 ) . there were significant differences in the total mfg scores ( p < .001 ) and rates of clinical hirsutism ( p = .013 ) and women who were diagnosed with pcos had greater severity and prevalence of hirsutism ( table 2 ) . a comparison between ethnic groups found a significant correlation between self - reported ethnicity and total mfg scores ( p = .009 ) and prevalence of clinical hirsutism ( p = .002 ) . patients of hispanic , middle eastern , south asian , african american , and mixed ethnicity had the highest total mfg scores and prevalence of clinical hirsutism while those of caucasian , ashkenazi jewish , east / southeast asian , and native american ethnicity had lower severity and prevalence rates of hirsutism . site - specific comparisons found significant ethnic differences in facial ( p = .031 ) , truncal ( p < .001 ) , and extremity ( p = .017 ) mfg scores . patients of hispanic , mixed , and african american ethnicity had higher facial mfg scores , particularly in the chin area for african american patients ( p = .015 ) . no age difference was detected between the ethnic groups ; however , a significant ethnic difference in body mass index ( bmi ) was found ( p < .001 ) . patients of hispanic , middle eastern , and native american ethnicity had the highest bmi scores while south asian women had a much lower bmi score . among the fst groups , a significant difference in total mfg score ( p = .021 ) and prevalence of hirsutism ( p = .012 ) was found . patients in group 3 ( skin types v and vi ) had the highest mfg scores and prevalence of hirsutism , followed by group 2 ( skin types iii and iv ) , and group 1 ( skin types i and ii ) . the majority of this variation in hirsutism among skin types is due to differences in truncal mfg scores ( p = .008 ) . this analysis of a diverse cohort of american patients with pcos revealed significant differences in prevalence , pattern , and severity of hirsutism between ethnic and fst subgroups . an increased prevalence of hirsutism and higher total mfg scores were found in patients of hispanic , middle eastern , south asian , african american , and mixed ethnicity . a lower prevalence in hirsutism and total mfg scores were found in caucasian , asian , ashkenazi jewish , and native american women with pcos . the results of this study are consistent with some but not all published studies that investigated ethnic variations in the prevalence and severity of hirsutism in women with pcos . a comparison with existing literature was limited by differences in methodology , which precluded generalizability . some studies focused on a single homogeneous ethnic cohort but many of the available studies focused on a comparison of hirsutism in limited subsets of ethnic groups rather than examining hirsutism across multiple ethnicities within a single pcos cohort ( carmina et al . 2014 ) . studies that identify ethnic differences in hirsutism in patients with pcos have largely relied on a limited comparison of two or three ethnic subgroups . several cross - sectional studies have found significantly higher mfg scores among migrant south asian and middle eastern women with pcos who live in europe compared with their caucasian european counterparts ( glintborg et al . , 2010 , mani et al . , 2015 , wijeyaratne et al . , 2002b ) . important differences may lie in the distinction of asian subgroups because comparisons between european caucasian and chinese cohorts of patients with pcos who live in their native countries found a lower prevalence of hirsutism and mfg scores in the east asian group ( guo et al . similarly , a multi - center cross - sectional study of women with pcos found lower mfg scores in an east asian ( japanese ) cohort compared with italian and hispanic american cohorts with all patients living in their native countries ( carmina et al . , 1992 ) . in contrast , multiple studies of american women with pcos did not find ethnic differences in hirsutism prevalence and severity ( knochenhauer et al . , 1998 , ladson et al . , 2011 , legro et al . , 2006 , welt et al . , 2006 ) . a study of a diverse cohort in boston reported equal prevalence of hirsutism and mfg scores between caucasian , african american , hispanic , and asian patients with pcos ( welt et al . , 2006 ) . in the pregnancy in polycystic ovarian syndrome study , similar rates of hirsutism prevalence and severity were also reported among patients who were categorized by race in african american , asian , caucasian , and american indian / native american groups and in latino versus non - latino ethnic subgroups ( legro et al . , 2006 ) . in contrast to previous studies that identified differences in hirsutism between distinct caucasian and east asian cohorts of patients with pcos who all lived in their native countries , a focused study that examined caucasian ( primarily of european ancestry ) and east asian subgroups within a cohort of american patients with pcos ( same cohort used in this study ) found no difference in prevalence and severity of hirsutism between the two groups ( wang et al . , 2013 ) . an important consideration for the disparate findings among studies studies have utilized subgroups on the basis of race , ethnicity , or a combination of the two , which makes comparisons between studies challenging . broad racial grouping , for example of caucasian and asian subjects , may have masked important differences between ethnic subgroups that were revealed in the present study , which utilized more granular categories on the basis of ethnicity such as middle eastern , hispanic , south asian , and east / southeast asian . the use of the rotterdam diagnostic criteria may identify a more phenotypically heterogeneous pcos cohort because the criteria have been shown to classify more women with pcos than the previous consensus criteria by the national institutes of health ( nih ; broekmans et al . , a study using the more stringent nih criteria may systematically exclude women from specific ethnicities that typically present with lower rates of hirsutism . in this study , patients with pcos demonstrated high truncal and extremity mfg scores ; however , our data also suggested distinct patterns in the presentation of hirsutism between different ethnic subgroups . higher facial mfg scores were observed in african american patients and particularly in the chin area in contrast with higher truncal and extremity mfg scores in the middle eastern subgroup . prior studies have also suggested increased truncal and extremity mfg scores in middle eastern women with and without pcos ( dner and ekmeki , 2013 , glintborg et al . , 2010 , hassa et al . , 2005 ) . distinct patterns in hirsutism were not seen in other groups such as hispanic patients who demonstrated higher mfg scores in all areas . the prevalence and severity of hirsutism when compared between caucasian and east asian patients with pcos in a previous study in this cohort did not differ ; however , a decrease in upper truncal hirsutism in east asian women was observed ( wang et al . , 2013 ) . interestingly , east asian women in this study demonstrated a trend for higher upper lip mfg scores , which is consistent with prior studies of east asian women ( cheewadhanaraks et al . whether weighting of site - specific mfg scores on the basis of ethnicity is warranted requires validation . in this study , there was a positive correlation between hirsutism and higher fst . patients with fsts v and vi had greater total mfg scores and a higher prevalence of clinical hirsutism than those with other skin types few studies have investigated the relationship between skin type and hirsutism , none in patients with pcos , and among the few studies the methodologies differ . a cross - sectional turkish study of 1034 premenopausal women ( excluding women with a complaint of hirsutism ) found that women with higher fsts ( fsts iv and v ) had higher total mfg scores compared with the groups of patients with lower fsts ( dner and ekmeki , 2013 ) . additionally , a multi - center cross - sectional study of 2895 women who were recruited from los angeles , rome , london , and akita ( japan ) reported that upper lip mfg score was influenced by ethnicity but not skin color as assessed by a chromometer ( javorsky et al . , 2014 ) . in the present study , upper lip mfg scores were also not associated with higher fst . the current study provides important evidence for the correlation of ethnicity and fst on the presentation of hirsutism in patients with pcos and offers additional support for a reconsideration of the current clinical criteria to diagnose hirsutism on the basis of these factors ( escobar - morreale et al . , 2012 , fauser et al . , although the original study by ferriman and gallwey ( 1961 ) defined hirsutism as a total score of 8 or higher , the proposal to adjust mfg criteria on the basis of ethnicity has already been implemented through the utilization of distinct mfg criteria by different research groups ( cheewadhanaraks et al . , 2004 , guo et al . , 2012 , ichikawa et al . , 1988 , kim et al . , 2014 , li et al . , 2013 , welt et al . , 2006 , zhang et al . , 2013 , zhao et al . , 2011 , studies within the general population ( not necessarily patients with pcos ) have provided validation for this practice and suggest distinct ethnic - specific mfg diagnostic criteria for clinical hirsutism on the basis of the 95th percentile of the ethnic population ( asuncion et al . , 2006 , kim et al . , 2011 , moran et al . , 2010 , tellez and frenkel , 1995 , zhao et al . , 2007 ) . on the basis of these studies , lower diagnostic cutoff points for east asian women ( mfg > 2 to > 5 ) and higher cutoff points for middle eastern ( mfg > 8 to > 10 ) , mediterranean ( mfg > 7 to > 10 ) , and mexican ( > 11 ) women have been recommended ( api et al . , 2009 , , 2004 , kim et al . , 2011 , moran et al . , 2010 , noorbala and kefaie , 2010 , sagsoz et al . , 2004 , given the complex interplay of ethnicity and fst on the presentation of hirsutism , additional studies are needed to validate mfg criteria for each ethnic subgroup and especially to assess individuals of mixed ethnic backgrounds . one of the limitations of this study is the small sample size . additionally , self - reported ethnicity and fst data are subject to reporting bias and misinterpretation of the classifications . the relationship between ethnicity and skin type is complex and a subanalysis of fst and ethnicity in this study found a significant positive correlation between ethnicity and skin type ( p < .001 , data not shown ) although a wide range of skin types can be found in patients of certain ethnicities . hirsutism is more prevalent in obese individuals with pcos ; however , this relationship may differ between ethnic groups and further limits the interpretation of the study findings ( glintborg et al . , 2010 , mani et al . , 2015 , schmidt et al . , 2016 , yuan et al . , 2016 middle eastern and hispanic patients had the highest bmi , followed by african american patients . these groups also had some of the highest mfg scores and prevalence of clinical hirsutism . whether these ethnicities have genetic or environmental risk factors predisposing to both weight gain and hirsutism or whether there is a direct effect of obesity on the manifestation of hirsutism is not known . ethnicity and fst have an important impact on the presentation of hirsutism in patients with pcos . because of the distinct patterns of hirsutism presentation in patients with pcos , understanding a patient s ethnic background and skin type in addition to a comprehensive skin exam larger cohort studies are required to validate whether clinical qualitative ( distribution ) and quantitative criteria ( mfg ) for hirsutism should be adjusted for ethnicity and fst in the pcos population .

backgroundthe complex interplay between ethnicity , fitzpatrick skin type ( fst ) , and hirsutism in patients with polycystic ovarian syndrome ( pcos ) is poorly understood.objectivein this cross - sectional , retrospective analysis , we examined the prevalence , severity , and distribution of hirsutism with clinician - rated site - specific and total modified ferriman - gallwey ( mfg ) visual scoring in a diverse cohort of american patients with pcos.methodsindependent analyses were conducted on the basis of patient - reported fst ratings and ethnicity.resultsin this pcos cohort , a correlation was found between hirsutism and ethnicity and the highest prevalence of hirsutism and total mfg scores was observed in hispanic , middle eastern , african american , and south asian patients . a positive correlation between hirsutism and fst was also observed with an increasing prevalence of hirsutism in the group of patients with higher fsts . significant trends in the anatomic distribution of hirsutism were observed between ethnic groups as well . a higher facial mfg score was found in african american patients but higher mfg scores in the truncal and extremity regions were observed in middle eastern patients . truncal hirsutism was also associated with higher fsts.conclusionsethnicity and fst may be important variables in both the quantitative and qualitative presentations of hirsutism in women with pcos and should be considered in the diagnostic evaluation of any patient who is suspected of having the condition . previously published studies that examined ethnicity , fst , and hirsutism in homogeneous cohorts limited comparison and generalizability but the strength of this study lies in its detailed analysis within a single large and diverse pcos cohort . validated studies are needed to determine whether clinical criteria for hirsutism should be adjusted for ethnicity and fst in the pcos population and particularly within diverse cohorts and patients of mixed ancestry .

You are an expert at summarizing long articles. Proceed to summarize the following text: use of dental implants has become a widespread and predictable treatment modality for the restoration of missing teeth and various edentulous cases . as progress in material and implant design continues dramatically over time , implant patients have been demanding treatment protocols that take less time and require fewer surgeries . consequently , immediate loading of dental implants has gained popularity and becomes more and more required . a fundamental prerequisite for immediate primary stability is defined as the absence of mobility in the bone bed after the implant has been placed . it depends on mechanical engagement of an implant with the fresh bone socket , but this stability declines with time during the early stages of healing , as remodeling of the surrounding bone takes place . while secondary stability is the progressive increase in stability related to biologic events at the bone - implant interface such as new bone formation and remodeling , it is absent at the time of implant placement and increases with time . in addition to considering the primary implant stability a critical factor when immediate loading is planned , it is one of the prerequisites for achievement and maintenance of osseointegration . besides the quantity and quality of the bone [ 4 , 7 ] , morphology of the implant , implant surface roughness , and topography [ 8 , 9 ] , the surgical technique adopted also influences the primary stability [ 4 , 10 ] . likewise one of the surgical techniques suggested to enhance the primary stability of implant in bone of low density is the undersized drilling technique , which has been introduced to locally optimize the bone density by using a final drill diameter considerably smaller compared with the implant diameter . in this way , an osteocompressive fit between the implant surface and bone bed is achieved . however , a drawback of all drilling techniques is that bone tissue is sacrificed during the drilling process . this shortcoming is exacerbated in situations where limited bone or bone of lesser density is available . in view of this , the osteotome technique has been introduced . this technique consists of first preparing a small - sized pilot hole , then compressing the bone tissue laterally and apically with a spreader or implant - shaped instrument . the goal of this technique is to replace the implant with a high degree of stability without removing additional bone , which is theoretically believed to improve final bone healing [ 1517 ] . in addition to conventional surgical preparation techniques , the piezoelectric bone surgery [ 18 , 19 ] offers an alternative technique to implant placement that professes to address some of the shortcomings of the conventional system utilizing an ultrasonic surgical system . the piezoelectric surgery unit claims to be superior to conventional methods in numerous ways : improved precision , selective cutting action , minimal damage to soft tissues such as nerves or blood vessels , reduced bleeding resulting in improved visibility within the surgical field , and the absence of overheating [ 19 , 20 ] . currently , the effect of ultrasounds is being widely investigated in various fields of medicine : in orthopedics , they are used to accelerate healing of bone fractures and ligament damage by promoting cell proliferation and bone matrix synthesis [ 2123 ] . also , multidisciplinary clinical reports on the application of ultrasounds in bone surgery obtained promising results in terms of precision and safety [ 24 , 25 ] . the use of low - level lasers has also been suggested as another way of accelerating and improving the bone tissue healing process . laser light irradiation has been applied in the medical field and has biostimulatory effects on wound healing , collagen synthesis , and fibroblast proliferation [ 2729 ] . in addition , it has been demonstrated that bone irradiated mostly with infrared wavelengths shows increased osteoblastic proliferation , collagen deposition , and bone formation when compared to nonirradiated bone [ 30 , 31 ] . however , little reliable data exist concerning the laser effect on the osseointegration process of implants . therefore , this review aimed to find if there is scientific - based evidence to support laser influence on stability of dental implants . nowadays , various computer - assisted systems comprising a three - dimensional virtual planning by means of a computer tomography ( ct ) or digital volume tomogram suggest a flapless procedure . for the accurate and predictable placement of the implants , a surgical template is fabricated based on the virtual planning and consequently a prosthetically driven and template - guided implant placement can be carried out . according to oh et al . , a flapless implant surgery provides esthetic soft tissue results in single - tooth implants either immediately or delayed loaded . it has been documented that the use of stereolithographic appliances in accordance with flapless surgery assists in the immediate loading of implants . also , immediate loading with flapless surgery technique has been shown to reduce the treatment period and enhance implant stability compared to the conventional flap surgery protocol [ 36 , 37 ] . different clinical methods for monitoring implant stability at various stages have been proposed , such as periotest ( siemens ag , bensheim , germany ) , dental fine tester ( kyocera , kyoto , japan ) , osstell mentor ( osstell ab , stampgatan , gteborg , sweden ) , and the cutting - torque or insertion torque ( it ) measurement . the periotest is composed of a metallic tapping rod in a handpiece , which is electromagnetically driven and electronically controlled . signals produced by tapping are converted to unique values called periotest values ( ptv ) . however , periotest and dental fine tester have been the subject of criticism as a result of their poor sensitivity and because their measurements are significantly influenced by variables such as the vertical measuring point on the implant abutment , the handpiece angulations , and the horizontal distance of the handpiece from the implant [ 39 , 40 ] . the osstell resonance frequency analysis ( rfa ) system involves the placement of a smart peg into the implant , which is screwed into the implant itself and the use of a transducer , which is held close to and perpendicular to the smart peg without actually making contact . osstell gives the implant stability quotient ( isq ) through resonance frequency analysis on a scale from 1 to 100 . recent studies have shown the isq to be an accurate , noninvasive means of determining implant stability , and it is becoming a widely used instrument [ 4244 ] to monitor the changes in stiffness and stability at the implant - tissue interface and to discriminate between successful implants and clinical failures [ 44 , 45 ] . regarding the cutting - torque or insertion torque measurement which was originally developed by johansson and strid and later improved by friberg et al . , its main purpose was to quantify the initial torque ( in ncm units ) required to seat the implant into the socket during surgery by means of a torque application device ( osseocaret ) and thereby predict bone support and density . although this method is nonsubjective , noninvasive , and extensively used in clinical practice during implant placement to assess primary stability , it allows only a single measurement at implant insertion and can not be used for evaluating secondary stability . considering that the surgical technique might influence the primary and secondary stability of dental implants , the aim of this systematic review was to investigate the influence of different surgical techniques including the undersized drilling , the osteotome , the piezosurgery , the flapless procedure , and the bone stimulation by low - level laser therapy on the primary and/or secondary stability of dental implants . the present systematic review was focused on this question : is there scientific evidence to support the influence of these surgical techniques on the primary and/or secondary stability of dental implants ? the inclusion criteria comprised observational clinical studies and randomized controlled trials ( rcts ) conducted in patients who received dental implants for rehabilitation , studies that evaluated the association between the surgical technique ( prognostic factor ) and implant primary and/or secondary stability ( outcome ) . surgical techniques evaluated were the underdrilling technique , osteotome technique , piezosurgery , flapless technique , and the low - level laser therapy . dental implant stability was evaluated by isq value ( osstell , integration diagnostics , gothenburg , sweden ) , ptv value ( periotest , medizintechnik gulden , modautal , germany ) , or it measurement . studies that reported surgical technique and implant stability but did not verify their association were excluded from this systematic review . for the identification of the clinical studies to be considered in this review , combinations of the following keywords were used : dental implants , implant stability , primary stability , secondary stability , implant stability quotient , isq , resonance frequency analysis , rfa , osstell , periotest value , ptv , periotest , osteotome technique , undersized drilling , piezosurgery , surgical technique , flap implant placement , and flapless implant placement . a search of health science databases ( cochrane library and medline - pubmed ) and grey literature was performed , including papers published until may 2013 . . only articles in english were included in this review . the titles and abstracts ( when available ) of all articles identified through the electronic searches were scanned independently by at least two review authors . for studies appearing to meet the inclusion criteria , or for which there were insufficient data in the title and abstract to make a clear decision , the full reports were assessed independently by at least two review authors to establish whether they met the inclusion criteria or not . studies rejected at this or subsequent stages were recorded in the flow diagram of literature review , and reasons for exclusion were recorded . data were extracted by at least two review authors independently using specially designed data extraction form . any disagreement was discussed and a third review author was consulted where necessary ( figure 1 ) . for each study , the following data were extracted ( table 1).year of publishing , country of conducting the study , sample size , and number of implants.implant dimensions , surface treatment , and implant manufacturer.arch region of implant insertion and the surgical technique used.primary stability isq or it values and association between primary stability and surgical technique.confounders included in analysis.secondary stability isq or it values and association between secondary stability and surgical technique . year of publishing , country of conducting the study , sample size , and number of implants . the risk of bias assessment for the included studies was considered independently and in duplicate by at least two review authors . this was conducted using the methodological checklist for prognostic studies developed by the national institute for health and clinical excellence of the united kingdom ( 2009 ) ( table 2 ) . response always indicates that the study has been designed and conducted in such a way as to minimize the risk of bias for that item . an unclear response to a question may arise when the answer to an item is not reported or is not reported clearly . a study was classified as having high methodological quality if at least five of six parameters received the answer yes , moderate methodological quality if at least three of the parameters received the answer yes , or low methodological quality if two or less parameters received the answer the search procedure retrieved 59 articles from electronic searches . after screening the titles and abstracts ( when available ) independently by at least two review authors , 14 articles appeared to meet the inclusion criteria [ 11 , 32 , 37 , 4853 , 5559 ] . of the 14 potentially eligible studies , 5 studies had to be excluded because relation between surgical technique and implant stability was not clear in one study , in two studies intervention was confounded [ 37 , 56 ] , one study did not include a control group , and one study did not study the surgical technique influence on implant stability . thus , a total of 9 clinical studies [ 11 , 32 , 4853 , 55 ] that met the inclusion criteria underwent quality assessment and data extraction . ( 1 ) undersized implant site preparation . will undersized implant site preparation affect primary and/or secondary stability ? two observational clinical studies [ 51 , 52 ] studied this intervention . a clinical study compared between the undersized implant site preparation and conventional implant site preparation with respect to the primary stability . the implants were inserted in posterior maxilla ; six groups with 10 implants each , two controls ( c1 and c2 ) , and four tests ( t1t4 ) were created according to the implant dimensions and the surgical technique adopted . in c1 group , implants of 3.75 mm width and 10 mm length were used with the 2- and 3-mm diameter drills reached up to 10 mm length . in t1 group , implants of 4 mm width and 10 mm length were used , with the 2- and 3-mm diameter drills reached up to 10 mm length . in t2 group , implants of 4 mm width and 10 mm length were used , with the 2-mm dill reached to 10 mm , and the 3-mm drill reached to 7 mm length . in c2 group , implants of 3.75 mm width and 11.5 mm length were used with the 2- and 3-mm diameter drills reached up to 11.5 mm length . in t3 group , implants of 4 mm width and 11.5 mm length were used with the 2- and 3-mm diameter drills reached up to 11.5 mm length . finally , in t4 group , implants of 4 mm width and 11.5 mm length were used with the 2-mm drill reached up to 11.5 mm and the 3-mm diameter drills reached up to 8.5 mm length . both isq and it values were recorded at implant placement to evaluate the primary stability . the other clinical study investigated the effect of undersized drilling technique on primary implant stability when compared with the standard drilling protocol . undersized bone drilling was performed using 2.8 mm twist drills for 4.1 mm diameter implants ; widening of implant bed with osteotome or tapping was not used . implants with same dimensions ( 12 4.11 mm ) were used in both groups . isq and it values were recorded at implant placement to evaluate the primary stability . ( 2 ) osteotome technique . will osteotome technique affect primary and/or secondary implant stability ? one rct and two clinical observational studies [ 48 , 50 ] studied this intervention . a clinical observational study compared conventional implant placement with osteotome technique to place 10 implants in maxillary anterior region . the implants were placed in the first quadrant using the conventional method ( group a ) and in the second quadrant using the osteotome technique ( group b ) . for group a the implant sites were sequentially enlarged to 3.7 mm in diameter with pilot and spiral drills according to standard protocol , in group b the implant sites were prepared initially by a 2 mm diameter pilot drill , this was followed by condensing the bone using osteotomes of increasing diameters using a hand ratchet . once the implant sites were prepared , implants of 13 mm length and 3.7 mm width were inserted . isq values of implant stability were measured at implant placement and at six months after . a total of 102 implants were placed in posterior segment of maxilla , 51 self - tapping ( 4 mm in width and 10 mm in length ) implants , and 51 non - self - tapping ( 4.1 mm in width and 10 mm in length ) . four study groups were formed according to the surgical technique to be used for implant site preparation and implant macrodesign . in group i : bone condensation technique was used for implant site preparation and self - tapping implants were inserted ; group ii : non - self - tapping implants were placed following condensation technique ; group iii : self - tapping implants were inserted after bone drilling ; and in group iv : bone drilling was performed and non - self - tapping implants were placed . in groups i and ii , bone condensation technique was performed by pilot drill and bone condensers of increasing diameter , while in groups iii and iv , implant sites were gradually enlarged with pilot and spiral drills . one rct compared the conventional drilling technique and the osteotome technique in anterior segment of the maxilla . 46 screw type oral implants with the length of 10 or 12 mm and diameter of 4.1 mm were used . for control group , implant bed sites were prepared with pilot and spiral drills to a final diameter of 3.3 mm according to protocol recommended by manufacturer . for the test group after preparing a pilot hole with 2.2 mm diameter drill , the procedure was continued with series of consecutive osteotomes to a final diameter of 3.5 mm according to manufacturer instructions . all implants were placed in the sites using a nonsubmerged technique and in one stage procedure . isq values representing implant stability were measured at implant placement and at three months after . one rct compared piezosurgery with conventional implant bed preparation . the trial was conducted using split mouth technique in 20 patients . the control site was performed with conventional twist drills and the test site was performed with specific piezoelectric inserts . the last instrument used was 3 mm in diameter in both groups to place 4 mm diameter and 10 mm length implants . one observational clinical study compared placement of implants with flap elevation versus flapless implant placement with respect to primary and secondary implant stability . forty patients with complete edentulous maxilla were consecutively admitted for treatment with implant supported prosthesis . one hundred and ten implants were placed conventionally in 23 patients ( flap group ) and eighty five implants in 17 patients by means of flapless method ( flapless group ) using a stereolithographic template . the isq values were recorded immediately after implant placement and after a period of 3 months . one rct compared implant placement with low - level laser irradiation with implant conventional placement without laser irradiation . thirty implants were distributed bilaterally in posterior mandible of eight patients . at the experimental side the implants were submitted to low - level laser treatment and in the control side the irradiation was simulated ( placebo ) . the irradiations were performed with a gallium aluminum - arsenide ( gaalas ) diode low - level laser with continuous emission of 830 nm wavelength . the first irradiation was performed in the immediate post - operation period and was repeated every 48 hours in the first 14 days . none of the articles was excluded from the systematic review after quality assessment , except for one article on studies [ 50 , 55 ] conducted by the same author and having some overlapping patients . in this case , after ranking the studies , the one with the highest score was included in the systematic review , the other was excluded . a priori calculation for the sample size inclusion and exclusion criteria for the sample selection were clearly defined in only five studies [ 11 , 32 , 49 , 50 , 53 ] . in addition , blinding of outcome assessors were mentioned by the authors in only three of the included studies [ 11 , 50 , 53 ] . finally , confounders were not considered for analysis in three studies [ 32 , 49 , 52 ] . consequently , the quality assessment and control of bias ranked five articles as moderate and three as high ( table 3 ) . ( 1 ) will undersized implant site preparation affect primary and/or secondary stability ? in both studies [ 51 , 52 ] , the difference in isq and it values among the undersized drilling and the standard press - fit drilling techniques was not statistically significant ( p > 0.05 ) , but it was clearly in favour of the undersized group . however , secondary stability was not evaluated . they demonstrated a statistically significant higher primary stability for implants placed with osteotome technique than those placed with the conventional drilling technique in the maxillary anterior and maxillary posterior regions , based on isq values ( p < 0.05 ) . in contrast , padmanabhan and gupta , based on isq values , demonstrated a statistically significant higher primary stability for implants placed with conventional drilling technique than those placed with osteotome in the maxillary anterior region ( p < 0.05 ) . with respect to the influence of osteotome technique on secondary implant stability , there was no significant influence of using osteotome on secondary implant stability when compared with conventional drilling technique for isq values , in the two selected studies [ 48 , 49 ] ( p > 0.05 ) . on the other hand , markovi et al . showed a statistically significant higher secondary stability for implants placed with osteotome technique than those placed with the conventional drilling technique during the entire 12-week observation period , based on isq values ( p < 0.05 ) . the single rct demonstrated that there was no real difference in primary stability when implants were placed following piezoeletric technique versus the conventional twist - drill technique ( p > 0.05 ) . however , it found a statistically significant higher secondary stability for piezogroup than the control group . this statistically significant difference was during the entire follow - up 90 days , and from day 14 to day 42 , in particular , the difference was extremely significant ( p < 0.0001 ) . the one observational clinical study demonstrated that there was a positive association between the flapless technique and the primary and secondary implant stability at three months after surgery ( p < 0.001 ) . ( 5 ) will low - level laser therapy affect primary and/or secondary stability of implants ? the one rct concluded that there was no evidence of any effect of irradiating bone osteotomies with infrared wavelengths on either primary or secondary implant stability within 12-week follow - up in the posterior mandible , when measured by rfa . the purpose of this systematic review was to evaluate whether there was scientific evidence to support the association between different surgical techniques and primary and/or secondary implant stability . the surgical techniques that we found in the world literature evaluated by clinical studies whether they have influence on primary and/or secondary implant stability were the undersized drilling , the osteotome technique , the piezosurgery , the flapless , and the low - level laser therapy . just three randomized controlled trials ( rcts ) and five observational clinical studies were included . we selected only clinical studies that verified the association between the surgical techniques and implant stability . laboratory or animal studies which did not report any clinical implant - related outcomes were not considered of interest since they would not be able to provide reliable clinical information for the prognosis of dental implant rehabilitation . because only a limited number of studies investigated the influence of different surgical techniques on stability of dental implants , the pattern of the current literature review was customized to primarily summarize the pertinent information . when evaluating whether the undersized drilling technique could enhance the primary implant stability , the two included observational clinical studies [ 51 , 52 ] did not show a significant difference between the undersized drilling and the standard press - fit drilling techniques , but it was clearly in favour of the undersized group . the authors concluded that using thinner drills for implant placement in sites with poor bone density ( posterior edentulous maxilla and mandible ) is beneficial in enhancing primary implant stability . the higher primary stability of implants inserted after undersized drilling compared with those inserted after standard press - fit drilling might be interpreted by that the implants placed in undersized beds could compress the bone and increase its density , thereby enhancing the primary implant stability . however , why no significant difference was detected between the under drilling and the press - fit techniques could be interpreted by the relatively small sample size of those two studies which likely made them underpowered to demonstrate any significant difference in outcome measures between groups . therefore , further clinical prospective studies and randomized controlled trials with larger sample sizes are required to provide compelling scientific - based evidence of the influence of the undersized drilling technique on the primary and also on the secondary implant stability and healing potential of bone . when evaluating what the impact of using the osteotome in implant bed preparation on primary and/or secondary implant stability is , only one rct and two clinical observational studies [ 48 , 50 ] were selected . . found positive association between using the osteotome technique and the primary implant stability . this increase in primary stability could be due to changes in the micromorphology of peri - implant trabecular bone caused by apicolateral condensation by osteotome . so , the primary stability is enhanced in this low density bone maybe due to increase in its density . in contrast , padmanabhan and gupta demonstrated a statistically significant higher primary stability for implants placed with conventional drilling technique than those placed with osteotome in the maxillary anterior region ( p < 0.05 ) . the too small sample size ( n = 5 ) in this study to provide any reliable evidence and methodological differences might be responsible for this contrasting result compared with the abovementioned two . with respect to the influence of osteotome technique on secondary implant stability , there was no significant influence of using osteotome on secondary implant stability when compared with conventional drilling technique in the two selected studies [ 48 , 49 ] , six months and three months after the surgery , respectively . on the other hand , one article showed a statistically significant higher secondary stability for implants placed with osteotome technique than those placed with the conventional drilling technique during the entire 12-week observation period . although a direct comparison among the three studies was not possible due to different implant brands used , different recipient sites , and due to different surgeon 's experience , an earlier significant increase of secondary stability in the osteotome group in markovi et al . study compared with padmanabhan and gupta and shayesteh et al . first : as different surgeon 's hands conducted these studies , maybe in padmanabhan and gupta and shayesteh et al . studies , excessive loads were exerted on the bone by osteotome ; and provided that loads of more than 20 mpa , which might be anticipated during use of osteotomes , could displace bone marrow spaces and disturb the blood supply , the bone needs more time to form new spaces for angiogenesis and to repair this microdamaged bone . study , the lateral bone compression might be within the physiological range and as such may have stimulated bone healing probably by activating the trauma - dependent repair mechanism known as regional acceleratory phenomenon , unlike the usual process of bone regeneration in the control group . so this might interpret why secondary stability was higher for osteotome technique compared with conventional technique in this study . second : provided that secondary stability is not only influenced by surgical technique but also by implant surface characteristics , the enhanced surface characteristics of implants used in the markovi et al . study compared with padmanabhan and gupta and shayesteh et al . might be more able to detect a significant difference between the two techniques . when evaluating whether using piezosurgery in implant bed preparation could influence the primary and/or secondary implant stability , just one rct was found . it demonstrated that there was no real difference in primary stability when implants were placed following piezoeletric technique versus the conventional twist - drill technique . however , it found a statistically significant higher secondary stability for piezogroup than the control group . a possible interpretation of the earlier shifting from a decreasing to an increasing stability pattern in ultrasonic preparation sites , when compared with the traditional drilling technique , could derive from the cleaning effect of piezosurgery , microvibrations , and the cavitation effect of saline solution could result in effectively removing bony debris and tissue remnants deriving from site preparation , exposing marrow spaces , and favoring a rapid migration of osteoprogenitor cells into the fresh wound . however , the results of this study can not be generalized because of some of limitations . variables such as the single operator 's surgical technique , the limited numerosity of the sample , and the choice of the surgical site ( limited to the lateral maxilla ) must be taken into account . also , the implants were not yet loaded and it can not be stated whether the finding may have a prognostic value for long - term stability of the implants procedure . therefore , further rcts using a larger sample size and longer follow - ups are necessary in order to confirm or refute these findings , and , thus , benefit from the possible clinical advantages of piezosurgery in immediate and early loading protocols for dental implant therapy . when assessing the influence of flapless procedure on primary and/or secondary implant stability , just one observational clinical study was selected . concluding from this study , there was positive association between the flapless technique and the primary and secondary implant stability at three months after surgery . interpreting this finding , it can be assumed that raising a mucoperiosteal flap and having the bone denuded during a certain time causes a postsurgical reaction and may have an impact on the bone remodeling around the implant . while the opposite occurs with flapless procedure where the bone remains covered by the periosteum ; this may increase vascularity of the peri - implant mucosa , which furthermore appeared to be free from signs of inflammation . despite that primary and secondary implant stability were observed in slight favor of the flapless method in this study , we can not generalize this finding because of single operator 's surgical technique , the choice of the surgical site ( limited to complete edentulous maxilla ) , and because the implants were not yet loaded and it can not be stated whether the finding may have a prognostic value for long - term stability of the implants . when evaluating whether the use of low - level laser therapy ( lllt ) to stimulate the osteotomy bone could influence the primary and/or secondary implant stability , only one rct was conducted . it concluded that there was no evidence of any effect of irradiating bone osteotomies with infrared wavelengths on either primary or secondary implant stability within 12-week follow - up in the posterior mandible . this finding could be explained by a hypothesis that the effect of the laser could have been masked by the high initial stability attained . this high initial stability can be attributed not only to the bone quality ( type ii bone in the posterior mandible ) but also to the implant geometry used in this study . thus , additional lllt may have little impact macroscopically . however , it is important to point out that outcomes of this study are limited to the specific methodology and results may differ in different bone conditions and implants when using different lllt protocols with other methodologies and different lengths of follow - up . in addition , the small sample size of this trial is another limitation . to provide objective assessment of implant stability , three methods were chosen to assess implant stability in this review : the resonance frequency method , which generated the isq value , the percussion method , which generates the ptv value , and the insertion torque measurement that provided the it value in ncm . despite that the periotest has been the subject of criticism as a result of its poor sensitivity and the insertion torque method allows a single measurement of primary stability and can not be used for evaluating secondary stability , the three methods were chosen to cover the maximum number of clinical studies on this subject and to avoid subjectivity . although ptv , and periotest were used as key words , none of the selected articles used this method to assess primary or secondary stability . although this systematic review aimed to verify the influence of different surgical techniques on primary and/or secondary stability of dental implants , it was also possible to extract some data concerning the implant dimensions , implant macrodesign , and the bone density from the selected articles . . discovered an important influence of implant diameter on primary implant stability ( p < 0.05 ) . . showed no significant effect of implant diameter and length on primary and secondary stability . since implant shape , design , and surface characteristics are important for primary stability , most of the selected articles in this review standardized the implant marco- and microdesign except one , which demonstrated that self - tapping implants achieved greater primary and secondary stability at 12-week than non - self - tapping implants with conventional bone drilling technique ( p < 0.05 ) . also , because there is a positive association between primary implant stability and bone mineral density of the receptor site , most of the selected studies in this review utilized one specific surgical site of the arch to minimize the effect of bone density on stability . one of the selected articles reported strong correlations between bone density and primary implant stability values ( isq and it ) . with respect to the influence of gender factor on primary stability , alghamdi et al . and katsoulis et al . revealed significantly higher isq values for men . despite the relative positive association found between primary and/or secondary implant stability and some of the aforementioned surgical techniques , the methodological quality and control of bias of the studies need to be improved to produce stronger evidences . a priori calculation for the sample size was undertaken in only two studies [ 49 , 53 ] . inclusion and exclusion criteria for the sample selection were clearly defined in only five studies [ 11 , 32 , 49 , 50 , 53 ] . in addition , blinding of outcome assessors were mentioned by the authors in only three of the included studies [ 11 , 50 , 53 ] . finally , confounders were not considered for analysis in three studies [ 32 , 49 , 52 ] . consequently , the quality assessment and control of bias ranked five articles as moderate and just three as high . first , the search was limited to english - language publications , which may have introduced a publication bias and excluded other relevant articles . however , such an exclusion may not considerably change the overall estimate of treatment effects . second , the quality assessment and control of bias ranked five articles as moderate as assessed by the methodological checklist for prognostic studies developed by the national institute for health and clinical excellence of the united kingdom . third , most of the selected articles had small or very small sample sizes , with relatively short follow - ups . fourth , the inclusion of nonrandomized controlled clinical trials ( ccts ) in the analysis may have introduced a bias . however , it was postulated that ccts can complement the evidence provided by rcts , particularly when rcts are not of a high quality . these conclusions are based on few studies with small or very small sample sizes , relatively short follow - ups , moderate methodological quality , and being sometimes judged to be at moderate risk of bias , therefore they should be viewed with great caution.there is a weak evidence suggesting that undersized drilling technique could enhance the primary implant stability in sites of poor bone density.there is still a lack of evidence about the influence of undersized drilling technique on secondary implant stability.there is a weak evidence suggesting that using the osteotome technique to prepare implant beds in poor bone density could enhance the primary and secondary implant stability.there is a weak evidence suggesting that ultrasonic implant site preparation by piezoelectric inserts does not affect the primary mechanical stability but could fasten the bone healing process and increase the secondary implant stability , earlier than the traditional drilling technique.there is a weak evidence suggesting that flapless procedure could enhance the primary and secondary implant stability.there is insufficient evidence supporting or confuting the efficacy of irradiating bone osteotomies with infrared wavelengths for enhancing the primary or secondary stability of the implants . there is a weak evidence suggesting that undersized drilling technique could enhance the primary implant stability in sites of poor bone density . there is still a lack of evidence about the influence of undersized drilling technique on secondary implant stability . there is a weak evidence suggesting that using the osteotome technique to prepare implant beds in poor bone density could enhance the primary and secondary implant stability . there is a weak evidence suggesting that ultrasonic implant site preparation by piezoelectric inserts does not affect the primary mechanical stability but could fasten the bone healing process and increase the secondary implant stability , earlier than the traditional drilling technique . there is a weak evidence suggesting that flapless procedure could enhance the primary and secondary implant stability . there is insufficient evidence supporting or confuting the efficacy of irradiating bone osteotomies with infrared wavelengths for enhancing the primary or secondary stability of the implants . more properly designed , rcts with at least 1-year follow - up after implant loading are needed to understand the influence of undersized drilling , the osteotome technique , the piezosurgery , the flapless , and the low - level laser therapy on primary and secondary stability of implants placed particularly in low density bone . at this time , we could revise the existing loading protocols in this poor - quality bone dealing with these suggested surgical techniques .

background . a number of surgical techniques for implant site preparation have been advocated to enhance the implant of primary and secondary stability . however , there is insufficient scientific evidence to support the association between the surgical technique and implant stability . purpose . this review aimed to investigate the influence of different surgical techniques including the undersized drilling , the osteotome , the piezosurgery , the flapless procedure , and the bone stimulation by low - level laser therapy on the primary and/or secondary stability of dental implants . materials and methods . a search of pubmed , cochrane library , and grey literature was performed . the inclusion criteria comprised observational clinical studies and randomized controlled trials ( rcts ) conducted in patients who received dental implants for rehabilitation , studies that evaluated the association between the surgical technique and the implant primary and/or secondary stability . the articles selected were carefully read and classified as low , moderate , and high methodological quality and data of interest were tabulated . results . eight clinical studies were included then they were classified as moderate or high methodological quality and control of bias . conclusions . there is a weak evidence suggesting that any of previously mentioned surgical techniques could influence the primary and/or secondary implant stability .

