Datasets:

anumafzal94
/

pubmed_full_finetuning

Dataset card Viewer Files Files and versions Community

Split (2)

train · 104k rows

text stringlengths 699 822k	summary stringlengths 205 4.34k
You are an expert at summarizing long articles. Proceed to summarize the following text: cerebral palsy ( cp ) is a chronic disorder of movement and posture caused by a non - progressive brain lesion . cp can manifest itself in many ways , causing spastic , dyskinetic , dystonic , ataxic and mixed palsies . the prevalence of cp is 2 2.5 of every 1000 live - born children in the western world , making it one of the most common causes of motor disability in children . cp has important comorbidities , such as visual impairments , learning difficulties and epilepsy ( 5 ) . epilepsy is one of the most common neuroimpairments in childhood , with a prevalence of 5 7% in the general population ( 5 ) . although there is some conflict in the literature , it appears that the prevalence of epilepsy in children and adults with cp is between 15 55% ( 5 ) . in addition , if learning difficulties and cp coexist , the risk of epilepsy in children with cp rises to 71% ( 5 ) . furthermore , robinson found that 21% of children with language impairment had seizures ( 6 ) . these are children who can not understand or express themselves ( either verbally or non - verbally ) in the normal way expected of age - matched peers within the general population ( 6 ) . utilizing an audit of clinical notes for children at two schools in one city , this study investigated whether a higher incidence of epilepsy existed in children with cp , learning difficulties ( ld ) or language and communication difficulties ( lacd ) compared to children without these conditions . in addition , data was studied to ascertain whether an earlier age of onset , low birth weight or gestational age is associated with increased incidence of cp , ld or lacd . conclusions made from local data could then allow for the possibility of adequate planning of services for these children . school a and school b are special primary schools in the city of newcastle upon tyne , uk . school a enrolls children with a variety of developmental difficulties , whereas pupils at b , a more specialist school , either have cp or lacd . medical records for current pupils in 2004 were obtained and carefully studied over seven weeks ( january to february ) to collate epidemiological information . details of the child s birth history , diagnosis ( as cp , lacd and/or ld ) , past history of syndromes , past history of epilepsy , age of onset , presence of neonatal encephalopathy , infantile spasms and febrile convulsions , type of epilepsy , frequency of fits were recorded . epilepsy was recorded as active if the child was currently on anti - epileptic medication . medical records for all 59 of the pupils at school b were obtained and studied . medical records for 83 ( 77% of pupils ) at school a were collected . the mean age of children at school b was 8.20 years ( s.d . 2.48 ) . children at school b were older ( t = 2.17 , p = 0.03 ) table 1 shows the number of children with each diagnosis by gender . many children had a combination of diagnoses , therefore totals in each gender row exceed 100% . epilepsy , both active and inactive , was more common in females than males ( x = 9.07 , p < 0.01 ) . although there were more females with cp and more males with lacd and ld , the differences between groups were not statistically significant . at each school there were three children that had a combination of cp , ld and lacd . there were 62 cases of epilepsy ( seizures at any time ) in the combined school population , representing 43% of the total . separate school data shows that more children at school b had cp than school a ( x = 9.56 , p < 0.01 ) or language and communication problems ( x 4.25 , p = 0.04 ) . more children at school a had learning difficulties ( x = 32.41 , p < 0.01 ) or active epilepsy ( x = 3.03 , p = 0.08 ) compared to school b. table 3 reports the association between active epilepsy or cp , lacd , or ld . the results show that active epilepsy was significantly more common in those children with cp when compared to children without cp ( x = 7.58 , p = 0.01 ) . there was no association between active epilepsy and the presence of ld however , all children with cp and ld had epilepsy ( n = 6 ) . interestingly , epilepsy was more likely to occur in children without lacd ( x = 8.45 , p < 0.01 ) . using combined data from both schools , females had an earlier age of onset of epilepsy than males ( t = 2.27 , p = 0.03 , data not shown ) . the average age of onset in children with cp was earlier at 21.50 months compared to 37.15 in children without cp , although this was not statistically significant ( t = 1.40 , p = 0.17 ) . there was no difference in age of onset of epilepsy in those with or without lacd ( t = 0.51 , p = 0.62 ) or ld ( t = 0.10 , p = 0.92 ) . although not statistically significant , the data also showed a trend that those children who developed epilepsy within the first 24 hours of life were more likely to have cp than those who developed epilepsy later in life ( x = 3.10 , p = 0.08 ) . finally , children with neonatal encephalopathy are more likely to have cp than those without neonatal encephalopathy ( x = 8.74 , p < 0.01 , data not shown ) . table 4 shows the mean gestational age and birth weight in children with cp , lacd , and ld . the results showed that those with cp tended to have a lower birth weight ( t = 3.15 , p < 0.01 ) and a shorter gestation ( t = 3.17 , p < 0.01 ) than children without cp . although not statistically significant , children with lacd tended to be heavier at birth than children without lacd ( t = 1.79 , p = 0.08 ) . those with learning difficulties have a longer gestation compared to those without ( t = 2.00 , p = 0.047 ) there were three anomalous results for birth weight and gestation age . these results , although collected from the notes , seemed unlikely to be correct therefore were excluded from the analysis ( see discussion for details ) . medical records for all 59 of the pupils at school b were obtained and studied . medical records for 83 ( 77% of pupils ) at school a were collected . the mean age of children at school b was 8.20 years ( s.d . 2.48 ) . children at school b were older ( t = 2.17 , p = 0.03 ) table 1 shows the number of children with each diagnosis by gender . many children had a combination of diagnoses , therefore totals in each gender row exceed 100% . epilepsy , both active and inactive , was more common in females than males ( x = 9.07 , p < 0.01 ) . although there were more females with cp and more males with lacd and ld , the differences between groups were not statistically significant . at each school there were three children that had a combination of cp , ld and lacd . there were 62 cases of epilepsy ( seizures at any time ) in the combined school population , representing 43% of the total . separate school data shows that more children at school b had cp than school a ( x = 9.56 , p < 0.01 ) or language and communication problems ( x 4.25 , p = 0.04 ) . more children at school a had learning difficulties ( x = 32.41 , p < 0.01 ) or active epilepsy ( x = 3.03 , p = 0.08 ) compared to school b. table 3 reports the association between active epilepsy or cp , lacd , or ld . the results show that active epilepsy was significantly more common in those children with cp when compared to children without cp ( x = 7.58 , p = 0.01 ) . there was no association between active epilepsy and the presence of ld however , all children with cp and ld had epilepsy ( n = 6 ) . interestingly , epilepsy was more likely to occur in children without lacd ( x = 8.45 , p < 0.01 ) . using combined data from both schools , females had an earlier age of onset of epilepsy than males ( t = 2.27 , p = 0.03 , data not shown ) . the average age of onset in children with cp was earlier at 21.50 months compared to 37.15 in children without cp , although this was not statistically significant ( t = 1.40 , p = 0.17 ) . there was no difference in age of onset of epilepsy in those with or without lacd ( t = 0.51 , p = 0.62 ) or ld ( t = 0.10 , p = 0.92 ) . although not statistically significant , the data also showed a trend that those children who developed epilepsy within the first 24 hours of life were more likely to have cp than those who developed epilepsy later in life ( x = 3.10 , p = 0.08 ) . finally , children with neonatal encephalopathy are more likely to have cp than those without neonatal encephalopathy ( x = 8.74 , p < 0.01 , data not shown ) . table 4 shows the mean gestational age and birth weight in children with cp , lacd , and ld . the results showed that those with cp tended to have a lower birth weight ( t = 3.15 , p < 0.01 ) and a shorter gestation ( t = 3.17 , p < 0.01 ) than children without cp . although not statistically significant , children with lacd tended to be heavier at birth than children without lacd ( t = 1.79 , p = 0.08 ) . those with learning difficulties have a longer gestation compared to those without ( t = 2.00 , p = 0.047 ) there were three anomalous results for birth weight and gestation age . these results , although collected from the notes , seemed unlikely to be correct therefore were excluded from the analysis ( see discussion for details ) . the data from the schools shows that the percentage of children with epilepsy was high compared with the general population ( 43% compared to 7% ) . school a takes children with multiple and more complex disabilities , illustrated by the tendency of more children to have active epilepsy and learning difficulties at this school . school b takes children with cp or lacd , also shown by the data , and is therefore considered more specialised . the data demonstrates that 40% of children with cp alone and 100% of children with a combined diagnosis of cp and ld also had epilepsy ( x = 4.44 , p = 0.035 ) . this is comparable with the literature , in which epilepsy occurs in 15 55% of children and adults with cp alone , rising to 71% in children also suffering from ld ( 5,710 ) . the proportion of children with epilepsy and lacd ( 14% ) was comparable to that of the literature ( 21% ) , and is greater than that of the general population ( 6 ) . we found that epilepsy occured more in children without lacd , but this may be due to the fact that these children suffered from other , predisposing conditions . the average age of onset of 21.5 months in children with cp was higher when compared to children without cp . furthermore , this age of onset was greater than data in the literature [ 18.9 months ( 10 ) ] . we also found that children who developed epilepsy within the first 24 hours of life were