You are an expert at summarizing long articles. Proceed to summarize the following text: worldwide rates of obesity and type 2 diabetes have increased at alarming speed , and nowhere this is more evident than among the city - dwelling middle classes of india . current estimates by the international diabetes federation suggest nationwide prevalence rates of 9.2% among indians aged 20 - 79 years . while rural populations bare approximately 3% of the burden , in the order of 15% of india 's adult urban populace are now believed to have type 2 diabetes . asian indians appear genetically predisposed , most likely through the interplay of multiple susceptible genes ; however , recent environmental and behavioral change appears to be the primary driver of the increasing prevalence of obesity , insulin resistance , and type 2 diabetes . most notably , india 's rapidly developing economy has driven the expansion of urbanized zones , altered social and employment patterns , and provided greater access to high fat processed foods that are often consumed outside of the home . refined vegetable oils have become more plentiful and affordable and an increasing number of meals and snacks are being consumed out of the home . fast- and snack - foods are generally high in fat , and also commonly contain trans fats , both of which can contribute to insulin resistance . city - dwellers in particular appear to consume a greater percentage of energy from fat ( 32% ) compared to rural areas ( 17% ) . aberrant dietary patterns are associated with the diabetes onset and progression and once established , food choice and eating patterns play a pivotal role in the diabetes management . although studies among northern indians are lacking , investigation of southern indians with type 2 diabetes have however , demonstrated low adherence to dietary regimes . in the multi - center diabcare asia - india study , only 4% of 2269 participants followed a specific dietary therapy . in two urban south indian groups of similar size to the current study , around one- third of participants were adhering to any dietary prescription . adherence to a diabetic regimen was positively related to dietary counseling and optimistic , pro - active health - related attitudes . both studies emphasized the need for on - going direct counseling to help maintain enthusiasm and treatment adherence . research conducted in women with diabetes from other cultures suggests those believing that their individual dietary choices play a role in disease development and the treatment were more compliant with the dietary recommendation . within north indian urban populations with type 2 diabetic , the present study aimed to : ( 1 ) characterize aspects of current eating patterns , behaviors , and preferences ; and ( 2 ) assess factors related to food decision - making including dominant beliefs and attitudes linked to food and health - related themes . relationships between these factors and metabolic health were also examined in order to inform the effective nutrition and the life - style intervention strategies . the study was conducted in two large tertiary teaching hospitals in the national capital region of new delhi , india . the first , indraprasthra apollo hospital is a 600 bed facility located in the southern district of new delhi ; the second , medanta the medicity is a 700 bed hospital located in gurgaon , a growing business district 30 km southwest of new delhi . both hospitals cater to the population of north india and serve as national referral centers . between september 2010 and march 2011 , upon presentation for an out - patient endocrine review , all males and females of asian indian origin , 25 to 65 years of age , with pre - existing type 2 diabetes ( 6 months ) , diagnosed according to standard world health organization criteria were invited to take part in the study . study participants were under the care of one of the authors ( ambrish mithal ) . the institutional review board of the sponsoring hospitals approved the study and all participants gave their informed consent . the study involved the cross - sectional collection of a range of clinical , anthropometric and biochemical data , plus assessment of eating patterns , food - related knowledge and beliefs , and factors driving food choice . respondents provided information on marital status ; educational attainment ; the number of persons living ( and eating ) within the household . weight was recorded on electronic scales ( tanita corporation , japan ) in kilograms to the nearest gram ; height was recorded on a wall - mounted stadiometer in centimeters ; waist circumference was taken at the umbilicus to the nearest millimeter . metabolic health was assessed by a series of biochemical tests including fasting plasma glucose ( mg / dl ) , glycosylated haemoglobin ( hba1c % ) , low density lipoprotein ( ldl)-cholesterol ( mg / dl ) , high density lipoprotein ( hdl)-cholesterol ( mg / dl ) and triglycerides ( mg / dl ) . blood samples were taken during the routine care by experienced clinicians and analyzed according to standard procedures in hospital laboratories certified by the national accreditation board of laboratories . additional clinical information was recorded from the case notes after the out - patient appointment . data were obtained by one of two clinic - based diabetes educators in a single semi - structured interview of approximately 30 min duration . the semi - structured interview consisted on a defined program of questions including multiple choice , 5-point rating scales , short answer , and dichotomous response . an initial draft was pilot - tested on ten individuals , which resulted in the restructuring and removal of a number of questions to reduce the survey length . to obtain data on food purchasing habits within the home , respondents approximated how much of the family 's income was spent on food ( response range : ; to ; ; do nt know ) ; who was in charge of household food and meal choices and who purchased most household food . the consumption frequency of meals , snacks , fruits , and vegetables was determined by asking how many set meals ; between - meal snacks ; whole fruits ; different types of vegetables subjects consumed during an average day . individuals indicted if they were vegetarian . to investigate the quality and the quantity of habitually consumed fats and oils participants were presented with a list of 10 butters and oils : butter , desi ghee ( clarified butter ) , vanaspati ( hydrogenated vegetable oil ) , mustard seed oil , olive oil , sunflower oil , cotton seed oil , soyabean oil , canola oil , and blended vegetable oil . subjects indicated which products were used in their home ; the average size ( in ml or liters ) of the container(s ) purchased ; length of time each container lasted ; and the number of people ( including themselves ) the container fed . if any usage details were unclear , the respondent was encouraged to contact the relevant individual for clarification . for analysis , all volumes were converted in ml and the average time a container lasted was converted into days ( 1 week = 7 days ; 1 month = 30 days ) . to calculate the average daily household intake , the size of each container was divided by the number of people in the household that it fed . this figure was divided by the estimated number of days each container lasted and values were added to yield an estimate for the total daily household intake . at analysis , the top and bottom 2% of estimates were excluded . to investigate intakes of high in fat processed foods , participants were asked how many times a week or month on average they consumed fast - food or participants also indicated how often they consumed 3 common fast - foods and 12 common snack items : fried chips , burgers , commercial fried chicken , puri subzi ( fried flat indian bread with vegetables ) , namkeen ( deep - fried snack ) , roasted channa ( roasted chick peas ) , pakoras ( deep - fried ball of chick pea flour mixed with vegetables ) , chholey bhature ( chick pea curry with deep - fried indian bread ) , chaat ( spicy fried potato ) , samosas / kachauri ( deep - fried pocket of wheat flour filled with vegetables ) , pav bhaji ( white bun with a spicy vegetable gravy ) , plain sweet biscuits , chocolate , indian sweets ( burfi , rasgulla , jallebi ) ( milk - based indian sweets ) , cakes / pastries . consumption frequency options ranged from never ; rarely ; 1 - 3 times / month/1 - 7 times / week . a rating of rarely was considered to be an intake of 0.5 days / month . for analysis , all weekly values were multiplied by four in order to express consumption as days / month . a total estimate of processed snack intake / month was calculated by adding all monthly figures for each consumed food . to assess the relative importance of factors involved in food choice decisions , subjects were asked to rate 13 possible factors on a 5-point scale from 1 ( very much ) to 5 ( not at all ) , including : parents / upbringing ; schooling / study ; cultural background ; job / working hours ; dieting ; food cost ; food taste ; perceived health value ; convenience ; what is served ; habit ; diabetes control ; stress ; other ( extended response ) . preference for fatty / savory food tastes was assessed from a list of eight commonly available foods ( dal rice [ a lentil curry and rice ] ; a sandwich ; samosa ; hot chips / french fries ; fresh fruit ; chat ; home - cooked vegetable [ vegetable curry ] ; pizza ) . in addition to indicating their consumption frequency of the various household fats / oils and fast foods snacks , participants also rated how healthy they perceived these foods to be . all ratings were based on a 5-point scale from 1 ( very healthy ) to 5 ( very unhealthy ) . subjects were asked to specify , which statement defined simple carbohydrates ( cho ) : ( a ) those digested quickly that are rapidly converted into sugar , or ( b ) those digested slowly , that are converted slowly into sugar . descriptive statistics were used to express values as mean sd for continuous demographic , anthropometric , clinical , biochemical , and dietary variables , median ( interquartile range [ iqr ] ) for categorical variables , and percentages . independent samples t - tests were used to compare differences between the continuous variables divided into respondents and non - respondents , by gender and groups split at the median value . statistical package for the social sciences ( spss ) version 12.0.1 was used for statistical analysis . respondents provided information on marital status ; educational attainment ; the number of persons living ( and eating ) within the household . weight was recorded on electronic scales ( tanita corporation , japan ) in kilograms to the nearest gram ; height was recorded on a wall - mounted stadiometer in centimeters ; waist circumference was taken at the umbilicus to the nearest millimeter . metabolic health was assessed by a series of biochemical tests including fasting plasma glucose ( mg / dl ) , glycosylated haemoglobin ( hba1c % ) , low density lipoprotein ( ldl)-cholesterol ( mg / dl ) , high density lipoprotein ( hdl)-cholesterol ( mg / dl ) and triglycerides ( mg / dl ) . blood samples were taken during the routine care by experienced clinicians and analyzed according to standard procedures in hospital laboratories certified by the national accreditation board of laboratories . additional clinical information was recorded from the case notes after the out - patient appointment . data were obtained by one of two clinic - based diabetes educators in a single semi - structured interview of approximately 30 min duration . the semi - structured interview consisted on a defined program of questions including multiple choice , 5-point rating scales , short answer , and dichotomous response . an initial draft was pilot - tested on ten individuals , which resulted in the restructuring and removal of a number of questions to reduce the survey length . to obtain data on food purchasing habits within the home , respondents approximated how much of the family 's income was spent on food ( response range : ; to ; ; do nt know ) ; who was in charge of household food and meal choices and who purchased most household food . the consumption frequency of meals , snacks , fruits , and vegetables was determined by asking how many set meals ; between - meal snacks ; whole fruits ; different types of vegetables subjects consumed during an average day . to investigate the quality and the quantity of habitually consumed fats and oils participants were presented with a list of 10 butters and oils : butter , desi ghee ( clarified butter ) , vanaspati ( hydrogenated vegetable oil ) , mustard seed oil , olive oil , sunflower oil , cotton seed oil , soyabean oil , canola oil , and blended vegetable oil . subjects indicated which products were used in their home ; the average size ( in ml or liters ) of the container(s ) purchased ; length of time each container lasted ; and the number of people ( including themselves ) the container fed . if any usage details were unclear , the respondent was encouraged to contact the relevant individual for clarification . for analysis , all volumes were converted in ml and the average time a container lasted was converted into days ( 1 week = 7 days ; 1 month = 30 days ) . to calculate the average daily household intake , the size of each container was divided by the number of people in the household that it fed . this figure was divided by the estimated number of days each container lasted and values were added to yield an estimate for the total daily household intake . at analysis , the top and bottom 2% of estimates were excluded . to investigate intakes of high in fat processed foods , participants were asked how many times a week or month on average they consumed fast - food or participants also indicated how often they consumed 3 common fast - foods and 12 common snack items : fried chips , burgers , commercial fried chicken , puri subzi ( fried flat indian bread with vegetables ) , namkeen ( deep - fried snack ) , roasted channa ( roasted chick peas ) , pakoras ( deep - fried ball of chick pea flour mixed with vegetables ) , chholey bhature ( chick pea curry with deep - fried indian bread ) , chaat ( spicy fried potato ) , samosas / kachauri ( deep - fried pocket of wheat flour filled with vegetables ) , pav bhaji ( white bun with a spicy vegetable gravy ) , plain sweet biscuits , chocolate , indian sweets ( burfi , rasgulla , jallebi ) ( milk - based indian sweets ) , cakes / pastries . consumption frequency options ranged from never ; rarely ; 1 - 3 times / month/1 - 7 times / week . a rating of rarely was considered to be an intake of 0.5 days / month . for analysis , all weekly values a total estimate of processed snack intake / month was calculated by adding all monthly figures for each consumed food . to assess the relative importance of factors involved in food choice decisions , subjects were asked to rate 13 possible factors on a 5-point scale from 1 ( very much ) to 5 ( not at all ) , including : parents / upbringing ; schooling / study ; cultural background ; job / working hours ; dieting ; food cost ; food taste ; perceived health value ; convenience ; what is served ; habit ; diabetes control ; stress ; other ( extended response ) . preference for fatty / savory food tastes was assessed from a list of eight commonly available foods ( dal rice [ a lentil curry and rice ] ; a sandwich ; samosa ; hot chips / french fries ; fresh fruit ; chat ; home - cooked vegetable [ vegetable curry ] ; pizza ) . in addition to indicating their consumption frequency of the various household fats / oils and fast foods snacks , participants also rated how healthy they perceived these foods to be . all ratings were based on a 5-point scale from 1 ( very healthy ) to 5 ( very unhealthy ) . subjects were asked to specify , which statement defined simple carbohydrates ( cho ) : ( a ) those digested quickly that are rapidly converted into sugar , or ( b ) those digested slowly , that are converted slowly into sugar . descriptive statistics were used to express values as mean sd for continuous demographic , anthropometric , clinical , biochemical , and dietary variables , median ( interquartile range [ iqr ] ) for categorical variables , and percentages . independent samples t - tests were used to compare differences between the continuous variables divided into respondents and non - respondents , by gender and groups split at the median value . statistical package for the social sciences ( spss ) version 12.0.1 was used for statistical analysis . a p value of less than 0.05 was considered as statistically significant . of 378 patients approached , 258 completed the study ; a response rate of 68% . the final group included 101 individuals recruited from indraprastha apollo hospital ( 39.1% ) and 157 subjects from medanta medicity . there was no statistical differences between the grouped demographic , anthropometric or biochemical data of subjects recruited from either hospital ( data not shown ) ; therefore , group data were combined . the study group included 185 males ( 71.7% ) and 73 females , mostly older adults who , according to modified asian indian cut - offs , were categorized as obese ( body mass index [ bmi ] > 25 kg / m ) with a high - risk waist circumference ( men > 90 cm , women : > 80 cm ) . no differences in the plasma fasting glucose or hba1c% were apparent between males and females ; however , females recorded higher ldl - cholesterol ( 111.8 38.4 vs. 95.5 35.3 , p = 0.003 ) , hdl - cholesterol ( 43.7 12.0 vs. 37.0 8.6 , p = 0.002 ) , and triglyceride levels ( 161.6 70.2 vs. 153.6 67.7 , p < 0.001 ) . demographic and anthropometric characteristics of the sample of adults with diabetes attending an out - patient appointment ( n=258 ) biochemical parameters of the sample of adults with diabetes attending an out - patient appointment ( n=258 ) of those who responded ( n = 188 ; 72.9% ) , 49.4% reported that - and 44.7% reported of household income was used to purchase food . within the household , the wife was most often responsible for food purchases ( 45% ) , then husband ( 22.1% ) and cooks / servants ( 16.3% ) . wives were most accountable for organizing household meals ( 57% ) ; less so by cooks / servants ( 19.4% ) and husbands ( 11.6% ) . within the group , 155 individuals ( 60.1% ) were vegetarian . compared to non - vegetarians , vegetarians had a smaller waist circumference ( 90.2 13.8 cm vs. 93.5 12.1 ; p = 0.05 ) but did not differ on any other measure ( data not shown ) ; therefore , all individuals were combined for the dietary analysis . table 3 lists the frequency of the group 's meal , snack , and fruit and vegetable consumption . total daily eating episodes ranged from 1 ( 0.4% ) to 8 ( 1.2% ) with the majority reporting 4 ( 36.4% ) or 5 ( 37.6% ) . the average participant consumed a combined total of 4.0 2.0 ( median iqr ) types of fruits and vegetables / day . compared to 4 serves / day of fruit / vegetables ( n = 162 ; 62.8% ) , habitual consumption of 5 serves / day was associated with a smaller waist circumference ( 88.8 13.3 vs. 93.0 13.0 ; p = 0.014 ) and lower household fat usage ( 29.5 12.0 vs. 38.4 17.9 ; p < 0.001 ) . ( p < 0.001 ) as important factors in food choice , and were less likely to indicate number of reported daily meals , snacks , fruits , and vegetables consumed by the total group ( n=258 ) the number of different fats and oils used within the home ranged from 1 to 7 varieties and median iqr 3.0 1.0 varieties per household . the most commonly used fats / oils were desi ghee ( n = 184 ; 71.3% ) , butter ( n = 166 ; 62.0% ) , mustard oil ( n = 139 ; 53.9% ) , sunflower oil ( n = 124 ; 48.1% ) , soyabean oil ( n = 78 ; 30.2% ) , blended vegetable oils ( n = 61 ; 23.6% ) , and olive oil ( n = 52 ; 20.2% ) . canola ( n = 9 ; 3.5% ) , vanaspati ( n = 8 ; 3.1% ) and cotton seed oils ( n = 1 ; 0.4% ) were used infrequently . when extreme and improbable values were excluded , average household fat / oil usage ( n = 229 ; 88.8% ) was 35.0 16.4 ml / day ( range 10.3 - 95.7 ) . table 4 shows characteristics of lower and higher consumers . ratings of the health value of each fat / oil varied ; however , more favorable ratings were associated with a higher reported use of butter ( p < 0.001 ) ; vanaspati ( p = 0.005 ) ; olive oil ( p < 0.001 ) ; soya bean oil ( p = 0.001 ) ; canola ( p = 0.05 ) ; and blended oil ( p < 0.001 ) . basic associations between clinical , biochemical , and behavioral parameters and the amount of fat and oil consumption within the home reported purchases of fast- or take - away food ranged from never to daily ; median iqr 2.0 4.2 days / month . those consuming these foods > 3 times / month ( n = 125 ; 48.4% ) were younger ( 53.2 11.4 years vs. 57.9 9.9 years ; p = 0.001 ) , with higher waist circumference ( 93.7 12.8 cm vs. 89.3 13.4 cm ; p = 0.008 ) and triglycerides ( 168.4 78.0 vs. 144.3 55.8 ; p = 0.006 ) . the most commonly consumed snack foods were roasted chana , sweet biscuits , namkeen , and indian sweets ( data not shown ) . as reported consumption increased and hence did the health rating of nine items . those who believed between - meal snacks assisted their diabetic control ( n = 154 ; 59.7% ) ate more processed snacks ( p < 0.001 ) . from a list of 13 factors subjects rated on a 5-point scale from 1 ( very much ) to 5 ( not at all ) the extent to which each factor influenced their usual eating patterns . the most highly ranked group choices were the health value of food and to control my diabetes ( both median iqr 2.0 1.0 ) , followed by taste and out of habit ( both median iqr 2.0 2.0 ) . those who preferred the taste of one or more high fat / salt foods ( chat potato , samosa , fried chips or pizza ) were younger , of higher bmi and waist circumference , with a higher ldl - cholesterol ( 107.8 37.1 and triglycerides ( data not shown ) than the remainder . over one quarter of respondents ( 26.7% ) were unsure of the definition of simple cho . of those who felt they knew , 98 ( 51.9% ) individuals agreed that simple cho are those digested quickly that are rapidly converted into sugar . a similar number ; however , ( 91 ; 48.1% ) , designated simple cho as those digested slowly that are converted slowly into sugar . of 378 patients approached , 258 completed the study ; a response rate of 68% . the final group included 101 individuals recruited from indraprastha apollo hospital ( 39.1% ) and 157 subjects from medanta medicity . there was no statistical differences between the grouped demographic , anthropometric or biochemical data of subjects recruited from either hospital ( data not shown ) ; therefore , group data were combined . the study group included 185 males ( 71.7% ) and 73 females , mostly older adults who , according to modified asian indian cut - offs , were categorized as obese ( body mass index [ bmi ] > 25 kg / m ) with a high - risk waist circumference ( men > 90 cm , women : > 80 cm ) . no differences in the plasma fasting glucose or hba1c% were apparent between males and females ; however , females recorded higher ldl - cholesterol ( 111.8 38.4 vs. 95.5 35.3 , p = 0.003 ) , hdl - cholesterol ( 43.7 12.0 vs. 37.0 8.6 , p = 0.002 ) , and triglyceride levels ( 161.6 70.2 vs. 153.6 67.7 , p < 0.001 ) . demographic and anthropometric characteristics of the sample of adults with diabetes attending an out - patient appointment ( n=258 ) biochemical parameters of the sample of adults with diabetes attending an out - patient appointment ( n=258 ) of those who responded ( n = 188 ; 72.9% ) , 49.4% reported that - and 44.7% reported of household income was used to purchase food . within the household , the wife was most often responsible for food purchases ( 45% ) , then husband ( 22.1% ) and cooks / servants ( 16.3% ) . wives were most accountable for organizing household meals ( 57% ) ; less so by cooks / servants ( 19.4% ) and husbands ( 11.6% ) . within the group , 155 individuals ( 60.1% ) were vegetarian . compared to non - vegetarians , vegetarians had a smaller waist circumference ( 90.2 13.8 cm vs. 93.5 12.1 ; p = 0.05 ) but did not differ on any other measure ( data not shown ) ; therefore , all individuals were combined for the dietary analysis . table 3 lists the frequency of the group 's meal , snack , and fruit and vegetable consumption . total daily eating episodes ranged from 1 ( 0.4% ) to 8 ( 1.2% ) with the majority reporting 4 ( 36.4% ) or 5 ( 37.6% ) . the average participant consumed a combined total of 4.0 2.0 ( median iqr ) types of fruits and vegetables / day . compared to 4 serves / day of fruit / vegetables ( n = 162 ; 62.8% ) , habitual consumption of 5 serves / day was associated with a smaller waist circumference ( 88.8 13.3 vs. 93.0 13.0 ; p = 0.014 ) and lower household fat usage ( 29.5 12.0 vs. 38.4 17.9 ; p < 0.001 ) . ( p < 0.001 ) as important factors in food choice , and were less likely to indicate number of reported daily meals , snacks , fruits , and vegetables consumed by the total group ( n=258 ) the number of different fats and oils used within the home ranged from 1 to 7 varieties and median iqr 3.0 1.0 varieties per household . the most commonly used fats / oils were desi ghee ( n = 184 ; 71.3% ) , butter ( n = 166 ; 62.0% ) , mustard oil ( n = 139 ; 53.9% ) , sunflower oil ( n = 124 ; 48.1% ) , soyabean oil ( n = 78 ; 30.2% ) , blended vegetable oils ( n = 61 ; 23.6% ) , and olive oil ( n = 52 ; 20.2% ) . canola ( n = 9 ; 3.5% ) , vanaspati ( n = 8 ; 3.1% ) and cotton seed oils ( n = 1 ; 0.4% ) were used infrequently . when extreme and improbable values were excluded , average household fat / oil usage ( n = 229 ; 88.8% ) was 35.0 16.4 ml / day ( range 10.3 - 95.7 ) . ratings of the health value of each fat / oil varied ; however , more favorable ratings were associated with a higher reported use of butter ( p < 0.001 ) ; vanaspati ( p = 0.005 ) ; olive oil ( p < 0.001 ) ; soya bean oil ( p = 0.001 ) ; canola ( p = 0.05 ) ; and blended oil ( p < 0.001 ) . basic associations between clinical , biochemical , and behavioral parameters and the amount of fat and oil consumption within the home reported purchases of fast- or take - away food ranged from never to daily ; median iqr 2.0 4.2 days / month . those consuming these foods > 3 times / month ( n = 125 ; 48.4% ) were younger ( 53.2 11.4 years vs. 57.9 9.9 years ; p = 0.001 ) , with higher waist circumference ( 93.7 12.8 cm vs. 89.3 13.4 cm ; p = 0.008 ) and triglycerides ( 168.4 78.0 vs. 144.3 55.8 ; p = 0.006 ) . the most commonly consumed snack foods were roasted chana , sweet biscuits , namkeen , and indian sweets ( data not shown ) . as reported consumption increased and hence did the health rating of nine items . those who believed between - meal snacks assisted their diabetic control ( n = 154 ; 59.7% ) ate more processed snacks ( p < 0.001 ) . from a list of 13 factors subjects rated on a 5-point scale from 1 ( very much ) to 5 ( not at all ) the extent to which each factor influenced their usual eating patterns . ( both median iqr 2.0 1.0 ) , followed by taste and out of habit ( both median iqr 2.0 2.0 ) . those who preferred the taste of one or more high fat / salt foods ( chat potato , samosa , fried chips or pizza ) were younger , of higher bmi and waist circumference , with a higher ldl - cholesterol ( 107.8 37.1 and triglycerides ( data not shown ) than the remainder . over one quarter of respondents ( 26.7% ) were unsure of the definition of simple cho . of those who felt they knew , 98 ( 51.9% ) individuals agreed that simple cho are those digested quickly that are rapidly converted into sugar . a similar number ; however , ( 91 ; 48.1% ) , designated simple cho as those digested slowly that are converted slowly into sugar . investigation of particular eating patterns and food - related beliefs and associations between ranges of demographic , anthropometric , and biochemical characteristics in this older , well - educated grouping of asian indians living in urbanized regions of new delhi yielded a number of useful findings . while the use of household fats / oils and intakes of processed meals and snacks were common to some respondents , average daily intakes of fruits and vegetables were generally low . intakes of at least three to five servings of non - starchy vegetables plus two to three portion - controlled servings of fruit are recommended . higher intakes of fruits and vegetables were linked with a lower average waist circumference and positively associated with food 's perceived health - value and eating to maintain control of diabetes . those reported to eat according to what they were served , thereby taking less personal food choice responsibility , consumed fewer fruits and vegetables . high ratings of taste as a food choice determinant were younger and showed a preference for processed , high fat foods . this and other studies emphasize the need for personal accountability and active participation in diabetes self - management , the need for more dietary education with the inclusion of those responsible for meal planning , and the benefits of recurring patient review . education should build dietary self - efficacy to change former habits and provide skills in forward planning and decision - making . a study in urban south india also highlighted the role of family support and health - related values in facilitating compliance with recommended diabetes treatment regimes . accurate knowledge about healthy food choice and patterns and monitoring of carbohydrate types and amounts are cornerstones of diabetes management . despite a high level of education and socio - economic advantage , this study group displayed a generally low level of knowledge related to the healthy food choices and the basic concept of simple carbohydrates and dietary fiber . erroneous beliefs regarding the health - valuey of foods also influenced consumption patterns . high health ratings of processed snack foods and the belief that snacking assisted control were associated with higher consumption frequency . an emphasis on small , frequent meals to manage the blood sugar and avoid hypoglycemia if on medication may have driven these beliefs and behaviors . a study based in southern india also reported poor knowledge and diabetes about diabetes and management , more pronounced in females , and those less educated and in lower functioning jobs . inside the home , use of butter and desi ghee , which can contain up to 50% trans fats , was common and high fat snacks were especially common in younger participants . in india , addition of trans fats is currently unrestricted and commonly used in processed oils , biscuits , sweets , convenience and street foods . high consumption of fats , especially trans fats , and saturates has been implicated in the etiology of insulin resistance and glucose intolerance , and poor diabetes management . the ada recommends intakes of saturated fat be 7% of total calories consumed , and trans fat should be minimized . this was a small , cross - sectional study with relatively more men ; thus , the ability to generalize findings is limited . the survey was reliant on memory ; however , respondents asked household members for assistance . although dietary interviews were semi - structured , terminology such as meals and snacks can vary in interpretation , and misreports and bias are possible , and dietary estimates were based on novel calculations , as outlined . strengths include the use of standardized anthropometric and biochemical measures , and a range of novel data in a north indian population with type 2 diabetes . india is not alone in its failure to provide optimal multidisciplinary care of individuals with diabetes . improved counseling skills and more resources allocated to the holistic dietary intervention could encourage beneficial food- and health - related beliefs to support sustained behavior change . future work should test cost - effective approaches to the dietary intervention in asian indian individuals with type 2 diabetes that include assessment of underlying beliefs and determinants of food choice , and strategies for change .

background : almost 15% of india 's urban adult populace now lives with type 2 diabetes . this study aimed to characterize the eating patterns , knowledge , beliefs , and determinants of food choice , and assess associations with the metabolic health among urban asian indians with type 2 diabetes.materials and methods : a cross - sectional study of 258 individuals ( mean age 55.7 10 years ; body mass index 27.1 4.8 kg / m2 ; diabetes duration 10.1 6.5 years ) attending two out - patient clinics in new delhi , india . food - related information was collected during a semi - structured interview . clinical , anthropometric , and biochemical data were recorded.results:beliefs related to health and diabetes played a role determining food choice and dietary patterns ; erroneous views were associated with the poor food choices and greater metabolic perturbations . average consumption of fruits / vegetables was low . intakes were positively associated with intentions to manage diabetes ; inversely associated with the waist circumference and negatively correlated with one 's degree of personal responsibility for food choice . household saturated fat usage was common . high fat intakes were positively associated with the taste preference , ratings of perceived health - value ; waist circumference , glycosylated haemoglobin percentage ( hba1c% ) and lipids.conclusions:strategies to enhance diabetes control among asian indians are required and should encourage fruit / vegetable intake , personal accountability , and consider individual beliefs and preferences . greater emphasis and resources directed to regular dietary and behavioral counseling may assist .

You are an expert at summarizing long articles. Proceed to summarize the following text: micrornas ( mirnas ) are small ( 2123 nt ) non - coding rnas that are important regulators of gene expression . they act by base pairing with partially complementary sites in the mrna of their targets , and either inhibit translation into protein or decrease the stability of the transcript ( 1,2 ) . the number of currently known mirnas in mammalian systems has risen dramatically in the last year , and predictions about their total number in humans amount up to 1000 ( 3 ) . mirnas are transcribed as long primary transcripts ( pri - mirnas ) , some of them being polycistronic , which are processed in the cell nucleus by an enzyme called drosha , yielding precursor mirnas ( pre - mirnas ) that exhibit a characteristic stem loop sequence . these are exported into the cytosol where mature mirnas are generated by the rnase iii - type enzyme dicer , producing a small double - stranded rna from which one strand ( called mirna * ) is quickly degraded , releasing the small single - stranded mirna ( 4 ) . translational inhibition , which seems to be the major mode of action in animals , is performed by a riboprotein complex called rna - induced silencing complex ( risc ) consisting of the mirna and proteins of the argonaute family ( 5,6 ) . mirnas are involved in several cellular processes , including cellular differentiation ( 7,8 ) , organism development ( 9,10 ) and apoptosis ( 11,12 ) . while all of these are conserved in metazoans , the number of conserved mirnas between mammals suggests that there are additional functions only found in vertebrates ( 13 ) , e.g. controlling hematopoietic differentiation ( 14 ) . recent studies provide growing evidence for the involvement of mirnas in cancerogenesis ( 1518 ) . the advantages of argonaute over current databases on mirnas are as follows : it has information on ( i ) origin of a mirna , i.e. in which host gene it is encoded , ( ii ) its expression in different tissues and its known or proposed function , ( iii ) its potential target genes including gene ontology annotation as well as ( iv ) on mirna families and proteins known to be involved in mirna processing . the first release of argonaute contains 839 mirnas from human , mouse and rat . in summary , argonaute is a comprehensive database for mammalian mirnas collecting all available latest information about mirna expression , pre - mirna sequence and length of the stem loop region , function and potential target genes , and is thus providing a valuable platform for quick and efficient access to all important information on the fast growing field of mirna research . through a user - friendly web interface at , as main sources for mirnas and corresponding annotation , we used the mirbase sequence database ( 19 ) . we further checked noncode ( 20 ) and rnadb ( 21 ) for mirnas that were not contained in mirbase::sequences like hsa - mir-350 and hsa - mir-196 - 4 . these have been reported in literature ( 22 ) , but the only information given there is that they are contained within intron 6 of ensg00000143702 . owing to the lack of other information , we also decided not to include them in argonaute . for individual mirnas with direct support in the literature , the details ( sequence , accession number , chromosomal location , etc . ) additional annotation , especially on confirmed or predicted targets of mirnas and on tissue specificity of expression , was entered manually based on primary literature . literature scanning is done on a regular basis using my ncbi ( cubby ) in order to keep the contents of the database up - to - date . a list of studies used for the current version of argonaute is reported in supplementary data ( supplementary table 1 ) . information on mirnas and their targets is contained in different objects in order to be able to map the many - to - many relationships correctly . for each mirna target relation , individual reference to the literature is reported which is kept in a separate table to minimize redundancy . possible queries include exact or wildcard search for an mirna name , batch retrieval based on a text file with mirna names and browsing the entire contents of the database . a selection panel allows to tailor information retrieval by selecting or deselecting fields to be displayed in the output . results of queries are presented in two different tables ( figure 1 ) , one on the mirnas and one on the targets ( provided that target information has been selected for display ) . if the box annotation for targets is unchecked , all predicted targets for a given mirna are presented in one row of the result table , together with all references . if it is checked , there is one row per target gene , including the reference that reported the mirna target relationship , so it can be tracked where the evidence on the relationship has come from . target gene identifiers are linked to ensembl to get information on the transcript assumed to be regulated by a certain mirna . the result field origin is linked to a third table ( figure 1 , inset ) providing comprehensive results on the gene the mirna is contained in ( many mirnas are hosted in introns of protein - coding genes ) . additionally , a detailed list of proteins involved in mirna processing can also be obtained from the homepage . in order to facilitate the characterization of target genes we developed an information retrieval system mainly based on several ncbi sources as well as unigene , swiss - prot and ensembl . this allows us to perform a comprehensive search for each target gene by clicking on the gene name ( figure 2 ) . the major advantage of our interface is that it generates an automated pubmed search using all synonyms of the individual gene ( figure 2 , inset ) . this search can be tailored to an organ - specific search or a search for transgenes / knock - outs . furthermore , information on the availability of the target gene on affymetrix chips is given . the system is implemented as a php - based web interface to an mysql database . it is capable of generating automatic search strings for the target gene in pubmed using several criteria . it is possible to save the results of the search as an excel table for later use . furthermore , the system is able to process a list of genes , which is very convenient when analyzing results of microarray experiments or any experiments yielding a group of related genes . currently , argonaute hosts information on 839 mammalian mirnas from human , mouse and rat , and reports 312 mirna target relationships . we continue to add further information as reported in primary literature and synchronize with mirbase::sequence db ( microrna registry ) every 4 months . we are currently developing an interface for sequence - based search that allows to find potential target sites for mirnas in the query sequence based on established mirna target - prediction algorithms . the upper table provides comprehensive information on the mature mirna and its precursor , the middle table has information on predicted targets of hsa - mir-328 . the inset shows additional information on the origin of this mirna , i.e. the gene it is encoded in . the table provides comprehensive information on the gene , including affymetrix probe set ids , cross - references to other databases , synonyms and textual summary information . the links to pubmed search by all synonyms of the gene , either alone ( inset ) or in combination with ( transgen * or knockout or knock - out ) and ( animals[mh ] or animal [ mh]) to find reports on genetically modified organisms where this gene is altered or deleted .

micrornas ( mirnas ) constitute a recently discovered class of small non - coding rnas that regulate expression of target genes either by decreasing the stability of the target mrna or by translational inhibition . they are involved in diverse processes , including cellular differentiation , proliferation and apoptosis . recent evidence also suggests their importance for cancerogenesis . by far the most important model systems in cancer research are mammalian organisms . thus , we decided to compile comprehensive information on mammalian mirnas , their origin and regulated target genes in an exhaustive , curated database called argonaute ( ) . argonaute collects latest information from both literature and other databases . in contrast to current databases on mirnas like mirbase::sequences , noncode or rnadb , argonaute hosts additional information on the origin of an mirna , i.e. in which host gene it is encoded , its expression in different tissues and its known or proposed function , its potential target genes including gene ontology annotation , as well as mirna families and proteins known to be involved in mirna processing . additionally , target genes are linked to an information retrieval system that provides comprehensive information from sequence databases and a simultaneous search of medline with all synonyms of a given gene . the web interface allows the user to get information for a single or multiple mirnas , either selected or uploaded through a text file . argonaute currently has information on 839 mirnas from human , mouse and rat .