more likely to develop cp than those with a later onset ( p = 0.08 ) , a fact supported by existing literature ( 7 ) . finally , we found that neonatal encephalopathy , characterised by disturbed neurological function including seizure activity occurring in the first days of life ( 7,11 ) , was associated with cp ( p < 0.01 ) . the bw and ga of children with cp from both schools was lower when compared to children without cp ( p < 0.01 ) , supporting theories that the etiology of cp is due to prenatal events ( 2,7 ) . this data also supports conclusions made by an epidemiological study of cp performed in the north east of england from 1964 to 1993 ( 3 ) . this study concluded that there was a substantial increase in the overall rate of cp over time , caused by increased rate of cp in those children born weighing less than 2.5 kg . it is conceivable that many children with cp who would have died in the past could now survive because of improvements in the perinatal care of premature and low birth weight babies . the small study cohort ( only 37 children had active epilepsy ) is a considerable limitation and it can not be determined whether the schools studied were representative of special schools as a whole . many of the medical records for pupils in school a were inaccessible due to the amalgamation of hospital files across three different sites . this issue limited data collection , and as a result , also limits potential conclusions that could be drawn . three pupils were left out of the analysis of bw and ga due to improbable data - two were noted to be above 4 kg at birth , likely reflecting an older weight , and one recording was illegible . in addition , the lack of documentation of certain details such as association with family history , type of epilepsy and frequency of seizure activity meant that this information could not be included in formal analyses . in addition , definite negatives , such as the absence of seizure activity and family history , are rarely recorded in medical records . the results are at risk of type two error , which indicates that statistical significance could have been found by chance . this is possible due to the fact that there was no hypothesis stated prior to the beginning of the study , and also to the fact that the the data was collected by data dredge and analysed looking for statistically significant results ( 12 ) . this study could be improved by carrying out a prospective study using questionnaires and consultations thereby directly asking patients and their families about their medical history . in addition , investigations such as eeg , video recording and ct could give useful information about the type of epilepsy and its underlying pathology . standardised scores for ld versus the relatively crude manner in which data was documented would refine the methodology in a future study . . the comparison group could be children with epilepsy and no cp at a mainstream school , or a random sample taken from the general population . it would be interesting to broaden the study questions to include a detailed look at the type and the severity of cp , as some studies have found that epilepsy occurs in a higher rate in certain types of cp ( 7 ) . in addition , it would be of benefit to look at behaviour and educational attainment in children with epilepsy and cp as opposed to no epilepsy and cp . the data in this study builds on conclusions made by existing studies , reinforcing the fact that epilepsy commonly accompanies cp . the association between low bw and ga , and early age of onset of seizures in children with cp , illustrates the importance of past medical history from birth to determine any risk factors for epilepsy in later life . diagnosis and treatment of these children require skills in addition to those needed for non - complicated cp . therefore , members of the multidisciplinary team managing children in special schools like a and b need to be aware of this association and be educated to adequately manage these children .	purpose of the study : to determine in children the proportion and characteristics of epilepsy associated with cerebral palsy , learning difficulties and language and communication difficulties in a specific population of two special schools.basic procedures : retrospective review of case notes for 142 children in two special schools ( school a and school b ) in newcastle , ukmain findings : school a had more children with learning difficulties ( x2 = 32.41 , p < 0.01 ) and active epilepsy ( x2 = 3.03 , p=0.08 ) than school b. there were more children with cerebral palsy ( x2 = 9.56 , p < 0.01 ) and language and communication problems ( x2 = 4.25 , p = 0.03 ) at school b compared to school a. active epilepsy is significantly more common in children with cerebral palsy ( x2 = 7.58 , p = 0.01 ) . all children with cerebral palsy and learning difficulties had epilepsy ( n = 6 ) . although not statistically significant , those children who developed epilepsy within the first 24 hours of life were more likely to have cerebral palsy than those who developed epilepsy later in life ( x2 = 3.10 , p = 0.08 ) . those children with cerebral palsy tended to have a lower birth weight ( t = 3.15 , p < 0.01 ) and a shorter gestation ( t = 3.17 , p < 0.01 ) than children without cerebral palsy.principal conclusions : the data supports evidence from previous studies , demonstrating that epilepsy commonly accompanies cerebral palsy , thus complicating this difficult chronic condition . we show an association between both low birth weight and gestational age , and early age of onset of seizures , in children with cerebral palsy . this illustrates the importance , in these children , of past medical history from birth to determine risk factors for epilepsy later in life .
You are an expert at summarizing long articles. Proceed to summarize the following text: a total of 14 female patients aged 35 - 59 years , treated between january and april 1999 , were included in this study . all fulfilled the american college of rheumatology ( acr ) criteria ( 16 ) , and the mean duration of their ra was 71.6 months . a criterion for inclusion in this study was a lack of clinical improvement after 3-or more months of treatment with disease - modifying anti - rheumatic drugs . patients were excluded if they had undergone knee surgery or if laboratory studies revealed renal , hepatic or hematological abnormalities . during the follow - up period , medication was maintained , without dosage change , and the effect of the medicines used thus did not influence our findings . this study was approved by the ethics subcommittee of our hospital , and written informed consent was obtained from each patient prior to their enrollment . ho is a product of the neutron activation of holmium-165 , and is predominantly a beta - emitter ( emax = 1.84 mev ) with radiotherapeutic properties appropriate for therapy . it also emits gamma - ray photons ( 81 kev , 6.2% ) , detectable at scintillation imaging . holmium solution ( ho ( no3)35h20 ) was generated at the korea atomic energy research institute ( taejon , korea ) . in this study , we used ho - cc , a combination of ho and chitosan . the latter is a polymer of 2-deoxy-2-amino - d - glucose with -1 , four bonds , derived by the deacetylation of chitin ( 17 ) , and was supplied by pharmaceutical development lab ( dong wha pharm . ho - cc was injected into the knee joint via the medial or lateral routes of the suprapatellar recess after the aspiration of 1 - 2 ml of joint fluid . the injection volume and dose were approximately 1 ml and 10 - 20 mci , respectively . for all examinations , a 1.5-t mr imaging system ( sigma , ge medical systems , milwaukee , wis . images were obtained both before and four months after the treatment of synovitis of the knee , and the following pulse sequences were used : ( a ) t2-weighted spin echo sagittal imaging ( tr / te=2000/70 , fov=1616 , slice thickness=4 mm with 1 mm interslice gap , matrix=256256 , 1 nex ) ; ( b ) t1-weighted spin - echo axial imaging ( tr / te=620 - 450/14 , fov=1616 , slice thickness=4 mm with 1 mm interslice gap , matrix=256192 , 1 nex ) ; ( c ) fat - suppressed , three - dimensional spoiled gradient - echo ( 3d spgr ) sagittal imaging , both pre- and post - gd - dtpa enhancement ( tr / te=21.0 - 23.6/2.1 - 3.0 , fov=1616 to 2020 , slice thickness=1.3 - 1.5 mm , matrix=256256 , 1 nex , flip angle=15 ) . all clinical evaluations were performed before and 4 months after radiation synovectomy . to assess knee pain , the system , involving a form of cross - modality matching in which line length is the response continuum , is useful for the measurement of chronic pain ( 18 ) , and has been reported to provide valid and reliable measurements of its intensity ( 19 - 21 ) . the circumference of the knee at the level of the center of the patella was measured before and 4-months after radiation synovectomy for the evaluation of swelling , and the range of motion of the knee joint was also evaluated by measuring the angle of flexion and extension using a goniometer . extra - articular leakage of injected ho - cc was evaluated in nine patients . for the analysis of gamma - scan images and radionuclide preparations , counts were corrected for the decay of ho to the planned time of evaluation , based on the half - life of ho . whole - body scans were obtained using a genesys gamma camera ( adac , milpitas , u.s.a . ) with a high - energy collimator . the biodistribution of the injected dw-166hc was analyzed chronologically by calculating the activity counts of different regions of interest , including the knee , brain , chest and abdomen . the degree of synovial enhancement was determined from sagittal fat - suppressed 3d spgr images ( fig . 1 ) , using scion image ( free software developed at the u.s . national institutes of health and modified at the scion corporation ) . synovial enhancement volume was decided by means of the following three steps , as described previously ( 8 , 9 , 22 , 23 ) : first , a region containing synovium was traced manually ; second , a segmentation procedure was undertaken , threshold cut - off value being defined as the midpoint between the mean voxel value of the enhancing synovium minus 2 standard deviations ( sd ) and the mean voxel value of muscle plus 2 sds , and mean values and sds were obtained from multiple regions of interest ; third , enhanced pixels on a segmented image were counted , and the volume was calculated . using sagittal t2-weighted images , synovial thickness was measured and summed from 18 areas of the suprapatellar pouch ; anterior and posterior synovial pouch tissue was divided into midline , lateral and medial regions and then subdivided into superior , middle and inferior portions . the amount of joint effusion was measured on t2-weighted images , where joint effusion is easily demarcated from the synovium . using scion image , joint effusion was determined through three separate steps , identical to the method mentioned above . threshold signal intensity was defined as the midpoint between the mean voxel value of the joint effusion minus 2 sds and the mean voxel value of fat plus 2 sds . in contrast to the evaluation of synovial enhancement , fat was selected as the comparison value due to its intermediate signal intensity on t2-weighted images . two radiologists ( s.h.l , j.s.s ) reviewed the mr images and reached their conclusions by consensus . t1-weighted axial and 3d spgr images were used to determine the number of marginal and central erosions that involved the medial and lateral femur , medial and lateral tibia , patella , and tibio - fibular joint ( fig . a lesion was defined as bone marrow edema if t2-weighted and 3d - spgr images showed that it was poorly defined and demonstrated high signal intensity . if consecutive images indicated that a nodular lesion present in the popliteal space lacked continuity to popliteal vessels , it was regarded as a lymph node . the following scores were assigned : if one or more lesions were present at each site : 1 ; if the lesion was aggravated : 1.5 ; if the lesion had disappeared : 0 ; and if the lesion was newly developed : 1 . spearman 's correlation coefficient analysis was used to assess differences between the visual analog scale readings obtained before and after radiation synovectomy , and differences in mri findings . the paired t test was used to determine correlation between pre- and post - radiation synovectomy mr scores and clinical data . the reproducibility of the quantification of volume measurement was evaluated , intra- and inter - observer variation being expressed as mean percentage average absolute variation and percentage coefficient of variation . a statistical analysis system package ( spss version 10.0 ) a total of 14 female patients aged 35 - 59 years , treated between january and april 1999 , were included in this study . all fulfilled the american college of rheumatology ( acr ) criteria ( 16 ) , and the mean duration of their ra was 71.6 months . a criterion for inclusion in this study was a lack of clinical improvement after 3-or more months of treatment with disease - modifying anti - rheumatic drugs . patients were excluded if they had undergone knee surgery or if laboratory studies revealed renal , hepatic or hematological abnormalities . during the follow - up period , medication was maintained , without dosage change , and the effect of the medicines used thus did not influence our findings . this study was approved by the ethics subcommittee of our hospital , and written informed consent was obtained from each patient prior to their enrollment . ho is a product of the neutron activation of holmium-165 , and is predominantly a beta - emitter ( emax = 1.84 mev ) with radiotherapeutic properties appropriate for therapy . it also emits gamma - ray photons ( 81 kev , 6.2% ) , detectable at scintillation imaging . holmium solution ( ho ( no3)35h20 ) was generated at the korea atomic energy research institute ( taejon , korea ) . in this study , we used ho - cc , a combination of ho and chitosan . the latter is a polymer of 2-deoxy-2-amino - d - glucose with -1 , four bonds , derived by the deacetylation of chitin ( 17 ) , and was supplied by pharmaceutical development lab ( dong wha pharm . ho - cc was injected into the knee joint via the medial or lateral routes of the suprapatellar recess after the aspiration of 1 - 2 ml of joint fluid . the injection volume and dose were approximately 1 ml and 10 - 20 mci , respectively . for all examinations , a 1.5-t mr imaging system ( sigma , ge medical systems , milwaukee , wis . images were obtained both before and four months after the treatment of synovitis of the knee , and the following pulse sequences were used : ( a ) t2-weighted spin echo sagittal imaging ( tr / te=2000/70 , fov=1616 , slice thickness=4 mm with 1 mm interslice gap , matrix=256256 , 1 nex ) ; ( b ) t1-weighted spin - echo axial imaging ( tr / te=620 - 450/14 , fov=1616 , slice thickness=4 mm with 1 mm interslice gap , matrix=256192 , 1 nex ) ; ( c ) fat - suppressed , three - dimensional spoiled gradient - echo ( 3d spgr ) sagittal imaging , both pre- and post - gd - dtpa enhancement ( tr / te=21.0 - 23.6/2.1 - 3.0 , fov=1616 to 2020 , slice thickness=1.3 - 1.5 mm , matrix=256256 , 1 nex , flip angle=15 ) . all clinical evaluations were performed before and 4 months after radiation synovectomy . to assess knee pain , the system , involving a form of cross - modality matching in which line length is the response continuum , is useful for the measurement of chronic pain ( 18 ) , and has been reported to provide valid and reliable measurements of its intensity ( 19 - 21 ) . the circumference of the knee at the level of the center of the patella was measured before and 4-months after radiation synovectomy for the evaluation of swelling , and the range of motion of the knee joint was also evaluated by measuring the angle of flexion and extension using a goniometer . extra - articular leakage of injected ho - cc was evaluated in nine patients . for the analysis of gamma - scan images and radionuclide preparations , counts were corrected for the decay of ho to the planned time of evaluation , based on the half - life of ho . whole - body scans were obtained using a genesys gamma camera ( adac , milpitas , u.s.a . ) with a high - energy collimator . the biodistribution of the injected dw-166hc was analyzed chronologically by calculating the activity counts of different regions of interest , including the knee , brain , chest and abdomen . the degree of synovial enhancement was determined from sagittal fat - suppressed 3d spgr images ( fig . 1 ) , using scion image ( free software developed at the u.s . national institutes of health and modified at the scion corporation ) . synovial enhancement volume was decided by means of the following three steps , as described previously ( 8 , 9 , 22 , 23 ) : first , a region containing synovium was traced manually ; second , a segmentation procedure was undertaken , threshold cut - off value being defined as the midpoint between the mean voxel value of the enhancing synovium minus 2 standard deviations ( sd ) and the mean voxel value of muscle plus 2 sds , and mean values and sds were obtained from multiple regions of interest ; third , enhanced pixels on a segmented image were counted , and the volume was calculated . these three steps were repeated for all sagittal images relating to each patient . using sagittal t2-weighted images , synovial thickness was measured and summed from 18 areas of the suprapatellar pouch ; anterior and posterior synovial pouch tissue was divided into midline , lateral and medial regions and then subdivided into superior , middle and inferior portions . the amount of joint effusion was measured on t2-weighted images , where joint effusion is easily demarcated from the synovium . using scion image , joint effusion was determined through three separate steps , identical to the method mentioned above . threshold signal intensity was defined as the midpoint between the mean voxel value of the joint effusion minus 2 sds and the mean voxel value of fat plus 2 sds . in contrast to the evaluation of synovial enhancement , fat was selected as the comparison value due to its intermediate signal intensity on t2-weighted images . two radiologists ( s.h.l , j.s.s ) reviewed the mr images and reached their conclusions by consensus . t1-weighted axial and 3d spgr images were used to determine the number of marginal and central erosions that involved the medial and lateral femur , medial and lateral tibia , patella , and tibio - fibular joint ( fig . a lesion was defined as bone marrow edema if t2-weighted and 3d - spgr images showed that it was poorly defined and demonstrated high signal intensity . if consecutive images indicated that a nodular lesion present in the popliteal space lacked continuity to popliteal vessels , it was regarded as a lymph node . the following scores were assigned : if one or more lesions were present at each site : 1 ; if the lesion was aggravated : 1.5 ; if the lesion had disappeared : 0 ; and if the lesion was newly developed : 1 . spearman 's correlation coefficient analysis was used to assess differences between the visual analog scale readings obtained before and after radiation synovectomy , and differences in mri findings . the paired t test was used to determine correlation between pre- and post - radiation synovectomy mr scores and clinical data . the reproducibility of the quantification of volume measurement was evaluated , intra- and inter - observer variation being expressed as mean percentage average absolute variation and percentage coefficient of variation . a statistical analysis system package ( spss version 10.0 ) between pre- and post - radiation synovectomy , a significant decrease in the visual analog scale was noted [ 20.120.7 ( range , -21 to 44 ) ] ( p < 0.05 ) . knee circumference decreased by 0.8 ( range , -1.5 to 4.0 ) cm ( p = 0.054 ) , but the range of motion of the knee joint was unchanged ( p > 0.1 ) . in nine of the 14 patients , 3 ) , but the difference was not statistically significant ( table 2 , p = 0.107 ) . joint effusion decreased by 8.812.3 ml ( p < 0.05 ) , but bony erosion , marrow edema and lymph nodes showed no change ( p > 0.1 ) . correlation between changes in visual analog scale values and in mri scores was not significant ( p > 0.01 ) , but there was significant correlation between the former and changes in knee circumference ( p < 0.05 ) . among mri scores , changes in synovial volume showed positive correlation with changes in synovial thickness ( p < 0.05 ) and the amount of effusion ( p < 0.01 ) . pre- and post - radiation synovectomy images indicated that the lateral femur was the most frequent site of bony erosion ( score of 27 ) , followed by the medial tibia ( 21.5 ) , medial femur ( 20.5 ) , lateral tibia ( 7 ) , tibio - fibular joint ( 6 ) and patella ( 1 ) . bone marrow edema was observed most frequently in the medial femur ( 15 ) , medial tibia ( 9 ) , lateral femur ( 7.5 ) , lateral tibia ( 5.5 ) and patella ( 2 ) . twenty - four hours after the injection of ho - cc , almost all radioactivity was still retained in the knee joint ; less than 1% had spread to other tissues . eight days after injection , activity distribution rates had increased in the brain , lungs , abdomen and pelvic area to 1.5% , 2.0% , 1.9% , and 1.9% , respectively . in this study , high intra- and inter - observer