You are an expert at summarizing long articles. Proceed to summarize the following text: although the current composites exhibit excellent physical resistance and esthetic properties , there are still several problems related to shrinkage during polymerization and bacterial invasion . siloranes are popular restorative materials that have been synthesized to overcome the problems related to the polymerization shrinkage . the manufacturer recommends this material to reduce the risk of post - operative sensitivity , cusp deflection and enamel cracks . in the field of dentistry , there has been growing interest in the use of lasers for various applications , including cavity preparation , due to their ability to efficiently remove dentin and enamel . the erbium , chromium : yttrium - scandium - gallium - garnet ( er , cr : ysgg ) laser has been used in a clinical setting to prepare cavities ; it provides the same clinical effectiveness compared with bur , but reduces pain and discomfort by eliminating pressure and intense vibration . furthermore , the er , cr : ysgg laser provides a more conservative method for cavity preparation that is associated with minimal injury to the pulp , less noise and in most cases , a significantly reduced need for local anesthesia . microleakage at the tooth - adhesive interface is another important factor to be considered with respect to the long - term durability of the bonding . when considering a laser for routine use , it is essential that the laser does not adversely influence the marginal integrity of the resulting restoration . the er , cr : ysgg laser uses a pulsed irradiation mode and the energy is delivered through a proprietary flexible fiber to a handpiece , which is attached to a sapphire tip with a diameter of 0.4 or 0.6 mm . during irradiation and between pulses , the tissues are bathed in a water mist spray and this spray is employed for most soft - tissue surgical procedures and when cutting enamel and dentine . laser - induced changes in the surface texture of enamel and dentine could potentially affect the microleakage and bond strength of adhesive restorative materials . the characteristics of the enamel and dentine after irradiation with the er , cr : ysgg laser have been reported to produce an anfractuous surface ( fractured and uneven ) suitable for adhesion , with open tubules , the absence of a smear layer , a scaly appearance or an irregular surface and no thermal injury . the application of the laser to the dentin surface is thought to provide an advantage because of the apparently enlarged surface area available for adhesion following laser irradiation . while some authors believe that the laser may be able to provide restorations that have better microleakage results , greater bond strength and greater longevity than those obtained by the conventional method , others have reported that the laser did not improve adhesive procedures and that it actually hampered them . proposed that the ablation of dentin resulted in fusion of the collagen fibrills , resulting in a lack of interfibrillar space and restricting the diffusion of resin into the subsurface intertubular dentin , which is the most likely explanation for lower bond strengths . shigetani et al . compared the marginal seal of enamel and dentin between cavities prepared by erbium : yttrium - aluminum - garnet ( er : yag ) laser irridiation and drilling and found no significant differences . the effectiveness of lasers and their impact on the adjacent tissues depend on parameter settings , such as the irradiation time , the pulse energy , the pulse repetition rate , the pulse duration , the emission mode , the efficiency of tissue cooling using water , the rates of water and air flow and the distance between the laser device and the tooth surface . several authors have used different power settings for the lasers when comparing the micro - shear bond strength ( sbs ) of composite restorations to tooth surfaces prepared using the er , cr : ysgg laser or a conventional method . the marginal integrity and . currently , none of the available materials and technics are able to prevent microleakage for class v cavities . data on the quality of the margins of composite fillings in relation to the use of an er , cr : ysgg laser for hard tissue preparation have been described . previous studies have shown a significantly improved marginal integrity of silorane - based composite ( sbc ) compared with methacrylate - based composites ( mbcs ) on both enamel and dentin in cavities prepared with a water - cooled high - speed diamond bur . it can be expexted that the differences in surface alterations following the use of laser and conventional bur preparation techniques would influence microleakage and bond strength depending on the composite and adhesive system used . the microleakage and bond strengths of the tooth substrate on er , cr : ysgg lased tooth surfaces that have been reported in the literature are often confusing and even contradictory . therefore , the purpose of this in vitro study was to compare the microleakage and bond strength of class v silorane - based micro - hybrid composite ( filtek silorane ) and universal micro - hybrid composite ( filtek z250 ) restorations prepared either with a conventional diamond bur or with an er , cr : ysgg laser at different power levels . a total of 160 intact human third molar teeth that were free of caries and had no other microscopic defects and were designated for extraction were extracted . the teeth were stored in distilled water at 4c for a maximum of 1 month . to prevent bacterial growth , after surface debridement with hand - scaling instruments and cleaning with a slow - speed hand piece and a brush with pumice , 80 specimens were selected for microleakage assessment and 80 were selected for sbs . a total of 80 teeth were sectioned 2 mm below the cemento - enamel junction with a slow - speed diamond saw sectioning machine ( isomet ; buchler ltd . , lake bluff , illinois , usa ) and the crowns were embadded in autopolymerizing acrylic resin ( meliodent ; bayer dental ltd . , newbury , uk ) with the labial surface facing up for surface treatment and composite bonding . after polymerization of the embadding resin , the buccal surfaces were ground with water - cooled silicon carbide of grit size 400 - 600 and then sequentially polished in a polishing machine ( mecapol p230 , presi tavernoles 38 and brieet angonnes , france ) to produce a uniform smear layer . after it had been confirmed with a stereo - microscope that no dentin was exposed on the enamel surfaces ( nikon se , tokyo , japan ) the enamel surfaces were prepared with a water - cooled high - speed hand piece ( kavo supertorque 630b , kavo co. , biberach , germany ) and a diamond bur ( komet iso 806 314 110524012 ( 836 ) , brasseler gmbh co. , lemgo , germany ) . a surface area of approximately 4 mm 4 mm was prepared in this manner . in groups 2 , 3 and 4 , the enamel surfaces were irradiated with an er , cr : ysgg laser ( waterlase md , biolase technology inc . , san clemente , ca , usa ) under 95% air flow and 85% water flow using a contact tip with a repetition rate of 20 hz ( 20 pulses / s ) and the output power was set to 3 w ( 150 mj / pulse ) , 4 w ( 200 mj / pulse ) or 5 w ( 250 mj / pulse ) , respectively . the er , cr : ysgg laser system was operated at a wavelength of 2,790 nm with pulse duration of 140 - 200 s . the laser energy was delivered through a fiberoptic system to a sapphire tip terminal that was 600 m in diameter and 6 mm long with a tip - to - target distance of 1 mm . to standardize the distances and to control the size of the irradiation area , a 4 mm 4 mm hole was prepared on the surface of the acrylic disc . this acrylic resin with a 4 mm 4 mm hole helps to avoid unnecessary laser irradiation . in each group , half of the samples ( n = 10 ) were restored with filtek silorane ( 3 m espe , st . 7ax ) with the silorane adhesive system ( 3 m espe , seefeld , germany , lot no . 7ae ) while the others were restored with filtek z250 ( 3 m , espe , st . paul , mn , usa ) according to the manufacturer 's instructions [ table 1 ] . summary of the dentin bonding systems and composite resins used for restoration following the respective pretreatment sequences , a teflon tube with an inner diameter of 3 mm and a height of 2 mm was attached to the prepared enamel surfaces . the micro - hybrid composite resin was inserted into the teflon tube incremantally , each polymerized for 40 s ( curing light xl 3000 , 3 m dental products , st . after curing had been completed , the teflon tube surrounding the composite was carefully removed . the samples were stored in distilled water at 37c for 24 h and then subjected to thermocycling for a total of 500 cycles at 5 - 55c with a dwell time of 30 s. the specimens were then tested in shear mode by using a shear knife - edge blade in a universal testing machine ( instron corporation , canton , ma , usa ) with a crosshead speed of 0.5 mm / s . the maximum load to failure was recorded for each sample and the sbs was expressed in megapascals , which is derived by dividing the imposed force newtons ( n ) by the bond area ( mm ) . class v cavities were prepared on both the buccal and lingual surfaces of each tooth , with the occlusal margins in the enamel and the cervical margins located 2 mm apical to the cemento - enamel junction . the cavity dimensions were standardized with a template that was 3 mm wide and 3 mm high . the depth of the cavity was 3 mm and was measured and controlled by a pre - marked periodontal probe . the 80 teeth selected for microleakage were divided into four subgruops ( n = 20 ) . in the first group , class v cavities ( 3 mm 3 mm 3 mm ) prepared on the buccal and lingual surfaces of the teeth using a water - cooled high - speed hand piece and a diamond bur , which was changed after every four preparations . class v cavities were prepared similarly in the other three groups using er , cr : ysgg laser irradiation . the output power parameters for group 2 , 3 and 4 specimens were 3 w ( 150 mj / pulse ) , 4 w ( 200 mj / pulse ) and 5 w ( 250 mj / pulse ) with a repetition rate of 20 hz , respectively . for enamel and dentine cutting , the manufacturer 's recommended settings were used ; namely , for enamel a power of 3 w , 4 w or 5 w was used with 95% air flow and 85% water flow and for dentine , a power of 2 w ( 100 mj / pulse ) , 2.5 w ( 125 mj / pulse ) or 3 w was used with 75% air flow and 65% water flow . in this study , two different composite resins were used to restore the teeth : the filtek silorone and its dedicated adhesive or the silorane adhesive system with a micro - hybrid composite filtek z250 and a total - etch adhesive , adper single bond plus . the composite resins were applied in three increments , against the gingival wall , against the occlusal wall and flush with the contour of the tooth and then covered with a transparent matrix strip ( ruwa matrix strips , demetron research co. , danbury , ct , usa ) . each increment was lightcured for 40 s. finishing was carried out immediately after polymerization using graded soflex discs ( 3 m dental products , st . the specimens were subjected to a thermocycling regimen ; all teeth were then placed in deionized water at 37c for 24 h and thermocycled ( 500 times at 5 2c to 55 2c ; dwell time 15 s and transfer time 10 s ) . the apices of the teeth were sealed with epoxy resin ( struers , copenhagen , denmark ) and the specimens were covered with two coats of nail varnish up to 1 mm from the sealant margins to prevent dye infiltration . the specimens were then immersed in 0.5% basic - fuchsin solution ( wako pure chemical industry ; osaka , japan ) for 24 h at 37c . after being rinsed with distilled water , each specimen was embedded in epoxy resin and subsequently sectioned longitudinally in a bucco - lingual plane through the midpoint of the restorations with a water - cooled , slow - speed diamond saw ( mecatome t201 , presi , france ) to provide two sections of each tooth . the cut sections were examined under a stereo - microscope ( olympus sz 40 , sz - pt , tokyo , japan ) at 20 magnification by two examiners who were unaware of the groupings of the teeth and the teeth were scored using the linear scoring criteria shown in table 2 . both sections of each tooth were examined and the worst scores for both the occlusal ( enamel ) and gingival ( dentine ) margins were used for the data analysis . criteria for microleakage scoring the results were recorded and analyzed using the statistical package statistical package for the social sciences ( spss ) 14.0.0 for windows chicago , il , usa ) . the inter - examiner reproducibility was analyzed with the kappa statistic for microleakage scores . the kruskal wallis test was used for comparing the microleakage scores among the groups and composites in the occlusal and the gingival margins and the sbs data were analyzed using one - way analysis of variance tests at a confidence interval of 95% . a total of 160 intact human third molar teeth that were free of caries and had no other microscopic defects and were designated for extraction were extracted . the teeth were stored in distilled water at 4c for a maximum of 1 month . to prevent bacterial growth , after surface debridement with hand - scaling instruments and cleaning with a slow - speed hand piece and a brush with pumice , 80 specimens were selected for microleakage assessment and 80 were selected for sbs . a total of 80 teeth were sectioned 2 mm below the cemento - enamel junction with a slow - speed diamond saw sectioning machine ( isomet ; buchler ltd . , lake bluff , illinois , usa ) and the crowns were embadded in autopolymerizing acrylic resin ( meliodent ; bayer dental ltd . , newbury , uk ) with the labial surface facing up for surface treatment and composite bonding . after polymerization of the embadding resin , the buccal surfaces were ground with water - cooled silicon carbide of grit size 400 - 600 and then sequentially polished in a polishing machine ( mecapol p230 , presi tavernoles 38 and brieet angonnes , france ) to produce a uniform smear layer . after it had been confirmed with a stereo - microscope that no dentin was exposed on the enamel surfaces ( nikon se , tokyo , japan ) the enamel surfaces were prepared with a water - cooled high - speed hand piece ( kavo supertorque 630b , kavo co. , biberach , germany ) and a diamond bur ( komet iso 806 314 110524012 ( 836 ) , brasseler gmbh co. , lemgo , germany ) . a surface area of approximately 4 mm 4 mm was prepared in this manner . in groups 2 , 3 and 4 , the enamel surfaces were irradiated with an er , cr : ysgg laser ( waterlase md , biolase technology inc . , san clemente , ca , usa ) under 95% air flow and 85% water flow using a contact tip with a repetition rate of 20 hz ( 20 pulses / s ) and the output power was set to 3 w ( 150 mj / pulse ) , 4 w ( 200 mj / pulse ) or 5 w ( 250 mj / pulse ) , respectively . the er , cr : ysgg laser system was operated at a wavelength of 2,790 nm with pulse duration of 140 - 200 s . the laser energy was delivered through a fiberoptic system to a sapphire tip terminal that was 600 m in diameter and 6 mm long with a tip - to - target distance of 1 mm . to standardize the distances and to control the size of the irradiation area , a 4 mm 4 mm hole was prepared on the surface of the acrylic disc . this acrylic resin with a 4 mm 4 mm hole helps to avoid unnecessary laser irradiation . in each group , half of the samples ( n = 10 ) were restored with filtek silorane ( 3 m espe , st . 7ax ) with the silorane adhesive system ( 3 m espe , seefeld , germany , lot no . 7ae ) while the others were restored with filtek z250 ( 3 m , espe , st . paul , mn , usa ) according to the manufacturer 's instructions [ table 1 ] . summary of the dentin bonding systems and composite resins used for restoration following the respective pretreatment sequences , a teflon tube with an inner diameter of 3 mm and a height of 2 mm was attached to the prepared enamel surfaces . the micro - hybrid composite resin was inserted into the teflon tube incremantally , each polymerized for 40 s ( curing light xl 3000 , 3 m dental products , st . after curing had been completed , the teflon tube surrounding the composite was carefully removed . a total of 80 teeth were sectioned 2 mm below the cemento - enamel junction with a slow - speed diamond saw sectioning machine ( isomet ; buchler ltd . , lake bluff , illinois , usa ) and the crowns were embadded in autopolymerizing acrylic resin ( meliodent ; bayer dental ltd . , newbury , uk ) with the labial surface facing up for surface treatment and composite bonding . after polymerization of the embadding resin , the buccal surfaces were ground with water - cooled silicon carbide of grit size 400 - 600 and then sequentially polished in a polishing machine ( mecapol p230 , presi tavernoles 38 and brieet angonnes , france ) to produce a uniform smear layer . after it had been confirmed with a stereo - microscope that no dentin was exposed on the enamel surfaces ( nikon se , tokyo , japan ) the enamel surfaces were prepared with a water - cooled high - speed hand piece ( kavo supertorque 630b , kavo co. , biberach , germany ) and a diamond bur ( komet iso 806 314 110524012 ( 836 ) , brasseler gmbh co. , lemgo , germany ) . a surface area of approximately 4 mm 4 mm was prepared in this manner . in groups 2 , 3 and 4 , the enamel surfaces were irradiated with an er , cr : ysgg laser ( waterlase md , biolase technology inc . , san clemente , ca , usa ) under 95% air flow and 85% water flow using a contact tip with a repetition rate of 20 hz ( 20 pulses / s ) and the output power was set to 3 w ( 150 mj / pulse ) , 4 w ( 200 mj / pulse ) or 5 w ( 250 mj / pulse ) , respectively . the er , cr : ysgg laser system was operated at a wavelength of 2,790 nm with pulse duration of 140 - 200 s . the laser energy was delivered through a fiberoptic system to a sapphire tip terminal that was 600 m in diameter and 6 mm long with a tip - to - target distance of 1 mm . to standardize the distances and to control the size of the irradiation area , a 4 mm 4 mm hole was prepared on the surface of the acrylic disc . this acrylic resin with a 4 mm 4 mm hole helps to avoid unnecessary laser irradiation . in each group , half of the samples ( n = 10 ) were restored with filtek silorane ( 3 m espe , st . 7ax ) with the silorane adhesive system ( 3 m espe , seefeld , germany , lot no . 7ae ) while the others were restored with filtek z250 ( 3 m , espe , st . paul , mn , usa ) according to the manufacturer 's instructions [ table 1 ] . summary of the dentin bonding systems and composite resins used for restoration following the respective pretreatment sequences , a teflon tube with an inner diameter of 3 mm and a height of 2 mm was attached to the prepared enamel surfaces . the micro - hybrid composite resin was inserted into the teflon tube incremantally , each polymerized for 40 s ( curing light xl 3000 , 3 m dental products , st . after curing had been completed , the teflon tube surrounding the composite was carefully removed . the samples were stored in distilled water at 37c for 24 h and then subjected to thermocycling for a total of 500 cycles at 5 - 55c with a dwell time of 30 s. the specimens were then tested in shear mode by using a shear knife - edge blade in a universal testing machine ( instron corporation , canton , ma , usa ) with a crosshead speed of 0.5 mm / s . the maximum load to failure was recorded for each sample and the sbs was expressed in megapascals , which is derived by dividing the imposed force newtons ( n ) by the bond area ( mm ) . class v cavities were prepared on both the buccal and lingual surfaces of each tooth , with the occlusal margins in the enamel and the cervical margins located 2 mm apical to the cemento - enamel junction . the cavity dimensions were standardized with a template that was 3 mm wide and 3 mm high . the depth of the cavity was 3 mm and was measured and controlled by a pre - marked periodontal probe . the 80 teeth selected for microleakage were divided into four subgruops ( n = 20 ) . in the first group , class v cavities ( 3 mm 3 mm 3 mm ) prepared on the buccal and lingual surfaces of the teeth using a water - cooled high - speed hand piece and a diamond bur , which was changed after every four preparations . class v cavities were prepared similarly in the other three groups using er , cr : ysgg laser irradiation . the output power parameters for group 2 , 3 and 4 specimens were 3 w ( 150 mj / pulse ) , 4 w ( 200 mj / pulse ) and 5 w ( 250 mj / pulse ) with a repetition rate of 20 hz , respectively . for enamel and dentine cutting , the manufacturer 's recommended settings were used ; namely , for enamel a power of 3 w , 4 w or 5 w was used with 95% air flow and 85% water flow and for dentine , a power of 2 w ( 100 mj / pulse ) , 2.5 w ( 125 mj / pulse ) or 3 w was used with 75% air flow and 65% water flow . in this study , two different composite resins were used to restore the teeth : the filtek silorone and its dedicated adhesive or the silorane adhesive system with a micro - hybrid composite filtek z250 and a total - etch adhesive , adper single bond plus . the composite resins were applied in three increments , against the gingival wall , against the occlusal wall and flush with the contour of the tooth and then covered with a transparent matrix strip ( ruwa matrix strips , demetron research co. , danbury , ct , usa ) . each increment was lightcured for 40 s. finishing was carried out immediately after polymerization using graded soflex discs ( 3 m dental products , st . class v cavities were prepared on both the buccal and lingual surfaces of each tooth , with the occlusal margins in the enamel and the cervical margins located 2 mm apical to the cemento - enamel junction . the cavity dimensions were standardized with a template that was 3 mm wide and 3 mm high . the depth of the cavity was 3 mm and was measured and controlled by a pre - marked periodontal probe . the 80 teeth selected for microleakage were divided into four subgruops ( n = 20 ) . in the first group , class v cavities ( 3 mm 3 mm 3 mm ) prepared on the buccal and lingual surfaces of the teeth using a water - cooled high - speed hand piece and a diamond bur , which was changed after every four preparations . class v cavities were prepared similarly in the other three groups using er , cr : ysgg laser irradiation . the output power parameters for group 2 , 3 and 4 specimens were 3 w ( 150 mj / pulse ) , 4 w ( 200 mj / pulse ) and 5 w ( 250 mj / pulse ) with a repetition rate of 20 hz , respectively . for enamel and dentine cutting , the manufacturer 's recommended settings were used ; namely , for enamel a power of 3 w , 4 w or 5 w was used with 95% air flow and 85% water flow and for dentine , a power of 2 w ( 100 mj / pulse ) , 2.5 w ( 125 mj / pulse ) or 3 w was used with 75% air flow and 65% water flow . in this study , two different composite resins were used to restore the teeth : the filtek silorone and its dedicated adhesive or the silorane adhesive system with a micro - hybrid composite filtek z250 and a total - etch adhesive , adper single bond plus . the composite resins were applied in three increments , against the gingival wall , against the occlusal wall and flush with the contour of the tooth and then covered with a transparent matrix strip ( ruwa matrix strips , demetron research co. , danbury , ct , usa ) . each increment was lightcured for 40 s. finishing was carried out immediately after polymerization using graded soflex discs ( 3 m dental products , st . the specimens were subjected to a thermocycling regimen ; all teeth were then placed in deionized water at 37c for 24 h and thermocycled ( 500 times at 5 2c to 55 2c ; dwell time 15 s and transfer time 10 s ) . the apices of the teeth were sealed with epoxy resin ( struers , copenhagen , denmark ) and the specimens were covered with two coats of nail varnish up to 1 mm from the sealant margins to prevent dye infiltration . the specimens were then immersed in 0.5% basic - fuchsin solution ( wako pure chemical industry ; osaka , japan ) for 24 h at 37c . after being rinsed with distilled water , each specimen was embedded in epoxy resin and subsequently sectioned longitudinally in a bucco - lingual plane through the midpoint of the restorations with a water - cooled , slow - speed diamond saw ( mecatome t201 , presi , france ) to provide two sections of each tooth . the cut sections were examined under a stereo - microscope ( olympus sz 40 , sz - pt , tokyo , japan ) at 20 magnification by two examiners who were unaware of the groupings of the teeth and the teeth were scored using the linear scoring criteria shown in table 2 . both sections of each tooth were examined and the worst scores for both the occlusal ( enamel ) and gingival ( dentine ) margins were used for the data analysis . the results were recorded and analyzed using the statistical package statistical package for the social sciences ( spss ) 14.0.0 for windows the kruskal wallis test was used for comparing the microleakage scores among the groups and composites in the occlusal and the gingival margins and the sbs data were analyzed using one - way analysis of variance tests at a confidence interval of 95% . the distributions of marginal leakage scores according to the groups are presented in table 3 and descriptive statistics , including the median ( min - max ) and the statistical differences are shown in table 4 . the mean values and standard deviations of the sbs for each experimental group are shown in table 5 . microleakage scores of all cavities descriptive statistics for marginal microleakage shear bond strengths ( mean sd , mpa ) of the tested materials in all groups no statistically significant differences were found ( p > 0.05 ) between the methods of preparation ( groups ) and the composites regarding microleakages in either the occlusal or the gingival margins or in the bond strength values for diamond bur and the er , cr : ysgg laser at different power levels . although no significant differences were found between the composites , silorane exhibited slight microleakages and higher sbs values compared with filtek z250 ( p > 0.05 ) . this study was conducted to compare the sbs and microleakage of silorane and micro - hybrid composite restorations prepared with a conventional diamond bur or er , cr : ysgg laser using different power levels . the results of the present study showed that composite restorations prepared with diamond bur and laser at different power levels may result in similar bond strength and microleakage , silorane exhibited similar microleakage and sbs values compared with micro - hybrid composite . it was reported that acid etching produces a hybrid layer and the characteristic funnel - shaped resin tags , regardless of the type of surface preparation ( bur / laser ) . in their study , assessed the influence of er : yag laser irradiation on the sbs between a total etch adhesive system and lased primary dentin . showed that the values of the sbs of bur - prepared dentin surfaces that were treated either with acid , with an er : yag laser or with an er : yag laser and acid did not differ significantly , whereas trajtenberg et al . reported the highest bond strengths when the tooth surfaces were acid - etched after preparation with either a laser or a bur prior to the application of the bonding agent . found that er : yag laser irradiation did not adversely affect the sbs of single bond 2 or clearfil protect bond to dentin , but it positively affected the bond strength of clearfil tri - s bond . in their study , da silva et al . found similar results in all groups a one - step adhesive was not used in our study , but the results for the other materials were comparable . in our study , the bond strengths of all the laser - treated samples were similarly to those prepared with the bur . although no significant differences were found between the composites , silorane ( with two - step self - etch silorane adhesive ) showed slight microleakage and higher bond strength values when compared with filtek z250 ( the total - etch system ) . found that despite the lower level of enamel etching associated with the self - etching adhesive primer , the etching pattern was able to produce bond strength values similar to those obtained with the etch - and - rinse adhesive system . in addition , it is well - known that smear layers can not be occurred after the laser irradiation . in our study , the laser groups were restored either silorane or filtek z250 . this may also be explained by the fact that the tested teeth had a similar surface morphology after the laser application . the laser creates rough surfaces free of smear layer , extensive surface fissuring , less homogeneous and regular surface patterns . in the current study , furthermore , acid etching was also performed after the laser application . in some previous studies , laser application was used as a pretreatment alone , without acid etching , but there was not any increase in the bond strengths . this may be the similar to the effect of laser and bur preparation whereby the surface roughness is increased before the total - etch adhesives are applied . microleakage is a well - known phenomenon that occurs with time and is often responsible for the post - operative sensitivity , discoloration and recurrence of caries in a restored teeth . several studies have shown that the microleakage is minimal when the bonding between the restoration and the tooth is adequate . several previous studies similar to ours investigated the effects of preparation with an erbium laser and convantional burs on marginal microleakage . some of these studies found that lasers produced equal or better microleakage scores than burs , and other studies have reported the opposite . similar to our study , marotti et al . stated that preparing the class v cavity with either a conventional technique using burs or with an er , cr : ysgg laser had the same effectiveness in terms of microleakage . investigated the effects of preparation with an er : yag laser or a diamond bur on microleakage in human teeth in vitro . the results of our study agree with the findings of these previous studies . a potential explanation for these results could be that studies on surface alterations of enamel and dentine after er , cr : ysgg laser irradiation demonstrate the micro - irregularities on both tissues and the lack of a smear layer . laser - induced changes in the surface texture of the enamel and dentine could potentially affect the microleakage of adhesive restorative materials . on the other hand , gutknecht et al . demonstrated that the bond strength is significantly weaker when tooth surfaces are prepared with the er , cr : ysgg laser compared with a diamond bur . lin et al . explained that the er , cr : ysgg laser ablates hard tissues thermomechanically by making micro - explosions within the inorganic structures of the teeth . proposed that ablation of dentin fuses collagen fibrils together , resulting in the lack of an interfibrillar space and preventing resin from diffusing into the subsurface of the intertubular dentin . furthermore , studies on the sbs showed that the er : yag laser created a laser - modified layer that adversely affected the adhesion to dentin . in their study , korkmaz et al . demonstrated that the use of a er : yag laser for cavity preparation may interfere with the marginal sealing , as lased cavities showed a higher degree of leakage than those of conventionally bur - prepared teeth at the occlusal margin . the findings of ozel et al . suggest that the use of an er : yag laser for cavity preparation may decisively interfere with the marginal sealing , as lased cavities showed a higher degree of leakage than those of conventionally bur - prepared teeth at both the enamel and the cementum margins . laser treatment did not have an additional effect on the bond strengths of the tested groups in the present study . the discrepancies between our results and those of previous studies may be attributed to different testing methods and conditions , the varying nature of dentin as a substrate , the composite adhesive used or differences between the lasers and their energy parameters . several studies have assessed the ability of different settings of erbium lasers to improve marginal seal and bond strength . used different power settings of the er , cr : ysgg laser and compared the micro - sbs of composite restorations to tooth surfaces with restorations prepared by the conventional method . they reported a wide range of standard deviations in the laser groups , making it difficult to draw conclusions by comparing the results . in their study , baaran et al . showed that laser irradiation with lower power outputs demonstrated lower sbs while higher outputs showed higher sbs . . showed that the er : yag laser irradiation parameters and pulse widths used for cavity preparation had no influence on the microleakage of composite resin restorations and scanning electron microscopy analysis of the morphology of cavities revealed a more conservative pattern resulting from the laser than from the conventionally preparation method . compared the acid - etch technique with laser enamel etching at two different power settings ( 1 w , 2 w-20 hz ) . the results indicate that etching of enamel surface with an er , cr : ysgg laser yielded statistically similar lower and less predictable bond strengths than etching with acid . baaran et al . discussed these contradictory findings and the possible effects of differences in the types of lasers used , the duration of exposure , the energy applied to the surface and the experimental design . in the present study , silorane and micro - hybrid composite were compared with respect to the microleakage and bond strength in cavities prepared with a laser and a conventional bur . it was found relatively lower microleakage in the silorane groups compared with the micro - hybrid composites . the microleakage may be partly compensated for by the low shrinkage stress due to the silorane - based composite . the two - step self - etch silorane adhesive bonding material has less technical sensitivity than the total - etch system . although the dental laser is popular in the dental literature , the specific advantages of its use for increasing bond strength or eliminating microleakage remain unclear and in vivo studies are required . within the limitations of this in vitro study , it was concluded that composite restorations prepared with a diamond bur resulted similar bond strength and microleakage compared with laser at different power levels . in addition , silorane ( with two - step self - etch silorane adhesive ) exhibited similar microleakage and sbs values compared with filtek z250 ( with the total - etch system ) .

objective : the aim of this in vitro study was to compare the microleakage and bond strength of class v silorane - based and universal micro - hybrid composite restorations prepared either with diamond bur or with an erbium , chromium : yttrium - scandium - gallium - garnet ( er , cr : ysgg ) laser.materials and methods : a total of 160 molar teeth were used for microleakage assessment and shear bond strength ( sbs ) test . the specimens were prepared using either diamond bur or 3 w- , 4 w- and 5 w-20 hz er , cr : ysgg laser irradiation . all specimens were subjected to thermocycling ( 500 times at 5 2c to 55 2c , dwell time 15 s and transfer time 10 s ) . microleakage was assessed using a 0.5% basic - fuchsin solution . the bond strengths were determined using a microtensile tester at a crosshead speed of 0.5 mm / min . the kruskal wallis test was used for the analysis of microleakage and a one - way analysis of variance test was used to analyze the sbs ( p < 0.05).results : no statistically significant differences were found ( p > 0.05 ) between er , cr : ysgg laser and bur preparation methods regarding microleakage and bond strength values.conclusion:irradiation with er , cr : ysgg laser was confirmed to be as effective as conventional methods for preparing cavities before adhesive restorations .

You are an expert at summarizing long articles. Proceed to summarize the following text: emergency department universiti kebangsaan malaysia medical centre ( ed ukmmc ) started the em postgraduate program in 2005 . the emergency department is made up of various levels of health care professionals consisting of emergency specialists ( emergency physicians , anaesthesiologists and orthopaedic surgeons ) , non - specialist service medical officers , em post - graduate trainees , paramedics and nurses . all ed ukmmc resuscitations were managed using a team approach according to recognised international guidelines ( advanced cardiac life support , paediatric advanced life support and advanced trauma life support ) . besides the compulsory life - support training , the department also provides in - house airway training in the form of manikin simulation . the postgraduate trainees in em also undergo a 6-month anaesthetic posting during their first year of training . airway management is an important part of the management of the critically ill and injured in the emergency department ( ed ) . numerous studies from developed countries have demonstrated the competency of emergency doctors in establishing a definitive airway [ 211 ] in their settings , but there is currently no published data on definitive ed airway management in malaysia . the general objective of this study was to describe the current practice of definitive airway management in the ed ukmmc . the specific objectives were to determine the success rates of endotracheal intubation and to describe the immediate complications . this was an observational study performed in the ed ukmmc from 7 august 2007 till 28 august 2008 . the exclusion criteria were pre - intubated patients transferred from other hospitals or other places beside the ed ( i.e. , wards or clinics ) , any missed documentation of intubation events and incomplete data . a standardised form was filled in by ed health care professional after performing endotracheal intubation . the information collected was patient age , sex , estimated weight , indication for intubation , number of attempts , technique of definitive airway management , all medications used to facilitate intubation and immediate complications of intubations . the level of training and specialty of the professional performing the intubation were also documented . for the purpose of this study , methods of airway management were initially classified into orotracheal intubation ( oti ) , rapid sequence intubation ( rsi ) , nasotracheal intubation ( nti ) and cricothyrodotomy ( cr ) . orotracheal intubation ( oti ) was defined as oral intubation using direct laryngoscopy with or without the use of a sedative agent . rapid sequence intubation ( rsi ) was defined as oral intubation using direct laryngoscopy with the use of sedative and rapid onset neuromuscular blocking agent to facilitate intubation . cricothyrodotomy was defined as emergency incision through the skin and cricothyroid membrane to secure the airway . ed ukmmc maintains different types and sizes of laryngoscope blades ( magill and macintosh ) , varying sizes of endotracheal tubes and classic laryngeal masks ( lma ) as standard equipment for both adult and paediatric airway management . these include the mccoy laryngoscope , intubating lma , proseal lma , gum elastic bougie , flexible fibreoptic scope , and instruments for cricothyrodotomy and transtracheal jet ventilation . intravenous anaesthetic agents and muscle relaxants available are midazolam , propofol , etomidate , sodium thiopentone , ketamine , suxamethonium and rocuronium . an attempt at intubation was defined as placement of a laryngoscope into the patient s airway followed by the insertion of an endotracheal tube . the methods for confirmation of endotracheal intubation were direct visualisation of an endotracheal tube passing through the vocal cords and five - point auscultation . difficult intubation for this study was defined as either an intubation requiring more than two attempts or the usage of alternative intubation techniques . immediate complications post - intubation include significant changes in the physiological status and technique - related events . desaturation was defined as a decrease in oxygen saturation by pulse oximetry to less than 90% . hypotension was defined as a drop in systolic blood pressure to less than 90 mmhg that could not be accounted for by other mechanisms ( e.g. , acute haemorrhage ) or any reduction more than 20% from the baseline . endobronchial intubation was recorded to have occurred if the chest radiograph indicated that the tip of the endotracheal tube was in a mainstem bronchus or when the air entry to both lungs equalised after readjusting endotracheal tube level . a pneumothorax was considered to be a complication if it was identified on a post - intubation chest radiograph in the absence of chest trauma to the affected side . any damage to the teeth that was attributable to laryngoscope use was considered as intubation - associated dental trauma . during this study period , the ed ukmmc received a total of 70,356 patients , 12,712 ( 18.1% ) of whom were admitted . the proportion of patients requiring triage 1 ( the highest priority for care ) was 1,506 ( 2.1% ) , with 374 patients intubated in ed ukmmc during the 12-month and 3-week study period . only 302 intubations were recorded prospectively ; however , only 228 patients had complete documentation based on the study protocol . table 1 summarises the demographic characteristics of the patients in terms of age and their main condition for admission , i.e. , medical or trauma . the ages of the patients ranged from newborns to 93 year olds . the mean age of patients intubated was 46.7 years ( ci 43.8149.58 ) years . the ratio of trauma to medical cases in the study sample was 1 : 2.4 . the paediatric population represented 4.4% ( n = 10 ) of the total number of intubated patients . table 1demographic characteristics of intubated patientsage ( years)number of patients ( % ) number of patientsmedical disorderstrauma110 ( 4.4)100>1125 ( 2.2)1413177 ( 3.1)341864149 ( 65.4)93566557 ( 25.0)543total22816167 demographic characteristics of intubated patients table 2 summarises the main indications for intubation . rapid sequence intubation was the method of choice in patients with head injury and respiratory failure . table 2indications for intubation and the different methods of intubation : rsi , oti and oti with sedationindication for intubationfrequency ( % ) otioti with sedationrsimedicalcardiopulmonary arrest81 ( 35.5%)8100respiratory failure35(15.4%)3626cva / ich16 ( 7.0%)1015severe sepsis / septic shock14 ( 6.1%)248poisoning13 ( 5.7%)0310status epilepticus2 ( 0.9%)002traumahead injury42 ( 18.4%)4335polytrauma22 ( 9.6%)8014burn / inhalation injury3 ( 1.3%)003total2289916113 indications for intubation and the different methods of intubation : rsi , oti and oti with sedation of the 228 intubated cases , 79.8% were successfully done on the first attempt , while 17.5% and 2.6% were successfully performed on the second and third attempts , respectively . table 3 summarises the level of training and specialties of the health care professionals intubating and their success rates . there appears to be no apparent difference in the success rates among the non - specialist ed health care professionals . table 3health care professionals who performed intubations in ed ukmmchealth care professionalnumber of successful intubationstotal number of attemptspercentage of successful 1st attempts ( % ) final success rate in percentage ( % ) service medical officers8711277.077.7em trainees11013580.681.5emergency specialists1616100100doctors from other specialties55100100paramedics101283.383.3total228280 health care professionals who performed intubations in ed ukmmc table 4 shows that midazolam was the most common induction agent used , followed by propofol . table 4agents used for intubationname of agentfrequencyrsioti with sedationsuxamethonium109rocuronium6midazolam8611propofol132etomidate111thiopentone8diazepam31fentanyl866 agents used for intubation table 5 summarises the immediate complications of intubation in 34 patients . in these 34 patients , there were 38 immediate adverse events . of these , 33 patients were managed by ed personnel , and 1 patient was intubated by an anaesthetic trainee . the most common complication was oesophageal intubation , all cases of which were immediately recognised and interventions carried out . table 5immediate complicationseventfrequencycardiac arrest0dental and oral trauma2desaturation10oesophageal intubation15hypotension8endobronchial intubation3total38 immediate complications of 228 intubated patients , 106 ( 46.5% ) were admitted to critical care units , which comprised of the general intensive care unit , cardiac care unit , paediatric intensive care unit and burns care unit . twenty patients ( 8.8% ) were transferred to the ward , while 6 ( 2.6% ) patients had to be transferred out to other hospitals due to inavailability of critical care beds in ukmmc . ventilation of patients in the general ward was acceptable at ukmmc because of the limited availability of critical care beds . there were 96 ( 42% ) deaths within 24 h of admission ; 67 of these patients arrived at the ed with cardiac arrest . there was no published literature available describing ed intubation practices in malaysia . in this study , the mean age of the medical patients was 56 years 26 , while for trauma patients it was 29 years 21 . the mean age of our trauma patients was consistent with the general data on national trauma - related injury . there was an apparent difference in the mean age of intubated patients in our study ( 46.7 years ) , which is less compared to that of other asian countries , e.g. , hong kong ( 60.7 years ) and singapore ( 63 years ) [ 7 , 11 ] . all the patients in this study except for five were intubated by ed doctors and paramedics . the five patients were one neonate , one trauma and three medical - related cases . in the neonatal case , an urgent request for assistance was made to the neonatal intensive care doctor as the ed doctors on duty were inexperienced in performing intubation . in the trauma patient , as the trauma team was activated early in the resuscitation efforts , the attending anaesthetist performed the intubation . in one medical case , the patient had a terminal condition and was deemed unsuitable for intubation and active resuscitation by the ed doctors . however , the medical consultant decided to intubate the patient with the assistance of the anaesthesia team . another medical patient who was deemed to have a difficult airway because of limited neck mobility was also intubated by the anaesthetist electively . the third medical patient was intubated by the anaesthetist colleague because the ed doctors were occupied with other major resuscitation cases . data from united kingdom ( uk ) surveys indicate a significant prevalence of anaesthetist - performed rsis , although there was an increasing trend of emergency physician - performed rsis [ 4 , 9 , 10 ] . in a 1-year survey carried out from 19951996 , emergency residents and physicians in a single united states ( us ) ed performed 93% of intubations with minimal immediate complications . in a university hospital in glasgow , uk , only 31% of rsi in eds were undertaken by emergency physicians , while the majority were still being performed by anaesthetists in 1999 . intubation rates in the same hospital by emergency physicians increased to 75% in 2003 , and the complication rates decreased over the 5 years . in a smaller survey in the uk published in 2001 , emergency physicians performed 26% of rsis with minimal complication rates . in a study conducted in a single us ed , success rates of intubation of trauma patients by emergency physicians were similar to those of anaesthetists . a 2-year study from 1999 to 2001 conducted in eds of seven scottish teaching hospitals revealed that anaesthetists achieved more good views at laryngoscopy with higher initial success rates during rsi than emergency physicians . a study done in an ed of a district general hospital in scotland from 2003 to 2006 demonstrated similar findings . this study revealed that the success rate of intubation on first attempts by em trainees in ed ukmmc was 80.6% , which is slightly lower than a study done by sagarin on north american em residents ( 83% ) . the percentages of successful intubation on the third or more attempt in hong kong , singapore and thailand were 5% , 4% and 1.9% , respectively [ 7 , 11 , 13 ] . in one of our six patients with a difficult intubation , a cormack lehane ( cl ) i view was documented in which the initial two unsuccessful attempts were attributed to excessive external laryngeal pressure using backward , upward and right position manoeuvres ( burp ) , obliterating the view . in another patient , a gum elastic bougie was used in one of the two patients with a cl grade iii view , while the other was successfully intubated with the blind oral intubation technique . two patients with a cl grade iv view were intubated with a gum elastic bougie and intubating lma , respectively . the patient who was finally intubated with an intubating lma was obese , weighing about 100 kg . in this study , most of the patients were intubated using rsi ( 49.5% ) , followed by oti without any pharmacological agents ( 43.4% ) . this oti figure was higher compared to those reported in two different studies in north america ( 11% and 15.2% ) [ 3 , 6 ] . however , the oti rate in hong kong was comparable ( 111 out of 214 patients ) . this may be due to the fact that nearly all of the otis in our centre were performed in cases of cardiopulmonary resuscitation . the other anaesthetic agents , such as propofol and etomidate , were more frequently used by em trainees than by service medical officers . this may be explained by the fact that em trainees were exposed to a variety of anaesthetic agents during the 6-month anaesthetic / intensive care rotation in the first year of training . the muscle relaxant of choice in rsi was suxamethonium , which is the standard practice worldwide [ 3 , 7 ] . the actual complication rate in our series was 14.9% ( 38/228 ) , which was higher than the 9.3% rate observed in the us and 10% in a hong kong survey . the most common documented complications were oesophageal intubation , desaturation and hypotension , which were similar to those observed in the uk , north america and hong kong [ 3 , 6 , 7 ] . first , there was difficulty getting the health care personnel to comply with the documentation requirement of the intubation processes in the standard form , which include incomplete documentation of physiological parameters of pre- and post - intubation events . this resulted in 146 out of 374 ( 39% ) patients being excluded from the analysis because of missing or incomplete data . the second limitation was that most of the data collected were based on reports from different levels of health care professionals , thus contributing to bias .

backgroundairway management is an important part of the management of the critically ill and injured patients in the emergency department ( ed ) . numerous studies from developed countries have demonstrated the competency of emergency doctors in intubation . to date there have been no published data on intubations performed in eds in malaysia.methodsdata on intubations from 7 august 2007 till 28 august 2008 were prospectively collected.resultsthere were 228 intubations included in the study period . cardiopulmonary arrest was the main indication for intubation ( 35.5% ) . the other indications were head injury ( 18.4% ) , respiratory failure ( 15.4% ) , polytrauma ( 9.6% ) and cerebrovascular accident ( 7.0% ) . all of the 228 patients were successfully intubated . rapid sequence intubation ( rsi ) was the most frequent method ( 49.6% ) of intubation . a total of 223 ( 97.8% ) intubations were done by ed personnel . in 79.8% of the cases , intubations were successfully performed on the first attempt . midazolam was the most common induction agent used ( 97 patients ) , while suxamethonium was the muscle relaxant of choice ( 109 patients ) . there were 34 patients ( 14.9% ) with 38 reported immediate complications . the most common complication was oesophageal intubation.conclusionemergency department ukmmc personnel have a high competency level in intubation with an acceptable complication rate . rsi was the most common method for intubation .