reproducibility were demonstrated . for observer a , mean percentage average absolute variation was 0.5 ( range , 0.16 - 2.1 ) , and the percentage coefficient of variation was 1.3% ( 0.1 - 1.8 ) . inter - observer mean percentage coefficient of variation was 0.5% ( 0.1 - 0.9 ) . radiation synovectomy is a locally acting treatment for chronic refractory synovitis and is an alternative to intra - articular injection of corticosteroids and other systemic pharmacological treatments . radionuclide treatment has advantages over external radiotherapy : because most radionuclides currently used are beta emitters , which have properties of high linear energy transfer and rapid fall - off , there are no adverse effects on adjacent bones and soft tissues . an ideal radiation synovectomy agent should have the following four characteristics ( 6 , 25 ) : first , the radionuclide should have beta - particle energy sufficient to penetrate and ablate the enlarged area of synovial tissue but not so great as to damage underlying articular cartilage or overlying skin . second , the radionuclide should be attached to a particle that is sufficiently small to be phagocytized but not so small as to leak from the joint before being phagocytized ; the appropriate size range is usually thought to be 2 - 5 m . the binding between the radionuclide and particle should be irreversible throughout the course of the radiotherapy ; the timespan is determined by the physical half - life of the particular isotope employed . third , the particle should be biodegradable ; persistence in the joint of non - biodegradable materials can itself give rise to granulomatous tissues . fourth , and finally , any biologically induced degradation of the agent should ideally release the radionuclide in a chemical form that rapidly egresses from the body . the accepted biological mechanism by which these agents function involves their rapid phagocytosis by synoviocytes , their even distribution over the surface of the synovium , and the irradiation of pathologic synovial tissue . the primary disadvantage of this procedure is the unacceptable radiation doses delivered to non - target organ systems due to leakage of radioactive material from the cavity . leakage can , however , potentially be avoided in two ways : by using large carrier particles or aggregates , and by choosing a radioisotope that has a short half - life , thus allowing almost all radioactivity to decay before leakage occurs ( 25 ) . ho - cc was initially introduced as an intratumoral administration agent ( 7 ) , and if injected locally into the liver or a solid tumor , it precipitates , thus preventing systemic distribution of ho . it is because chitosan dissolves in dilute mineral and organic acids , but precipitates at a ph of above 6.0 , that distribution does not occur ( 17 ) . after we administered ho - cc , radioactive concentrations in the blood were low and cumulative urinary and fecal excretions over a period of 0 - 72 hrs were 0.53% and 0.54% , respectively . ( 7 ) has proved the suitability of ho - cc for local injection by showing that 24 hours after injection , less than 1% of the total injected amount was detectable in tissues other than those at the injection site . ho - cc leaks only minimally because in tissues it is transformed into a gel , and has an appropriate half - life . in toxicity evaluations after the intravenous injection of ho - cc , the major effects of injections of 1 mci / kg were limited to the spleen , and the hematological parameters were reversible by day 14 ( 28 ) . our report is the first to describe the mri evaluation of dw-166hc radiation synovectomy in patients with ra . information regarding biodistribution , doses , and adverse effects after intra - articular injection has been detailed by song et al . ( 27 ) . several radionuclides are used for radiation synovectomy , namely y , p , re , er , dy , and ho . because of the deep penetration capability of its energetic beta particles ( mean tissue penetration of 3.6 mm ) , y has been most commonly used to treat the rheumatoid knee , while rhenium-186 and erbium-169 agents are also recommended for intermediate - sized joints ( mean tissue penetration of 1.2 mm ) and the smallest joints ( mean tissue penetration of 0.3 mm ) , respectively ( 6 ) . first of all , it can be produced in a simple way from ho , a naturally abundant element , and is less expensive than y ; second , because it can emit the gamma rays necessary for image acquisition , it is also suitable for quantitative dosimetric studies ; third , it has a half - life of 26.8 hours ; lastly , it has an adequate penetration range for synovial ablation , while avoiding damage to adjacent cartilage or bone . ho deposits ninety percent of its energy within an area 2.1 mm in diameter , while the remainder is deposited within an area measuring 2.1 - 8.7 mm ( 28 ) . the absorbed dose relative to depth required for successful radiation synovectomy has not been established . in fact , the rationale for choosing a particular dose of a given radionuclide in a given joint remains obscure , and most published studies have relied on historically derived , empirical dosimetry ( 28 ) . in patients with ra , y is the most commonly used agent for radiation synovectomy of the knee , and the most commonly used dosage is 5 mci . deutsch et al . ( 6 ) stated that at this dosage , 91% of patients showed a good response . y delivers an absorbed dose ( 28 mgy / mbq ) higher than that delivered by ho ( 8.7 mgy / mbq ) ( 29 ) , and the therapeutic dosage of ho must therefore be at least three times greater than that of y. in ra , the synovium becomes inflamed , and the synovial mass consists of vascular congestion , edema and cellular infiltration as well as hyperplasia of the synovial lining and pannus tissue formation ( 11 , 30 ) . the histologic changes occurring after radiation synovectomy include the regression of destructive pannus , and the reduction of cellular infiltration and synovial sclerosis ( 31 ) . the severity of the disease might possibly be determined by measuring the volume of synovial inflammation . several investigators have described the use of mri for quantification of the synovial volume of the knee joint ( 10 , 11 - 13 , 32 ) . although there is no consensus as to the optimal mri method for synovial volume measurement , we used fat - suppressed , enhanced 3d spgr imaging , which has been previously described and permits a thin slice setting and high tissue contrast between enhancing synovium and non - enhancing tissue ( 8 , 9 , 33 ) . synovial volume measurement has proven useful for evaluating the therapeutic effectiveness of antirheumatic drugs ( 10 , 12 ) . ( 10 ) reported that the duration of clinical remission in patients with ra showed significant inverse correlation to pre - treatment synovial volume . they found that at relapse , synovial volume had increased roughly to pretreatment levels , but effusion volumes remained lower than before treatment , and thus insisted that synovial volume measurement could play a more important role in the assessment of treatment outcome . only one published report has described the usefulness of synovial volume measurement after radiation synovectomy ( y and triamcinolone ) ( 11 ) , noting that synovial volume tended to decrease , but not to a statistically significant extent . our results showed a similar tendency after treatment with ho - cc , and the decrease was also statistically insignificant . as a means of evaluating the outcome of radiation synovectomy , investigators have used mr imaging to measure synovial thickness ( 14 , 34 ) . thickness was found to be reduced by 4.4 - 7.7 mm at one - year follow - up after dy treatment ( 34 ) , and by 1.0 - 2.3 mm at six - month followup after y treatment ( 14 ) . however , our results demonstrated no significant change in synovial thickness , which had decreased from 3.8 mm to 3.7 mm at follow - up four months after treatment . we believe , however , that because changes in synovial effusion may lessen the accuracy of synovial thickness measurement , the measurement of synovial volume is a more reliable indicator . it is conceivable that as synovial effusion decreases , proliferated synovial tissue can become folded from an unfolded or effaced state . joint effusion has been thought to be a therapeutic response indicator ( 14 ) ; as measured by joint aspiration ( 14 ) or mri ( 10 , 11 ) , it has shown reductions after radiation synovectomy ; good correlation was found between the aspirated volume of synovial fluid and the volume of fluid calculated after mri ( 11 ) . in our study , the volume of effusion measured by mri was significantly lower after therapy , and , as was expected , correlated well with the circumference of the knee , an indirect indicator of joint swelling . on the other hand we believe that therapeutic effect may depend on communication between a baker cyst and the joint , though our study did not investigate whether baker cysts communicated with the knee joint . two common alterations occurring in the juxta - articular bones in ra are osteoporosis and marginal erosion . the latter usually develops near synovial pockets and on bare areas that do not possess protective cartilaginous coats ( 35 ) , and may represent a very early manifestation of the disease , occurring one or two years prior to the onset of joint symptoms . in this study , the bony erosion score tended to increase even after radiation synovectomy , and for this there are three possible reasons . ( 36 ) , areas of bony erosion may remain static for long periods of time or even become bigger as more widespread osseous damage becomes manifest . the second possible explanation is the fact that unless erosive lesions communicate with the joint , intruded synovial tissue within the lesions can not be reached by injected radiopharmaceuticals ( 37 , 38 ) . finally , although the amount of synovial tissue in an eroded area is reduced over a given period , bone erosion may not be refilled with bone or marrow tissue . the occurrence of bone marrow edema has not been fully described , and the significance of its presence in ra has been poorly investigated . in our study involving ra patients , bone marrow edema was a common finding , though other investigators have found it to be a rare manifestation ( 39 ) . this discrepancy may result from differences in the duration of disease : in that earlier study , the mean duration of knee synovitis was about ten weeks , whereas all synovitis cases in our study were chronic . bone marrow edema was found most frequently in the medial femur , but bone erosion had occurred in the lateral femur , a finding which corroborates the fact that bone marrow edema is associated not only with bone erosion but also with conditions such as periarticular osteoporosis , hyperemia , co - existing osteoarthritis , and reflex sympathetic dystrophy superimposed on the rheumatoid process ( 35 ) . it has been postulated in only one study that marrow edema reduction is associated with remission after disease modifying anti - rheumatic drug therapy ( 40 ) ; our results , however , showed that bone marrow edema did not change significantly after radiation synovectomy . we speculated that marrow edema reduction would ensue if synovial inflammation was reduced , but this did not occur during our follow - up period , and for the evaluation of marrow edema in ra , further study is thus required . lymph nodes , which in this study occurred frequently in the popliteal fossa , were rarely observed at mr imaging for the evaluation of internal derangement of the knee . kojima et al . have reported the presence of reactive proliferative lymph nodes in ra ( 41 ) , describing histological findings of follicular hyperplasia with active germinal centers , and polyclonal plasma cell infiltration of the interfollicular area . the relationship between lymph node size and disease activity is one that future studies should address . certain investigators have reported the usefulness of mr perfusion studies in the evaluation of ra , analysing synovial enhancement in terms of its degree and the maximal gradient of increased signal intensity ( 11 ) , the maximal enhancement ratio ( 14 ) , the intensity of enhancement ( 34 ) , the time to maximum synovial lining signal ratio , and the maximum synovial lining signal ratio ( 13 ) . to determine the usefulness of the quantification of synovial enhancement , further investigation is required . one is that it is cross - sectional , demonstrating clinical and mr imaging changes occurring during a 4-month follow - up period after ho - cc radiation synovectomy . other limitations are the small number of patients and the short duration of follow - up . in the future , long - term follow - up data should be collected from the same patients , and a larger patient population should be studied . from a technical point of view , mr contrast agent may have leaked into a joint within the period of image acquisition , affecting mri measurements and perhaps leading to the overestimation of synovial volume . in conclusion , the decreased joint effusion observed at 4-month follow - up resulted from radiation synovectomy of the rheumatoid knee by means of intra - articular injection of ho - cc . radiation synovectomy is a locally acting treatment for chronic refractory synovitis and is an alternative to intra - articular injection of corticosteroids and other systemic pharmacological treatments . radionuclide treatment has advantages over external radiotherapy : because most radionuclides currently used are beta emitters , which have properties of high linear energy transfer and rapid fall - off , there are no adverse effects on adjacent bones and soft tissues . an ideal radiation synovectomy agent should have the following four characteristics ( 6 , 25 ) : first , the radionuclide should have beta - particle energy sufficient to penetrate and ablate the enlarged area of synovial tissue but not so great as to damage underlying articular cartilage or overlying skin . second , the radionuclide should be attached to a particle that is sufficiently small to be phagocytized but not so small as to leak from the joint before being phagocytized ; the appropriate size range is usually thought to be 2 - 5 m . the binding between the radionuclide and particle should be irreversible throughout the course of the radiotherapy ; the timespan is determined by the physical half - life of the particular isotope employed . third , the particle should be biodegradable ; persistence in the joint of non - biodegradable materials can itself give rise to granulomatous tissues . fourth , and finally , any biologically induced degradation of the agent should ideally release the radionuclide in a chemical form that rapidly egresses from the body . the accepted biological mechanism by which these agents function involves their rapid phagocytosis by synoviocytes , their even distribution over the surface of the synovium , and the irradiation of pathologic synovial tissue . the primary disadvantage of this procedure is the unacceptable radiation doses delivered to non - target organ systems due to leakage of radioactive material from the cavity . leakage can , however , potentially be avoided in two ways : by using large carrier particles or aggregates , and by choosing a radioisotope that has a short half - life , thus allowing almost all radioactivity to decay before leakage occurs ( 25 ) . ho - cc was initially introduced as an intratumoral administration agent ( 7 ) , and if injected locally into the liver or a solid tumor , it precipitates , thus preventing systemic distribution of ho . it is because chitosan dissolves in dilute mineral and organic acids , but precipitates at a ph of above 6.0 , that distribution does not occur ( 17 ) . after we administered ho - cc , radioactive concentrations in the blood were low and cumulative urinary and fecal excretions over a period of 0 - 72 hrs were 0.53% and 0.54% , respectively . ( 7 ) has proved the suitability of ho - cc for local injection by showing that 24 hours after injection , less than 1% of the total injected amount was detectable in tissues other than those at the injection site . ho - cc leaks only minimally because in tissues it is transformed into a gel , and has an appropriate half - life . in toxicity evaluations after the intravenous injection of ho - cc , the major effects of injections of 1 mci / kg were limited to the spleen , and the hematological parameters were reversible by day 14 ( 28 ) . our report is the first to describe the mri evaluation of dw-166hc radiation synovectomy in patients with ra . information regarding biodistribution , doses , and adverse effects after intra - articular injection has been detailed by song et al . several radionuclides are used for radiation synovectomy , namely y , p , re , er , dy , and ho . because of the deep penetration capability of its energetic beta particles ( mean tissue penetration of 3.6 mm ) , y has been most commonly used to treat the rheumatoid knee , while rhenium-186 and erbium-169 agents are also recommended for intermediate - sized joints ( mean tissue penetration of 1.2 mm ) and the smallest joints ( mean tissue penetration of 0.3 mm ) , respectively ( 6 ) . first of all , it can be produced in a simple way from ho , a naturally abundant element , and is less expensive than y ; second , because it can emit the gamma rays necessary for image acquisition , it is also suitable for quantitative dosimetric studies ; third , it has a half - life of 26.8 hours ; lastly , it has an adequate penetration range for synovial ablation , while avoiding damage to adjacent cartilage or bone . ho deposits ninety percent of its energy within an area 2.1 mm in diameter , while the remainder is deposited within an area measuring 2.1 - 8.7 mm ( 28 ) . the absorbed dose relative to depth required for successful radiation synovectomy has not been established . in fact , the rationale for choosing a particular dose of a given radionuclide in a given joint remains obscure , and most published studies have relied on historically derived , empirical dosimetry ( 28 ) . in patients with ra , y is the most commonly used agent for radiation synovectomy of the knee , and the most commonly used dosage is 5 mci . deutsch et al . ( 6 ) stated that at this dosage , 91% of patients showed a good response . y delivers an absorbed dose ( 28 mgy / mbq ) higher than that delivered by ho ( 8.7 mgy / mbq ) ( 29 ) , and the therapeutic dosage of ho must therefore be at least three times greater than that of y. in ra , the synovium becomes inflamed , and the synovial mass consists of vascular congestion , edema and cellular infiltration as well as hyperplasia of the synovial lining and pannus tissue formation ( 11 , 30 ) . the histologic changes occurring after radiation synovectomy include the regression of destructive pannus , and the reduction of cellular infiltration and synovial sclerosis ( 31 ) . the severity of the disease might possibly be determined by measuring the volume of synovial inflammation . several investigators have described the use of mri for quantification of the synovial volume of the knee joint ( 10 , 11 - 13 , 32 ) . although there is no consensus as to the optimal mri method for synovial volume measurement , we used fat - suppressed , enhanced 3d spgr imaging , which has been previously described and permits a thin slice setting and high tissue contrast between enhancing synovium and non - enhancing tissue ( 8 , 9 , 33 ) . synovial volume measurement has proven useful for evaluating the therapeutic effectiveness of antirheumatic drugs ( 10 , 12 ) . ( 10 ) reported that the duration of clinical remission in patients with ra showed significant inverse correlation to pre - treatment synovial volume . they found that at relapse , synovial volume had increased roughly to pretreatment levels , but effusion volumes remained lower than before treatment , and thus insisted that synovial volume measurement could play a more important role in the assessment of treatment outcome . only one published report has described the usefulness of synovial volume measurement after radiation synovectomy ( y and triamcinolone ) ( 11 ) , noting that synovial volume tended to decrease , but not to a statistically significant extent . our results showed a similar tendency after treatment with ho - cc , and the decrease was also statistically insignificant . as a means of evaluating the outcome of radiation synovectomy , investigators have used mr imaging to measure synovial thickness ( 14 , 34 ) . thickness was found to be reduced by 4.4 - 7.7 mm at one - year follow - up after dy treatment ( 34 ) , and by 1.0 - 2.3 mm at six - month followup after y treatment ( 14 ) . however , our results demonstrated no significant change in synovial thickness , which had decreased from 3.8 mm to 3.7 mm at follow - up four months after treatment . we believe , however , that because changes in synovial effusion may lessen the accuracy of synovial thickness measurement , the measurement of synovial volume is a more reliable indicator . it is conceivable that as synovial effusion decreases , proliferated synovial tissue can become folded from an unfolded or effaced state . joint effusion has been thought to be a therapeutic response indicator ( 14 ) ; as measured by joint aspiration ( 14 ) or mri ( 10 , 11 ) , it has shown reductions after radiation synovectomy ; good correlation was found between