You are an expert at summarizing long articles. Proceed to summarize the following text: patients receiving hemodialysis are exposed to a large volume of dialysis fluid ( approximately 120 l ) in a single dialysis treatment ( 1 ) . the presence of a nonselective semipermeable membrane , which acts as a barrier between blood and dialysis fluid , provides a direct route for transformation of contaminants into the blood stream . consequently , many of permitted levels of chemical substances in drinking water are potentially dangerous for dialysis patients ( 2 ) . some of these chemicals such as calcium , nitrate , sulfate and chloramines cause well - defined acute or chronic poisoning syndromes for these patients ( 3 ) . aluminum overload may also lead to encephalopathy , bone disease and anemia in dialysis patients ( 4 ) . to minimize patient exposure to potential contaminants of drinking water therefore , additional purification treatment is necessary for water used in dialysis . a series of purification processes such as deionization , carbon filtration and reverse osmosis ( ro ) are generally used to remove chemical pollutants from water used in hemodialysis . these processes are also an effective barrier against microbiological contaminants ( 5 ) . in addition , tubing system ( hydraulic circuit ) of the dialysis machines could promote bacterial growth and biofilm formation . biofilm acts as a source of bacterial fragments such as dna and endotoxin which are released into the water and potentially able to penetrate dialysis membranes ( 1 , 6 ) . cytokine induction causes acute symptoms and has been incriminated in the various dialysis - related complications of patients such as dialysis - related amyloidosis , malnutrition inflammation and atherosclerosis syndrome ( 7 , 8) . therefore , the quality of dialysis fluid is a critical factor in the overall care received by dialysis patients and bacteriological quality particularly , has a strong effect on the patient health and outcome ( 4 , 7 ) . to prevent patients from risks of water contaminants a number of standards for quality of dialysis water and fluid have been proposed ( 2 ) . the association for the advancement of medical instrumentation ( aami ) standards have represented the most widely standards for the chemical and microbial quality of dialysis water ( 2 , 3 ) . over the last decade , a number of studies aimed at evaluating the quality of dialysis water and fluid , especially microbial quality , have been performed in developed countries ( 3 , 5 , 9 ) . performed a survey on microbiological and chemical quality of the dialysis water in seven dialysis wards in vienna , austria . they observed an increase in endotoxin levels after the water had passed through the tubing system of dialysis machines . they reported that a satisfactory chemical water quality for dialysis could be obtained only by the combination of ion exchange and reverse osmosis ( 9 ) . a study in 2 dialysis facilities showed viable cell counts of dialysis fluids were less than 10 cfu / ml but colonies were not formed after passing the endotoxin retentive filters ( 1 ) . microbiological results from the central plant and piping ring of 5 dialysis units have led to an improvement in microbiological quality of water subsequent to changes made in the use of materials and procedures . besides , these changes have a positive impact on the microbiological quality of dialysis patients over a 15-yr period ( 5 ) . based on these premises , the present study was undertaken to investigate the chemical and bacteriological quality of dialysis water and fluid in dialysis centers of five hospitals in isfahan , iran . since , identification of bacteria could be important for assessment of health risks associated with the presence of pathogens and opportunistic bacteria in dialysis fluid ( 10 ) ; the identification of predominant bacteria was also performed . in a cross - sectional study , the bacteriological and chemical quality of the water used in dialysis centers of five hospitals in isfahan , iran was analyzed over a 5-month period in 20112012 . all of centers received water from the municipal drinking water network and used a water purification system consisted of deionization , activated carbon filtration and reverse osmosis . a total of 30 water samples were collected from the input of dialysis water purification system ( municipal drinking water ) and at the end of purification system after ro ( dialysis water ) . chemical analyses ( concentration of calcium , magnesium , copper , lead , zinc , chromium , cadmium , aluminum , nitrate , sulfate , fluoride , chloramines and free chlorine ) were performed monthly on the water samples over a period of 3 months . residual free chlorine ( rc meter , rc-24p ) was determined at the time of sample collection . the concentration of nitrate , chloramines , sulfate , calcium , magnesium , aluminum and fluoride was assayed by dr5000 ( hach company , usa ) . iron , zinc , cadmium , chromium and lead concentrations were measured by flame atomic absorption spectrophotometery ( perkin - elmer 2380 ) . all chemical tests were performed according to the drinking water analyses recommended by standard methods ( 11 ) . bacteriological quality ( heterotrophic plate count and endotoxin concentration ) of drinking water , dialysis water and dialysis fluid of 40 machines in five centers were monitored . the sample port was disinfected with alcohol and allowed to run for 2 min before sampling . samples were transferred to the laboratory in an insulated box with cooling packs and were processed immediately after arrival at the laboratory . for heterotrophic plate count , water samples were taken in sterilized 100 ml glass bottles . fifty ml of water samples were concentrated by centrifugation and aliquots of concentrated and non - concentrated samples were spread plated on r2a agar medium and incubated at 35 c for 35 days . following incubation , colonies were counted on each plate and results were expressed as colony - forming units per milliliter ( cfu / ml ) ( 11 ) . bacterial colonies were also characterized based on the colony and cell morphology on the agar plates and gram - staining . ten ml of each sample was also taken into a sterile pyrogen free tube for endotoxin analysis . endotoxin test was carried out using limulus amebocyte lysate ( lal ) by the gel the endotoxin ( et ) levels for the positive samples were being made semi - quantitative by dilution of the samples with endotoxin free water . predominant bacteria of dialysis fluid were isolated and sub - cultured onto r2a agar plates based on their gram - stain and colony morphology . the isolated colonies were suspended in 100 l of deionized water , and genomic dna was extracted by boiling for 15 min and centrifugation at 13,000 rpm for 5 min . the supernatant was used for pcr amplification with eubac 27f and 1492 r primers , which amplify a 1,420 bp fragment of the 16s rrna gene ( 12 ) . dna sequencing of the amplified gene was performed , and dna sequences analysis was undertaken by blast algorithms and databases from the national center for biotechnology information ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) . significant difference between the analyzed parameters in raw drinking water and dialysis water and also with standard values was tested using t - test a total of 30 water samples were collected from the input of dialysis water purification system ( municipal drinking water ) and at the end of purification system after ro ( dialysis water ) . chemical analyses ( concentration of calcium , magnesium , copper , lead , zinc , chromium , cadmium , aluminum , nitrate , sulfate , fluoride , chloramines and free chlorine ) were performed monthly on the water samples over a period of 3 months . residual free chlorine ( rc meter , rc-24p ) was determined at the time of sample collection . the concentration of nitrate , chloramines , sulfate , calcium , magnesium , aluminum and fluoride was assayed by dr5000 ( hach company , usa ) . iron , zinc , cadmium , chromium and lead concentrations were measured by flame atomic absorption spectrophotometery ( perkin - elmer 2380 ) . all chemical tests were performed according to the drinking water analyses recommended by standard methods ( 11 ) . bacteriological quality ( heterotrophic plate count and endotoxin concentration ) of drinking water , dialysis water and dialysis fluid of 40 machines in five centers were monitored . the sample port was disinfected with alcohol and allowed to run for 2 min before sampling . samples were transferred to the laboratory in an insulated box with cooling packs and were processed immediately after arrival at the laboratory . for heterotrophic plate count , water samples were taken in sterilized 100 ml glass bottles . fifty ml of water samples were concentrated by centrifugation and aliquots of concentrated and non - concentrated samples were spread plated on r2a agar medium and incubated at 35 c for 35 days . following incubation , colonies were counted on each plate and results were expressed as colony - forming units per milliliter ( cfu / ml ) ( 11 ) . bacterial colonies were also characterized based on the colony and cell morphology on the agar plates and gram - staining . ten ml of each sample was also taken into a sterile pyrogen free tube for endotoxin analysis . endotoxin test was carried out using limulus amebocyte lysate ( lal ) by the gel the endotoxin ( et ) levels for the positive samples were being made semi - quantitative by dilution of the samples with endotoxin free water . predominant bacteria of dialysis fluid were isolated and sub - cultured onto r2a agar plates based on their gram - stain and colony morphology . the isolated colonies were suspended in 100 l of deionized water , and genomic dna was extracted by boiling for 15 min and centrifugation at 13,000 rpm for 5 min . the supernatant was used for pcr amplification with eubac 27f and 1492 r primers , which amplify a 1,420 bp fragment of the 16s rrna gene ( 12 ) . dna sequencing of the amplified gene was performed , and dna sequences analysis was undertaken by blast algorithms and databases from the national center for biotechnology information ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) . significant difference between the analyzed parameters in raw drinking water and dialysis water and also with standard values was tested using t - test . statistical analysis showed a significantly higher concentration of lead , nitrate , aluminum and calcium in most dialysis water samples than recommended concentration by aami . furthermore , the magnesium ; cadmium and chromium concentration exceeded the maximum level suggested by aami in some centers . however , these differences were not significant except for magnesium in one center . mean values of chemical parameters of municipal drinking water and dialysis water from the hemodialysis centers of five hospitals , in comparison to association for the advancement of medical instrumentation ( aami ) standards mw : municipal drinking water ( input water ) . there was a significant difference between the concentration of analyzed chemical parameter in mw and dw ( p - value < 0.05 ) . table 2 shows the results of bacteriological analysis of dialysis fluid of 40 machines in five centers . the results indicated that the bacterial count in all dialysis fluid samples was lower than the stated ammi limits for hpc ( < 200 cfu / ml ) ( 2 ) . the statistical analysis showed no significant difference between hpc number of raw water , dialysis water and dialysis fluid . the endotoxin analysis revealed that the et values in all water samples and dialysis fluid were in the limit of guideline values of the aami ( < 2 eu / ml ) with the exception of two dialysis machines . heterotrophic plate count ( hpc ) level and endotoxin concentration of dialysis fluid in five dialysis centers aami standard for endotoxin : < 2 eu / ml aami standard for hpc : < 200 cfu / ml heterotrophic plate count according to the 16s rrna gene sequence analysis of predominant bacteria , six species of bacteria were identified in dialysis fluid . species of identified bacteria and accession number for each 16s rrna gene sequenced are indicated in table 3 . since , the quality of dialysis fluid plays an important role in patient safety and welfare ; it should be viewed as a medicinal product and every effort should be made to ensure a high quality fluid ( 5 ) . water purification system in hemodialysis centers especially , reverse osmosis leads to a sufficient decrease in the amount of contaminant parameters . the results of our study showed that the chemical quality of drinking water is not acceptable as dialysis water because of the presence of some chemicals in higher concentrations than recommended by standards for dialysis water . based on the results , concentration of lead , nitrate , aluminum and calcium in drinking water exceeded maximum levels suggested by the aami and the purification systems could nt significantly reduce these chemicals in all centers . in other words , the chemical quality of water coming out of the ro in all centers was not completely suitable as the dialysis water ( table 1 ) . furthermore , concentration of magnesium ; cadmium and chromium of dialysis water in some centers did nt comply with the aami guidelines ( table 1 ) . these results indicate that water treatment by purification systems in some centers could nt lead to a sufficient decrease in concentration of these chemicals . nitrate , calcium and magnesium may be naturally present in the drinking water which is used . however , some chemicals may originate from procedures applied in the treatment of water or may be released from water pipes ( 3 , 9 ) . generally , ro - based treatment systems produce dialysis water of optimal chemical quality . however , the efficacy of the systems depends on the maintenance and operation ( 3 ) . based on the chemical analyses , a little higher concentration of zinc , copper and lead were found in dialysis water samples than drinking water from two centers , which may have caused by materials in the treatment systems or chemicals used . therefore , special attention must be paid to the suitability of materials and chemicals used in dialysis treatment systems ( 9 ) . as shown in table 2 all cfu values for dialysis fluid were lower than the stated aami limits for hpc ( < 200 cfu / ml ) . cfu values exceeded the european pharmacopeia value ( < 100 cfu / ml ) in 12.5% ( n=40 ) of dialysis water samples ( 9 ) . a study of hemodialysis centers of nine hospitals in japan showed that the aami limit for microbial count was exceeded in one ( 5.5% ) of all 18 water samples and the microbial count of dialysate ( dialysis fluid ) was significantly higher than of treated water ( 13 ) . the results of our study showed no significant difference between hpc number of raw water , dialysis water and dialysis fluid . however , it was noticeable that most of dialysis water samples had higher cfu values in comparison to drinking water samples . our finding confirms that ion exchange resins and activated carbon filtration generally promote bacterial growth ( 3 , 5 ) . therefore a uv disinfection step in the dialysis treatment system is favorable from the microbiological and safety point of view ( 9 ) . endotoxin concentration in dialysis water of all centers was in the limit of guideline value of the aami ( < 2 eu / ml ) . however , endotoxin concentration exceeded the limit value after the water had passed through the tubing system of the two dialysis machines in hospital centers 3 and 4 whereas , cfu values were below the standard limit ( table 2 ) . the result is in accordance with other studies that found discrepancies between the levels of et and bacterial count ( 1 , 7 , 14 ) in dialysis fluid . for this reason , to evaluate the bacteriological quality of dialysis fluid , both et concentration and viable cell count should be measured ( 1 , 14 ) . collection of the data from 3488 dialysis facilities in japan showed that the japanese society for dialysis therapy ( jsdt ) standard for the bacterial cell count ( < 100 cfu / ml ) and et level ( < 0.050 eu / ml ) in dialysis fluid was achieved in 96.9% and 89.0% of facilities ( 7 ) . in the study of lima on microbiological quality of water from hemodialysis services in sao luis , brazil ; heterotrophic bacteria and endotoxin contamination were detected in 66.6% and 33.3% of the post - treatment samples , respectively ( 15 ) . to reduce the risk of endotoxin contamination , periodic cleaning and disinfection of the dialysis machines are essential ( 9 ) . although , all centers used daily chemical disinfection procedure of the dialysis machines in the morning ; we found endotoxin values exceeding the guideline value of the aami for the two dialysis machines . double ultrafiltration of dialysis fluid resulted in sterile fluids with endotoxin concentration well below the european pharmacopeia standards ( 16 ) . application of ultrapure dialysis fluid is also associated with a range of clinical benefits ( 2 ) . according to the 16s rdna sequence analysis of predominant bacteria in dialysis fluid , two and four species of gram positive and gram negative rod shaped bacteria these bacteria produce spores that are quite resistant to disinfection ( 18 ) and therefore could be found in dialysis water and fluid as reported in other hemodialysis studies ( 10 , 19 , 20 ) . sphingomonas adhaesiva and pelomonas saccharophila are gram negative , rod - shaped , non - spore forming bacteria . gomila et al . described two other species of the pelomonas in dialysis fluid ( 21 ) . they also described the role of sphingomonas in the build - up of biofilm in hemodialysis systems ( 10 ) and s. paucimobilis detected by oie et al . in dialysate samples ( 13 ) . sphingomonas spp are a group of chemoheterotrophic strictly aerobic rod - shaped bacteria that are widely distributed in the nature and found in water distribution lines ( 18 ) . porphyrobacter donghaensis and dechloromonas agitate are also gram negative bacteria and presence of p. donghaensis in sea water was reported ( 22 ) . the dialysis water in all centers failed to meet the all chemical requirements for hemodialysis . failure to ensure adequate water chemical quality may have dire consequences to patient safety and welfare . therefore , dialysis water must be monitored routinely and a constant and vigorous control of hemodialysis water treatment system is essential . furthermore , the endotoxin contamination of two dialysis machines indicates the need for an appropriate disinfection program to guarantee better control of bacterial growth and biofilm formation . ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors .

background : chemical and microbial quality of water used in hemodialysis play key roles in a number of dialysis - related complications . in order to avoid the complications and to guarantee safety and health of patients therefore , vigorous control of water quality is essential . the objective of present study was to investigate the chemical and bacteriological characteristics of water used in dialysis centers of five hospitals in isfahan , central iran.methods:a total of 30 water samples from the input of dialysis purification system and dialysis water were analyzed for chemical parameters . heterotrophic plate count and endotoxin concentration of drinking water , dialysis water and dialysis fluid of 40 machines were also monitored over a 5-month period in 20112012.results:concentration of the determined chemicals ( copper , zinc , sulfate , fluoride , chloramines and free chlorine ) did not exceed the recommended concentration by the association for the advancement of medical instrumentation ( aami ) exclude lead , nitrate , aluminum and calcium . furthermore , the magnesium ; cadmium and chromium concentration exceeded the maximum level in some centers . no contamination with heterotrophic bacteria was observed in all samples , while the ammi standard for endotoxin level in dialysis fluid ( < 2 eu / ml ) was achieved in 95% of samples.conclusion:dialysis water and fluid failed to meet the all chemical and bacteriological requirements for hemodialysis . to minimize the risk of contaminants for hemodialysis patients therefore , a water quality management program including monitoring , maintenance and development of water treatment system in hemodialysis centers is extremely important . in addition , an appropriate disinfection program is needed to guarantee better control of bacterial growth and biofilm formation .

You are an expert at summarizing long articles. Proceed to summarize the following text: it is estimated that 100 million us adults suffer from chronic pain.1 in 2012 alone , prescribers wrote 82.5 opioid prescriptions for every 100 of the population.2 however , opioid abuse has been demonstrated in 9% to as much as 41% of patients receiving chronic pain management.3 due to the increase in opiate - related deaths ( 28,647 in 2014 ) and new prescribing regulations , the awareness of opioid misuse has grown.4 nevertheless , use of prescription drug monitoring programs ( pdmps ) and risk screening is still underutilized.5 with the volume of chronic pain patients , limited treatment options , high risk of misuse , and the public eye , development of time - sensitive and accurate technology for risk screening is essential for adequate care . one approach to assisting providers with the prediction of aberrant drug - related behavior ( adb ) among chronic pain patients is the use of validated screeners . the screener and opioid assessment for patients with pain revised ( soapp - r ) is a 24-item self - report questionnaire that has been well - studied for this purpose . a higher score on the soapp - r indicates greater risk of aberrance . in its initial validation study , the soapp - r exhibited sensitivity of 0.81 and specificity of 0.68 for predicting an external measure of adb.6 the screener has since been cross - validated.7 one inherent limitation of self - report questionnaires is the possibility that a respondent will answer the items in an aberrant manner ( not to be confused with exhibiting adb ) . that is , a respondent may answer the items in a way that does not produce meaningful or useful information with respect to the intended purpose of the test . one type of such aberrance occurs when an individual uses deception in his / her responses , in order to promote a false impression of his / her status . in the present context , a respondent may seek to portray falsely a lower risk of adb than he / she in fact has . the soapp - r was designed to contain more items that are subtle ( ie , less transparent ) in their scoring than the previous version of the questionnaire , the original soapp ; nevertheless , the possibility of deception remains present for the soapp - r.7 another type of aberrant responding occurs when an individual answers items without adequate thought as to the most appropriate answer choice . in this case , the individual is not intentionally attempting to distort the truth via his / her answers , but responds to the items in a haphazard manner , whether due to a lack of motivation , a lack of reading comprehension ability , or another reason . an approach to investigating the aberrance of respondents answers that has been well studied and has been described as a critical element of such investigations8 involves the use of individuals response times.911 indeed , the increasing popularity of computer - based testing facilitates the tracking of the time taken by a given respondent to complete each item and/or the time taken to finish the assessment as a whole ( the latter of which may be referred to as the completion time).12 in the context of educational testing , van der linden and van krimpen - stoop noted that an individual s response times are distinct from his / her answers ; therefore , the response times may provide additional information about an individual s level of aberrant responding that can not be gleaned from the answer choices themselves.11 in a general assessment context , unduly fast responses may signify aberrant response behavior , for example , that an individual is responding carelessly in an effort to complete the assessment as quickly as possible , or is mechanically faking good in his / her responses , without deep consideration of the most accurate answer , when it is a simple matter to do so.8,1321 on the other hand , unduly slow responses may also signify aberrant response behavior , for example , an individual who takes an unduly long time to provide responses may be doing so because he / she is thoroughly assessing the answer choices to determine which is the most socially desirable , when making such a determination is not trivial.2224 for questionnaires for which individuals times can be tracked ( such as those that are administered via computer ) , suspicious times may be flagged for subsequent review . when using completion times to predict a specific behavior , such as adb , it can be determined on an assessment - by - assessment basis whether unduly fast times , unduly slow times , or both are associated with the behavior in question . response times have been used in a variety of research settings , including ( among other applications ) the measurement of the accessibility of attitudes,2530 the identification of poor , difficult , or emotionally arousing items,3133 the evaluation of the feasibility of electronic assessment and/or the comparison of different modes of questionnaire administration,3442 and the prediction of inconsistencies between voting intentions and voting behavior.43 indeed , it has been established in the psychological literature for decades that the speed of a response may be predictive of behavior.26,27,43,44 to our knowledge , however , no previous research has investigated the degree to which soapp - r completion times are associated with adb . if either fast completion or slow completion were found to be predictive of adb , then an individual s completion time could be used as a supplement to his / her soapp - r score in assessing the risk of adb . a finding that completion times are not associated with adb may also be of interest to providers who administer the soapp - r to their patients . therefore , the primary aim of this research was to evaluate the utility of completion times in predicting adb among a population of subjects who took a computer - based version of the soapp - r in an emergency department . the secondary aim was to assess the association between completion times and soapp - r total scores in this patient population . this retrospective study used data from subjects who had completed the soapp - r as part of previous research on the feasibility of an electronic version of the screener , and the concordance of the screener with pdmp data , in an emergency department population.42,45 the institutional review board at tufts medical center and tufts university health sciences campus granted exempt status for this study . patients were selected from one location , a level 1 trauma center in an inner - city teaching hospital , between may and august 2013 . using medhost emergency department information system electronic tracking , a trained researcher identified potential participants , each of whom had a diagnosis of a painful condition . patients included in the study were at least 18 years old , understood english , had no physical disability preventing them from using a tablet , had no significant mental impairment , and were not currently prescribed any opioid medication . the treating clinician was approached to determine whether the patients identified were being considered for an opioid prescription . if the patient was being considered for opioid treatment , they were approached by the researcher , the study was described , and the patient was verbally consented . answer options for each item are never , seldom , sometimes , often , and very often ; see table 1 for the wording of all items . no items are reverse - scored , and hence the same scoring rule is applied to each item ( never = 0 , seldom a cutoff 18 was used in the screener s original validation study6 and its cross - validation study;7 those respondents with total scores at or above the cutoff are considered to be at greater risk of adb than respondents with total scores below the cutoff . identified patients were given a tablet computer , consent was acknowledged electronically , and the first page on the tablet informed patients that their information would not be shared with the treating clinician and would not affect their treatment . a researcher was present at all times while the patient was completing the soapp - r . the researcher provided no assistance with completion of the screener and had no immediate knowledge of screener results . the time the patient took to complete the soapp - r was tracked in seconds by the computer . adb was determined with the use of the pdmp , which is a program aimed at reducing prescription - drug misuse by collecting electronically transmitted prescribing and dispensing data that have been submitted by prescribers and pharmacies . the information is provided to prescribing clinicians in an easily accessible online database.46 an external criterion for adb based on the pdmp data was defined as follows : a given patient was considered to exhibit adb only if he / she had four or more opioid prescriptions from four or more providers in a period of 12 months . this criterion had been employed in previous studies,4749 and we believe it to make empiric sense . for example , a patient with chronic pain may have four or more prescriptions in a year , but such a patient following up with their primary physician or specialist(s ) in an appropriate fashion should not , in most cases , have four or more providers . descriptive statistics were calculated , and graphic techniques are employed to display the results . the association between soapp - r completion time and soapp - r total score was assessed via the spearman correlation . associations between predictor variables ( soapp - r completion time and soapp - r total score ) and the outcome variable of interest ( adb status according to pdmp ) were assessed in several ways . 1 ) a simple logistic regression was performed , with completion time defined as the predictor and adb status defined as the outcome . 2 ) a multiple logistic regression was conducted including both completion time and soapp - r total score as predictors and adb status as the outcome . for both logistic regression models , 3 ) receiver - operating characteristic ( roc)-curve analyses were conducted , along with corresponding area under the curve ( auc ) statistics , to evaluate predictive utility . in particular , auc statistics were computed to quantify 1 ) the ability of soapp - r completion time alone to predict adb and 2 ) the joint ability of soapp - r completion time and soapp - r total score to predict adb based on the aforementioned multiple logistic regression model . sensitivity and specificity were calculated separately for 1 ) and 2 ) directly above , using cutoff points on the completion - time scale and probability scale ( the latter being appropriate for a multiple logistic regression model ) , respectively . the cutoff points were chosen to maximize the youden j index ( ie , in each analysis , the cutoff point maximizing the quantity of sensitivity + specificity 1 was selected).50 the auc for predicting adb from soapp - r total score alone had previously been reported for this patient population and data set,45 as had the sensitivity and specificity when using the usual soapp - r cutoff point of 18 , which will be detailed in a subsequent section . that is , they tested the presence of a trend for the risk of adb to increase as completion time increased ( a positive association ) , or a trend for the risk of adb to decrease as completion time increased ( a negative association ) . however , these analyses did not address the possibility that both unduly long completion times and unduly short completion times might be associated with a greater risk of adb , in comparison with completion times near the mean value . to investigate the latter possibility , specifically , the transformed value for each subject was obtained by taking the subject s completion time , subtracting the mean completion time , then taking the absolute value . the resulting transformed value quantified the magnitude of the difference ( regardless of the direction of the difference ) between the subject s completion time and the mean completion time . by using the transformed variable as a predictor of adb in further logistic regression and roc curve analyses , it was evaluated whether a larger discrepancy from the mean completion time in either direction ( positive or negative ) was associated with risk of adb . patients were selected from one location , a level 1 trauma center in an inner - city teaching hospital , between may and august 2013 . using medhost emergency department information system electronic tracking , a trained researcher identified potential participants , each of whom had a diagnosis of a painful condition . patients included in the study were at least 18 years old , understood english , had no physical disability preventing them from using a tablet , had no significant mental impairment , and were not currently prescribed any opioid medication . the treating clinician was approached to determine whether the patients identified were being considered for an opioid prescription . if the patient was being considered for opioid treatment , they were approached by the researcher , the study was described , and the patient was verbally consented . answer options for each item are never , seldom , sometimes , often , and very often ; see table 1 for the wording of all items . no items are reverse - scored , and hence the same scoring rule is applied to each item ( never = 0 , seldom a cutoff 18 was used in the screener s original validation study6 and its cross - validation study;7 those respondents with total scores at or above the cutoff are considered to be at greater risk of adb than respondents with total scores below the cutoff . identified patients were given a tablet computer , consent was acknowledged electronically , and the first page on the tablet informed patients that their information would not be shared with the treating clinician and would not affect their treatment . a researcher was present at all times while the patient was completing the soapp - r . the researcher provided no assistance with completion of the screener and had no immediate knowledge of screener results . the time the patient took to complete the soapp - r was tracked in seconds by the computer . adb was determined with the use of the pdmp , which is a program aimed at reducing prescription - drug misuse by collecting electronically transmitted prescribing and dispensing data that have been submitted by prescribers and pharmacies . the information is provided to prescribing clinicians in an easily accessible online database.46 an external criterion for adb based on the pdmp data was defined as follows : a given patient was considered to exhibit adb only if he / she had four or more opioid prescriptions from four or more providers in a period of 12 months . this criterion had been employed in previous studies,4749 and we believe it to make empiric sense . for example , a patient with chronic pain may have four or more prescriptions in a year , but such a patient following up with their primary physician or specialist(s ) in an appropriate fashion should not , in most cases , have four or more providers . the association between soapp - r completion time and soapp - r total score was assessed via the spearman correlation . associations between predictor variables ( soapp - r completion time and soapp - r total score ) and the outcome variable of interest ( adb status according to pdmp ) were assessed in several ways . 1 ) a simple logistic regression was performed , with completion time defined as the predictor and adb status defined as the outcome . 2 ) a multiple logistic regression was conducted including both completion time and soapp - r total score as predictors and adb status as the outcome . for both logistic regression models , 3 ) receiver - operating characteristic ( roc)-curve analyses were conducted , along with corresponding area under the curve ( auc ) statistics , to evaluate predictive utility . in particular , auc statistics were computed to quantify 1 ) the ability of soapp - r completion time alone to predict adb and 2 ) the joint ability of soapp - r completion time and soapp - r total score to predict adb based on the aforementioned multiple logistic regression model . sensitivity and specificity were calculated separately for 1 ) and 2 ) directly above , using cutoff points on the completion - time scale and probability scale ( the latter being appropriate for a multiple logistic regression model ) , respectively . the cutoff points were chosen to maximize the youden j index ( ie , in each analysis , the cutoff point maximizing the quantity of sensitivity + specificity 1 was selected).50 the auc for predicting adb from soapp - r total score alone had previously been reported for this patient population and data set,45 as had the sensitivity and specificity when using the usual soapp - r cutoff point of 18 , which will be detailed in a subsequent section . that is , they tested the presence of a trend for the risk of adb to increase as completion time increased ( a positive association ) , or a trend for the risk of adb to decrease as completion time increased ( a negative association ) . however , these analyses did not address the possibility that both unduly long completion times and unduly short completion times might be associated with a greater risk of adb , in comparison with completion times near the mean value . to investigate the latter possibility specifically , the transformed value for each subject was obtained by taking the subject s completion time , subtracting the mean completion time , then taking the absolute value . the resulting transformed value quantified the magnitude of the difference ( regardless of the direction of the difference ) between the subject s completion time and the mean completion time . by using the transformed variable as a predictor of adb in further logistic regression and roc curve analyses , it was evaluated whether a larger discrepancy from the mean completion time in either direction ( positive or negative ) was associated with risk of adb . descriptive statistics about the sample have been provided in previous studies.42,45 a total of 43 of the 82 subjects ( 52% ) were male , 23 ( 28% ) were in the 46- to 55-year age group ( this was the age group with the greatest representation ) , 51 subjects ( 62% ) self - reported as white , 63 ( 77% ) self - reported as having used opioids previously , and 62 ( 76% ) self - reported as having used opioids recently ( within the previous 7 days ) . the mean standard deviation total score on the soapp - r was 1612.8 , 55 subjects ( 67% ) had a total score of < 18 on the soapp - r , and 69 subjects ( 84% ) were not identified by the pdmp as having had adb ( table 2 ) . the items with the highest means were how often do you feel bored ? ( 1.5 ) , how often do you have mood swings ? ( 1.3 ) , and how often have any of your close friends had a problem with alcohol or drugs ? the item with the lowest mean was how often have you had to borrow pain medications from your family or friends ? ( 0.2 ) , with four other items following with a mean of 0.3 . the figure shows a peak between 100 and 200 seconds , as well as a positive skew . mean standard deviation time spent on the screener was 16474 seconds ; median and interquartile range were 148 and 67 seconds , respectively . one subject ( 1.2% ) completed the assessment in 1 minute , 24 ( 29.3% ) completed it in 2 minutes , 61 ( 74.4% ) completed it in 3 minutes , and 71 ( 86.6% ) completed it in 4 minutes . figure 2 displays side - by - side box plots of soapp - r completion times , with one box plot for individuals who were identified by the pdmp results as having had adb and one box plot for individuals who were not so identified . although there was a slight tendency for individuals positive for adb to have greater completion times , there was substantial overlap between the groups . both groups had at least one high outlier , with the group negative for adb having several . the simple logistic regression results in which adb status according to pdmp was predicted from soapp - r completion time yielded an odds ratio of 1.004 ( 95% ci 0.9971.011 ) ; the association between the two variables was not statistically significant ( p=0.307 ) . the result of the hosmer lemeshow test did not indicate significant evidence of a lack of fit in the simple logistic regression model ( p=0.115 ) . in the multiple logistic regression model adjusting for soapp - r total score , the odds ratio for completion time was 1.003 ( 95% ci 0.9961.010 ) ; the association between completion time and adb was again not significant ( p=0.419 ) . the association between soapp - r total score and adb was not significant either , based on the multiple logistic regression model ( odds ratio 1.027 , 95% ci 0.9841.073 ; p=0.216 ) . the hosmer lemeshow test for this model showed no significant evidence of lack of fit ( p=0.266 ) . in the roc - curve analysis of the prediction of adb from completion time alone , the youden j index identified the cutoff point on the completion time scale to be 169 seconds ; sensitivity and specificity corresponding to this cutoff point were 0.62 and 0.65 , respectively . the auc statistic for the prediction of adb from soapp - r total score alone was 0.64 ( 95% ci 0.480.8 ) , and sensitivity and specificity corresponding to the usual 18 cutoff point on the soapp - r total score scale were 0.54 and 0.71 , respectively ; these statistics , with the exception of the ci , have been reported in previous research.45 finally , the auc statistic for the prediction of adb from both completion time and soapp - r total score was 0.65 ( 95% ci 0.510.79 ) . the youden j index identified the cutoff point on the probability scale to be 0.125 ( ie , a positive result was obtained if the multiple logistic regression model estimated the probability of adb to be 12.5% ) . using this cutoff point , the sensitivity and specificity of the multiple logistic regression model including both completion time and soapp - r total score as predictors were 0.92 and 0.45 , respectively . in the logistic regression using the transformed completion time to predict adb , the odds ratio was 0.999 ( 95% ci 0.9871.011 ) . the association between the transformed value and adb was not statistically significant ( p=0.826 ) . the hosmer lemeshow test did not indicate significant evidence of misfit ( p=0.774 ) . the auc statistic predicting adb from transformed completion time was 0.46 ( 95% ci 0.310.62 ) . figure 3 shows a scatterplot of soapp - r completion times and soapp - r total scores . the plot does not indicate a strong tendency for the soapp - r total score to increase or decrease as soapp - r completion time increased . the spearman correlation between soapp - r completion time and soapp - r total score was 0.17 ( 95% ci 0.06 to 0.38 ) ; this correlation was not statistically significant ( p=0.135 ) . the use of response times to detect the aberrant answering of assessment items is well known.811,1320,5157 to our knowledge , no previous research has evaluated the utility of soapp - r completion times to predict adb , despite the fact that respondent deception has been identified as a concern for this questionnaire.7 the methodology utilized in the current study can also be used for investigations of other screeners that assess risk of adb . results of the study did not provide significant evidence of the utility of soapp - r completion time in the prediction of adb defined by pdmp criteria . when prediction via raw completion times was conducted , although subjects with longer times had slightly higher odds of adb , the association was not statistically significant . furthermore , the auc values obtained when predicting adb from completion time alone ( 0.63 ) and from the combination of completion time and soapp - r total score ( 0.65 ) were modest . when transformed completion times were used , subjects with greater values actually exhibited a slightly lower chance of adb ( as expressed by an odds ratio just below 1 ) . this association was not statistically significant either . these results could reflect that soapp - r completion times are inherently of limited utility in the prediction of adb . however , it should be noted that the auc value corresponding to the prediction of adb from soapp - r total score alone for this data set ( 0.64 ) was also modest45 and was lower than auc values for soapp - r total scores reported in other settings.6,7 therefore , it is plausible that the low auc values observed herein were due to a factor other than the fundamental inutility of the predictive variables . for instance , the use of pdmp data to identify adb may have been imperfect , which could then have contributed to low auc values . additionally , all participants were patients at a single inner - city emergency department and knew that they were part of a study and that the results would not be shared with their treating clinicians ; results do not necessarily generalize to other populations . not only do auc values vary from population to population , but optimal cutoff points do so as well ; therefore , the cutoff point determined herein for the completion time scale ( 169 seconds ) does not necessarily translate to other settings . a limitation of the current study is its relatively small sample size , especially the small sample of individuals exhibiting adb according to pdmp . the limited number of subjects in the highest age group ( five subjects aged between 56 and 65 years ) precluded the comparison of completion times of subjects in this group with those of younger subjects . another limitation is that only total completion times were available , rather than item - level response times . if an individual became distracted at some point while taking the soapp - r , this would have artificially increased his / her total completion time , while not being detectable from the data at hand . additionally , if a respondent spent a great deal of time at the beginning of the assessment , but then answered items unduly quickly at the end of the assessment , such a pattern ( which could only be detected from item - level response times ) could be useful in identifying potentially problematic answering . indeed , item - level response times have been employed in identifying aberrant answering911 and would allow more diverse modeling approaches to be considered in the context of predicting adb . data on person - level confounding variables ( eg , reading speed and cognitive skills ) were unavailable ; adjusting for these variables , as well as item - level variables ( eg , item complexity and length ) , could also improve the signal - to - noise ratio of the data through a richer statistical model.28,5256,5861 nevertheless , the direct use of the total amount of time taken on an assessment ( ie , the raw completion time ) had been found to have utility in previous work,12,37,6265 including the identification of aberrant answering.8,21,57 another consideration relevant to the methodology presented herein is that if respondents were to become aware that their completion times were used as part of the screening process , they might consciously alter their completion times in order to obtain a desired end . van der linden discussed this type of issue in the context of educational assessment and concluded that information on speed nevertheless provides useful information.9 in the current context of screening for adb , respondents could potentially make a conscious effort to provide answers more quickly if they learned that longer completion times were associated with greater perceived risk . however , this possibility is only a concern under the assumption that respondents would be aware of the role of completion times in the determination of risk and would actively attempt to provide deceptive completion times . moreover , we note that the current scoring method of the soapp - r is equally prone , if not more prone , to deception than a more sophisticated approach involving both soapp - r total scores and completion times . indeed , in the current scoring method of the soapp - r , no items are reverse - scored , and hence respondents with a desire to fake good can simply give the answer never to every item ( or nearly every item ) in order to obtain a low score , which would suggest a low risk of adb . the current scoring method of the soapp - r is publicly available , and the screener s susceptibility to deception was acknowledged in both its initial validation study6 and its cross - validation study.7 it should be noted that response times are not the only way to assess aberrant responding . in particular , a previously studied approach to measuring a respondent s tendency to give answers that he / she perceives as socially desirable is to administer such a scale as the marlowe crowne social desirability scale ( mcsds).66 a high score on the mcsds may suggest a greater tendency toward giving responses that will be perceived as socially desirable . as a low score on the soapp - r suggests lower risk , a highly negative correlation between the soapp - r and the mcsds would suggest that the former questionnaire is sensitive to social desirability . prior work investigated the correlation between the soapp - r and the short form of the mcsds and found that this correlation was only moderately negative ( r=0.47).6 this prior research also found empirically that the soapp - r predicts adb beyond the information provided by the short form of the mcsds.6 recent research on the soapp - r has indicated an interest in and the feasibility of employing a computerized version of the screener.42,67 the regular use of a computer - based soapp - r would facilitate the collection of further response - time data , which would open the door to new methods of determining risk of adb . the results presented herein did not find a statistically significant predictive relationship between soapp - r completion time and adb ; however , as noted earlier , the auc value for completion time was approximately equal to that of soapp - r total score , which had been found to be predictive of adb in previous research.6,7 therefore , further research is needed . future studies should investigate the utility of soapp - r completion times in diverse populations and with large data sets . item - level response times should be collected , and different statistical models incorporating both scores and such response times should be examined . each of these steps will advance our knowledge of how to assess the risk of adb for patients with pain . there was no evidence that soapp - r completion times are able to predict adb among emergency department patients . although respondents with greater soapp - r completion times tended to exhibit more adb , this association was not statistically significant . in isolation , completion times were slightly less efficacious than soapp - r total scores in determining risk .

backgroundrespondents scores to the screener and opioid assessment for patients with pain revised ( soapp - r ) have been shown to be predictive of aberrant drug - related behavior ( adb ) . however , research is lacking on whether an individual s completion time ( the amount of time that he / she takes to finish the screener ) has utility in predicting adb , despite the fact that response speed has been useful in predicting behavior in other fields . the purpose of this study was to evaluate the degree to which soapp - r completion time is predictive of adb.materials and methodsthis retrospective study analyzed completion - time data from 82 adult emergency department patients who completed the soapp - r on a tablet computer . the utility of soapp - r completion times in predicting adb was assessed via logistic regression and the area under the curve ( auc ) statistic . an external measure of adb using prescription drug monitoring program data defined adb to have occurred in individuals with at least four opioid prescriptions and at least four prescribers in 12 months.resultsalthough there was a slight trend for individuals with greater completion times to have greater odds of adb ( odds ratio 1.004 in simple logistic regression ) , the association between soapp - r completion time and adb was not statistically significant in either simple logistic regression ( p=0.307 ) or multiple logistic regression adjusting for soapp - r score ( p=0.419 ) . auc values for the prediction of adb using completion time alone , soapp - r score alone , and both completion time and soapp - r score were 0.63 , 0.64 , and 0.65 , respectively.conclusionthere was no significant evidence that soapp - r completion times were predictive of adb among emergency department patients . however , the auc value for completion times was only slightly less than that for soapp - r total scores .