the aspirated volume of synovial fluid and the volume of fluid calculated after mri ( 11 ) . in our study , the volume of effusion measured by mri was significantly lower after therapy , and , as was expected , correlated well with the circumference of the knee , an indirect indicator of joint swelling . on the other hand we believe that therapeutic effect may depend on communication between a baker cyst and the joint , though our study did not investigate whether baker cysts communicated with the knee joint . two common alterations occurring in the juxta - articular bones in ra are osteoporosis and marginal erosion . the latter usually develops near synovial pockets and on bare areas that do not possess protective cartilaginous coats ( 35 ) , and may represent a very early manifestation of the disease , occurring one or two years prior to the onset of joint symptoms . in this study , the bony erosion score tended to increase even after radiation synovectomy , and for this there are three possible reasons . ( 36 ) , areas of bony erosion may remain static for long periods of time or even become bigger as more widespread osseous damage becomes manifest . the second possible explanation is the fact that unless erosive lesions communicate with the joint , intruded synovial tissue within the lesions can not be reached by injected radiopharmaceuticals ( 37 , 38 ) . finally , although the amount of synovial tissue in an eroded area is reduced over a given period , bone erosion may not be refilled with bone or marrow tissue . the occurrence of bone marrow edema has not been fully described , and the significance of its presence in ra has been poorly investigated . in our study involving ra patients , bone marrow edema was a common finding , though other investigators have found it to be a rare manifestation ( 39 ) . this discrepancy may result from differences in the duration of disease : in that earlier study , the mean duration of knee synovitis was about ten weeks , whereas all synovitis cases in our study were chronic . bone marrow edema was found most frequently in the medial femur , but bone erosion had occurred in the lateral femur , a finding which corroborates the fact that bone marrow edema is associated not only with bone erosion but also with conditions such as periarticular osteoporosis , hyperemia , co - existing osteoarthritis , and reflex sympathetic dystrophy superimposed on the rheumatoid process ( 35 ) . it has been postulated in only one study that marrow edema reduction is associated with remission after disease modifying anti - rheumatic drug therapy ( 40 ) ; our results , however , showed that bone marrow edema did not change significantly after radiation synovectomy . we speculated that marrow edema reduction would ensue if synovial inflammation was reduced , but this did not occur during our follow - up period , and for the evaluation of marrow edema in ra , further study is thus required . lymph nodes , which in this study occurred frequently in the popliteal fossa , were rarely observed at mr imaging for the evaluation of internal derangement of the knee . kojima et al . have reported the presence of reactive proliferative lymph nodes in ra ( 41 ) , describing histological findings of follicular hyperplasia with active germinal centers , and polyclonal plasma cell infiltration of the interfollicular area . the relationship between lymph node size and disease activity is one that future studies should address . certain investigators have reported the usefulness of mr perfusion studies in the evaluation of ra , analysing synovial enhancement in terms of its degree and the maximal gradient of increased signal intensity ( 11 ) , the maximal enhancement ratio ( 14 ) , the intensity of enhancement ( 34 ) , the time to maximum synovial lining signal ratio , and the maximum synovial lining signal ratio ( 13 ) . to determine the usefulness of the quantification of synovial enhancement , further investigation is required . one is that it is cross - sectional , demonstrating clinical and mr imaging changes occurring during a 4-month follow - up period after ho - cc radiation synovectomy . other limitations are the small number of patients and the short duration of follow - up . in the future , long - term follow - up data should be collected from the same patients , and a larger patient population should be studied . from a technical point of view , mr contrast agent may have leaked into a joint within the period of image acquisition , affecting mri measurements and perhaps leading to the overestimation of synovial volume . in conclusion , the decreased joint effusion observed at 4-month follow - up resulted from radiation synovectomy of the rheumatoid knee by means of intra - articular injection of ho - cc .	objectiveto determine whether mri is able to demonstrate the effect of radiation synovectomy after the intra - articular injection of holmium-166-chitosan complex for the treatment of rheumatoid arthritis of the knee.materials and methodsfourteen patients aged 36 - 59 years were treated with 10 - 20 mci of holmium-166-chitosan complex . a criterion for inclusion in this study was the absence of observable improvement after 3- or more months of treatment of the knee with disease - modifying anti - rheumatic drugs . mr images were acquired both prior to and 4-months after treatment . clinical evaluation included the use of visual analog scales to assess pain , and the circumference of the knee and its range of motion were also determined . mr evaluation included measurement of the volume of synovial enhancement and wall thickness , the amount of joint effusion , and quantifiable scoring of bone erosion , bone edema and lymph nodes.resultsvisual analog scale readings decreased significantly after radiation synovectomy ( p < 0.05 ) . mri showed that joint effusion decreased significantly ( p < 0.05 ) , and that the volume of synovial enhancement tended to decrease , but to an insignificant extent ( p = 0.107).conclusionthe decreased joint effusion noted at 4-month follow - up resulted from radiation synovectomy of the rheumatoid knee by means of intra - articular injection of holmium-166-chitosan complex .
You are an expert at summarizing long articles. Proceed to summarize the following text: milrinone , a phosphodiesterase iii inhibitor currently used to treat pediatric patients with cardiac diseases , increases the level of cyclic adenosine monophosphate in the myocardium and vascular smooth muscle . high levels of cyclic adenosine monophosphate enhance the contractility of the myocardium by increasing calcium influx and relaxing vascular smooth muscles,1 ) therefore increasing cardiac output and decreasing afterload . milrinone also has a lusitropic property , which improves myocardial relaxation.2 ) unlike other inotropes such as dopamine , dobutamine , and epinephrine , milrinone is not associated with an increase in myocardial oxygen consumption.3 ) milrinone is widely used due to its inotropic , vasodilatory , and lusitropic properties . it is frequently prescribed after cardiac surgery due to its efficacy in preventing low cardiac output syndrome.4 ) milrinone is also commonly administered to pediatric patients with myocarditis as a bridge therapy for patients with heart failure who are waiting for cardiac transplantation.5)6 ) milrinone has been shown to improve heart contractility in patients with septic shock.7 ) milrinone is currently one of the most commonly used off - label cardiovascular medications in children.8 ) although a few reports showed the efficacy and safety of short - term milrinone treatment ( for about 35 hours ) in children with heart disease,9)10 ) the safety and efficacy of long - term use of milrinone in children is limited due to a lack of sufficient evidence - based studies in pediatric populations . currently , milrinone is widely used for 3 days , which is usually based on extrapolation from studies in adults or clinical experience . therefore , the objective of this study was to evaluate the safety and efficacy of the current pattern of milrinone administration for 3 days in pediatric patients . a retrospective analysis was conducted using data collected from patients who received milrinone treatment for 3 days at the seoul national university children 's hospital from january 2005 to december 2012 . patients were divided into two groups based on the indication for milrinone treatment : group a consisted of patients who received milrinone to prevent low cardiac output syndrome after cardiac surgeries whereas group b consisted of patients who received milrinone treatment due to acute heart failures from causes other than cardiac surgeries . patients with the following conditions or those who underwent the following treatments were excluded from the study : 1 ) severe left ventricular outflow obstructive diseases such as aortic stenosis ; 2 ) hypertrophic or restrictive cardiomyopathies ; 3 ) milrinone administration immediately after cardiopulmonary resuscitation ; 4 ) multi - organ failures ; 5 ) simultaneous administration of 3 inotropes other than milrinone to increase blood pressure ; 6 ) renal replacement therapies including peritoneal dialysis ; 7 ) myocardial infarctions ; 8) univentricular heart surgeries . however , patients receiving 3 inotropes were included if inotropes were added after an interval of > 2 hours consecutively . patients ' characteristics including age , sex , height , weight , and body surface area were recorded . the following parameters were analyzed to identify the clinical application of milrinone : 1 ) initial infusion rate ; 2 ) maintenance continuous infusion rate ; 3 ) total duration of milrinone therapy ; 4 ) concomitantly infused inotropes . the operation and anesthesiology records of patients who had undergone cardiac surgeries were also studied to identify data related to anatomic diagnosis , type of surgery , time of cardiopulmonary bypass , and time of aortic cross - clamping . systolic blood pressure , heart rate , and echocardiographic data ( the left ventricular internal dimension at end - diastole , ejection fraction , and fractional shortening ) obtained before or immediately after starting milrinone treatment were compared to the values prior to treatment cessation . in cases where appropriate echocardiographic data could not be obtained on the day milrinone treatment was discontinued , echocardiographic data obtained within a week of the treatment endpoint were used . the safety of milrinone was determined based on the occurrence of adverse events such as hypotension , arrhythmia , chest pain , headache , hypokalemia , and thrombocytopenia . hypotension was defined as a sudden decrease in blood pressure within two hours after starting milrinone that necessitated the addition of inotropes or cessation of milrinone . arrhythmia was classified as supraventricular tachycardia , ectopic atrial tachycardia , atrial fibrillation / flutter , accelerated junctional rhythm , junctional ectopic tachycardia , ventricular tachycardia , or ventricular fibrillation . evidence of chest pains or headache during milrinone use were collected from the patient 's chart . potassium levels and platelet counts 24 to 48 hours after starting milrinone infusion were estimated . changes in hemodynamic parameters and echocardiographic data were analyzed using a pairwise comparison test and the wilcoxon signed - rank test . the frequency of hypokalemia and thrombocytopenia after milrinone infusion was analyzed using the mcnemar test . univariate and multivariate logistic regression analysis was used to evaluate the relationships between diverse variables , including the practical use of milrinone and the development of arrhythmia . for statistical analyses , descriptive data are presented as means and standard deviation , whereas categorical variables are presented as proportions . data manipulation and statistical analyses were performed with statistical package for the social sciences ( spss ) 19.0 for windows ( spss inc . , somers , ny , usa ) and excel 2010 ( microsoft ) . the study protocol was approved by the institutional review board of seoul national university hospital and patient consent was waived due to the study 's retrospective design . a retrospective analysis was conducted using data collected from patients who received milrinone treatment for 3 days at the seoul national university children 's hospital from january 2005 to december 2012 . patients were divided into two groups based on the indication for milrinone treatment : group a consisted of patients who received milrinone to prevent low cardiac output syndrome after cardiac surgeries whereas group b consisted of patients who received milrinone treatment due to acute heart failures from causes other than cardiac surgeries . patients with the following conditions or those who underwent the following treatments were excluded from the study : 1 ) severe left ventricular outflow obstructive diseases such as aortic stenosis ; 2 ) hypertrophic or restrictive cardiomyopathies ; 3 ) milrinone administration immediately after cardiopulmonary resuscitation ; 4 ) multi - organ failures ; 5 ) simultaneous administration of 3 inotropes other than milrinone to increase blood pressure ; 6 ) renal replacement therapies including peritoneal dialysis ; 7 ) myocardial infarctions ; 8) univentricular heart surgeries . however , patients receiving 3 inotropes were included if inotropes were added after an interval of > 2 hours consecutively . patients ' characteristics including age , sex , height , weight , and body surface area were recorded . the following parameters were analyzed to identify the clinical application of milrinone : 1 ) initial infusion rate ; 2 ) maintenance continuous infusion rate ; 3 ) total duration of milrinone therapy ; 4 ) concomitantly infused inotropes . the operation and anesthesiology records of patients who had undergone cardiac surgeries were also studied to identify data related to anatomic diagnosis , type of surgery , time of cardiopulmonary bypass , and time of aortic cross - clamping . systolic blood pressure , heart rate , and echocardiographic data ( the left ventricular internal dimension at end - diastole , ejection fraction , and fractional shortening ) obtained before or immediately after starting milrinone treatment were compared to the values prior to treatment cessation . in cases where appropriate echocardiographic data could not be obtained on the day milrinone treatment was discontinued , echocardiographic data obtained within a week of the treatment endpoint were used . the safety of milrinone was determined based on the occurrence of adverse events such as hypotension , arrhythmia , chest pain , headache , hypokalemia , and thrombocytopenia . hypotension was defined as a sudden decrease in blood pressure within two hours after starting milrinone that necessitated the addition of inotropes or cessation of milrinone . arrhythmia was classified as supraventricular tachycardia , ectopic atrial tachycardia , atrial fibrillation / flutter , accelerated junctional rhythm , junctional ectopic tachycardia , ventricular tachycardia , or ventricular fibrillation . evidence of chest pains or headache during milrinone use were collected from the patient 's chart . potassium levels and platelet counts 24 to 48 hours after starting milrinone infusion were estimated . changes in hemodynamic parameters and echocardiographic data were analyzed using a pairwise comparison test and the wilcoxon signed - rank test . the frequency of hypokalemia and thrombocytopenia after milrinone infusion was analyzed using the mcnemar test . univariate and multivariate logistic regression analysis was used to evaluate the relationships between diverse variables , including the practical use of milrinone and the development of arrhythmia . for statistical analyses , descriptive data are presented as means and standard deviation , whereas categorical variables are presented as proportions . data manipulation and statistical analyses were performed with statistical package for the social sciences ( spss ) 19.0 for windows ( spss inc . , the study protocol was approved by the institutional review board of seoul national university hospital and patient consent was waived due to the study 's retrospective design . in total , 2299 eligible admissions were identified during the study period . of these admissions , a total of 730 admissions ( 684 patients ) met the inclusion criteria and were selected for the present study . twenty - seven patients received milrinone twice and one patient received milrinone thrice after serial cardiac surgeries . most patients ( 715 , 97.9% ) received milrinone to prevent low cardiac output after cardiac surgeries . there were 715 admissions in group a and 15 admissions in group b. the male to female ratio was 5.6:1 . the mean age of patients at the time of milrinone infusion was 0.82 years ( table 1 ) . in total , 429 admissions ( 60% ) in group a underwent cardiac surgeries at less than 3 months of age . the most common cardiac defect was ventricular septal defect in group a ( 42.4% ) , followed by tetralogy of fallot ( 11% ) and coarctation of the aorta with ventricular septal defect ( 6.4% ) ( table 2 ) . accordingly , the most common type of surgery was closure of the ventricular septal defect , followed by repair of tetralogy of fallot and coarctoplasty . in group b , the duration of milrinone treatment ranged from 3 to 64.4 days . in 149 ( 20.4% ) two or more inotropes other than milrinone were used in 425 ( 59.4% ) admissions . the most commonly infused inotrope in group a was dopamine ( 83.4% ) , whereas all patients in group b received dobutamine ( table 3 ) . systolic blood pressure , fractional shortening , and ejection fraction after milrinone treatment were significantly ( p<0.05 ) increased in group a when compared to values obtained immediately after cardiac surgeries . however , there was no significant difference in systolic blood pressure , fractional shortening , and ejection fraction before and after milrinone treatment in group b. in both groups , heart rate was significantly ( p<0.05 ) reduced after milrinone use ( table 4 ) . there were no reports of adverse events in the majority of admissions ( 78.7% ) ( table 5 ) . although diverse arrhythmias occurred in 75 ( 10.3% ) admissions , only 3 ( 0.4% ) required reduction or discontinuation of milrinone infusion to alleviate arrhythmia . two of them developed junctional ectopic tachycardia and one of them developed ectopic atrial tachycardia . one - third of patients in group b as well as approximately 10% of patients in group a developed arrhythmia . in total , 41 ( 58.6% ) of the 70 arrhythmias in group a were classified as junctional ectopic tachycardia , the development of arrhythmia was not influenced by the initial infusion rate , maintenance continuous infusion rate , or duration of milrinone treatment . based on univariate logistic regression analysis of group a data , the following parameters were associated with the development of arrhythmia : male gender , age 3 months , and cardiopulmonary bypass time 180 minutes . multivariate analysis of group a data in - dicated that male gender and cardiopulmonary bypass time 180 minutes influenced the development of arrhythmia . however , the incidence rate did not increase significantly ( p=0.390 ) , which was 108/730 ( 14.4% ) at the initial point and 118/730 ( 16.2% ) at 24 to 48 hours after starting milrinone treatment . thrombocytopenia did increase slightly but significantly ( p=0.039 ) , which occurred in 4/729 ( 0.5% ) at the initial point and 12/729 ( 1.6% ) at 24 to 48 hours after starting milrinone treatment . most patients in group a with thrombocytopenia required only a few platelet transfusions after cardiac surgeries . platelet count was increased and maintained 50000/dl spontaneously in 2 admissions , after 1 platelet transfusion in 6 admissions , and after 2 platelet transfusion in 2 admissions . the cardiopulmonary bypass time ( 249.272.8 minutes vs. 153.170.4 minutes ; p=0.004 ) were significantly longer in group a patients with thrombocytopenia than in patients without thrombocytopenia . the initial infusion rate , maintenance continuous infusion rate , and duration of milrinone treatment were not associated with thrombocytopenia . two patients in group b had a low platelet count due to additional medical illnesses such as hemophagocytic lymphohistiocytosis and fungal infection . in total , 2299 eligible admissions were identified during the study period . of these admissions , a total of 730 admissions ( 684 patients ) met the inclusion criteria and were selected for the present study . twenty - seven patients received milrinone twice and one patient received milrinone thrice after serial cardiac surgeries . most patients ( 715 , 97.9% ) received milrinone to prevent low cardiac output after cardiac surgeries . there were 715 admissions in group a and 15 admissions in group b. the male to female ratio was 5.6:1 . the mean age of patients at the time of milrinone infusion was 0.82 years ( table 1 ) . in total , 429 admissions ( 60% ) in group a underwent cardiac surgeries at less than 3 months of age . the most common cardiac defect was ventricular septal defect in group a ( 42.4% ) , followed by tetralogy of fallot ( 11% ) and coarctation of the aorta with ventricular septal defect ( 6.4% ) ( table 2 ) . accordingly , the most common type of surgery was closure of the ventricular