You are an expert at summarizing long articles. Proceed to summarize the following text: it is estimated that by 2020 , depression will be the second leading cause of morbidity after ischemic heart disease . lifetime prevalence of depression estimates varied widely , 8.6% in europe , 16.9% in the us , and 3% in japan . furthermore , about 14% of the global burden of disease has been attributed to neuropsychiatric disorders . the prevalence of major depression is approximately 2 times higher in women than in men . furthermore , the increased rates of depressive symptoms are observed in women after the birth of a child ( postpartum depression ) , in the unemployed , in older people and after cardiovascular and neurological disturbances . at the ages over 65-year - old , depression is the most common mental health problem and probably the most frequent cause of emotional suffering in late life . the aging of the world population results in the increasing prevalence of depression in the elderly and is estimated to affect one in seven people . moreover , the prevalence of major depression in higher age groups is estimated to be 14% in the community and of subsyndromal depression ( includes depressive syndromes such as dysthymia , bereavement , adjustment disorder with depressed mood , and minor depression ) 1530% . however , depression is not a natural part of aging and with appropriate treatment it is often reversible . untreated , depression poses a critical impact on well - being and the quality of life of the elderly leading to serious functional impairment , reduced quality of life , high rates of suicide attempts , increased health care utilization and health expenditures . despite the fact that persons with depression often seek help in primary care , they are not recognized as having depressive symptoms by the general practitioner . consequently , depression is under - detected and under - treated in primary health care . it has been noticed that only 11% ( in china ) to 61% ( in belgium ) of patients with severe mood disorders received any care in the year before . among the elderly , the major risk factors for depression are the female gender , co - morbidity where the prevalence of depression range from 10% to 43% , social network losses , low social support , cognitive deficits , and negative life events . in greece , the prevalence of depression in people over 60-year - old shows high variability , ranging from 6% to 70% depending on study design and studied population groups . the aim of the present study was to estimate a possible under - detection of depression in members of the daycare centers for older people ( kapi ) in the municipality of patras and tripolis in greece . further objectives were to estimate the prevalence of depressive symptoms in older people , to investigate the possible risk factors and to compare with other findings for greece . a cross - sectional study was conducted among the registered and active members of the four kapi in the municipality of patras and tripolis , west - greece , and peloponnese , respectively , in the time period from march 2011 to october 2012 . the choice of age ( 60 years and over ) was made according to the age limit of registration for the kapi . an anonymous questionnaire was developed to collect basic demographic , medical , and socioeconomic data including three questions from the european health interview survey ( ehis ) regarding self - reported and/or by a physician - diagnosed depression , in the last 12 months or during the lifetime course ( hs.4 , hs.5 , hs.6 ) . none of the participants suffer from cognitive deficits according to their medical records and prescribed medications . all of the participants who state suffering from depression in the last 12 months or during a lifetime period were confirmed according to their medical history data and their prescribed medications for depression . moreover , to all participants the greek validated version of the geriatric depression scale-15 ( gds-15 ) was applied , to screen for depressive symptoms . the scores of the gds-15 were compared to the corresponding answers of the ehis questions . associations between the gds-15 score and various recorded basic parameters were made . during the study period , the same researcher visited either in the morning or in the afternoon , one of the four centers , and distributed the questionnaires to the members . in the most cases , a face to face interview about 400 persons ( active members ) visit daily one of the kapi , of whom 378 agreed to participate in the study . the majority of the nonactive members do not visit the centers for several reasons such as serious health problems or moving to another area . the gds-15 was first developed by yesavage et al . , ( 1982 ) has been tested and used extensively in many countries to assess depressive symptoms in elderly , in community , in acute , and in long - term care settings . it is a brief questionnaire , in which participants are asked to response to the 15 closed questions by answering yes or no , in reference to how they felt on the day of administration . the gds-15 has been standardized and adapted in a greek elderly population and was found to have a 92% sensitivity and a 95% specificity . scores 05 are considered normal , 610 indicate moderate depression , and 1115 indicate severe depression . the study was approved by the plenary meeting of the medical school of patras and the ethics committee of the university of patras , greece . participants were informed about the aims and procedures of the study and provided written informed consent for participation . moreover , the board of both kapi at the municipality of patras and tripolis approved the research protocol and the conduction of the study . statistical analysis was performed with statistical analysis was performed using spss for windows ( version 17.0 , spss , chicago , il , usa ) . the chi - square test was used to test the difference between categorical variables . a p < 0.05 was considered as statistically significant . a total of 378 individuals ( 239 from three kapi in patras and 139 from kapi in tripolis ) took part in the study ( response rate 94.5% ) , 55% males , and mean age 74 years . demographic and socioeconomic characteristics of the study population according to the results of the gds-15 , 48.1% ( 45% in patras , 53.3% in tripolis ) of the studied population revealed to have depressive symptoms , 38.6% of moderate and 9.5% of severe form [ figure 1 ] . having ever been affected with chronic depression reported 19.0% , of them 12.7% being diagnosed by a medical doctor , and 11.9% having received medication . nearly , 10% reported having experienced depressive symptoms during the last 12 months . distribution of the severity of depressive symptoms based on the scores of the geriatric depression scale-15 ( n = 378 , in % ) . about 05 no depression , 610 moderate depression , and 1115 severe depression of the 162 subjects who reported never been affected by a depression in patras and of 106 in tripolis , 27.7% and 44.7% screened positive for moderate and severe depressive symptoms , respectively . in 28 ( 11.7% ) individuals who reported not to know if they have / had depression in patras and 10 ( 7.2% ) in tripolis , depressive symptoms were observed in 60.7% and 90% , respectively , applying the gds-15 [ table 2 ] . depressive symptoms were more frequent in women members of the three kapi of patras than in men , ( 54.6% vs. 37.4% , p = 0.027 ) , not married , including divorced and widowed , than married ( 55.6% vs. 38.9% , p = 0.038 ) , and the participants living alone at home ( 62% vs. 38.1% , p = 0.003 ) . furthermore , depression was more frequent in older adults with chronic diseases compared to elderly without co - morbidity ( 50.8% vs. 27.5% , p = 0.02 ) and the participants with lower educational level ( 52.6% vs. 31.3% , p = 0.007 ) [ table 3 ] . in addition , the semi - urban area of tripolis depressive symptoms was also more frequent in women ( 62.9% vs. 45.5% , p = 0.012 ) comparison to men , not married , including divorced and widowed , ( 85.6% vs. 38.9% , p < 0.001 ) and in subjects without children ( 91.7% vs. 49.2% , p = 0.001 ) . depressive symptoms were more common in elderly with chronic diseases compared to elderly without co - morbidity ( 62.4% vs. 4.5% , p < 0.001 ) , in participants with low monthly income ( 63.7% vs. 25.8% , p = 0.001 ) , and in older adults suffering from insomnia ( 88.6% vs. 6.7% , p < 0.001 ) [ table 4 ] . comparison of results between gds-15 and ehis question hs.4 depression in association to various demographic - socioeconomic characteristics in members of kapi in patras depression in association to various demographic socioeconomic characteristics in members of kapi in tripolis the present study reveals a high percentage ( 48.1% ) of the members of open daycare centers for older people in urban area of patras and semi - urban area of tripolis , to suffer from both moderate and severe depressive symptoms . these findings differ from the results of previous studies in greece , where lower rates of depression in similar populations were observed . on the other hand , the study of mamplekou et al . , conducted in various greek islands and cyprus , revealed rates of 25% and 35% for severe depression ( gds score > 10 ) , while 54% and 70% scored above the depression cut - off of five , respectively . a recent study in four kapi of municipality in attica indicates an overall prevalence rate of 30.3% , more detailed 22.2% for moderate , and 8.1% for severe depressive symptoms , measured with gds-15 . , conducted in a health center in northern greece , where the prevalence of mild to moderate depression in women and men was estimated to be 29.9% and 19.6% , respectively , according to geriatric depression screening scale . in the study of papadopoulos et al . , which was conducted in a rural area in central greece , the prevalence of depressive symptoms was 39% , 27% of mild ( gds-15 > 6 ) , and 12% of severe type ( gds-15 > 10 ) . a study conducted in uk with the largest community sample of people aged 75 years and higher showed lower rates of moderate and severe depressive symptoms ( gds - score 3 = 34.6% , 6 = 8.0% , 8 = 3.1% ) than the present study . however , it must be noted that different thresholds were used as compared to our study . except the high prevalence of depressive symptoms , the present study reveals that a remarkable percentage of the study population is not aware of having depression and was never been diagnosed with this condition . the low self - reported percentage of diagnosed depression in contrary to the results obtained by the gds-15 screening , suggests a substantial under - detection in the specific population group . as other studies had shown , depression seems to be the most under - diagnosed disease in primary health care and especially patients in early stages of disease are less likely to be detected . it is estimated that only 3555% are recognized by primary care physicians , although it is known , that depression is one of the most common disorders in older adults who are seeking help in primary health care . our findings come to support these high rates of under - diagnosis since one in two of the participants screened with depressive symptoms , is not recognized and does not receive the appropriate medication . moreover , it has been observed that depressive disorders are not only under - recognized but also under - treated and often not in line with current medical standards . other studies reveal that only 19% of patients are receiving appropriate anti - depressive treatment , or that 43% of patients who have been diagnosed with depression by their general practitioner were prescribed an antidepressant , 34% are not being treated appropriate and 41% remain without treatment . several reasons are described in the literature for under - diagnosis and under - treatment of depression in older adults . the study of bartels pointed out that elderly people with depressive symptoms are less likely to use special mental health care but prefer to access the general health care system . however , general practitioners are more likely to under - detect depression due to lack of experience , lack of continuous training in mental health , or due to their attitude regarding depression as a natural consequence of ageing and as accessory symptom of a physical disease . last but not least , stigmatization of depressed individuals may lead to low recognition , treatment discontinuation and nonadherence of therapy in older patients . depression , even the most severe forms , is one of the diseases with high treatment effectiveness if diagnosed at an early stage . studies have shown , that various interventions , combining enhanced strategies of physicians and patient education , specialist services support , as well as monitoring of medication compliance have a positive effect on recognition , management , and outcome of the disease . consequently , it is wishful to train primary care physicians , as well as nurses and social workers to raise the awareness of recognizing depression , especially in older adults . the application of the short and user - friendly gds-15 by general practitioners would increase the ability to detect and treat depression in the elderly population , as shown in this study . the present study revealed women having higher rates of depression than men , a result , which is in agreement with other studies conducted in greece and other countries . other aggravating factors for depression in the present study , as well as in several other studies , are the low education level , being not married , including being widowed or divorced and in patients with chronic diseases , which is confirmed by previous studies . the limitations of the present study derive from the fact that , the prevalence of depression depends on the cut - off scores are used to distinguish between no depression , moderate and severe form of depression , and the validity of this threshold against the clinical diagnosis . the observed variations in the mentioned studies , may be attributed to different characteristics of the rural , urban , and island populations ; the cut - off score and the tools that have been used to estimate depression or to other parameters that were not measured . even though the prevalence of depression seems to be high in the studied population , if the registered members of kapi who do not visit the day care centers due to various reasons would have been included , very possibly the prevalence of depressive symptoms would be higher . however , the study was conducted in a specific population , that is , the members of daycare centers for older people and thus our findings can not be generalized for the whole older population . depression in the older population shows a high prevalence is associated with specific demographic and socioeconomic characteristics and appears to be an under - diagnosed disease . to respond to this problem and to focus on prevention and early detection of depression in older adults , it is necessary to create a strong supportive network and simultaneously to strengthen the already existing programs , institutions and services in the community , and primary health care .

objective : the objective of this study was to estimate the prevalence and probable under - diagnosis of depressive symptoms in elderly of an urban and semi - urban area in greece.materials and methods : a cross - sectional study was conducted among the members of 4 days care centers for older people ( kapi ) , three in the municipality of patras , west - greece , and in one in tripolis , peloponnese , greece . a total of 378 individuals took part in the study , aged > 60 years . a questionnaire was developed to collect basic demographic data , including three questions from the european health interview survey , regarding self - reported or by a physician - diagnosed depression . moreover , to all participants the greek validated version of the geriatric depression scale-15 ( gds-15 ) was applied , to screen for depressive symptoms.results:according to gds-15 , 48.1% of the studied population screened positive for depressive symptoms ( 38.6% moderate , 9.5% severe ) , whereas having ever been affected with chronic depression reported 19.0% by themselves . in 162 members of kapi of patras and in 106 of tripolis , who never reported have been affected by depression and depressive symptoms were observed in 27.7% and 44.7% , respectively . in 28 individuals from patras , who reported not to know if they have depression and in 10 from tripolis , depressive symptoms were observed in 60.7% and 90% , respectively , applying the gds-15.conclusion:except the high prevalence , the present study reveals a remarkable under - detection of depressive symptoms in older adults . various interventions in primary care are necessary so as to increase detection rates of depression among the elderly .

You are an expert at summarizing long articles. Proceed to summarize the following text: archived canine serum samples ( n=6,582 ) submitted to the vbddl ncsu for serological testing against tick - borne pathogens between january 2008december 2010 ( n=6,270 ; 95.3% ) and january march 2012 ( n=312 ; 4.7% ) were available for snap m - a testing and analysis . samples submitted from the same dog within 5 weeks of the initial submission were excluded . available information included signalment ( age , breed , and sex ) , date of sample collection , and owner or veterinary practice address . distribution of all samples collected between 20082010 and 2012 ( n=6,582 ) by region ( gray shading ) and state with seroreactivity to ehrlichia canis ( ec ) , e. ewingii ( eew ) , e. chaffeensis ( ech ) , anaplasma platys ( apl ) , a. phagocytophilum ( aph ) , borrelia burgdgorferi ( bb ) , anaplasma spp . p - value calculated for regional differences without caribbean values ; p - values remained < 0.05 when calculated without canadian or caribbean values . all canine sera were retrospectively tested by snap m - a for the simultaneous and individual detection of specific ec , ech , eew , aph , apl , and bb antibodies . included on snap m - a are two additional spots containing a combination of anaplasma spp . ( ec and ech only ) synthetic peptides , labeled e - genus . snap m - a uses a reversible chromatographic flow of sample and automatic , sequential flow of wash solution and enzyme substrate . archived canine serum stored at 80c was thawed to room temperature prior to mixing four drops of serum with 45 drops of snap m - a conjugate . the mixture was allowed to move across a flow matrix where peptide - specific antibody could bind to peptide - hrp conjugate before color reactant release . seroprevalence , defined as the number of seropositive samples divided by the number of samples tested , was calculated by region , month , and year . the chi - squared test or fisher exact test was used to determine significant differences in the proportions of seroreactivity by region , month , and year . multiple comparisons were performed using the multtest procedure in sas / stat v.9.3 ( sas institute , cary , nc ) . regions were assigned into the following categories based on owner or veterinary hospital address : northeast , mid - atlantic , south , midwest , west , canada , and the caribbean region , which includes all countries and territories in and around the caribbean sea . state - wide seroprevalence was calculated for states with at least 30 sample submissions and depicted in heat maps ( openheatmap.com ) . the proportion of co - exposures , defined as the number of dogs with two or more seropositive results divided by the total number of dogs , was calculated . the following positive species - specific peptide combinations were not considered co - exposures : e - genus+ech , e - genus+ec , a - genus+apl , or a - genus+ aph . odds ratios ( ors ) and 95% confidence intervals ( 95% ci ) were used as measures of association between exposure to one pathogen and exposure to a second pathogen ( representing concurrent or sequential co - exposures ) . statistical analyses were performed using sas / stat 9.3 ( sas institute inc . , cary , nc ) . archived canine serum samples ( n=6,582 ) submitted to the vbddl ncsu for serological testing against tick - borne pathogens between january 2008december 2010 ( n=6,270 ; 95.3% ) and january march 2012 ( n=312 ; 4.7% ) were available for snap m - a testing and analysis . samples submitted from the same dog within 5 weeks of the initial submission were excluded . available information included signalment ( age , breed , and sex ) , date of sample collection , and owner or veterinary practice address . distribution of all samples collected between 20082010 and 2012 ( n=6,582 ) by region ( gray shading ) and state with seroreactivity to ehrlichia canis ( ec ) , e. ewingii ( eew ) , e. chaffeensis ( ech ) , anaplasma platys ( apl ) , a. phagocytophilum ( aph ) , borrelia burgdgorferi ( bb ) , anaplasma spp . p - value calculated for regional differences without caribbean values ; p - values remained < 0.05 when calculated without canadian or caribbean values . all canine sera were retrospectively tested by snap m - a for the simultaneous and individual detection of specific ec , ech , eew , aph , apl , and bb antibodies . included on snap m - a are two additional spots containing a combination of anaplasma spp . ( ec and ech only ) synthetic peptides , labeled e - genus . snap m - a uses a reversible chromatographic flow of sample and automatic , sequential flow of wash solution and enzyme substrate . archived canine serum stored at 80c was thawed to room temperature prior to mixing four drops of serum with 45 drops of snap m - a conjugate . the mixture was allowed to move across a flow matrix where peptide - specific antibody could bind to peptide - hrp conjugate before color reactant release . seroprevalence , defined as the number of seropositive samples divided by the number of samples tested , was calculated by region , month , and year . the chi - squared test or fisher exact test was used to determine significant differences in the proportions of seroreactivity by region , month , and year . multiple comparisons were performed using the multtest procedure in sas / stat v.9.3 ( sas institute , cary , nc ) . regions were assigned into the following categories based on owner or veterinary hospital address : northeast , mid - atlantic , south , midwest , west , canada , and the caribbean region , which includes all countries and territories in and around the caribbean sea . state - wide seroprevalence was calculated for states with at least 30 sample submissions and depicted in heat maps ( openheatmap.com ) . the proportion of co - exposures , defined as the number of dogs with two or more seropositive results divided by the total number of dogs , was calculated . the following positive species - specific peptide combinations were not considered co - exposures : e - genus+ech , e - genus+ec , a - genus+apl , or a - genus+ aph . odds ratios ( ors ) and 95% confidence intervals ( 95% ci ) were used as measures of association between exposure to one pathogen and exposure to a second pathogen ( representing concurrent or sequential co - exposures ) . statistical analyses were performed using sas / stat 9.3 ( sas institute inc . , cary , nc ) . a total of 6,582 dog serum samples were tested , including 6,268 ( 95.2% ) from the us , representing 43 states ; 285 ( 4.3% ) from canada , representing seven provinces ; and 29 ( 0.44% ) from the caribbean region ( table 1 ) . exposure to at least one tick - borne pathogen was documented in 1,198 ( 18.2% ) dogs . of the 6,582 sera tested , exposures included bb ( n=545 , 8.3% ) , eew ( n=251 , 3.8% ) , aph ( n=227 , 3.4% ) , ech ( n=202 , 3.1% ) , ec ( n=117 , 1.8% ) , and apl ( n=99 , 1.5% ) ( table 1 ) . e - genus and a - genus antibodies were detected in 327 ( 5.0% ) and 238 ( 3.6% ) dogs , respectively . of the e - genus and a - genus antibody positives , 50 ( 15.3% ) and 32 ( 13.4% ) dogs , respectively , did not have species - specific antibodies , which could represent dogs with low ehrlichia and anaplasma species - specific antibody titers or potentially , seroreactivity to a species , such as ehrlichia muris or the panola mountain ehrlichia not specifically tested for in this study . the greatest proportion of samples were submitted from the south ( n=3,011 , 45.7% ) , followed by the midwest ( n=1,162 , 17.7% ) , the mid - atlantic ( n=1,065 , 16.2% ) , the northeast ( n=532 , 8.1% ) , the west ( n=498 , 7.6% ) , canada ( n=285 , 4.3% ) , and the caribbean ( n=29 , 0.44% ) . regional comparisons documented significantly higher bb exposure frequencies in the northeast ( n=122 , 22.9% ) and mid - atlantic ( n=236 , 22.2% ) , as compared to the midwest ( n=66 , 5.7% ; p<0.001 and p<0.001 , respectively ) and the south ( n=100 , 3.3% ; p<0.001 and p<0.001 , respectively ) . aph seroprevalence was significantly higher in the northeast ( n=69 , 13% ) and the mid - atlantic ( n=58 , 5.5% ) when compared with other regions in the us ( p<0.01 , all comparisons ) . eew and ech exposures were most prevalent in mid - atlantic ( n=61 , 5.7% ; n=59 , 5.5% , respectively ) and southern dogs ( n=156 , 5.2% ; n=129 , 4.3% , respectively ) compared to the midwest ( n=14 , 1.2% ; n=8 , 0.7% , respectively ) ( p<0.001 for all comparison listed ) and did not significantly differ across the mid - atlantic and southern regions . ec prevalence was low among all us and canadian regions ( ranging from 0.5 to 3.2% ) , with the highest prevalence in the west ( n=12 ; 2.4% ) and canada ( n=9 , 3.2% ) . the caribbean had a significantly higher ec seroprevalence ( n=8 , 27.6% ) than all other regions ( p<0.001 , all comparisons ) . the apl seroprevalence ranged from a high of 10.3% ( n=3 ) in the caribbean to a low of 0.6% ( n=7 ) in the midwest . due to the lack of complete 2012 data for the entire year , significant differences in overall and regional seroprevalences were evaluated by year and month using only data from years 2008 ( n=2,327 ; 35.4% ) , 2009 ( n=2,184 ; 33.2% ) , and 2010 ( n=1,759 ; 27% ) ( table 2 ) . there were significant differences in the overall aph , anaplasma spp . , and ech seroprevalences by year ( p<0.0001 , p=0.0024 , and p=0.0004 , respectively ) . overall ech exposure appeared to decline from 2008 to 2009 , but increased in 2010 , while aph increased . regionally , significant increases in seroprevalence were observed in the mid - atlantic , including aph ( p=0.0026 ) , and the south , including aph and bb ( p<0.0001 and p<0.0001 , respectively ) . the south also had significant changes in ech and eew seroprevalences , with a decline in eew and ech exposure in 2009 followed by an increase in 2010 ( p=0.0191 and p=0.0001 , respectively ) . no significant changes or trends were observed when seroprevalences were compared between months ( data not shown ) . states with no sample submissions included hi , ak , mt , i d , sd , and nd . heat maps of the us were generated when in - state seroprevalence data were based upon 30 submissions ( figs . seroprevalence by state of borrelia burgdorferi ( bb ) or anaplasma phagocytophilum ( aph ) in dogs suspected of canine vector - borne disease . seroprevalence by state of ehrlichia canis ( ec ) or anaplasma platys ( apl ) in dogs suspected of canine vector - borne disease . seroprevalence by state of ehrlichia ewingii ( eew ) or e. chaffeensis ( ech ) in dogs suspected of canine vector - borne disease . seroprevalence per year between 2008 and 2010 in the us , canada , and caribbean to ehrlichia canis ( ec ) , e. ewingii ( eew ) , e. chaffeensis ( ech ) , anaplasma platys ( apl ) , a. phagocytophilum ( aph ) , borrelia burgdgorferi ( bb ) , anaplasma spp . ( e - genus ) co - exposures , defined as seroreactivity to more than one anaplasma spp . seroreactivity to two pathogens occurred in 207 dogs ( 3.1% ) ; three pathogens in 44 dogs ( 0.7% ) ; four pathogens in seven dogs ( 0.1% ) ; and five pathogens in three dogs ( 0.05% ) . the most common co - exposures included eew+ech ( n=91 , 1.4% ) ; aph+bb ( n=76 , 1.2% ) ; and eew+bb ( n=41 , 0.6% ) , in contrast to ec+apl ( n=18 , 0.3% ) ( table 3 ) . notable regional co - exposures included aph+bb in the northeast ( n=33 ; 6.2% ) , eew+ech in the south ( n=62 ; 2.1% ) and mid - atlantic ( n=22 ; 2.1% ) . the mid - atlantic had the highest co - exposure seroprevalence rates for several unexpected pathogen combinations including eew+bb ( n=19 ; 1.8% ) , ech+bb ( n=17 ; 1.6% ) , and ech+aph ( n=12 ; 1.1% ) ( table 3 ) . the highest ors were found among pathogens known to share a common tick vector ( eew+ech : or=31.9 , 95% ci=23.243.8 ; ec+apl : or=14.3 , 95% ci=8.324.8 ) . the or for aph+bb ( or=6.2 , 95% ci=4.68.3 ) was lower by comparison . the lower ors were found among unexpected combinations of pathogens ( ec+bb : or = 0.2 , 95% ci=0.050.8 ; apl+bb : or=2.2 , 95% ci=1.33.7 ; and ec+ech : or=2 , 95% ci=0.94.5 ) ( table 3 ) . co - exposures from all samples collected between 20082010 and 2012 ( n=6,582 ) with corresponding seroprevalence ( % ) and odds ratios ( or ) with 95% confidence interval ( ci ) to ehrlichia canis ( ec ) , e. ewingii ( eew ) , e. chaffeensis ( ech ) , anaplasma platys ( apl ) , a. phagocytophilum ( aph ) , and borrelia burgdgorferi ( bb ) or and 95% ci calculated for overall co - exposures only . this study utilized a panel of species - specific , cvbd peptides to determine regional seroprevalences in dogs with suspected tick - borne pathogen exposure . ec , ech , eew , aph , apl , and bb peptides were designed to detect species - specific antibodies , so as to facilitate identification of unique patterns of cvbd exposure in dog sera from the us , canada , and the caribbean ( 912 ) . significant regional changes and various co - exposure patterns were identified overall , regionally and during 20082010 ; however , significant patterns were not observed between months or seasons ( data not shown ) of the year , likely because these data do not represent infection onset . limitations of this study include the following : sample submission was not proportional across regions with a near majority of specimens submitted from the southern region ( 45.7% ) compared to the northeast ( 8% ) , the west ( 7.6% ) , canada ( 4.3% ) , and the caribbean ( 0.4% ) . specimens were regionalized based on local veterinary hospital or owner zip codes , and individual dog travel histories were not available . all samples from ncsu - college of veterinary medicine were regionalized according to owner zip codes ; however , 21% ( n=1,353 ) of samples submitted from other veterinary teaching hospitals may not accurately represent local exposure , since clients may travel farther distances for specialized services offered at large teaching hospitals . as this convenience sample was submitted to the vbddl from dogs suspected of a cvbd , seroprevalence rates are most likely higher than in the general dog population . bb ( 8.3% ) , the etiologic agent of lyme disease , was the most seroprevalent pathogen in this convenience sample of dogs ( n=6,582 ) . this finding is consistent with a recent study involving a large cohort of dogs from the us that reported an overall canine bb seroprevalence , defined as seroreactivity to c6 peptide , of 7.2% ( 509,195/6,996,197 ) ( 13 ) . this is an increase from an earlier , similar study , which showed an overall canine bb seroprevalence of 5.1% ( 49,817/982,336 ) ( 14 ) . lyme disease is the most prevalent tick - borne disease in humans in the us and has historically been confined to northeast and upper midwestern regions of the country ( 15 , 16 ) . notably , we documented a statistical increase in bb seroprevalence from 2008 to 2010 in the south ( ( p<0.0001 ) ( table 2 ) , a region not historically endemic for bb infection . a study by duncan et al . using a convenience sample from sick dogs submitted for testing to the vbddl between 2001 and 2003 measured a lower seroprevalence of bb , defined as c6 seroreactivity , in individual southern states , including , nc ( 0.4% ) , va ( 8.7% ) , and md ( 14.4% ) than the bb seroprevalences reported in this study ( nc , 5.4% ; va , 20.3% ; md , 24.9% ) ( 8) . notably , the seroprevalence of bb in northern states was more similar between the two studies ( 25% vs. 22.2% , respectively , in pa ) suggesting the differences in the south are more likely due to prevalence changes and less likely testing variations . our study found the bb seroprevalence in dogs from the mid - atlantic ( n=236 ; 22.2% ) , a region bordering the south , to approximate the bb seroprevalence in the northeast ( n=122 ; 22.9% ) ( p=0.99 ) . furthermore , one third ( n=1,014 ; 34% ) of the samples from the south in this study were collected from dogs residing in nc , a state that borders va , where according to the cdc , an increase in lyme disease incidence had been reported in recent years ( 17 ) . recently , va established five counties along the nc border endemic for lyme disease ( 18 , 19 ) . the increased bb seroprevalence observed in dogs from the southern us supports a potential trend for bb expansion southward , warranting further studies to monitor lyme disease in both dogs and humans south of mid - atlantic states . the cdc reports the approximate distribution of i. scapularis extends from texas to the southeast , mid - atlantic , northeast , and upper midwestern states , and a recent report has documented population increases in canada ( 20 , 21 ) . we found a bb seroprevalence of 2.1% ( ( n=6 ) within our canadian dog population ( n=285 ) . previous studies measuring canine seroreactivity to c6 peptide reported lower bb seroprevalences in canada ; canine sera collected from southern ontario and quebec between 2000 and 2003 ( n=108 ) reported bb seroprevalence as 1.85% , while another study in 2008 that included all provinces found an overall seroprevalence of 0.72% ( n=624 ) ( 22 , 23 ) . the increased seroprevalence could be related to differences in testing platforms , health status of the dogs , population number and distribution differences and possibly a northern movement of bb infected ticks . in 2009 , lyme disease became a nationally reportable disease in canada , with reports of increasing incidence in people ( 24 , 25 ) . interestingly , a study in dogs using snap 3dx and 4dx showed the incidence of lyme in dogs from on in 2006 ( 0.36 ) and 2007 ( 0.58 ) is approximate to the incidence reported in people from on in 2006 ( 0.35 ) and 2007 ( 0.58 ) ( 25 , 26 ) . these data further support the use of dogs as sentinels for bb exposure in people . this study documented a significant increase in canine exposure to aph in the us from 2008 to 2010 ( p<0.0001 ) ( table 2 ) , suggesting a progressively increased risk for human aph exposure . these data are supported by the substantial ( 53% ) increase of reported human granulocytic anaplasmosis cases described by the cdc from 2009 to 2010 ( 2729 ) . furthermore , canine aph seroprevalences were high in the northeast ( n=69 ; 13% ) , mid - atlantic ( n=58 ; 5.4% ) and the midwestern state , wi ( n=6 ; 10.3% ) emphasizing the potential utility of dog data for establishing real - time regional human aph exposure risk . the south had a higher aph seroprevalence ( 2.1% ) than previous reports that documented anaplasma spp . ( n=496 ; 0.5% and n=1,631,332 ; 0.9% ) ( 13 , 14 ) ; the discrepancy , in part , could be due to a greater number of sick dogs in this sample set , while the former studies included a larger population of healthy dogs . we identified a significant increase in aph seroprevalence from 2008 to 2010 in the mid - atlantic ( p<0.0001 ) and the south ( p<0.0001 ) , consistent with bb seroprevalence trends for the southern region . studies reporting the molecular presence of aph in ticks from the south found aph dna in 1.3% of i. scapularis ticks and 2.7% of a. americanum ticks collected from rodents in florida ( 30 ) ; another study found 1.6% aph dna in i. scapularis ticks collected in sc , ga and fl , with the highest prevalence ( 20% ) identified in ticks collected along the ga coast , a documented avian flyway ( 31 ) . despite similar aph and bb seroprevalence trends and a significant aph+bb co - exposure pathogen association ( or=6.2 ; 95% ci=4.68.3 ) , overall the aph ( 3.5% ) and bb ( 8.3% ) seroprevalences differed significantly ( p0.001 ) . correspondingly , the prevalence of aph dna in i. scapularis ticks collected in nj was much lower than bb ( 6.1% ( n=9 ) and 50.3% ( n=74 ) , respectively ) ( 32 ) . in this study , bb seroprevalence was found to be similar among dogs from the mid - atlantic ( 22.2% ) and the northeast ( 22.9% ) ( p=0.99 ) ; however , the aph seroprevalence differed significantly between the two regions ( mid - atlantic ; 5.4% ( n=58 ) and northeast ; 13% ( n=69 ) ( p0.001 ) , potentially reflecting a less prevalent aph infection of ticks in the mid - atlantic when compared to the northeast . we identified eew ( 3.8% ) as the most common ehrlichia exposure in dogs , followed by ech ( 3.1% ) and ec ( 1.8% ) , which is consistent with a 2010 study that found eew ( 5.1% ) as the most seroprevalent ehrlichia spp . pathogen in a large population of dogs from north america ( n=8,622 ) , when compared to ech ( 2.8% ) and ec ( 0.8% ) ( 9 ) . a similar study in dogs from the south central us ( n=143 ) detected much higher eew ( 44.8% ) and ech ( 17.5% ) seroprevalences and a similar ec ( 1.4% ) seroprevalence ( 33 ) . in this study , overall ech seroprevalence varied significantly over time with an initial decrease and then increase in 2010 ; seroprevalence rates were determined to be 3.3% ( n=77 ) in 2008 , 2.0% ( n=43 ) in 2009 , and 4.1% ( n=72 ) in 2010 ( p=0.0004 ) ( table 2 ) . this pattern was observed in three regions , the south , mid - atlantic and midwest , in which a. americanum ticks are prevalent . reported ech human monocytic ehrlichiosis ( hme ) cases increased before a significant drop in 2010 ( 2729 ) , which did not mirror our canine ech seroprevalence . regionally , however , the high prevalence of hme cases was largely similar to dog ech seroprevalence , with highest exposure risk in the south and mid - atlantic ( 2729 ) . in the south , canine eew seroprevalence also showed statistically significant changes over 2008 ( n=57 ; 5.5% ) , 2009 ( n=37 ; 3.6% ) , and 2010 ( n=48 ; 6.3% ) ( p=0.02 ) ( table 2 ) , which mirrored the trend for human eew cases ( eew ehrlichiosis ) for 20082010 ( 2729 ) . the difficulty in clinically distinguishing between hme and eew ehrlichiosis , along with the low number of human eew infection reports could complicate comparisons made between canine and human eew exposure ( 5 , 28 ) ; nevertheless , reports of high canine eew seroprevalences should prompt more consideration for greater eew exposure risk in humans throughout much of the central and southern us . in 2008 , cdc made eew ehrlichiosis a reportable disease in humans ( 29 ) . overall , ec ( n=117 ; 1.8% ) and apl ( n=99 ; 1.5% ) had the lowest seroprevalences in dogs from the us . exposure frequencies were high in the caribbean ( n=8 ; 27.6% and n=3 ; 10.3% , respectively ) , as expected , where r. sanguineus , the known vector for ec and potential vector for apl , is prevalent . a previous study reported high ec sero- ( 43.8% ) and pcr ( 24.7% ) prevalences in the caribbean ( 4 ) . r. sanguineus is rarely documented in canada ( 34 ) ; however , canada had unexpectedly high ec and apl seroprevalences ( n=9 ; 3.2% and n=5 ; 1.8% , respectively ) , potentially due to a reporting bias from low numbers tested in this study or because dogs had traveled to or were transported from ec and apl endemic regions . efforts to relocate homeless animals , particularly from tropical regions , including the caribbean , to the northeastern us and canada have increased . for example , in 2003 the save a sato foundation , which aims to relocate homeless dogs in puerto rico to the us , transported roughly 14,000 dogs to the us ( 35 ) . relocating animals to shelter environments in non - endemic us regions and canada could create r. sanguineus infestations within kennels , significantly impacting the prevalence rates of foreign tick - borne pathogen strains within the local dog population and exposing people to foreign , zoonotic pathogens . co - infections complicate interpretation of the clinical manifestations typically associated with single tick - borne diseases in both canine and human medicine . co - infections can occur from simultaneous or sequential exposure to several tick species , or when multiple pathogens are transmitted by a single tick ( 2 , 3 , 36 ) . in our study , co - exposures were defined as dogs seropositive to two or more vector - borne pathogens . combinations with the highest seroprevalence rates were among pathogens known to share a common tick vector such as eew+ech in a. americanum and aph+bb in i. scapularis . regional co - exposure seroprevalences were highest in areas where the respective shared tick species are endemic , including eew+ech in the south and mid - atlantic , and aph+bb in the northeast . interestingly , the mid - atlantic had the highest co - exposure seroprevalence rates for several unexpected pathogen combinations including eew+bb , ech+bb , and ech+aph ( table 3 ) . these co - exposure combinations and seroprevalence rates highlight the mid - atlantic as a potential region where i. scapularis and a. americanum ticks and their respective pathogens coalesce . as tick species migrate and habitats overlap , co - exposures will likely be more common with the potential for more disease severity . when monitoring tick - borne diseases in regions like the mid - atlantic , co - infections should be considered . in conclusion , this study provides further support for the use of dogs in tick - borne pathogen human surveillance risks for several zoonotic infections of human and veterinary medical importance . over a relatively brief time period , we demonstrated significant shifts in cvbd seroprevalence rates including overall increases in aph and ech , increases in aph in the mid - atlantic and the south and increases in bb in the south . furthermore , by recognized species - specific seroprevalence , expected and unique co - exposures were identified and highlight the potential for tick - borne pathogen co - infections . combining dog and human tick - borne disease surveillance data could enhance both public health and animal health . the authors have not received any funding or benefits from industry or elsewhere to conduct this study . barbara qurollo 's fellowship in vector - borne disease research at the college of veterinary medicine , north carolina state university is supported by idexx laboratories . ramaswamy chandrashekar , melissa j. beall , brett a. stillman , jiayou liu , and brendon thatcher are employees of idexx laboratories , and edward b. breitschwerdt is a consultant to the company in the area of tick - borne infectious diseases .

introductiontick - borne pathogens cause a spectrum of disease manifestations in both dogs and humans . recognizing regional and temporal shifts in exposure are important as tick distributions change . to better delineate regional exposure to canine tick - borne pathogens , an expanded set of species - specific peptides were used to detect anaplasma phagocytophilum ( aph ) , anaplasma platys ( apl ) , ehrlichia canis ( ec ) , ehrlichia chaffeensis ( ech ) , ehrlichia ewingii ( eew ) , and borrelia burgdorferi ( bb ) antibodies in canine serum.methodsarchived canine serum samples ( n=6,582 ) collected during 20082010 and in 2012 from the us , canada , and the caribbean were retrospectively screened for antibodies against ehrlichia and anaplasma species - specific peptides . overall , regional and temporal seroprevalence rates were determined.resultsoverall bb and eew were the most seroprevalent pathogens . during 20082010 , seroprevalence rates increased overall for aph and ech , and regionally , bb and aph seroprevalence rates increased in the south . canada had unexpectedly high seroprevalence rates for ec and apl . the most common co - exposures were eew+ech , followed by aph+bb and eew+bb.conclusionsthis study demonstrated significant shifts in canine vector - borne disease seroprevalence rates . the use of specific peptides facilitated improved geographic delineation of tick - borne pathogen distributions among dogs , which may enhance epidemiological surveillance of vector - borne pathogens shared by dogs and humans .

You are an expert at summarizing long articles. Proceed to summarize the following text: unregulated oncogene expression during cancer development causes cancer cells to senesce prematurely , a gene - directed program that irrevocably induces cell cycle arrest [ 14 ] . first described in cell culture , oncogene - induced senescence ( ois ) has been confirmed in vivo as a vital mechanism that constrains the malignant progression of many tumors . unregulated oncoproteins promote senescence by activating effector pathways that are cell - type and oncogene specific . recent progress identified different regulatory circuitries of ois , but much remains to be learned . high - throughput sequencing of the cancer genomes has identified braf kinase as the most frequently mutated ( 5070% ) oncogene in melanoma . about 90% of braf gain - of - function mutations are at position 600 with glutamic acid ( e ) inserted for valine ( v ) . braf is a serine / threonine protein kinase that functions directly downstream of the small gtpase ras and upstream of the mek and erk mitogen - activated protein kinase ( mapk ) cascade . this mutation significantly increases braf kinase activity toward mek , causing constitutive braf - mek - erk signaling [ 7 , 8 ] . the braf gain - of - function val to glu mutation is required for cell viability , anchorage - independent growth , and proliferation of braf - positive melanoma cell lines in both cell - based studies and in vivo mouse models [ 911 ] . furthermore , a phase i clinical trial with a potent inhibitor of braf kinase demonstrates that braf - mutant melanomas are highly dependent on braf kinase activity . besides its frequent presence in melanoma , braf mutations are also present in up to 82% of melanocytic nevi with classical hallmarks of senescence . the gain - of - function mutation in braf may be the cause of growth arrest in nevi . indeed , in studies with genetically modified mouse models , the activated braf allele plays a causal role in promoting benign melanocytic hyperplasia in vivo [ 14 , 15 ] . however the underlying mechanisms driving b - raf - mediated senescence in melanocytes remain undefined . micrornas are small noncoding rna species of 2022 nucleotides that have critical functions across a myriad of biological processes [ 1619 ] . aberrant expression of several micrornas has also been reported in melanocytic nevi . in view of the emerging important role of micrornas in tumorigenesis and cell - cycle arrest , micrornas may play a causal role in braf - induced senescence in melanocytic nevi . braf - induced senescence requires the activation of a transcription program with multiple components [ 2123 ] . the mechanism that integrates the diverse components into a coordinated response to the braf mutation remains undefined . each microrna targets ~200 mrna molecules . because of their pleiotropic potentials , micrornas are attractive candidates as master regulators of the premature senescence transcription program . in this study , by ectopically expressing braf in primary melanocytes , we identified 8 different micrornas whose expressions were correlated with the braf gain - of - function activity . importantly , two of the identified micrornas , when expressed individually , are sufficient to induce premature senescence in primary melanocytes in the absence of braf mutation . to identify putative micrornas involved in ois , we detected micrornas induced by braf in melanocytes using a focused pcr - based microarray system that enabled assessment of 52 micrornas ( sabiosciences ) . as expected , expression of braf in primary human melanocytes induced constitutively high levels of erk1/2 phosphorylation ( figure 1(a ) ) promoting growth arrest ( figure 1(b ) ) and senescence as detected by the expression of senescence - associated -galactosidase ( sa--gal ) ( figure 1(c ) ) , dec1 , p16 , p15 , and dcr2 ( figures 1(a ) and 1(d ) ) . at a time point prior to the detection of senescence , we collected total rna and enriched for small rnas as recommended by the manufacturer . by enriching for small rnas , the levels of each microrna were quantified relative to the levels of four control small rnas . among the 52 micrornas that we examined , 13 were significantly induced and three ( mir-10b , -15b , and -16 ) were greatly repressed by braf in primary melanocytes ( data not shown ) . subsequently , quantitative real - time pcr ( qrt - pcr ) was used to further examine the effect of braf on the expression of these micrornas with specific primers for each individual microrna . eight out of the 13 that were stimulated in the original screen were consistently induced more than 2-fold by braf ( figure 2 ) . based on the documented expression of these micrornas in clinical melanocytic nevi , we selected four of them for further study [ 20 , 24 , 25 ] . to examine their causal role in cellular senescence in melanocytes the expression of micrornas was confirmed by qrt - pcr with specific primers ( figure 3(a ) ) . the effects of individual microrna expression on the expression of five senescence markers were determined by qrt - pcr ( figures 3(b)3(e ) ) . three out of the four micrornas tested had an observable effect on the expression of at least one of the senescence markers . these are micrornas 143 , 34a , and 29a . while expression of mir-34a increased p16 , p15 , dcr2 , and dec1 transcripts , expression of mir-143 , or 29a increased the p15 and dcr2 transcripts ( figures 3(c)3(e ) ) . to investigate directly their role in cellular senescence , we measured cell proliferation by quantifying the number of melanocytes expressing the proliferation marker protein ki-67 due to the expression of mir-143 , 34a , or 29a . expression of mir-143 or -34a but not -29a or -100 led to a decrease in melanocyte proliferation as measured by the expression of proliferation marker protein ki-67 . importantly , the decreased expression of ki-67 correlated with intense activity of sa--gal ( figure 3(f ) ) . oncogenic braf induced premature senescence in melanocytes with a concomitant increase in the expression of senescence markers p16 , p15 , dec1 , and dcr2 . in addition , we showed that oncogenic braf also significantly increased the expression of mir-143 , mir-34a , let-7c , mir-15a , mir-29a , mir-100 , mir-181a , and mir-181d . by specific watson - crick base pairing between the seed region of microrna and sites within the mrna 3utr expression of mir-143 , -34a , or -29a led to the increased expression of some of the senescence markers . it is therefore possible that a combined expression of the identified micrornas is responsible for the observed upregulation of senescence markers in oncogenic braf expressing melanocytes . among the micrornas that are induced by the braf gain - of - function mutation , only mir-143 or -34a is sufficient to induce growth arrest and senescence when ectopically expressed in primary melanocytes . mir-34a negatively regulates cell cycle g1/s transition genes cyclin d1 , cyclin e2 , cdk4 , and cdk6 and causes g1 arrest [ 2628 ] when expressed in human primary diploid fibroblasts . in human cancer cells , mir-143 is one of the most notable tumor suppressor mir - rnas , which can directly inhibit oncogene kras translation and block the downstream signal pathways . restoring mir-143 expression inhibited proliferation and induced apoptosis by targeting bcl2 [ 30 , 31 ] . in agreement with these studies ectopic expression of mir-34a increased expression of p16 , p15 , dec1 , and dcr2 . unlike mir-34a , mir-143 only increased expression of p15 and dcr2 . since both mir-34a and -143 expression caused senescence , it can be inferred that expression of p16 or dec1 is not essential for oncogenic braf - mediated premature senescence . concordantly , the presence of p16 was also previously found not to be required for senescence induced by gain - of - function braf mutation in melanocytes . it is presently not clear which mrnas , mir-34a or -143 , target for repression in melanocytes , nor do we know how oncogenic braf induces their expression . by targeting different subset of genes for regulation , micrornas can function either as oncogenes or tumor suppressor genes . for instance , mir-29 , which has three family members , negatively impinges on cancer cell survival by directly targeting the mrnas of the regulatory subunit of pi3 kinase ( p85a ) and cdc42 for regulation . consistent with its tumor suppressive role , mir-29 expression is frequently downregulated in multiple cancers . however despite its proven role in cell cycle regulation , expression of mir-29a is not sufficient to induce senescence in melanocytes . it is possible that mir-29a is required but not sufficient for oncogenic braf - induced senescence . it is also possible that the effect of mir-29a on cell cycle progression is cell - context dependent . we reason that if microrna is part of the mechanism that integrates the diverse components into a coordinated response to the braf mutation , we should also observe downregulation of oncogenic micrornas . indeed , mir-10b , which increases the expression of oncogene rhoc by directly targeting its transcriptional repressor hoxd10 , is consistently repressed in melanocytes harboring the braf mutation . in addition to mir-10b , we also observed expression levels of mir-15b and -16 downregulated . one is called mir-16 - 1 located on chromosome ( chr ) 13 and shares the same transcript with mir-15a forming the mir-15a/16 cluster . the other mir-16 is named mir-16 - 2 , which together with mir-15b is located at chr 3 as the mir-15b/16 cluster . interestingly while mir-15b and 16 were downregulated , the mir-15a was upregulated in melanocytes expressing braf . since our mir-16 primer detected both mir-16 - 1 and -16 - 2 transcripts , it is unknown at present which mir-16 was downregulated by oncogenic braf expression . the mir-15/16 family is known to have a negative effect on cell proliferation by targeting mrnas for various cell - growth - associated genes [ 3436 ] . it is therefore not clear why the downregulation of mir-15b and -16 is favored in melanocytes , which are undergoing senescence . although it is clear that braf induces senescence in melanocytes by activating mek and erk , the downstream effectors of its cytostatic effect remain to be identified [ 13 , 37 ] . braf - mediated senescence also requires additional effector pathways involving several immune and growth mediators such as il6 , il8 , and igfbp7 . however , the mechanism that integrates the diverse pathways into a coordinate response to oncogenic stimulation has not been defined . in this study expression of four of these micrornas induced the expression senescence - surrogate markers . among them , mir-143 or -34a alone can induce growth arrest and senescence when expressed in primary melanocytes . melanoma is a cancer of melanocytes and is the most deadly form of skin cancer . the transformation of melanocytes to malignant melanoma is a stepwise process fueled by the accumulation of mutations in critical growth and survival regulatory genes . the development of benign nevi from melanocytes is the first phenotypic change that can be detected during the progression of normal melanocytes to malignant melanoma . studies with mouse models have demonstrated the causal role of the activated braf allele in promoting benign melanocytic hyperplasia [ 14 , 15 ] . the underlying mechanisms that drive the transformation of melanocytes to a precancerous nevi are poorly understood . since micrornas have multiple regulatory targets , our results together with the expression of these micrornas in clinical melanocytic nevi strongly suggest that the identified micrornas may play a vital coordinative role in braf - induced senescence in melanocytic nevi . it is conceivable that benign nevi transform into melanoma of uncontrolled growth following subsequent mutations that inactivate the oncogenic b - raf - mediated senescence pathways . as such a thorough understanding of how oncogenic braf induces senescence will allow us to elucidate the molecular mechanisms that drive the conversion of melanocytes to preneoplastic nevi and transition to melanoma . human melanocytes were from cascade biologics ( portland , or , usa ) or yale cell culture core facility . human melanocytes were grown in media 254 with added growth supplements ( cascade biologics ) . retroviral expression vectors ( mir - vec ) for mir-100 , mir-15a/16 - 1 , and -181a were a kind gift of reuven agami . the mirna minigenes -29a , -34a , -143 , -181d , -15b , and -15b/16 - 2 were pcr amplifided from genomic human dna , cloned downstream of the cmv promoter in mir - vec , and sequence verified . the primers for the mirna minigenes cloning were the following : mir-29a forward : 5-gcggatccctggaaccaatccctcaa mir-29a reverse : 5-gcgaattcgctcctttcccatcatct mir-34a forward : 5-gcggatccggctggtcttgaactcct mir-34a reverse : 5-gcgaattccactggctactattctcccta mir-143 forward : 5-gcggatcctcaaggtttggtcctgggtg mir-143 reverse : 5-gcgaattccgtgaagcagatcgtggc mir-15b forward : gcggatccaaggggatgattatgaag mir-15b reverse : gcgaattcagtggaacaagtatgtcagt mir-15b/16 forward : gcggatccgacttggaccataataga mir-15b/16 reverse : gcgaattctaggtgcttaggtaaatc mir-181d forward : gcggatccgaccgttgagtggaccc mir-181d reverse : gcgaattctccagccagagcccatcc one 10 cm cultured plate of subconfluent primary melanocytes was harvested by trypsin digestion . the washed cell - pellet was resuspended with 1.2 ml cell resuspension buffer ( 10 mm tris - hcl , 10 mm nacl , 1.5 mm mgcl2 ) by gently pipetting up and down . cells were digested with 8 ml of sucrose / proteinase k lysis buffer ( 27% sucrose , 1xssc , 1 mm edta , 1%sds , 200 ug / ml proteinase k ) overnight at 37c . the next day digested cells were extracted with 10 ml phenol : chloroform : isoamyl alcohol ( 25 : 24 : 1 ) and the dna was precipitated with 1 volume isopropanol . dna was dissolved and extracted with phenol / chloroform / isoamyl alcohol again followed by precipitation with 1/3 volume of 7.5 m ammonium acetate ( ph 7.4 ) . precipitated dna was washed with 70% ethanol and dissolved in te ( ph 7.4 ) . the senescence - associated b - galactosidase activity in culture cell was detected with a staining kit purchased from cell signaling technology according to the manufacturer 's specifications . cells were plated on laminin - coated cover slips ( laminin , l 2020 , sigma ) . after 48 hours , cells were washed with pbs and fixed with 100% cold methanol for 10 minutes . fixed cells were then incubated in blocking solution ( 0.1% bsa in pbs ) for 30 minutes . primary antibodies , 200300 l ( 1 : 100 in block solution ) , specific for ki-67 ( sc-15402 , santa cruz ) were added onto each cover slips and incubated overnight at 4c . primary antibody - stained cells were washed 3 times for 3 minutes each with 0.1% bsa - pbs blocking solution . washed cells were subsequently incubated with fitc - conjugated secondary antibody ( 1 : 200 diluted in blocking solution ) for 1 hour at room temperature followed by one wash with blocking solution for 3 minutes , two pbs washes for 3 minutes each , and two washes with dh2o . the nuclei of ki-67 stained cells were visualized with dapi ( 4 g / ml in dh2o ) staining for 10 min . cells were rinsed with dh2o twice before mounting onto glass slides with dako fluorescent mounting medium ( dako , s3032 ) . the cover slip edges were sealed with nail enamel polisher and were dried in the hood for an addition 1020 min . the phospho - p44/42 mapk ( thr202/tyr204 ) ( e10 ) mouse mab ( number 9106 ) and p44/42 map kinase antibodies ( number 9102 ) were from cell signaling . dec1 ( s-8 ) ( sc-101023 ) , p16 ( jc8 ) ( sc-56330 ) , and p15 ( c-20 ) ( sc-612 ) antibodies were from santa cruz . monoclonal anti- tubulin clone b-5 - 1 - 2 ( t-5168 ) was from sigma . total cellular rna was extracted with the trizol reagent ( invitrogen ) and reverse transcribed using random hexamer primers ( applied biosystems ) . the resulting cdnas were used for pcr using sybr - green master pcr mix ( qiagen ) in triplicates . the gene - specific primers were as follows : r : 5-cat gac ctg gtc ttc tag gaa gc-3f : 5-ccc tcg tgc tga tgc tac tga-3 r : 5-cat gac ctg gtc ttc tag gaa gc-3 f : 5-ccc tcg tgc tga tgc tac tga-3 r : 5-gca tgc cct tgt tct cct cg-3f : 5-ggg aaa gaa ggg aag agt gtc gtt-3 r : 5-gca tgc cct tgt tct cct cg-3 f : 5-ggg aaa gaa ggg aag agt gtc gtt-3 r : 5-ggt tgt ggc ggg ggc agt t-3f : 5-ggg ggc acc aga ggc agt-3 r : 5-ggt tgt ggc ggg ggc agt t-3 f : 5-ggg ggc acc aga ggc agt-3 r : 5-ccg ggg gat ggt ggc aga gt-3f : 5-cgc tcg agc agg gcg cta tc-3 r : 5-ccg ggg gat ggt ggc aga gt-3 f : 5-cgc tcg agc agg gcg cta tc-3 r : 5-cga tga gcc ggt gcg gca at-3f : 5-ccg gga ctg gag cac gga ga-3 r : 5-cga tga gcc ggt gcg gca at-3 f : 5-ccg gga ctg gag cac gga ga-3 f : 5-atctggcaccagaccttctacaatgagctgcg-3r : 5-cgtcatactcctgcttgctgatccacatctgc-3 f : 5-atctggcaccagaccttctacaatgagctgcg-3 r : 5-cgtcatactcctgcttgctgatccacatctgc-3 glyceraldehyde-3-phosphate dehydrogenase f : 5-tgcaccaccaactgcttagc-3r : 5-ggcatggactgtggtcatgag-3 f : 5-tgcaccaccaactgcttagc-3 r : 5-ggcatggactgtggtcatgag-3 cdna from the obtained mirnas was synthesized using rt mirna first strand kit ( sabiosciences ) . small rna from primary melanocytes was prepared using rneasy mini kit protocol ( qiagen ) . chloroform was added to the tubes containing homogenate ( 20% of the volume of trizol used ) . after shaking the tubes vigorously , the tubes were incubated at rt for 2 - 3 minutes and centrifuged ( 12,000 g ) for 15 mins at 4c . the upper aqueous layer was transferred to new tubes and 1 volume of 70% ethanol was added . the sample was mixed and applied to the rneasy minispin column and centrifuged at 8000 g ( 10,000 rpm ) for 15 s at rt . the flow - through contained mirnas and was further purified according to the manufacturer 's specifications ( qiagen ) .

recent high - throughput - sequencing of the cancer genome has identified oncogenic mutations in braf genetic locus as one of the critical events in melanomagenesis . in normal cells , the activity of braf is tightly regulated . gain - of - function mutations like those identified in melanoma frequently lead to enhanced cell - survival and unrestrained growth . the activating mutation of braf will also induce the cells to senesce . however , the mechanism by which the oncogenic braf induces the senescent barrier remains poorly defined . micrornas have regulatory functions toward the expression of genes that are important in carcinogenesis . here we show that expression of several micrornas is altered when the oncogenic version of braf is introduced in cultured primary melanocytes and these cells undergo premature cellular senescence . these include eight micrornas whose expression rates are significantly stimulated and three that are repressed . while most of the induced micrornas have documented negative effects on cell cycle progression , one of the repressed micrornas has proven oncogenic functions . ectopic expression of some of these induced micrornas increased the expression of senescence markers and induced growth arrest and senescence in primary melanocytes . taken together , our results suggest that the change in microrna expression rates may play a vital role in senescence induced by the oncogenic braf .

You are an expert at summarizing long articles. Proceed to summarize the following text: radical cystectomy ( rc ) with pelvic lymph node dissection is considered to be the gold standard treatment of muscle invasive bladder cancer ( bc ) . in some cases of high grade non muscle invasive disease which is refractory to bcg therapy , radical cystectomy is also a viable option . in the majority of cases , the most popular choice of diversion is either an ileal conduit or an orthotopic neobladder . recently , however , minimally invasive radical cystectomy techniques have been gaining popularity and nowadays in most cases robot assisted technique is used . robot assisted radical cystectomy ( rarc ) has been shown to be equivalent to open radical cystectomy in terms of oncological and functional outcomes , while superior when it comes to the perioperative outcomes such as shorter hospital stay and blood loss [ 15 ] . it has been shown that robotic techniques have comparable oncologic outcomes in terms of nodal yield and positive margin rates compared to the open technique [ 2 , 5 ] . therefore , many surgeons are still adopting the hybrid approach when performing the cystectomy using robotic assistance and completing the urinary diversions extracorporeally to shorten the operating time . wiklund and associates have pioneered the technique of intracorporeal urinary diversion creating both neobladders and ileal conduits completely intracorporeally . the technique is to be credited as an almost identical replication of open surgical principles . recently , the group reported their oncologic and functional outcomes of their rarc cohort showing comparable results to open series . equally , desai and gill presented remarkable outcomes using a modification of the aforementioned technique . these reports have further consolidated that rarc and intracorporeal diversion are technically feasible with good outcomes . however , these observations are limited to very few pioneering centers worldwide and it remains unknown whether rarc and intracorporeal urinary diversions are reproducible by other tertiary centers with robotic expertise . particularly , intracorporeal neobladder formation is regarded a technically challenging and potentially time consuming surgery with steep learning curves [ 9 , 10 ] . herein , we present a homogenous series of patients who underwent rarc and subsequent intracorporeal urinary diversion in the form of ileal conduit and neobladder . we aim to demonstrate that rarc with intracorporeal urinary diversion is safely reproducible and teachable given adequate robotic experience . to our knowledge , this is one of the largest series of rarc with intracorporeal urinary diversion to date . we retrospectively identified 101 patients who underwent rarc and intracorporeal urinary diversion in two academic centers from october 2009 to october 2014 . institutional review board approval ( # 081/2014r ) was obtained before starting data collection and analysis . a total of 300 radical cystectomies were performed in the two centers during the same period . one surgeon from each center performed the rarc with intracorporeal diversions , each experienced in open cystectomy and robotic prostatectomy . a dedicated robotic team comprising of a senior resident and nurse practitioner participated routinely in all the cases . the indications for rarc were muscle invasive transitional carcinoma ( tcc ) and high grade non muscle invasive disease refractory to intravesical bcg treatment . both men and women tcc histology , coagulopathy , pre existing incontinence for patients undergoing neobladder , cerebrovascular disease and severe pulmonary dysfunction rendering robotic surgery impossible . in our series , patients with previous intra abdominal surgeries or radiotherapy were not excluded . data analysis comprised of perioperative variables ( operating time , blood loss , hospital stay ) , standardized complication reporting using the clavien dindo system , pathology reporting and functional as well as oncologic outcomes . furthermore , 3year cancer specific survival ( css ) and overall survival ( os ) were reported . rarc was done using a three arm da vinci s system ( intuitive surgical , sunnyvale , california ) . the optical trocar was placed 2 cm above the umbilicus while a 0 degree telescope was used in all cases . the two remaining robotic trocars were placed a handbreadth lateral to the umbilicus and two more 12 mm assisting trocars were inserted 5 cm above the anterior superior iliac spine . finally , a 5 mm trocar was placed in the right upper abdomen . nerve sparing in both men and women was attempted whenever oncologically permitted . in females , nerve sparing was achieved by careful preservation of a tissues lateral to vagina to avoid damage to autonomic nerves . extended pelvic node dissection included the external , the internal as well as the common iliac nodes , the obturator fossa and the presacral area . the bladder specimen and the lymph nodes both ureters were clipped early and the left ureter was transposed below the sigmoid mesocolon . the robot was redocked and a 50 cm loop of terminal ileum was isolated approximately 20 cm proximal to the ileocecal valve . it is crucial to ensure that the most dependent part can reach down to pelvis easily to ensure a tension free urethro the ileal loop was next discontinued using a 60 mm endo gia stapler ( covidien ) . bowel continuity was then restored using an endo gia stapler by performing a functional end to end anastomosis . the isolated loop was consequently opened according to previously described techniques from wiklund et al . . the posterior plate was then reconstructed using a 3/0 absorbable suture in a running fashion . j stents were placed over guide wire and the ends were advanced through the wall of the reservoir . stents were advanced to the skin through the 12 mm trocar . in the patients who underwent intracorporeal ileal conduit , 15 cm of the terminal ileum 20 cm away from the ileocaecal valve was isolated . the distal end of ileal conduit was then brought out to the right abdominal wall and matured . specimens were ultimately retrieved through a separate incision ( specimen delivered via the vagina in women ) . rarc was done using a three arm da vinci s system ( intuitive surgical , sunnyvale , california ) . the optical trocar was placed 2 cm above the umbilicus while a 0 degree telescope was used in all cases . the two remaining robotic trocars were placed a handbreadth lateral to the umbilicus and two more 12 mm assisting trocars were inserted 5 cm above the anterior superior iliac spine . nerve sparing in both men and women was attempted whenever oncologically permitted . in females , nerve sparing was achieved by careful preservation of a tissues lateral to vagina to avoid damage to autonomic nerves . extended pelvic node dissection included the external , the internal as well as the common iliac nodes , the obturator fossa and the presacral area . the bladder specimen and the lymph nodes both ureters were clipped early and the left ureter was transposed below the sigmoid mesocolon . the robot was redocked and a 50 cm loop of terminal ileum was isolated approximately 20 cm proximal to the ileocecal valve . it is crucial to ensure that the most dependent part can reach down to pelvis easily to ensure a tension free urethro the ileal loop was next discontinued using a 60 mm endo gia stapler ( covidien ) . bowel continuity was then restored using an endo gia stapler by performing a functional end to end anastomosis . the isolated loop was consequently opened according to previously described techniques from wiklund et al . . the posterior plate was then reconstructed using a 3/0 absorbable suture in a running fashion . j stents were placed over guide wire and the ends were advanced through the wall of the reservoir . both ureters were then anastomosed to the afferent limb using a 4/0 absorbable suture . in the patients who underwent intracorporeal ileal conduit , 15 cm of the terminal ileum 20 cm away from the ileocaecal valve was isolated . the uretero the distal end of ileal conduit was then brought out to the right abdominal wall and matured . specimens were ultimately retrieved through a separate incision ( specimen delivered via the vagina in women ) . in total , 101 rarcs with intracorporeal urinary diversion were identified in 82 men and 19 women . out of which , 73 patients ( 57 male , 16 female ) underwent intracorporeal neobladder ; and 28 patients ( 25 male , 3 female ) underwent intracorporeal ileal conduit . the mean body mass index ( bmi ) was 26.5 kg / m ( 1934 ) . in those patients who underwent intracorporeal neobladder , neoadjuvant chemotherapy was administered in 13 patients ( 12.9% ) with presumably advanced stage ( table 1 ) . the preoperative stage and grade of disease is also included in the table . the mean operating time was 402.3 minutes ( 205690 ) and blood loss was 345.3 ml ( 501000 ) while the mean diversion time was 156.6 minutes ( 85300 ) . bilateral nerve sparing was performed in all females and in 52 out of 82 men ( 63.4% ) . the postoperative tumor stage was cis in 7 patients ( 6.9% ) , pt0 in 11 patients ( 10.9% ) , pt1 in 6 patients ( 5.9% ) , pt2 in 33 patients ( 32.7% ) , pt3 in 31 patients ( 30.7% ) , pt4 in 13 patients ( 12.8% and all of them were high grade disease . out of all the patients , 8.9% had positive ureteric margins despite having negative intra concomitant prostate cancer was found in 29 men ( 35.3% ) . the gleason score was 3 + 3 in 18 patients ( 62.1% ) , 3 + 4 in 6 patients ( 20.7% ) and 4 + 3 in 3 patients ( 10.3% ) and gleason 8 disease a total of 3 men ( 10.3% ) had positive prostatic margins ( 2 men from ileal conduit arm and one patient from the neobladder arm ) . there was no preoperative psa performed , as it was not part of routine preoperative investigations . patient 's characteristics bmi body mass index , asa american society of anesthesiologists , cis carcinoma in situ , bcg bacillus calmette gurin perioperative and postoperative outcome pathology characteristics the perioperative complications were grade i in 12 patients ( 11.9% ) , grade ii in 16 patients ( 15.8% ) , grade iii in 28 patients ( 27.7% ) and grade iv in 9 patients ( 8.9% ) . minor ( clavien i&ii ) and major ( clavien iii ) complication rates were 27.7% and 36.6% respectively . early surgery related complications ( < 30 days ) occurred in 50.5% of patients with 6 patients requiring reoperation . out of which , three patients had prolonged ileus , one patient had post operative hemorrhage , one patient had small bowel anastomosis dehiscence and one patient had small bowel sealed perforation treated with small bowel resection . there was no statistical difference between the complication rates of neobladder and ileal conduit patients . the average follow up was 27.5 months ( 152 ) . during the follow ups , one patient ( 1.0% ) who underwent intracorporeal neobladder had developed local recurrence . metastatic disease developed in 25 patients ( 24.8% ) and all of them received chemotherapy . 17 patients have died due to metastatic disease during the follow up period , whereas 9 patients died from other non cancer related disease . the 3year cancer specific survival ( css ) and overall survival ( os ) was 80.2% and 69.8% respectively ( table 4 ) . early ( < 30 days ) and late ( > 30 days ) surgical complications the continence and sexual outcomes were assessed in patients 12 months after surgery . continence is defined as usage of less than 1 pad a day and iief5 score was used to assess the potency of patients . daytime continence could be achieved in 89.2% , while complete nighttime continence was noted in 67.6% of patients who underwent intracorporeal neobladder . erectile dysfunction was reported in 63.5% of men ( table 5 ) . functional and oncologic outcomes the perioperative complications were grade i in 12 patients ( 11.9% ) , grade ii in 16 patients ( 15.8% ) , grade iii in 28 patients ( 27.7% ) and grade iv in 9 patients ( 8.9% ) . minor ( clavien i&ii ) and major ( clavien iii ) complication rates were 27.7% and 36.6% respectively . early surgery related complications ( < 30 days ) occurred in 50.5% of patients with 6 patients requiring reoperation . out of which , three patients had prolonged ileus , one patient had post operative hemorrhage , one patient had small bowel anastomosis dehiscence and one patient had small bowel sealed perforation treated with small bowel resection . late surgery there was no statistical difference between the complication rates of neobladder and ileal conduit patients . the average follow up was 27.5 months ( 152 ) . during the follow ups , one patient ( 1.0% ) who underwent intracorporeal neobladder had developed local recurrence . metastatic disease developed in 25 patients ( 24.8% ) and all of them received chemotherapy . 17 patients have died due to metastatic disease during the follow up period , whereas 9 patients died from other non cancer related disease . the 3year cancer specific survival ( css ) and overall survival ( os ) was 80.2% and 69.8% respectively ( table 4 ) . early ( < 30 days ) and late ( > 30 days ) surgical complications continence is defined as usage of less than 1 pad a day and iief5 score was used to assess the potency of patients . daytime continence could be achieved in 89.2% , while complete nighttime continence was noted in 67.6% of patients who underwent intracorporeal neobladder . erectile dysfunction was reported in 63.5% of men ( table 5 ) . functional and oncologic outcomes rarc has been gaining popularity as a viable alternative to open radical cystectomy for patients with bladder carcinoma . however , it is still not as widely adopted as robotic radical prostatectomy for various reasons . recent reports have confirmed the long term safety and efficacy of laparoscopic rc as well as of rarc . equivalent oncologic outcomes have been shown by using surrogate parameters such as nodal yield and margin status . secondly , rarc especially intracorporeal diversion has always been considered a very lengthy procedure with the potential risk of complications associated with the steep trendelenburg position . this may be true for the initial series ; however , contemporary data has indicated competitive surgical times and other studies have also shown that operating time and patient 's length of stay continues to improve with the learning curve . thirdly , rarc and intracorporeal urinary diversion has been deemed a cumbersome procedure consisting of a robotic part and an open extracorporeal part for urinary diversion . many have hence questioned the point of performing rarc with extracorporeal diversion as this potentially takes away the advantages of minimally invasive surgery such as smaller wound incision and reduced bowel exposure . they followed the principles of open surgery in creating a studer neobladder including proper folding . their approach has evolved over time leading to technical modifications and a reduction of complications and operative times . in a cumulative analysis of 70 patients with a median follow up of 30.3 months , they found negative margins in 98.6% . relevant complications occurred in 31.4% at 30 d and 18.6% at > 30 d. at 90 d , the overall complication rate was 58.5% . the recurrence free , cancer specific , and overall survival at 24 months was 80.7% , 88.9% , and 88.9% . daytime continence and satisfactory sexual function or potency at 12 months ranged between 70% and 90% in both men and women . these results are well in line with contemporary open series . a retrospective comparison to open diversion in the framework of the international robotic cystectomy consortium including 935 patients further confirmed the safety of intracoroporeal diversion by showing lower risk of postoperative complication including gastrointestinal complications in these patients . notably , only 61 patients had undergone intracorporeal neobladder formation in this comparative study . in the u.s . , similar approaches have been described . although shorter follow up with fewer patients , comparable results have been reported . herein , we present our cumulative experience with rarc and intracorporeal urinary diversion performed in two tertiary referral centers with robotic expertise . this is a representation of a real life experience of rarc and intracorporeal urinary diversion outside of the pioneering centers . many findings by the pioneer groups have been corroborated and their results have been widely replicated . hence , rarc and intracorporeal urinary diversion may be safely implemented into clinical routine whenever adequate robotic experience is available . to the best of our knowledge , our report describes the largest series of rarc and intracorporeal diversion apart from the karolinska group . obviously , our surgical times in the initial cases were long due to the learning curve . however , over time average operative time spent could be reduced to less than 6 hours . this is in line with what has been shown by various studies that robotic cystectomy and intracorporeal urinary diversion can be done safely with a structured approach in a high volume center [ 9 , 15 ] . from our experience , another important element to a successful rarc with intracorporeal urinary diversion that provides patient with good oncological , functional and perioperative outcomes is a dedicated robotic team . rarc with intracorporeal diversion is extremely complex and can be intimidating for any young robotic surgeon . it helps to have a dedicated robotic team as familiarization is important not just for the surgeon , but also for the bedside assistants , scrub team as well as the theatre staff . in our practice , a dedicated team comprised of a senior resident and nurse practitioner participates routinely in all the cases . teamwork from all the members of the team involved is crucial to ensure a smooth sailing surgery to minimize complications , conversion rate and shorten the operating time . ileal anastomosis , smaller skin incision for delivery of specimen and , decreased bowel manipulation and exposure to external environment . all these factors can ultimately contribute the better outcomes in terms of better perioperative outcomes and lower risk of postoperative complications [ 15 , 14 ] . our results have shown the safety and reproducibility of this complex technique with comparable operating times , perioperative complications , functional and oncologic outcomes with the pioneer centers . in terms of hospital stay , our series showed a longer hospital stay compared to the contemporary series ; this could be partly attributed to our subsidy system whereby the patients have to stay for 1 week to receive full subsidies . however , we face the similar limitations faced by previous authors such as retrospective nature , limited number of patients and follow up durations . however , current results seem to favor robotic cystectomy with intracorporeal urinary diversion ; a conclusion which can only be established eventually with a randomized study of adequate power . with the advancement of technology and refinement of surgical technique , it is a matter of time before more will embark on robotic cystectomy and intracorporeal urinary diversions . a standardized technique with a dedicated robotic team in a high volume center makes robotic intracorporeal urinary diversion a feasible and reproducible technique .

introductionrobot assisted radical cystectomy ( rarc ) plus intracorporeal urinary diversion is feasible . few centers worldwide demonstrated comparable functional and oncologic outcomes . we reported a large series of rarc and intracorporeal diversion to assess its feasibility and reproducibility.material and methodswe identified 101 rarcs in 82 men and 19 women ( mean age 68.3 years ) from october 2009 to october 2014 . the patients underwent rarc and pelvic lymphadenectomy followed by intracorporeal urinary diversion ( ileal conduit/ neobladder ) . out of the 101 patients , 28 ( 27.7% ) received intracorporeal ileal conduits and 73 ( 72.3% ) intracorporeal neobladders . studer pouch was performed in all the patients who underwent intracorporeal neobladder formation . perioperative , functional and oncologic results including css and os are reported.resultsmean operative time was 402.3 minutes ( 205690 ) and blood loss was 345.3 ml ( 501000 ) . the mean hospital stay was 17.1 days ( 562 ) . all the surgeries were completed with no open conversion . minor complications ( grade i and ii ) were reported in 27.7% of patients while major complications ( grade iii and above ) were reported in 36.6% of patients . the mean nodal yield was 20.6 ( 046 ) . positive ureteric margins were found in 8.9% of patients . the average follow up was 27.5 months ( 152 ) . daytime continence could be achieved in 89.2% of patients who underwent intracorporeal neobladder . the 3year cancer specific survival ( css ) and overall survival ( os ) was 80.2% and 69.8% respectively.conclusionsrarc with intracorporeal diversion is safe and reproducible in non pioneer tertiary centers with robotic expertise having acceptable operative time and complications as well as comparable functional and oncologic outcomes .

You are an expert at summarizing long articles. Proceed to summarize the following text: the association between the several non - skeletal diseases and vitamin d deficiency has been recently reported ( 1 , 2 ) . some risk factors of vitamin d deficiency and type 2 diabetes are similar ( e.g. ethnicity , obesity , age and low physical activity level ) . a low level of vitamin d status has been reported in diabetic patients ( 1 , 3 - 5 ) . vitamin d may be involved in the pathways of insulin production , secretion , and possibly insulin signaling in insulin - sensitive tissues ( 6 ) . it may be effective in reducing the risk of type 2 diabetes ( 4 , 7 , 8) and its management ( 3 , 6 ) . vitamin d deficiency was associated with insulin resistance ( 4 , 7 , 9 , 10 ) and considered as a risk factor for type 2 diabetes ( 2 , 7 , 10 ) . adiponectin is one of the suggested mechanisms by which vitamin d may affect insulin sensitivity ( 5 , 11 ) and epidemiological studies have shown that adiponectin is inversely associated with obesity , insulin resistance , diabetes , metabolic syndrome , cardiovascular disease and hypertension ( 12 - 21 ) . in comparison to healthy people , the lower plasma concentrations of adiponectin have been reported in type 2 diabetic patients and obese people ( 7 , 22 , 23 ) . thiazolidinediones - induced improvement in insulin sensitivity may be related to an increase in serum adiponectin ( 23 ) . reported positive association between vitamin d and adiponectin in cross - sectional studies ( 5 , 7 , 21 , 24 , 25 ) may be arise from that vitamin d may affect serum adiponectin through increased adiponectin gene expression ( 5 ) or renin - angiotensinogen system ( 11 ) . given this relationship and since vitamin d status , as well as adiponectin , is inversely associated with insulin resistance and cardiovascular diseases ( 24 - 26 ) , it can be suggested a possible role of the adiponectin -dependent vitamin d effect in decreasing insulin resistance and cardiovascular diseases . thus , it is important to evaluate the effect of vitamin d supplementation on adiponectin concentration and illustrate whether vitamin d may improve the glycemic indicators through adiponectin . vitamin d supplementation alone , or in combination with calcium has shown conflicting results in prevention or management of type 2 diabetes ( 6 , 27 ) . these discrepancies may arise from lack of coordination in methodological design , supplementation dosage , duration , baseline body vitamin status and etc . since adiponectin is associated with a better glycemic control and other metabolic indicators , identifying the causes of deficiency and its enhancing factors may be useful in the management of diabetes and metabolic syndrome . however , only two interventional studies have been conducted to determine the effects of vitamin d supplementation on serum adiponectin and subsequent blood glucose ( 10 , 28 ) . regarding the high prevalence of diabetes ( 29 ) and vitamin d deficiency ( 30 ) in iran and since vitamin d deficiency may increase insulin resistance through low adiponectin levels , the aim of this study was to investigate the effect of therapeutic dose of vitamin d ( a single dose of 50000 iu / week for 8 weeks ) on serum adiponectin and insulin resistance in vitamin d - insufficient or deficient type 2 diabetic patients . this double - blind , randomized , clinical trial was approved by the ethic committee of endocrinology and metabolism research center , tehran university of medical sciences ( 00220 ) and was conducted during december - march 2012 at the diabetes and metabolic disease clinic of endocrinology and metabolism research center , tehran university of medical sciences , tehran , iran . sample size was determined according to variable homa - ir of al - daghri et al . clinical trial ( 25 ) considering = 0.05 and = 0.02 , the mean differences for vitamin d and placebo groups were 0.04 0.06 and 0.01 0.03 , respectively . by the possibility of 10% for sample missing , the required sample size per group was determined 44 cases . using medical documents , 105 type 2 diabetic patients controlled by oral glucose - lowering agents were invited to participate in the study and 98 patients were selected according to document - based inclusion criteria . serum 25-hydroxyvitamin d , aspartate transaminase , alanine transaminase , creatinine , blood urea nitrogen and glycated hemoglobin were measured and nine patients were excluded from the study because their vitamin d status was not within the vitamin d range of the study and also two cases were excluded due to hba1c more than 8% . overall , 87 patients were recruited the trial and allocated into two groups through sex - stratified randomization ( 43 receiving vitamin d and 44 receiving placebo ) ( figure 1 ) . inclusion criteria were diagnosed type 2 diabetes mellitus > one year and > 30 years old , aged 31 - 65 , body mass index ( bmi ) > 25 and < 30 kg / m , serum 25hydroxyvitamin d 10 - 30 ng / ml , glycated hemoglobin ( hba1c ) < 8% , no alcohol consumption and smoking , insulin therapy , consuming thiazolidinediones , pregnancy or menopause , consuming vitamin d - interfering drugs ( corticosteroids , antiepileptics and contraceptives ) and also calcium and vitamin d supplementation in last six months , no history of myocardial infarction , angina pectina and stroke in last year or suffering from cardiovascular , liver , kidney , thyroid gland diseases and chronic inflammation . exclusion criteria were non - regular consumption of supplements ( consuming less than 80% ) , changes in the dietary intake , physical activity level and medications . participants were explained in regard to the protocol and the aim of the study and the written informed consent was obtained . a demographic questionnaire was completed for each patient and blood samples were collected for determining the concentrations of serum 25-hydroxyvitamin d. then , vitamin d - insufficient or deficient diagnosed patients were randomly stratified according to sex into two groups receiving 50000 iu / week vitamin d , or paraffin as placebo . current acceptable approaches to treat vitamin d deficiency in infants are 2000 iu / d or a single dose of 50000 iu / week for 6 weeks until the serum 25-hydoryvitamin d level gets above 30 ng / ml and then 400 - 1000 iu / d for maintenance . in children 1 - 18 years old , treatments are 2000 iu / d at least for 6 weeks or a single dose of 50000 iu / week at least for 6 weeks and the maintenance of 600 - 1000 iu / d . in all adults the recommended approach is a single dose of 50000iu / week for 8 weeks to reach above 30 ng / ml and the maintenance dose of 1500 - 2000iu / d . in obesity , malabsorption syndrome or taking drugs affecting vitamin d metabolism , higher doses ( 6000 - 10000 iu / d ) are recommended and the maintaining dose would be 3000 - 6000 iu / d ( 31 ) . vitamin d supplementation in this study was 50000iu vitamin d3 soft gelatin spherical pearls with clear and transparent shell . vitamin d and placebo batches were named as a or b by a third person . each volunteers received eight pearls ( vitamin d or placebo ) in one batch at the beginning of the study and were asked to take weekly for eight weeks . all participants were recommended not to change their usual physical activity level and food intakes . maintaining the medication as before was a criteria for continuing the study . at the end of the study weight was determined to the nearest 0.1 kg on the same properly calibrated electronic digital scale , without shoes , with minimal clothing , and after voiding . two measurements were obtained and averaged ; with a third measurement taken if the first two differed by 0.1 . body mass index ( bmi ) was estimated as the ratio of body weight to height squared and expressed as kg / m . physical activity level was assessed by a validated questionnaire in which nine different metabolic equivalent ( met ) levels were ranged on a scale from sleep / rest ( 0.9 mets ) to high - intensity physical activities ( > 6 mets ) . dietary intake of vitamin d and calcium were ensured through 1-day 24-hour dietary recall at the baseline and end of the eighth week of the study . this dietary information was analyzed with n4 software ( nutritionist : version 4.0 ; tinuviel software , warrington , united kingdom ) . seven ml 12-hour fasting state blood samples were collected from brachial vein at the baseline and end of study . the samples centrifuged immediately at 3000 rpm for 15 minutes and promptly the serum aliquoted into separate tubes . serum glucose concentration was measured ( glucose determination kit , parsazmun , tehran , iran ) through auto - analyzer instrument ( sellectra ii , dieren , netherland ) and fluorometric method according glucose oxidase principle . serum insulin was measured by enzyme - linked immunosorbent assay ( elisa ) kit ( monobind , uppsala , us ) . homeostasis model of assessment ( homa - ir ) as an index of insulin resistance was used ( 32 ) . glycated hemoglobin was determined in whole blood sample by ds5 chromatography method ( hba1c kit , drew scientific limited , villaricca , united kingdom ) . the intra- and inter- assay coefficients of variation ( cvs ) for glucose , insulin and hba1c were 4.7% , 5.5% , 5.6% and 4.9% , 5.8% , 5.8% , respectively . the sensitivity of the assays for glucose , insulin and hba1c were 1 mg / dl , 1 mu / l and 1% , respectively . the intra- and inter- assay cvs for serum vitamin d were 5.4% and 5.5% , respectively . serum adiponectin were also measured by elisa kit ( mediagnost , uppsala , germany ) . the intra - and inter- assay cvs for adiponectin were 1.5% and 2% , respectively . the sensitivity of the assays was 0.6 ng / ml . data were analyzed with statistical package software for social sciences , version 16 ( spss inc . paired t - test was used to compare the mean variables before and after the intervention in each group . t - test was used to compare the mean differences of variables before and after the intervention as well as the mean changes between the groups . an alpha level of less than 0.05 was accepted in all tests as statistically significant and with the sample size of 87 ; a power value of % 90 was generated . sample size was determined according to variable homa - ir of al - daghri et al . clinical trial ( 25 ) considering = 0.05 and = 0.02 , the mean differences for vitamin d and placebo groups were 0.04 0.06 and 0.01 0.03 , respectively . by the possibility of 10% for sample missing , the required sample size per group was determined 44 cases . using medical documents , 105 type 2 diabetic patients controlled by oral glucose - lowering agents were invited to participate in the study and 98 patients were selected according to document - based inclusion criteria . serum 25-hydroxyvitamin d , aspartate transaminase , alanine transaminase , creatinine , blood urea nitrogen and glycated hemoglobin were measured and nine patients were excluded from the study because their vitamin d status was not within the vitamin d range of the study and also two cases were excluded due to hba1c more than 8% . overall , 87 patients were recruited the trial and allocated into two groups through sex - stratified randomization ( 43 receiving vitamin d and 44 receiving placebo ) ( figure 1 ) . inclusion criteria were diagnosed type 2 diabetes mellitus > one year and > 30 years old , aged 31 - 65 , body mass index ( bmi ) > 25 and < 30 kg / m , serum 25hydroxyvitamin d 10 - 30 ng / ml , glycated hemoglobin ( hba1c ) < 8% , no alcohol consumption and smoking , insulin therapy , consuming thiazolidinediones , pregnancy or menopause , consuming vitamin d - interfering drugs ( corticosteroids , antiepileptics and contraceptives ) and also calcium and vitamin d supplementation in last six months , no history of myocardial infarction , angina pectina and stroke in last year or suffering from cardiovascular , liver , kidney , thyroid gland diseases and chronic inflammation . exclusion criteria were non - regular consumption of supplements ( consuming less than 80% ) , changes in the dietary intake , physical activity level and medications . participants were explained in regard to the protocol and the aim of the study and the written informed consent was obtained . a demographic questionnaire was completed for each patient and blood samples were collected for determining the concentrations of serum 25-hydroxyvitamin d. then , vitamin d - insufficient or deficient diagnosed patients were randomly stratified according to sex into two groups receiving 50000 iu / week vitamin d , or paraffin as placebo . current acceptable approaches to treat vitamin d deficiency in infants are 2000 iu / d or a single dose of 50000 iu / week for 6 weeks until the serum 25-hydoryvitamin d level gets above 30 ng / ml and then 400 - 1000 iu / d for maintenance . in children 1 - 18 years old , treatments are 2000 iu / d at least for 6 weeks or a single dose of 50000 iu / week at least for 6 weeks and the maintenance of 600 - 1000 iu / d . in all adults the recommended approach is a single dose of 50000iu / week for 8 weeks to reach above 30 ng / ml and the maintenance dose of 1500 - 2000iu / d . in obesity , malabsorption syndrome or taking drugs affecting vitamin d metabolism , higher doses ( 6000 - 10000 iu / d ) are recommended and the maintaining dose would be 3000 - 6000 iu / d ( 31 ) . vitamin d supplementation in this study was 50000iu vitamin d3 soft gelatin spherical pearls with clear and transparent shell . vitamin d and placebo batches were named as a or b by a third person . each volunteers received eight pearls ( vitamin d or placebo ) in one batch at the beginning of the study and were asked to take weekly for eight weeks . all participants were recommended not to change their usual physical activity level and food intakes . maintaining the medication as before was a criteria for continuing the study . at the end of the study weight was determined to the nearest 0.1 kg on the same properly calibrated electronic digital scale , without shoes , with minimal clothing , and after voiding . two measurements were obtained and averaged ; with a third measurement taken if the first two differed by 0.1 . body mass index ( bmi ) was estimated as the ratio of body weight to height squared and expressed as kg / m . physical activity level was assessed by a validated questionnaire in which nine different metabolic equivalent ( met ) levels were ranged on a scale from sleep / rest ( 0.9 mets ) to high - intensity physical activities ( > 6 mets ) . dietary intake of vitamin d and calcium were ensured through 1-day 24-hour dietary recall at the baseline and end of the eighth week of the study . this dietary information was analyzed with n4 software ( nutritionist : version 4.0 ; tinuviel software , warrington , united kingdom ) . seven ml 12-hour fasting state blood samples were collected from brachial vein at the baseline and end of study . the samples centrifuged immediately at 3000 rpm for 15 minutes and promptly the serum aliquoted into separate tubes . serum glucose concentration was measured ( glucose determination kit , parsazmun , tehran , iran ) through auto - analyzer instrument ( sellectra ii , dieren , netherland ) and fluorometric method according glucose oxidase principle . serum insulin was measured by enzyme - linked immunosorbent assay ( elisa ) kit ( monobind , uppsala , us ) . homeostasis model of assessment ( homa - ir ) as an index of insulin resistance was used ( 32 ) . glycated hemoglobin was determined in whole blood sample by ds5 chromatography method ( hba1c kit , drew scientific limited , villaricca , united kingdom ) . the intra- and inter- assay coefficients of variation ( cvs ) for glucose , insulin and hba1c were 4.7% , 5.5% , 5.6% and 4.9% , 5.8% , 5.8% , respectively . the sensitivity of the assays for glucose , insulin and hba1c were 1 mg / dl , 1 mu / l and 1% , respectively . the intra- and inter- assay cvs for serum vitamin d were 5.4% and 5.5% , respectively . serum adiponectin were also measured by elisa kit ( mediagnost , uppsala , germany ) . the intra - and inter- assay cvs for adiponectin were 1.5% and 2% , respectively . data were analyzed with statistical package software for social sciences , version 16 ( spss inc . paired t - test was used to compare the mean variables before and after the intervention in each group . t - test was used to compare the mean differences of variables before and after the intervention as well as the mean changes between the groups . an alpha level of less than 0.05 was accepted in all tests as statistically significant and with the sample size of 87 ; a power value of % 90 was generated . among 87 patients , two patients receiving placebo and two cases in vitamin d receiving groups were excluded from the study due to the changes in diabetes treatment procedure and one placebo as immigration . at the end a statistical , but not clinical significant difference with higher level in the placebo group was shown in hba1c ( p value = 0.048 ) . abbreviations : bmi ; body mass index , hba1c ; hemoglobin a1c , fbs ; fasting blood glucose , homa - ir ; homeostatic model assessment of insulin resistance , pal ; ( met ) physical activity level ( metabolic equivalent ) . p value of chi square and independent t - test for variable sex and others , respectively . homa - ir homeostatic model assessment - insulin resistance . as seen in table 2 , there was no significant difference in baseline serum 25-hydroxyvitamin d concentration between the two groups . after eight - week intervention , serum 25-hydroxyvitamin d increased significantly in the group receiving vitamin d ( p value < 0.001 ) . the lowest and highest of achieved 25-hydroxyvitamin d concentration in the intervention group were 29.2 and 88 g / ml , respectively . comparing difference in changes between the two groups showed that vitamin d increased serum 25-hydroxyvitamin d by about 200 percent ( p value < 0.001 ) . the means and standard deviation of fasting serum glucose , insulin and homa - ir at the beginning and end of the study and their changes in each group were presented in table 3 . in patients taking vitamin , fasting glucose concentration decreased significantly in comparison to the beginning ( p value = 0.045 ) and also to placebo ( p value = 0.014 ) . fasting serum insulin was decreased significantly in the intervention group ( p value = 0.028 ) . comparison of the mean changes of serum insulin in the two groups showed a significant change in the group receiving vitamin d ( p value = 0.048 ) . vitamin d significantly decreased insulin resistance ( p value = 0.007 ) and the mean decrease in insulin resistance in patients receiving vitamin d was significantly higher than those who received placebo ( p value = 0.006 ) . p - value of independent t - test the means and standard deviation of serum adiponectin and its change in each group at the beginning and end of study were presented in table 3 . at the end of the study , no significant changes were seen in adiponectin concentrations in neither vitamin d nor placebo groups ( p value = 0.186 and 0.60 , respectively ) . also , the mean changes were not significantly different between the groups ( p value = 0.831 ) . in this study , eight weeks of 50000 iu / week vitamin d administration increased serum 25-hydroxyvitamin d and decreased fasting serum glucose , insulin and also insulin resistance with no changes in serum adiponectin . at the end of the study , the lowest concentration of 25-hydroxyvitamin d in the intervention group was 29.2 ng / ml , which was close to the defined normal range ( 31 - 40 ng / ml ) . also , the highest achieved level was 88 ng / ml compared to the toxicity level of 150 ng / ml . these showed the effectiveness and safety of therapeutic dose of vitamin d in improving vitamin d status . a significant association have been reported between serum 25-hydoxyvitamin d and glycemic control in cross - sectional studies ( 5 , 33 , 34 ) , while interventional studies reported contradictory results on glycemia or other glycemic indicators , which may be as a result of disparities in study design , supplementation dosage and possibly baseline concentration of 25-hydroxyvitamin d ( 6 , 35 , 36 ) . in almost all studies reported to date on vitamin d - insufficient or deficient subjects , vitamin d supplementation increased serum 25-hydroxyvitamin d to the normal range and subsequently decreased insulin resistance ( 6 , 25 , 37 - 40 ) . but , some other studies did not show any effects on glycemia ( 10 , 28 , 35 , 41 ) . ( 41 ) did not show any significant improvement in insulin resistance after 16 months of receiving a single dose ( 100000 and 200000 iu ) of vitamin d. although , a significant decrease in insulin resistance was reported after eight- week 2000000 iu vitamin d supplementation , this effect was less following a decrease in serum 25-hydroxyvoitamin d. moreover , jorde et al . did not report any beneficial effect of six- month 4000 iu / week supplementation on glycemic indicators in diabetic patients ; however , baseline vitamin d status of the participants was higher than 20 ng / ml ( 35 ) . breslavsky et al . also failed to bring serum 25-hydroxyvitamin d to the normal levels despite 12- month 1000 iu / day vitamin supplementation ; which was justified by the progressive nature of diabetes ( 10 ) . patel et al . also failed to achieve normal vitamin d status and reveal any benefits for vitamin d supplementation on glycemic control . nagpal et al . reported an improvement in oral glucose insulin sensitivity ( ogis ) in individuals with abdominal obesity along with no achievement of normal serum vitamin d or improvement in other insulin sensitivity indicators or homa - ir ( 36 ) . homa - ir is according to fasting plasma glucose and insulin concentration and is an indicator of measuring liver resistance against insulin in producing and releasing glucose , while ogis measures the ability of insulin in stimulating muscles to uptake 2-hour postprandial blood glucose ( 36 ) . neglecting ogis may be considered as a limitation of our study ; because both homa - ir and ogis calculation may be essential to determine the exact effects of vitamin d supplementation on insulin sensitivity and glycemia . it is possible that a single high dose injection of vitamin d , not only has no beneficial effects on insulin resistance , but also may have adverse effects on glycemic indicators ( 38 ) . taylor and colleagues reported increasing in insulin resistance and worsening glycemia in three type 2 diabetic patients with vitamin d deficiency three months following the injection of 300000iu vitamin d ; however , significant increases were shown in serum 25-hydroxy vitamin d , but none of three - mentioned patients achieved normal levels ( 42 ) . furthermore , heshmat et al . conducted a similar study and failed to show any improvement of glycemic indicators . even a non - significant incensement was seen in subjects taking vitamin d ( 3.1 2.3 to 3.4 1.9 ) ( 30 ) . it seems that an injection of vitamin d ( a single dose ) increased serum 25-hydroxyvitamin d for a short - term ; so , measuring the glycemic indicators three months after injection could be affected by other confounders . totally , it appears that vitamin d supplementation improves glycemia in vitamin d - insufficient or deficient patients providing improvement of vitamin status . several vitamin d and diabetes linking mechanisms have been suggested including the effects of vitamin d on insulin secretion , peripheral insulin resistance and inflammation . 1,25-dihydroxyvitamin d bind to nuclear receptors and up - regulate insulin cell - membrane receptors , increases the receptor synthesis resulting more presence of insulin - dependent glucose transporter ( glut4 ) in cell membrane ( 43 ) . vitamin d also up - regulates peroxisome proliferator - activated receptors , which improve fatty acid metabolism and insulin sensitivity ( 44 ) . it was also reported that vitamin d regulates renin angiotensin system through down - regulating renin and inhibiting angiotensin - i receptors , which their activity involves in insulin resistance , inflammation and hypertension ( 45 ) . another suggested mechanism is an increasing of parathyroid hormone and subsequently lipogenesis , obesity and insulin resistance due to vitamin deficiency ( 46 ) . despite the reported associations between vitamin d status and serum adiponectin as a cause of insulin resistance in individuals ( 7 , 11 , 25 ) , in the present study , vitamin d therapeutic dose had no effect on improving serum adiponectin . this finding is similar to the study by breslavsky ( 1000 iu / day vitamin d for 12 months ) ( 10 ) and patel et al . ( 400 iu and 1200 iu / day for 4 months ) ( 28 ) . however , in the first study , normal serum vitamin d levels did not achieve ( 10 ) and in the second , low sample size and absence of control group was prompted less power ( 28 ) . several mechanisms have been suggested to express the potential effects of vitamin d on adiponectin . increased activity of renin - angiotensinogen system is associated with an increased angiotensin production , which leads to the production of dysfunctional adipocytes and finally , decreased adiponectin production . vitamin d may involve in increasing serum adiponectin by down - regulating and decreasing angiotensin production ( 11 , 21 ) . insulin resistance and glucose intolerance are inflammatory conditions that are associated with decreased production of adiponectin and increased activity of inflammatory cytokines as well as tnf- and interleukin-1 . tnf- reduces adiponectin synthesis and vitamin d may be associated with increased serum adiponectin through decreasing gene expression ( 5 ) . with vitamin d receptors on adipocytes , direct involvement of vitamin d in adiponectin gene expression is considered ( 5 ) . vitamin d and calcium may play a role in the regulation adipocytokine gene expression in visceral adipose tissue . vitamin d is associated with the up - regulating of osteocalcin , which its carboxylated form plays a role in energy and glucose homeostasis ( 7 ) . adding osteocalcin into adipocyte cell cultures increased an adiponectin gene expression ( 7 ) . despite aforementioned mechanisms , in the present study , although serum vitamin d reached to normal levels and led to improvement in insulin resistance , no statistical significant changes were shown in serum adiponectin concentration . it should be noted that two forms of circulating adiponectin are found ; low - molecular weight ( lmw ) and high - molecular weight ( hmw ) adiponectin . the second is active form and the ratio of hmw adiponectin to total is more accurate in assessment of the association between insulin resistance and adiponectin ( 47 ) . so , the measurement of only total adiponectin level could be a big limitation of our study . indeed , further studies recommended to investigate the effects of vitamin d on different forms of serum adiponectin . another weakness of this study was the biochemical assessments immediately at the end of the study . it appears likely there was not enough time for revealing the positive effects of vitamin d on adiponectin gene expression or other possible mechanisms . so , it could not be definitely assigned vitamin d as no effect on adiponectin . the strong point of this study was the inclusion of vitamin d - insufficient or deficient type 2 diabetic patients with a narrow range of 25-hydroxyvitamin d concentrations that may be the most predictive value in interpreting of the results but has been ignored in previews studies . in summary , therapeutic dose of vitamin d ( 50000 iu / week ) for 8 weeks in vitamin d- insufficient or deficient type 2 diabetic patients improves the low levels of vitamin d status and glycemia , with no positive effect on serum adiponectin . a routine control of vitamin d status in type 2 diabetic patients and treatment of deficiency is suggested in vitamin d - insufficient patients to achieve a better control of glycemia .

background : lower vitamin d status has been reported in diabetic patients . serum 25-hydroxyvitamin d and adiponectin were inversely associated with type 2 diabetes and insulin resistance . vitamin d may involve in regulation of the adiponectin levels , which is directly related to insulin sensitivity.objectives:the aim of this study was to investigate the effect of therapeutic dose of vitamin d on serum adiponectin and insulin resistance in vitamin d - insufficient or deficient type 2 diabetic patients.materials and methods : this double - blind , randomized , clinical trial was conducted on 81 type 2 diabetic patients with vitamin d level of 10 - 30 ng / ml . intervention was 50000 iu vitamin d or placebo once a week for 8 weeks . at the beginning and end of the study , blood samples were collected after 12 hours of fasting and serum glucose , insulin , 25-hydroxyvitamin d , and adiponectin were measured . insulin resistance was calculated by homeostasis model assessment ( homa - ir).results : after 8-week intervention , serum 25-hydroxyvitamin d significantly increased and reached the normal levels in patients receiving vitamin d ( p < 0.001 ) and the levels of fasting serum glucose , insulin , and homa - ir were significantly decreased ( p = 0.04 , 0.02 and 0.007 , respectively ) . no significant changes were observed in these levels in the placebo group . significant differences were observed in mean changes in the above - mentioned variables between the two groups ( p = 0.01 , 0.04 and 0.006 , respectively ) . no significant changes were found in serum adiponectin in the vitamin d and placebo groups ( p = 0.83).conclusions : therapeutic dose of vitamin d can improve vitamin d status and glycemic indicators . but it seems that an 8-week intervention period was not sufficient to reveal the possible effects of vitamin d on serum adiponectin levels .

You are an expert at summarizing long articles. Proceed to summarize the following text: louis , mo ) were initially dissolved in distilled water to make stock solutions and then mixed in sucrose agar media ( 5% sucrose and 1% agar ) to achieve the desired concentrations . various nontoxic ranges of taurine / caffeine mixtures were included : 12.5:1 ( 0.125% taurine and 0.01% caffeine ) , 25:1 ( 0.25% taurine and 0.01% caffeine ) , 50:1 ( 0.5% taurine and 0.01% caffeine ) , and 75:1 ( 0.75% taurine and 0.01% caffeine ) . white - eyed ( w ) flies are wild type in circadian behavior and therefore used here for both the control and treatment groups . for the locomotor activity assays , individual glass tubes , each containing a single male fly and sucrose - agar media , were placed in a locomotor monitor ( trikinetics , waltham , ma ) . prior to recording , 57-day old flies were entrained to the 12 hour light ( 10:00 to 22:00 ) : 12 hour dark ( 22:00 to 10:00 ) cycle at room temperature ( ~ 22c ) , on a jazz - mix diet ( fisher scientific , pittsburgh , pa ) . all recordings were performed under constant darkness ( dd ) for 59 days ( as indicated in figure legends ) at 25c , to observe endogenous clock activity without environmental cues such as light or sound . in an actogram ( as seen in figure 1b ) , the number on top of the x axis represents a 24-hour period of recordings , from midnight ( 00:00 h ) to 00:00 h of the next day . the number on the y axis from top to bottom indicates successive days of continuous recordings , with each line representing a 24 hour period . locomotor activity was measured by recording the number of times the infrared light equipped within each locomotor monitor was interrupted due to the movement of a fly . the total number of movements were summed at the end of each 30-minute interval , and shown as a single bar on each line . the height of the bar is proportional to the number of movements recorded in a 30-minute period . the activity from all groups in the same figure was adjusted to the same scale ( indicated on the upper right - hand corner of each actogram ) . all data were collected with damsystem collection software ( trikinetics ) and analyzed using clock - lab software ( actimetrics , wilmette , il ) . to measure sleep behavior , flies were entrained and treated the same way as described above , except that the locomotor activity was collected at 5-minute intervals . a sleep bout is defined as no locomotor activity observed within a 5-minute period.32 sleep bouts measured over a 57-day recording period were expressed either as total minutes of sleep per 24 hours ( total sleep ) , or minutes per hour ( for subjective day or subjective night ) . all recordings were obtained in constant darkness for 57 days in an incubator set to 25c . statistical analysis was performed using a wilcoxon rank sum test ( two independent sample ) from socr ( statistics online computational resource ; http://nsdl.org/resource/2200/20061003060017201t ) . locomotor activity or sleep in caffeine- or taurine - only treatments was compared to sham control , whereas locomotor activity or sleep in the taurine : caffeine combined group was compared to that of the equivalent dose of taurine and caffeine separately . the effects of taurine or caffeine on drosophila locomotor activity were tested by recording the movement of flies over a 24-hour period . the locomotor activity of flies was decreased by 28% to 86% with increasing taurine concentration ( figure 1a ) . interestingly , while the daytime activity quickly diminished , the residual locomotor activity was shifted to the nighttime ( figure 1b ) . this effect was more pronounced in flies that received higher doses of taurine . in contrast , caffeine increased both the frequency as well as the amplitude of locomotor activity . for the 0.01% caffeine - treated group , flies had sustained high activity without lethality . with higher doses of caffeine ( 0.05% and 0.1% ) , there were initial bursts of high activity but most flies subsequently died ( figure 1c ) . five - day survival rates were 96% , 97% , 72% , and 57% , for sham control and various doses of caffeine ( 0.01% , 0.05% , 0.1% ) respectively ( data not shown ) . to determine whether the inactivity in the taurine - treated groups was the result of permanent damage of neuromuscular function , flies were first treated with 1.5% taurine for 5 days , and then transferred to regular media lacking taurine ; locomotor activity was recorded for three additional days . the locomotor activity of flies that were exposed to taurine first and switched to normal media was similar to that of the control flies ( p = 0.908 ) , and eight fold higher than that of flies that remained in taurine ( figure 2 ) . diurnal activity also emerged rapidly in the reversal group , supporting the notion that taurine alters the circadian component that controls daytime activity . the combined effect of taurine and caffeine on locomotion ( figure 3 ) and sleep ( figure 4 ) was measured using mixtures of a constant concentration of caffeine ( 0.01% ) and increasing concentrations of taurine from 0.125% to 0.75% . the lowest ratio of taurine to caffeine used in our experiment is identical to the ratio present in the red bull energy drink . none of the caffeine , taurine , or combined concentrations used were lethal to flies . flies receiving the taurine - only treatment showed a dose - dependent decrease in locomotor activity , though only the 0.5% and 0.75% concentrations showed a significant difference from the control ( figure 3a ; p < 0.005 ) . flies treated with 0.01% caffeine showed an approximately 30% increase in locomotor activity . at the lowest ratio of taurine to caffeine ( 12.5:1 ) , flies exhibited a similar level of locomotor activity to either the caffeine - only ( p = 0.41 ) or taurine - only group ( p = 0.1 ) . in groups with higher taurine : caffeine ratios locomotor activity was lower than that of the equivalent dose of caffeine alone ( p < 0.01 ) , but not different from that of the equivalent dose of taurine alone . these results suggest that the inhibitory effect of taurine quenches the stimulatory effect of caffeine as the level of taurine is increased in the mixture . we further investigated how caffeine and taurine either individually or in combination can impact sleep . for drosophila , a sleep bout is defined as 5 minutes of inactivity.8 as expected , caffeine reduced the amount of sleep ( ~18% ) , whereas the highest dose of taurine ( 0.75% ) increased total sleep by approximately 50% when compared to the control ( p < 0.005 , figure 4a ) . surprisingly , at the lowest taurine : caffeine ratio ( 12.5:1 ) , the amount of total sleep observed was less than that observed in the presence of caffeine ( p < 0.05 ) or taurine alone ( p < 0.005 ) . at higher taurine : caffeine ratios , the amount of sleep is similar to that of equivalent dose of taurine but higher than that in the presence of caffeine ( p < 0.05 and p < 0.005 for 50:1 and 75:1 , respectively ) . total sleep was subsequently broken down into subjective daytime ( 10:00 to 22:00 ) and subjective nighttime ( 22:00 to 10:00 ) sleep ( figure 4b ) . daytime or nighttime sleep was increased in all groups containing taurine concentrations of 0.5% or higher . at the lowest ratio ( 12.5:1 ) , daytime sleep was less than that observed for taurine ( p < 0.005 ) or caffeine treated flies ( p < 0.05 ) , while nighttime sleep was similar to that produced by 0.01c ( p = 0.244 ) but different from that in taurine - treated flies ( p < 0.05 ) . taken together , taurine not only decreases activity and increases sleep , but also appears to induce a greater change in daytime sleep , compared to that of nighttime sleep . the effects of taurine or caffeine on drosophila locomotor activity were tested by recording the movement of flies over a 24-hour period . the locomotor activity of flies was decreased by 28% to 86% with increasing taurine concentration ( figure 1a ) . interestingly , while the daytime activity quickly diminished , the residual locomotor activity was shifted to the nighttime ( figure 1b ) . this effect was more pronounced in flies that received higher doses of taurine . in contrast , caffeine increased both the frequency as well as the amplitude of locomotor activity . for the 0.01% caffeine - treated group , flies had sustained high activity without lethality . with higher doses of caffeine ( 0.05% and 0.1% ) , there were initial bursts of high activity but most flies subsequently died ( figure 1c ) . five - day survival rates were 96% , 97% , 72% , and 57% , for sham control and various doses of caffeine ( 0.01% , 0.05% , 0.1% ) respectively ( data not shown ) . to determine whether the inactivity in the taurine - treated groups was the result of permanent damage of neuromuscular function , flies were first treated with 1.5% taurine for 5 days , and then transferred to regular media lacking taurine ; locomotor activity was recorded for three additional days . the locomotor activity of flies that were exposed to taurine first and switched to normal media was similar to that of the control flies ( p = 0.908 ) , and eight fold higher than that of flies that remained in taurine ( figure 2 ) . diurnal activity also emerged rapidly in the reversal group , supporting the notion that taurine alters the circadian component that controls daytime activity . the combined effect of taurine and caffeine on locomotion ( figure 3 ) and sleep ( figure 4 ) was measured using mixtures of a constant concentration of caffeine ( 0.01% ) and increasing concentrations of taurine from 0.125% to 0.75% . the lowest ratio of taurine to caffeine used in our experiment is identical to the ratio present in the red bull energy drink . none of the caffeine , taurine , or combined concentrations used were lethal to flies . flies receiving the taurine - only treatment showed a dose - dependent decrease in locomotor activity , though only the 0.5% and 0.75% concentrations showed a significant difference from the control ( figure 3a ; p < 0.005 ) . flies treated with 0.01% caffeine showed an approximately 30% increase in locomotor activity . at the lowest ratio of taurine to caffeine ( 12.5:1 ) , flies exhibited a similar level of locomotor activity to either the caffeine - only ( p = 0.41 ) or taurine - only group ( p = 0.1 ) . in groups with higher taurine : caffeine ratios locomotor activity was lower than that of the equivalent dose of caffeine alone ( p < 0.01 ) , but not different from that of the equivalent dose of taurine alone . these results suggest that the inhibitory effect of taurine quenches the stimulatory effect of caffeine as the level of taurine is increased in the mixture . we further investigated how caffeine and taurine either individually or in combination can impact sleep . for drosophila , a sleep bout is defined as 5 minutes of inactivity.8 as expected , caffeine reduced the amount of sleep ( ~18% ) , whereas the highest dose of taurine ( 0.75% ) increased total sleep by approximately 50% when compared to the control ( p < 0.005 , figure 4a ) . surprisingly , at the lowest taurine : caffeine ratio ( 12.5:1 ) , the amount of total sleep observed was less than that observed in the presence of caffeine ( p < 0.05 ) or taurine alone ( p < 0.005 ) . at higher taurine : caffeine ratios , the amount of sleep is similar to that of equivalent dose of taurine but higher than that in the presence of caffeine ( p < 0.05 and p < 0.005 for 50:1 and 75:1 , respectively ) . total sleep was subsequently broken down into subjective daytime ( 10:00 to 22:00 ) and subjective nighttime ( 22:00 to 10:00 ) sleep ( figure 4b ) . daytime or nighttime sleep was increased in all groups containing taurine concentrations of 0.5% or higher . at the lowest ratio ( 12.5:1 ) , daytime sleep was less than that observed for taurine ( p < 0.005 ) or caffeine treated flies ( p < 0.05 ) , while nighttime sleep was similar to that produced by 0.01c ( p = 0.244 ) but different from that in taurine - treated flies ( p < 0.05 ) . taken together , taurine not only decreases activity and increases sleep , but also appears to induce a greater change in daytime sleep , compared to that of nighttime sleep . this study is the first in which the effect of taurine on both locomotor activity and sleep is reported . our results demonstrate that : 1 ) taurine reduces locomotor activity in a dose - dependent manner ; 2 ) while caffeine alone at 0.01% increases locomotor activity , the addition of taurine attenuates the effect of caffeine when the taurine : caffeine ratio reaches 25:1 or higher ; and 3 ) at the lowest taurine to caffeine ratio ( 12.5:1 ) , total sleep is reduced and fragmented to a greater extent than by caffeine alone . in drosophila , rhythmic locomotor activity is under the control of several clock protein - expressing neurons , which send projections to the accessory medulla , the medulla , and the dorsal protocerebrum . these structures then interact with other regions of the brain through either electrical or humoral pathways.9 the rhythmic expression of pdf is important not only for arousal in the daytime , but also for regulating sleep through the interaction with other neurons . for example , a pdf mutant fly is arrhythmic under conditions of constant darkness12 and also shows increased sleep.33 other regions of the drosophila brain , such as the mushroom bodies , are involved in the homeostatic regulation of sleep.16,17 the drosophila dopamine receptor , dda1,34 has been shown to be expressed in mbs and to mediate caffeine - induced arousal.35 wu and colleagues further demonstrated that caffeine activates the camp - pka pathway , resulting in increased camp levels and fragmented sleep in both wild type flies and in flies lacking a functional adenosine receptor ( ador1).36 though adenosine receptors are important for mediating caffeine - induced arousal in mammals , it does not appear to be true for drosophila . our result supports the previously published data that caffeine treatment alone increases locomotor activity , as well as decreases total sleep . as mentioned in the introduction , taurine , a gaba receptor agonist , is the second most abundant amino acid in the mammalian cns and is also normally present in mbs in drosophila.37 taurine can be released from either glia or neurons during stress conditions.38 jia reported that taurine concentrations in the range of 10100 m activate gabaa receptors in the mouse thalamus , which plays an important role in the regulation of sleep and wakefulness.39 additionally , agosto et al reported shortened latency to sleep onset and increased sleep in flies carrying a mutated gabaa receptor , rdl ( resistance to dieldrin ) , which has a longer period of channel opening.30 parisky et al demonstrated that overexpression of rdl , a gabaa subunit found in ventrolateral neurons ( lnvs ) , increases total sleep , while reducing rdl level decreases sleep.31 another gaba receptor , gabab , was also found in pdf - positive neurons,40 further supporting the notion that gaba and ventrolateral neurons modulate sleep circuitry in drosophila . our data support our hypothesis that taurine , as a gaba receptor agonist , promotes sleep . based on the presence of gaba receptors , we propose that taurine may target : a ) ventrolateral neurons , resulting in lower locomotor activity and more sleep ; b ) neurons that mediate caffeine - induced arousal . a possible explanation for the switch from diurnal to nocturnal locomotor activity is that once homeostatic need is met during the day , locomotor activity resumes in the nighttime . a similar observation was previously reported by crocker and sehgal.23 in their study , a mutation in th ( tyramine beta hydroxylase ) which is involved in octopamine biosynthesis resulted in a reduced level of octopamine and an accumulation of its precursor tyramine . th mutant flies exhibit increased daytime sleep , but also show more locomotor activity in the night . in this study , biphasic responses in sleep behavior were observed when taurine and caffeine were combined . at the lowest taurine to caffeine ratio , flies exhibit similar locomotor activity ( figure 3a ) but decreased sleep , as compared to flies treated with caffeine alone ( figure 4a ) . the lowest ratio of taurine : caffeine also results in less consolidated sleep than taurine or caffeine alone ( supplemental figure s1 ) . it is possible that at this low concentration taurine shifts the distribution of locomotor activity ( changing it to more nighttime hours ) that offsets from caffeine s locomotor rhythms , resulting in less sleep than that of caffeine alone ( supplemental figure s2 ) . thus , episodes of sleep which are 16 minutes or higher are fragmented with this low ratio of taurine : caffeine combination . the same ratio of taurine to caffeine ( 12.5:1 ) present in red bull produces the desired effect of energy drinks : sustained activity that is enhanced compared to beverages that contain only caffeine but not taurine . however , this effect is reversed with a higher taurine : caffeine ratio , indicating that a higher concentration of taurine is capable of inhibiting the caffeine effect completely . it is possible that taurine inhibits mobility by directly activating gaba receptor at the neuromuscular junction.41 leal and neckameyer42 have shown that millimolar amounts of gaba ( 0.1%0.5% ; equivalent to 948 mm ) can decrease locomotor activity in drosophila . to elicit a similar response of the gaba receptor by taurine , it usually requires a 1000-fold higher concentration.5 the taurine concentrations used in this study were much lower than required for the direct inhibition of mobility . additionally , if the neuromuscular system , rather than cns , is the sole target of taurine , we would have expected to see low or no activity throughout the 24 hour recording period . instead , we observed that low nighttime activity persisted even at the highest concentrations of taurine ( figure 1 ) . our results also indicate that the inactivity observed in taurine - treated flies is not due to permanent damage to muscles or to the neuromuscular junctions ( figure 2 ) . furthermore , to address whether the inactivity was simply due to a fly s aversion to the smell or taste of taurine , fruit flies were placed in tubes containing either regular media , or media with 1.5% taurine . after a 2-hour incubation period , flies were transferred to tubes containing only moist cotton and locomotor activity was recorded for another 24 hours . in the absence of the cue ( ie , smell or taste ) from food , the activity of the taurine - treated group was still 50% lower than that of the sham control ( data not shown ) . although we can not rule out the direct inhibition of the neuromuscular systemby taurine , our data suggest that the mechanism of action is likely through the inhibition of the cns . overall our study results demonstrate that the combination of caffeine and taurine at the same ratio as in energy drinks has synergistic effects in shortening sleep and can lead to sleep deprivation and subsequent attention deficit in the long run . however , sleep - wake behavior is unlikely the only target of caffeine and taurine . for example , it has been shown that taurine alone protects against cardiac injury by preventing ca overload ( see review by xu43 ) . the presence of taurine in energy drinks may alleviate or even quench the uncomfortable side effects of caffeine , such as heart palpitation , jitteriness , and anxiety . kong s group has previously demonstrated an anxiolytic - effect of taurine in a rat anxiety model.44 the propensity of taurine to blunt the symptoms of caffeine intoxication , raises important health concerns . in europe , red bull was banned after a few cases of cardiac arrest occurred due to ingestion of large amounts of energy drinks . consumers would presumably stop drinking caffeine - containing beverages if they experienced heart discomfort , nausea , or twitching muscles , but these symptoms are likely alleviated by taurine . thus , the threshold for perceiving a caffeine overdose is raised with taurine in the drink . second taurine interacts with the gaba receptor , which is a key component for maintaining neuronal plasticity . in the case of long term consumption of energy drinks , high doses of taurine can accumulate in tissues through the taurine transporter and be released during stress.38,45 higher than normal levels of taurine at synapses could interact with gaba receptors , cause receptor desensitization and/or alteration of gaba homeostasis , and lead to neurological disorders . along these lines , iyadurai and chung reported a possible link between energy consumption and new - onset seizure in four patients.46 with the majority of energy drink consumers being children or adolescents , clear labeling of caffeine content and its side effects , as well as age limitations should be mandated and enforced . interactions among other added ingredients should also be addressed ; indeed a synergistic effect of sugar and caffeine was observed on cognitive performance.47 although in the present study we only focused on the interaction of caffeine and taurine on locomotion and sleep , other analyses such as social behaviors or toxicity of overloaded supplements are required to assess the potential long - term impact of energy drink consumption in humans . number of sleep episodes were counted during the subjective day ( d ) or subjective night ( n ) over four consecutive days , and further divided into three groups : 515 minutes , 1660 minutes , and 61180 minutes . the number of sleep episodes observed in 0.125t/0.01c - treated flies is lower than that of the 0.01c- or 0.125t - treatedflies alone ( p > 0.05 for both ) at the 1660 minute range ( d ) , and it is also lower than that of 0.125 t ( p = 0.005 ) but not different from that of 0.01c ( p = 0.06 ) at 61180 minute range ( d ) . at the range of 61180 minutes during subjective night ( n ) , 0.125t/0.01c - treated flies have lower sleep episodes than that of 0.125 t ( p > 0.005 ) but not different from that of 0.01c ( p = 0.2 ) . the amplitude of locomotor activity is indicated by the height of the bar whereas sleep is shown as a space between the bars . shaded rectangles represent subjective day ( 10:00 to 22:00 ) , whereas solid black rectangles represent subjective night ( 22:00 to 10:00 ) . compared to the control , caffeine increases both amplitude and frequency of locomotor activity as well as reduces sleep . the locomotor activity in 0.125 t is lower and drifted to late night / early morning , accompanied by increase in sleep . when the two are combined ( 0.125t/0.01c ) , total sleep is reduced more than that of caffeine or taurine alone .

caffeine and taurine are two major neuromodulators present in large quantities in many popular energy drinks . we investigated their effects on sleep - wake control in constant darkness using the fruit fly drosophila as a model system . it has been shown that caffeine , as the most widely used psychostimulant , can boost arousal through the dopamine pathway in the mushroom bodies of flies . taurine is a gaba receptor agonist , which is inhibitory to neuronal firing . we show here that flies receiving a low dose of caffeine ( 0.01% ) increase locomotor activity by 25% , and decrease total sleep by 15% . treatment with taurine at 0.1% to 1.5% reduces locomotor activity by 28% to 86% , and shifts it from diurnal to nocturnal . at 0.75% , taurine also increases total sleep by 50% . our results show that taurine increases sleep , while caffeine , as previously reported , attenuates sleep . flies treated with both caffeine and taurine exhibit two differential effects which depend upon the ratio of taurine to caffeine . a high taurine : caffeine ratio promotes sleep , while a low ratio of taurine : caffeine inhibits sleep to a greater extent than the equivalent amount of caffeine alone . this intriguing enhancement of caffeine action by low doses of taurine may account for the presence of both compounds in energy - promoting drinks such as red bull and monster.

You are an expert at summarizing long articles. Proceed to summarize the following text: kawasaki disease ( kd ) , first described by tomisaku kawasaki in japan in 1967 , is an acute febrile vasculitis in childhood and is the leading cause of acquired pediatric heart disease in the developed world . kd is characterized by prolonged fever , nonpurulent conjunctivitis , oral mucositis , cervical lymphadenopathy , induration and erythema of the extremities , and polymorphous skin rash . there was a trend of increasing incidence of kd in beijing , varying from18 to 55/100,000 children < 5 years of age from 1995 to 2004 . although the inflammatory response is found in small and medium vessels of the body , the most common sites of inflammation and end - organ damage are the coronary arteries . coronary artery lesions ( cals ) develop in 1525% of untreated children with kd . despite appropriate therapy with intravenous immunoglobulin ( ivig ) , cals continue to develop in 5% of the affected children . children who develop coronary artery aneurysms ( caas ) , especially giant caas , have the risk of aneurysm thrombosis , coronary artery stenosis , myocardial infarction , or ischemic heart disease , and even sudden death , and require long - term follow - up and anticoagulant and antiplatelettherapy . prevention of cals is , therefore , a priority . since 1995 , we have organized a dataset of children with kd at our hospital , which is one of the largest tertiary children medical centers in china . we noticed that the number of caa cases gradually increased with the increase of kd cases , and many children with caas who were referred to us had received corticosteroid therapy before the onset of the caas . therefore , we supposed that corticosteroid therapy might be associated with the increase in the number of children with caas . thus , we conducted this study to evaluate the relation between corticosteroid therapy and caas . in this retrospective study , we reviewed the medical records of all children with kd who had been admitted to our hospital from january 2005 to december 2014 . information concerning the epidemiological characteristics , clinical manifestations , laboratory and echocardiographic findings , and treatment and outcome of each patient was obtained . the relation between the following factors and cals was analyzed using univariate and multivariable logistic regression analyses : age , sex , incomplete kd , total fever duration , days of illness at the initial treatment , corticosteroid therapy , ivig treatment resistance , white blood cell count ( wbc ) , c - reactive protein ( crp ) , platelet count ( plt ) , sodium , and albumin . the selection of the cutoffs of the variables was based on the more generally accepted cutoffs reported in the literature . kd and incomplete kd were diagnosed according to the criteria published by the american heart association in 2004 . corticosteroid therapy was defined as intravenous methylprednisolone ( 2 mgkgd ) or oral prednisone ( 2 mgkgd ) . ivig treatment resistance was defined as a fever of 38.0c at 36 h to 7 days after the completion of ivig infusion without another likely source . the z - scores were calculated as the body surface area ( bsa)-adjusted mean coronary internal diameters established by de zorzi et al . with the following equation : z - score = ( observed diameter mean normal diameter)/(standard deviation of the normal diameter ) . the mean normal diameter and standard deviation of the left main coronary , left anterior descending , and right coronary arteries were 1.688 + 0.995 bsa , 0.420 ; 1.186 + 0.820 bsa , 0.356 ; and 1.503 + 0.499 bsa , 0.398 , respectively . cals were defined as z - scores of the left main coronary , left anterior descending , or right coronary arteries > 2.5 . coronary artery dilations were defined as a z - score > 2.5 and a coronary internal diameter 4 mm ; caas were classified as small caas ( internal diameter > 4 mm and < 5 mm ) , medium caas ( 58 mm internal diameter ) , or giant caas ( > 8 mm internal diameter ) . the time to evaluate cals was 1 month after the kd onset . if an echocardiography was performed two or more times within 1 month , the maximum value of the coronary internal diameter was chosen for analysis . the data were analyzed using the spss statistical software version 19.0 ( spss inc . , data were presented as either mean standard deviation ( sd ) for quantitative variables or as percentages for qualitative variables . results were expressed as odds ratios ( ors ) with 95% confidence intervals ( cis ) . in all analyses , one hundred thirty - six cases were excluded because of multiple admissions ( not including relapse ) or incomplete data of coronary internal diameters and 2331 cases were analyzed using spss . of the 2331 cases , there were 1517 boys and 814 girls , with a male to female ratio of 1.86:1 . the ages varied from 1 month to 17.6 years ( median , 1.9 years ) . a total of 2294 ( 98.4% ) children received ivig treatment , 2180 ( 95.0% ) received an ivig dose of 2 gkgd for 1 day , 99 ( 4.3% ) received an ivig dose of 1 gkgd for 2 consecutive days , and 15 ( 0.7% ) received an ivig dose of 400500 mgkgd for 35 consecutive days . the incidence of cals within 1 month after kd was 36.0% ( 840 cases ) , including 625 ( 26.8% ) coronary artery dilations and 215 ( 9.2% ) caas . of the 215 children with caas , 84 had small caas , 103 had medium caas , and 28 had giant caas . there were 393 ( 16.9% ) children with incomplete kd and 523 ( 22.4% ) children with ivig treatment resistance . of the ivig - resistant children , 506 ( 96.7% ) were treated with additional ivig therapy . in addition , 39 ( 7.5% ) of the 523 ivig - resistant children received corticosteroid therapy because of continuing fever . of the 39 children , 36 received intravenous methylprednisolone ( 2 mgkgd ) after one or more additional ivig , 2 received intravenous methylprednisolone ( 2 mgkgd ) after the initial ivig , and 1 received oral prednisone ( 2 mgkgd ) after one additional ivig . cals developed in 59.0% of the 39 children ( 23 of 39 ) , including 13 coronary artery dilations , two small caas , five medium caas , and three giant caas . two children with small caas , three with medium caas , and two with giant caas had coronary artery dilations before receiving corticosteroid therapy and developed caas after receiving corticosteroid therapy . among the 523 ivig - resistant children , 484 the incidence of cals in the noncorticosteroid - treated group was 40.7% ( 197 of 484 ) , including 142 coronary artery dilations , 26 small caas , 21 medium caas , and 8 giant caas . in the 523 ivig - resistant children , the incidence of cals and caas in the corticosteroid group was significantly higher than that in the noncorticosteroid group ( cals : = 4.944 , p = 0.026 ; caas : = 5.512 , p = 0.019 ) . the laboratory parameters of wbc , crp , plt , sodium , and albumin were obtained before ivig . table 2 shows the statistical results of the risk factors for coronary artery dilatations from univariate logistic regression analysis . the results indicated that male , age 1 year , incomplete kd , longer fever duration , prolonged days of illness at the initial treatment , and crp > 100 mg / l were associated with coronary artery dilatations . when these six factors were subjected to multivariable logistic regression analysis [ table 3 ] , we obtained the independent risk factors for coronary artery dilatations , as follows : male ( or : 1.434 , 95% ci : 1.1711.755 , p < 0.001 ) , incomplete kd ( or : 2.008 , 95% ci : 1.5762.558 , p < 0.001 ) , longer fever duration ( or : 1.037 , 95% ci : 1.0041.072 , p = 0.029 ) , and crp > 100 mg / l ( or : 1.343 , 95% ci : 1.1201.611 , p = 0.001 ) . with the same statistical methods on the basis of the univariate logistic regression analysis , male , incomplete kd , longer fever duration , prolonged days of illness at the initial treatment , corticosteroid therapy , ivig treatment resistance , sodium 133 mmol / l , and albumin < 35 in addition , male , incomplete kd , longer fever duration , prolonged days of illness at the initial treatment , corticosteroid therapy , and albumin < 35 g / l were associated with giant caas [ table 5 ] . in multivariable logistic regression analysis , male ( or : 1.425 , 95% ci : 1.0142.003 , p = 0.042 ) , incomplete kd ( or : 2.001 , 95% ci : 1.4082.846 , p < 0.001 ) , corticosteroid therapy ( or : 2.864 , 95% ci : 1.2106.777 , p = 0.017 ) , prolonged days of illness at the initial treatment ( or : 1.091 , 95% ci : 1.0471.137 , p < 0.001 ) , longer fever duration ( or : 1.078 , 95% ci : 1.0321.126 , p = 0.001 ) , sodium 133 mmol / l ( or : 1.341 , 95% ci : 1.0501.714 , p = 0.019 ) , and albumin < 35 g / l ( or : 2.101 , 95% ci : 1.4962.949 , p < in addition , corticosteroid therapy ( or : 8.315 , 95% ci : 2.02434.158 , p = 0.003 ) , prolonged days of illness at the initial treatment ( or : 1.112 , 95% ci : 1.0461.181 , p = 0.001 ) , and albumin < 35 g / l ( or : 2.379 , 95% ci:1.1864.770 , p = 0.015 ) were independent risk factors for giant caas [ table 7 ] . assignment of each observed indicator kd : kawasaki disease ; wbc : white blood cell count ; crp : c - reactive protein ; plt : platelet count ; ivig : intravenous immunoglobulin . risk factors for coronary artery dilatations from univariate logistic regression analysis * p<0.05 was considered statistically significant . kd : kawasaki disease ; ivig : intravenous immunoglobulin ; wbc : white blood cell count ; crp : c - reactive protein ; plt : platelet count ; se : standard error ; or : odds ratio ; ci : confidence interval . risk factors for coronary artery dilatations from multivariable logistic regression analysis * p<0.05 was considered statistically significant . kd : kawasaki disease ; crp : c - reactive protein ; se : standard error ; or : odds ratio ; ci : confidence interval . risk factors for caas from univariate logistic regression analysis * p<0.05 was considered statistically significant . caas : coronary artery aneurysms ; kd : kawasaki disease ; ivig : intravenous immunoglobulin ; wbc : white blood cell count ; crp : c - reactive protein ; plt : platelet count ; se : standard error ; or : odds ratio ; ci : confidence interval . risk factors for giant caas from univariate logistic regression analysis * p<0.05 was considered statistically significant . caas : coronary artery aneurysms ; kd : kawasaki disease ; wbc : white blood cell count ; crp : c - reactive protein ; plt : platelet count ; ivig : intravenous immunoglobulin ; se : standard error ; or : odds ratio ; ci : confidence interval . risk factors for caas from multivariable logistic regression analysis * p<0.05 was considered statistically significant . caas : coronary artery aneurysms ; kd : kawasaki disease ; ivig : intravenous immunoglobulin ; se : standard error ; or : odds ratio ; ci : confidence interval . risk factors for giant caas from multivariable logistic regression analysis * p<0.05 was considered statistically significant . caas : coronary artery aneurysms ; kd : kawasaki disease ; se : standard error ; or : odds ratio ; ci : confidence interval . cals are the main complications in children with kd , and the prediction of cals is , therefore , the focus of this research . harada developed a risk score to determine the risk of caas in children with kd . the risk factors included wbc > 12,000/mm , plt < 350,000/mm , crp > 3 + , hematocrit < 35% , albumin < 35 g / l , age 12 months , and male . in 2006 , kobayashi et al . constructed a predictive system for the development of caas . the risk factors for caas included age 12 months , neutrophil 80% , crp > 100 mg / l , plt < 300,000/mm , sodium 133 mmol / l , aspartate transaminase 100 iu / l , and days of illness at the initial treatment 4 . another study showed that incomplete kd , ivig treatment resistance , and longer fever duration were associated with cals . in our study , cals were found to have possible associations with male , incomplete kd , longer fever duration , prolonged days of illness at the initial treatment , albumin < 35 g / l , sodium 133 mmol / l , crp > 100 mg / l , and corticosteroid therapy . although corticosteroid therapy is the treatment of choice for other types of vasculitis , the use of corticosteroids is still controversial in children with kd . in 1979 , kato et al . one or 2 months later , coronary angiography demonstrated caas in 64.7% of children treated with prednisolone and 11% of those treated with aspirin . the findings suggested that steroids might act adversely to cause a progression of cals . in 2003 , sundel et al . reported a prospective study that showed that children who received steroids ( 30 mg / kg intravenous methylprednisolone ) in the initial treatment of kd had shorter fever duration and shorter hospital stay , as well as lower erythrocyte sedimentation rate and crp level . , the american heart association criteria showed that studies of corticosteroids in the initial therapy for kd , as well as in the treatment for nonresponders after the initial ivig , have shown that corticosteroids reduce fever . , they recommended that corticosteroid therapy is restricted to children in whom two or more infusions of ivig have been ineffective in alleviating fever and acute inflammation . reported a prospective study that showed that compared with children receiving placebo , children receiving intravenous methylprednisolone for the initial therapy had a shorter initial period of hospitalization , lower erythrocyte sedimentation rate , and lower crp level but a similar incidence of cals . miura et al . revealed that intravenous methylprednisolone therapy for kd children who were unresponsive to the initial ivig suppressed cytokine levels faster and suppressed the recurrence of fever . ogata et al . reported that methylprednisolone therapy ( 30 mgkgd for 3 days ) was useful in reducing the fever duration and medical costs for kd children who were unresponsive to the initial ivig treatment . methylprednisolone therapy and additional ivig treatment were not significantly different in preventing the development of caas . in a retrospective study of 359 children with kd who were unresponsive to the initial ivig , kobayashi et al . noted that cals up to 1 month after treatment were less common in the ivig + prednisolone group than in the ivig group ( p = 0.005 ) and the prednisolone group ( p = 0.01 ) . ivig + prednisolone may be superior to prednisolone or ivig as a first - line rescue therapy for children with kd who were unresponsive to ivig . . showed that the changes in wbc , crp , and albumin were significantly greater in group a ( receiving methylprednisolone pulse therapy ) than in group b ( receiving the second ivig ) for ivig nonresponders . however , the prevalence of cals did not differ between the groups ( 36% in group a and 26% in group b , p > 0.05 ) . methylprednisolone pulse therapy did not reduce the risk for the development of cals and did not seem to be beneficial as a single - agent therapy for ivig - resistant kd . millar et al . reviewed the experience of 80 children with caas after kd , among whom 19 children received corticosteroids in the acute phase . the corticosteroid - treated group and noncorticosteroid - treated group had similar caa z - scores at baseline ( p > 0.05 ) ; however , 23 months and 1 year after the acute phase , the caa z - scores decreased in children not only treated with corticosteroids but also progressed for those treated with corticosteroids . their study showed that use of corticosteroids for children with kd may aggravate cals and cause impaired vascular remodeling . at present , the relation between corticosteroid therapy and cals in children with kd has not yet been clarified . we found that corticosteroid therapy was an independent risk factor for the development of caas , especially giant caas , by analyzing 12 factors that might be associated with cals in children with kd . the children who received corticosteroids were nonresponders to ivig and had more severe disease , which increases their risk for cals ; thus , we put some potentially confounding variables that may reflect the group who received corticosteroids into the statistical model ( such as total fever duration and ivig treatment resistance ) . after adjusting for these confounding variables , in the 523 ivig - resistant children , the incidence of cals and caas in the corticosteroid group was significantly higher than in the noncorticosteroid group ( p < 0.05 ) . currently , the first dose of ivig is well - established whereas corticosteroid or additional ivig for ivig - resistant children requires further investigation . the incidence of cals in our study was higher than that reported in the literature . this may be because many children with severe kd or those with unsuccessful treatment from other hospitals were referred to our hospital . in addition , the diagnosis standard of cals established by the japanese ministry of health was not based on the patients ' age or body size and also did not distinguish between different coronary artery branches , thus resulting in possible missed diagnoses of cals . second , measurement of the coronary internal diameter by means of echocardiography was not done by the same ultrasound technologists , and this may have affected the accuracy of the results . this study was supported by grants from national natural science foundation of china ( no . 81274109 , 30973238 ) , key research project of beijing natural science foundation ( b)/beijing education committee ( no . kz201010025024 ) , and project for science and technology innovation , beijing education committee ( no . pxm2011_014226_07_000085 ) . this study was supported by grants from national natural science foundation of china ( no . 81274109 , 30973238 ) , key research project of beijing natural science foundation ( b)/beijing education committee ( no . kz201010025024 ) , and project for science and technology innovation , beijing education committee ( no . pxm2011_014226_07_000085 ) .

background : coronary artery lesions ( cals ) are known to be the main complication in children with kawasaki disease ( kd ) . instead of intravenous immunoglobulin ( ivig ) , corticosteroid therapy has been accepted to be used for children with kd who are unresponsive to ivig . this study aimed to evaluate risk factors for cals in children with kd.methods:we retrospectively reviewed the clinical records of 2331 children with kd from january 2005 to december 2014 . to identify the independent risk factors for cals , multivariable logistic regression models were constructed using significant variables identified from univariate logistic regression analysis.results:the incidence of cals was 36.0% ( 840 of 2331 ) , including 625 ( 26.8% ) coronary artery dilations and 215 ( 9.2% ) coronary artery aneurysms ( caas ) . multivariable logistic regression analysis identified that male , incomplete kd , longer fever duration , and c - reactive protein ( crp ) > 100 mg / l were independent risk factors for coronary artery dilatations . on the other hand , male , incomplete kd , longer fever duration , prolonged days of illness at the initial treatment , corticosteroid therapy , sodium 133 mmol / l , and albumin < 35 g / l were the independent risk factors for caas . in addition , corticosteroid therapy , prolonged days of illness at the initial treatment , and albumin < 35 g / l were the independent risk factors for giant caas.conclusions:cals might be associated with male sex , incomplete kd , longer fever duration , prolonged days of illness at the initial treatment , albumin < 35 g / l , sodium 133 mmol / l , crp > 100 mg / l , and corticosteroid therapy . corticosteroid therapy was an independent risk factor for caas and giant caas . thus , corticosteroids should be used with caution in the treatment of kd with the risk for cals .

You are an expert at summarizing long articles. Proceed to summarize the following text: structural studies were carried out using an engineered hkor construct ( see methods and supplementary fig . 1 ) and crystallized in cholesterol - doped monoolein lipidic cubic mesophase ( see methods ) . the construct used displayed pharmacological behavior similar to that of a native receptor expressed in hek 293-t cells ( supplementary tables 2 and 3 ) . data collection and refinement statistics are shown in supplementary table 1 . the structure of hkor - jdtic was determined at 2.9 in the p 212121 space group . the asymmetric unit ( asu ) consists of a two receptors forming a parallel dimer ( fig . the dimer interface with ~1100 buried surface area is formed through contacts between helices i , ii and viii ( fig . parallel receptor dimers have been identified in crystal structures of activated rhodopsin ( involving helices i , ii and viii ) , 2 adrenergic receptor ( 2ar ; cholesterol mediated ) and cxcr4 ( involving helices iv , v and vi ) . consistent with these crystallographic data , recent biochemical studies have suggested the existence of two dimerization interfaces : along helices iv and v - sensitive to receptor activation , and along helix i insensitive to the state of activation . while the orientations of the two t4-lysozyme ( t4l ) copies in the receptor monomers in one asu differ by ~ 60 rotation , both copies of the receptor are highly similar ( fig . the remaining residues of the n- and c - termini in the hkor / jdtic structure are disordered as in other class a gpcrs . the main fold of the hkor consists of a canonical 7tm bundle of helices followed by an intracellular helix viii that runs parallel to the membrane . structural comparison with other gpcrs suggests that hkor has striking similarities in the ecl region with cxcr4 , another peptide binding receptor in the subfamily . in the 7tm region , however , the hkor structure is closer to aminergic receptors belonging to the subfamily ( rmsdc ~2.3 for 2ar , ~1.9 for dopamine d3 receptor ( d3r ) , and ~2.7 for cxcr4 ) . the structure reveals distinctive features of hkor , including : ( i ) conformation of the extracellular end of helix i that deviates from the position observed in cxcr4 , where the tip of helix i is pulled towards the tm bundle by a disulfide bond between the n - terminus and ecl3 . ( ii ) ecl2 , the largest extracellular loop of hkor , forms a -hairpin similar to that observed in cxcr4 , despite the low sequence similarity in this domain between the two receptors . conservation of this feature between these peptide receptors suggests that the -hairpin could be a common motif in the ecl2 of other subfamily receptors , where interactions between ecl2 and their endogenous peptide ligands are deemed important for ligand recognition and selectivity . ( iii ) unlike other solved non - rhodopsin class a gpcrs which have more than one disulfide bond , hkor has only one formed between cys131 ( superscripts indicate residue numbering using the ballesteros - weinstein nomenclature ) and cys210 , bridging ecl2 to the end of helix iii . these two cysteines are conserved in all ors and this disulfide bond is the canonical one shared by all other solved class a gpcrs . ( iv ) intracellular loop 2 ( icl2 ) adopts slightly different structures in the two hkor molecules in the asu , involving a two - turn helix in molecule b , and only a one - turn helix in molecule a ( supplementary fig . ( v ) ecl3 of hkor is disordered . of the approximately eleven residues in this loop ( residues 300310 ) , six residues in molecule a and three in molecule b do not have interpretable electron density . a common feature of the class a gpcrs is the presence of a conserved sequence motif asp / glu - arg - tyr ( d / ery ) located at the cytoplasmic end of helix iii . a salt bridge interaction between arg and asp / glu from the cytoplasmic end of helix vi constitutes an ionic lock , which is thought to stabilize the inactive conformation of rhodopsin and other rhodopsin - like class a gpcrs , while its absence can enhance constitutive activity . although hkor lacks either of the acidic residues asp / glu at position 6.30 , arg156 forms a hydrogen bond to another helix vi residue , thr273 ( supplementary fig . 3a ) in this inactive hkor structure , thereby conceivably stabilizing the inactive receptor conformation . the npxxy motif located at the cytoplasmic side of helix vii , which is composed of asn326 , pro327 , ile328 , leu329 and tyr330 in hkor , is another highly conserved functional motif that is proposed to act as one of the molecular switches responsible for class a gpcr activation . comparison of hkor with inactive 2ar and a2a adenosine receptor ( a2aar ) structures ( supplementary fig . 3b ) reveals a similar conformation of this motif in these receptors , thereby supporting the hypothesis that the observed hkor - jdtic complex structure corresponds to the inactive state . to further establish that jdtic stabilizes an inactive conformation , we evaluated its ability to modulate gi - mediated and -arrestin - mediated signaling in transfected hek293-t cells . we found that jdtic was devoid of agonist activity at both canonical and non - canonical pathways and completely blocked the effects of the prototypic agonist u69593 ( supplementary fig . the hkor ligand binding pocket displays a unique combination of key characteristics both shared with and distinct from those in the chemokine and aminergic receptor families . while the hkor binding pocket is comparatively large and partially capped by the ecl2 -hairpin , as in cxcr4 , it is also much narrower and deeper than in cxcr4 ( fig . in addition to a different set of side chains lining the pocket , the shape differences result from an approximately 4.5 inward shift of the extracellular tip of helix vi in hkor as compared to cxcr4 . 6 ) , which reaches deep into the pocket to form ionic interactions with the asp138 side chain ( fig . the asp residue is conserved in all aminergic gpcrs , thereby playing a critical role in the selectivity of aminergic receptors toward protonated amine - containing ligands . asp is conserved in all ors and for which modeling and mutagenesis studies suggest an essential role in anchoring positively charged hkor ligands . jdtic , developed as a derivative of the trans-(3r,4r)-dimethyl-4-(3-hydroxyphenyl ) piperidine scaffold , has exceptionally high affinity ( ki = 0.32 nm ) , potency ( ki = 0.02 nm in gtps assays ) , long duration of action and a more than 1000-fold selectivity for hkor as compared to other or subtypes . extensive structure activity relationship ( sar ) analyses performed on jdtic analogues have yielded important insights into key determinants of jdtic activity , although reliable identification of the interaction mode(s ) and contact residues of these ligands has not been feasible without a receptor crystal structure . jdtic shows a tight fit of the ligand in the bottom of the binding cleft ( fig . 2a ) , forming ionic , polar , and extensive hydrophobic interactions with the receptor ( fig . the protonated amines in both piperidine and isoquinoline moieties of the ligand form salt bridges to the asp138 side chain ( 3.0 and 3.1 n o distances , respectively ) . the piperidine amine is a part of the original trans-(3r,4r)-dimethyl-4-(3-hydroxyphenyl)piperidine scaffold , and is essential for binding . sar studies of jdtic analogues show that the isoquinoline nitrogen can be replaced by carbon , oxygen or sulfur atoms with only ~10- to 50-fold reduction in affinity . similar to the observed jdtic conformation in the hkor - jdtic complex , a v - shaped conformation was found in the crystal structure of jdtic by itself and which showed its amino groups coordinating a water molecule ( supplementary fig . 7a ) . while several rotatable bonds within the jdtic molecule allow for the sampling of different conformations ( see supplementary fig . 7b ) and facilitate the ligand passage through the narrow binding pocket entrance , the anchoring - type interaction of two amino groups with asp138 likely fixes the ligand in this characteristic v - shape . sar studies have also underscored the importance of the distal hydroxyl groups on both the piperidine and isoquinoline moieties of jdtic , the removal of which did result in about a 100-fold reduction of affinity . a much smaller effect was observed upon methylation of these hydroxyls or their replacement by other polar groups . these sar results suggest the importance of water - mediated interactions between these two hydroxyl groups and the receptor . indeed , while the crystal structure does not show direct hydrogen bonding with the receptor for both hydroxyl groups , there is clear electron density for several structured water molecules that mediate their polar interactions ( supplementary fig . the structure provides important clues for understanding the structural basis for the exceptional subtype selectivity of jdtic . among many extensive contacts , jdtic interacts with four residues of the binding pocket that differ in other closely related ors , which are thought to contribute to the subtype selectivity of jdtic and other kor - selective ligands ( human mor ( hmor ) and human dor ( hdor ) amino acids shown in parentheses , respectively ) : val108 ( ala and ala ) , val118 ( asn and lys ) , ile294 ( val and val ) , and tyr312 ( trp and leu ) ( fig . analysis of jdtic binding into hkor - based hmor and hdor homology models , as well as jdtic sar results ( supplementary fig . 9 ) , suggest that all described residues can contribute to the jdtic selectivity profile . thus , changes in the val118 side chain , where larger hydrophilic residues , asn and lys are found in hmor and hdor , respectively , are likely to introduce unfavorable contacts with jdtic . additionally , changing tyr312 to the trp and leu residues found in hmor and hdor , respectively , are likely to result in the loss of an important polar interaction with the jdtic amide . the remaining two hydrophobic side chains replacements , val to ala at position 2.53 and ile to val at position 6.55 , may cause a reduction of the hydrophobic contact between jdtic and the receptor . the isopropyl group from jdtic reaches deep in the orthosteric pocket to form a hydrophobic interaction with a conserved trp287 side chain ( aka the rotamer toggle switch ) , possibly playing a critical role in the pharmacological properties of this ligand . trp is thought to be a key part of the activation mechanism in many class a gpcrs including rhodopsin and a2aar , and similar hydrophobic contacts have been implicated in blocking activation - related conformational changes in the dark state visual rhodopsin by 11-cis retinal , and by inverse agonists in the a2aar and d3r . prior mutagenesis and modeling studies suggested that many small molecule opioid ligands can interact with kor , as well as with mor and dor , by forming a salt bridge with the highly conserved asp ( ref ) . this is consistent with our mutagenesis studies ( supplementary table 3 ) and flexible docking of a series of morphine analogues , including selective kor antagonists nor - bni and gnti ( fig . 3 and supplementary fig . 10 ) . to assess the compatibility of these bulky and rigid ligands with the observed hkor protein backbone conformation , we performed global energy optimizations of nor - bni and gnti in the binding cavity of hkor , keeping side chains of the binding pocket fully flexible . multiple independent runs consistently resulted in low energy conformations with essentially identical poses and receptor contacts for the common naltrexone moieties of both nor - bni and gnti ( rmsd = 0.85 ) . in addition to a highly complementary van der waals interface , both compounds formed an amino group salt bridge to the asp138 side chain and a hydrogen bond to the tyr139 side chain , both of which are important anchoring points for binding of morphine - based ligand , as supported by previous mutagenesis studies . moreover , unlike jdtic , both nor - bni and gnti compounds have a second basic moiety located more than 10 away from the first amino group ( the other morphine in nor - bni and the guanidine moiety in gnti ) . in the predicted models of hkor- nor - bni / gnti complexes , these additional amino groups of both ligands form a salt bridge with glu297 located at the entrance to the ligand binding pocket , which was previously characterized as a residue critical for subtype selectivity of hkor - selective morphinan derivatives . this interaction is also supported by our mutagenesis results ( supplementary table 3 ) , where a glu297ala mutation induced a significant drop in both nor - bni and gnti binding , but did not affect jdtic binding . hydrophobic interactions at the kor - specific residue ile294 were also found for both nor - bni and gnti ; consistent with our mutagenesis results ( supplementary table 3 ) and suggesting that ile294 may also be important for developing kor subtype selective morphinan derivatives . additional polar interactions with hkor - specific residues , glu209 and ser211 in ecl2 , are found for nor - bni , which may further enhance hkor - selectivity of this bulky ligand . another side chain of the pocket , his291 , which is involved in the highly conserved aromatic cluster around trp and thought to play a critical role in the receptor activation process , forms hydrophobic contacts with jdtic , nor - bni and gnti . his291 can be mutated to another aromatic residue , phenylalanine , without disrupting binding of these antagonists ( supplementary table 3 ) . the non - conservative his291lys mutation , however , totally abolished binding of all tested ligands , likely because of the disruption of the aromatic cluster induced by the lysine side chain . interestingly , the cyclopropyl moiety of both nor - bni and gnti in these binding poses has the same position as the isopropyl moiety of jdtic , making hydrophobic contact with the conserved residue trp287 . this cyclopropyl moiety is generally implicated in conversion of opioid agonists into antagonists ( e.g. agonist oxymorphone into antagonist naltrexone ) , and this effect may be partially explained by a direct interaction with the trp287 side chain . overall , these structure - based docking results support the message - address model in applications to morphine - based ligands nor - bni and gnti , which points to glu297 as a key side chain that controls hkor selectivity by anchoring the , however demonstrates that even in lieu of address interaction with glu297 more than 1000-fold subtype - selectivity to hkor can be achieved for jdtic and some of its derivatives . importantly , then , the message - address hypothesis does not uniformly apply to all hkor - selective antagonists . salvinorin a ( sala ) , a naturally occurring diterpene from the widely abused hallucinogenic plant salvia divinorum , represents an exceedingly potent ( ec50 = 1 nm ) and selective kor agonist ( > 1000-fold ) . sala is unique compared to other kor ligands in that it lacks a charged or polar nitrogen atom to anchor it in the binding pocket . extensive site - directed mutagenesis , scam ( substituted cysteine - accessibility mutagenesis ) and sar studies on sala and its analogues have been performed , indicating ( among others ) that the 2-acetoxy moiety interacts with cys315 ( ref ) . possible modes of interaction between the cysteine - reactive and ultra - potent agonist and sala analog 22-thiocyanatosalvinorin a ( rb-64 ; ki = 0.59 nm ; ec50 = 0.077 nm ) , and the hkor structure were thus evaluated . exposure of hkor to rb-64 produces irreversibly - bound , wash - resistant adducts that are tethered to cys315 ( ref ) . as the thiocyanate group contains two electrophilic centers , two distinct adducts may be formed , increasing the mass by either 463 or 431 amu . docking studies using gold predict that the salvinorin 2-position can access cys315 while maintaining many of the interactions implicated by site - directed mutagenesis for sala , providing a possible mechanism for the formation of the kor additionally , the docking results serve as a model of the initial recognition process of sala - related agonists of the hkor in an inactive state , although additional studies will be needed to fully elucidate the nature of the sala - induced activation mechanism . the jdtic - hkor crystal structure has uncovered a combination of key features shared with chemokine and aminergic gpcrs along with unique structural details characteristic of the opioid subfamily . the hkor was crystallized as a parallel - dimer with contacts involving helices i , ii and viii . while the existence of gpcr dimers in vivo and their physiological relevance remain highly debatable , several distinct potential dimer interfaces are starting to emerge from crystallographic and biochemical studies . such multiple dimerization interfaces may serve to support different functional pathways , as well as to promote oligomeric assembly of gpcrs . analysis of the ligand - receptor interactions has revealed important molecular details responsible for the exceptionally high affinity and subtype selectivity of jdtic a small molecule antagonist with a broad therapeutic potential . the elucidation of a large binding cavity with a multitude of potential anchoring points begins to explain both the extreme structural diversity of hkor drugs and differences in their receptor interaction modes , as supported by differential effects of various site - directed mutations on the binding properties of chemically diverse prototypic ligands . the structure clearly provides a long anticipated molecular framework for understanding opioid drug action , and thereby affords valuable new opportunities for a structure - based discovery of new drugs with ideal pharmacological properties . sf9 cells were solubilized using 1% ( w / v ) n - dodecyl--d - maltopyranoside ( ddm ) and 0.2% ( w / v ) cholesteryl hemisuccinate ( chs ) , and purified by immobilized metal ion affinity chromatography ( imac ) , followed by reverse imac after cleaving n - terminal flag-10xhis tags by his - tagged tobacco etch virus ( tev ) protease . the purified protein was mixed with monoolein and cholesterol in a ratio of 40%:54%:6% ( w / w ) to form lipidic cubic phase ( lcp ) from which the receptor was crystallized . crystals were grown at 20 c in 45 nl protein - laden lcp boluses overlaid by 800 nl of precipitant solutions as described in methods . x - ray diffraction data were collected on the 23id - b / d beamline ( gm / ca cat ) at the advanced photon source , argonne , il using a 10 m minibeam at wavelength of 1.0330 . modeling of jdtic analogues and hkor - selective morphine derivatives nor - bni and gnti was performed using icm - pro ; sybyl - x 1.3 and gold suite 5.1 were used to model rb-64 complexes , as described in methods . full methods and any associated references are available in the online version of the paper at www.nature.com/nature .

opioid receptors ( ors ) mediate the actions of endogenous and exogenous opioids for many essential physiological processes including regulation of pain , respiratory drive , mood , and , in the case of -opioid receptors ( kor ) , dysphoria and psychotomimesis . here we report the crystal structure of the human kor ( hkor ) in complex with the selective antagonist jdtic , arranged in parallel - dimers , at 2.9 angstrom resolution . the structure reveals important features of the ligand binding pocket that contribute to jdtic s high affinity and subtype - selectivity for hkor . modeling of other important kor - selective ligands , including the morphinan - derived antagonists nor - bni and gnti , and the diterpene agonist salvinorin a analog rb-64 , reveals both common and distinct features for binding these diverse chemotypes . analysis of site - directed mutagenesis and ligand structure - activity relationships confirms the interactions observed in the crystal structure , thereby providing a molecular explanation for hkor subtype - selectivity along with insight essential for the design of hkor compounds with new pharmacological properties .

You are an expert at summarizing long articles. Proceed to summarize the following text: surgical resection has been a well - documented treatment modality in patients with partial epilepsy localized to the temporal lobe . while resection has lead to good postoperative seizure outcomes , it is not without risk . contralateral superior quadrant visual field deficits are one of the most commonly reported adverse outcomes after temporal lobe surgery , occurring in between 28% and 52% of patients , . multiple techniques and adjuvant intraoperative technologies have been reviewed in an effort to minimize visual field deficits after temporal lobe surgery . in this case report , we describe a subtle preoperative visual field deficit that was not altered after temporal lobe surgery . we postulate that the true rate of postoperative visual field deficits is actually lower than the reported rates and that there are likely subtle deficits attributable to the patient 's underlying epilepsy . she had a 4-year history of seizures with no significant history of trauma or pediatric complications . the clinical semiology was very suggestive of dyscognitive seizures ( complex partial seizures ) of temporal lobe origin . based on some of the semiologic details ( lip smacking , left upper extremity dystonic posturing , and head deviation to the left ) , our clinical suspicion was for right mesial temporal onset epilepsy . her antiepileptic regimen included 100 mg of lamotrigine twice a day , 100 mg of topiramate twice a day , and 400 mg of eslicarbazepine daily . she had significant decline in her quality of life because she was legally not able to drive and work disabled because of her seizures . on physical examination performed by the epileptologist as part of our epilepsy protocol , patients undergo neuroophthalmologic evaluation in addition to neuropsychological testing . upon neuroophthalmologic evaluation the inpatient epilepsy monitoring unit workup revealed 8 focal seizures with either bitemporal onset or right temporal lobe onset , with rapid spread to the contralateral temporal lobe . magnetic resonance imaging did not reveal any signs of mesial temporal lobe sclerosis , gray matter heterotopia , or focal cortical dysplasia . positron emission tomography ( pet ) scan revealed interictal right mesial temporal lobe hypometabolism ( fig . 2 ) . based on these findings , the patient elected to undergo laser thermoablation of the right mesial temporal lobe . as of her last follow - up appointment , the patient had remained seizure free , and neuroophthalmologic evaluation revealed no change in her baseline visual field deficit ( fig . visual field deficits are one of the most commonly reported complications following temporal lobe surgery . this is likely due to the close proximity of the visual fibers to the epileptogenic zone in temporal lobe epilepsy . nasal fibers from the superior temporal visual field pass through the optic nerve and decussate in the optic chiasm . these fibers synapse in layers 1 , 4 , and 6 of the lateral geniculate body and then travel anteriorly and inferiorly to loop around the temporal horn of the lateral ventricle to their eventual destination of synapsing in the primary visual cortex . the ventral aspect of the optic radiation passing anteriorly around the temporal horn it was originally thought that one could avoid meyer 's loop by limiting the posterior extent of a temporal lobectomy to 6 cm from the temporal pole . however , recent studies suggest a high degree of variability in the location of the temporal radiations , with variations both between subjects , as well as between the left and right temporal lobes , with meyer 's loop typically being more anterior in the left temporal lobe , , . due to this variability , surgeons have increasingly employed intraoperative adjuncts , such as neuronavigation with tractography , in an attempt to minimize postoperative visual field deficits . in addition , cortical - sparing approaches have been employed , such as selective amygdalohippocampectomies through a subtemporal approach or trans - sulcal approaches , and most recently , laser thermoablation . despite the use of cortical - sparing approaches and intraoperative adjunctive tools , visual field deficits remain a potentially significant morbidity , with field cuts detected postoperatively in 20% to 35% of patients , . fortunately , many of these deficits are clinically insignificant and do not preclude patients from driving . this case illustrates a patient with a clinically silent contralateral superior homonymous quadrantanopsia following laser thermoablation of the mesial temporal lobe . in most retrospective studies and series , this would have been attributed to a lesion of meyer 's loop from surgery . however , due to our recent protocol accommodation of preoperative visual field examination , our patient 's visual field deficit was recognized preoperatively and was noted to have remained stable after the procedure . while antiepileptics such vigabatrin , topiramate , and carbamazepine are known to cause visual disturbances and visual field changes , it is unlikely that an isolated superior homonymous quadrantanopsia was the result of antiepileptics . we posit that the patient 's visual field deficit was the result of aberrant neuronal activity in the mesial temporal lobe , as depicted in the pet scan . while the onset of seizures is generally cortical in location , seizures can propagate through white matter tracts ( meyer 's loop ) , and prolonged seizure propagation along these tracts could potentially lead to the subtle visual field defect we detected in our patient . while we acknowledge the limitations of a single case report , the authors believe that subtle preoperative visual field deficits are likely an underreported entity and contribute to the high incidence of postoperative visual field deficits . we advocate the judicious use of preoperative visual field testing for patients undergoing temporal lobe surgery for epilepsy .

surgical resection and laser thermoablation have been used to treat medically refractory epilepsy with good results . however , they are not without risk . one of the most commonly reported complications of temporal lobe surgery is contralateral superior homonymous quadrantanopsia . we describe a patient with quadrantanopsia discovered as part of our recently modified protocol to workup patients prior to epilepsy surgery . this field cut was subtle and not detected on routine neurological examination . while we understand that this is a single case , we advocate for more judicious preoperative visual field examinations to truly characterize the incidence of postoperative visual field lesions .