septal defect , followed by repair of tetralogy of fallot and coarctoplasty . in group b , the duration of milrinone treatment ranged from 3 to 64.4 days . in 149 ( 20.4% ) two or more inotropes other than milrinone were used in 425 ( 59.4% ) admissions . the most commonly infused inotrope in group a was dopamine ( 83.4% ) , whereas all patients in group b received dobutamine ( table 3 ) . systolic blood pressure , fractional shortening , and ejection fraction after milrinone treatment were significantly ( p<0.05 ) increased in group a when compared to values obtained immediately after cardiac surgeries . however , there was no significant difference in systolic blood pressure , fractional shortening , and ejection fraction before and after milrinone treatment in group b. in both groups , heart rate was significantly ( p<0.05 ) reduced after milrinone use ( table 4 ) . there were no reports of adverse events in the majority of admissions ( 78.7% ) ( table 5 ) . although diverse arrhythmias occurred in 75 ( 10.3% ) admissions , only 3 ( 0.4% ) required reduction or discontinuation of milrinone infusion to alleviate arrhythmia . two of them developed junctional ectopic tachycardia and one of them developed ectopic atrial tachycardia . one - third of patients in group b as well as approximately 10% of patients in group a developed arrhythmia . in total , 41 ( 58.6% ) of the 70 arrhythmias in group a were classified as junctional ectopic tachycardia , whereas the most common arrhythmia identified in group b was ventricular tachycardia . the development of arrhythmia was not influenced by the initial infusion rate , maintenance continuous infusion rate , or duration of milrinone treatment . based on univariate logistic regression analysis of group a data , the following parameters were associated with the development of arrhythmia : male gender , age 3 months , and cardiopulmonary bypass time 180 minutes . multivariate analysis of group a data in - dicated that male gender and cardiopulmonary bypass time 180 minutes influenced the development of arrhythmia . however , the incidence rate did not increase significantly ( p=0.390 ) , which was 108/730 ( 14.4% ) at the initial point and 118/730 ( 16.2% ) at 24 to 48 hours after starting milrinone treatment . thrombocytopenia did increase slightly but significantly ( p=0.039 ) , which occurred in 4/729 ( 0.5% ) at the initial point and 12/729 ( 1.6% ) at 24 to 48 hours after starting milrinone treatment . most patients in group a with thrombocytopenia required only a few platelet transfusions after cardiac surgeries . platelet count was increased and maintained 50000/dl spontaneously in 2 admissions , after 1 platelet transfusion in 6 admissions , and after 2 platelet transfusion in 2 admissions . the cardiopulmonary bypass time ( 249.272.8 minutes vs. 153.170.4 minutes ; p=0.004 ) were significantly longer in group a patients with thrombocytopenia than in patients without thrombocytopenia . the initial infusion rate , maintenance continuous infusion rate , and duration of milrinone treatment were not associated with thrombocytopenia . two patients in group b had a low platelet count due to additional medical illnesses such as hemophagocytic lymphohistiocytosis and fungal infection . in the present study , we reviewed the current patterns of milrinone use that continued for 3 days . of a total of 2299 eligible admissions in which milrinone was used , 730 ( 31.8% ) admissions involved the use of milrinone for 3 days . although the korean national insurance covers only 35 hours of milrinone use , we found that milrinone was frequently prescribed for a longer duration in actual settings , suggesting a significant off - label use . the frequent use of milrinone in pediatric patients undergoing heart surgery was supported by the findings of the prophylactic intravenous use of milrinone after cardiac operation in pediatrics ( primacorp ) trial , which demonstrated that low cardiac output syndromes could be prevented by high - dose milrinone infusion after pediatric cardiac surgeries.10 ) although the initial and maintenance milrinone infusion rates determined in the present study were lower than those previously reported in the primacorp study , our values were similar to those reported in other european practices.4)10 ) in terms of efficacy issue , fractional shortening and ejection fraction were both improved after milrinone infusion in group a patients , which is in consistent with previous findings.9)11 ) chang et al.9 ) reported that milrinone treatment in neonates with low cardiac output after congenital heart surgery improved the cardiac index without changing myocardial oxygen consumption . duggal et al.11 ) documented that milrinone therapy improved the left and right myocardial performance index , a reliable index that reflects myocardial contractility . our findings revealed no significant changes in fractional shortening and ejection fraction after milrinone infusion in group b , which is in contrary to previously reported data in adults.12 ) the severity of the disease in group b is likely to have some influence on the results . seven ( 46.7% ) of the 15 admissions in group b involved patients who died due to underlying cardiac disease itself , reflecting the severity of disease in group b. in terms of safety , several adult studies have shown detrimental effects of milrinone on hemodynamic stability in chronic heart failures . the prospective randomized milrinone survival evaluation13 ) trial revealed that oral administration of milrinone to patients with heart failure increased mortality and induced serious adverse cardiovascular events including hypotension . the outcomes of a prospective trial of intravenous milrinone for exacerbations of chronic heart failure trial reported that sustained hypotension requiring additional treatment was more common in patients who received milrinone infusion for exacerbation of chronic heart failure.14 ) however , in the present study , only 1 ( 6.7% ) of 15 admissions in group b needed a reduction in milrinone dose due to a decrease in blood pressure , with the incidence of hypotension being lower than that reported previously in adult data . furthermore , only 3 ( 0.4% ) of the 715 admissions in group a experienced hypotension that required a reduction in milrinone infusion rate . this result was in consistent with previous pediatric data that reported an infrequent occurrence of hypotension in the milrinone treatment group after cardiac surgery.10 ) milrinone use has been known to be associated with postoperative arrhythmia in adults that increased mortality and morbidity after cardiac surgery.15 ) arrhythmia is a concern following milrinone use in the pediatric population as well . smith et al.16 ) recently reported that approximately half of the pediatric patients receiving milrinone after cardiac surgery experienced arrhythmia . in the present study , various arrhythmias occurred in 70 ( 9.8% ) of 715 admissions in group a. however , only 3 ( 0.4% ) admissions required modification of milrinone infusion to manage arrhythmias . our finding is in consistent with that from other studies,17)18 ) indicating that the incidence of arrhythmia due to milrinone use in pediatric patients is relatively low after cardiac surgery . postoperative arrhythmia is associated with age , cardiopulmonary time , aortic cross clamping time , and type of repair.19)20 ) in the present study , the initial infusion rate , maintenance infusion rate , and duration of milrinone treatment were not associated with the development of arrhythmia . however , in consistent with the previous findings , a longer cardiopulmonary time affected the development of arrhythmia in group a ( table 6 ) . junctional ectopic tachycardia is the most common type of arrhythmia after cardiac surgery.20 ) in the present study , the incidence rate of junctional ectopic tachycardia in group a was 5.7% . this result is in accordance with previous studies , which reported that the incidence rate of junctional ectopic tachycardia after cardiac surgery range from 1.4% to 14.7%.21)22 ) the relationship between junctional ectopic tachycardia and milrinone use has not been elucidated thus far.23 ) a study in adults showed that atrial arrhythmia developed more frequently in patients with chronic heart failure who received milrinone treatment.14 ) however , the independent cause - effect relationship of milrinone with arrhythmia in pediatric patients with heart failure has not yet been established . five ( 33.3% ) of the 15 admissions in group b involved patients who mainly developed ventricular arrhythmia . in the present study , there was no significant difference in initial infusion rate , maintenance infusion rate , or duration of milrinone treatment between patients with or without arrhythmia in group b. in fact , heart failure due to myocarditis or dilated cardiomyopathy itself increased the vulnerability of the patients to tachyarrhythmia and conduction disturbance.24 ) ichikawa et al.25 ) reported that 3 of 7 patients with fulminant myocarditis developed ventricular tachycardia or ventricular fibrillation . friedman et al.26 ) also documented the high incidence rate of arrhythmia in pediatric idiopathic dilated cardiomyopathy . the incidence rate of thrombocytopenia in the present study was lower than that in previous studies . ten ( 1.4% ) of the 715 admissions in group a involved patients who developed thrombocytopenia after milrinone treatment , which required a few platelet transfusions . ramamoorthy et al.17 ) previously reported that milrinone treatment resulted in a high incidence ( 58% ) of thrombocytopenia ( platelet count < 100000/dl ) that did not often necessitate platelet transfusions . bishara et al.18 ) further documented that 12.7% of admissions developed thrombocytopenia with milrinone treatment . however , it is difficult to identify milrinone - induced thrombocytopenia , because various factors could confound the observations , including the cardiac surgery itself . cardiopulmonary bypass is known to be associated with thrombocytopenia that results from hemodilution and mechanical disruption.27 ) in the present study , patients who developed thrombocytopenia had a longer cardiopulmonary bypass time and aorta - clamping time . thus , patients with a more complex heart disease and longer bypass times during cardiac surgery would be more likely to develop thrombocytopenia . in contrast to amrinone , the first phosphodiesterase inhibitor used that was known to have adverse effect on platelets , milrinone did not alter platelet count or function in patients after cardiac surgery.28 ) the fact that two ( 13.3% ) patients in group b developed thrombocytopenia could be due to complications such as hemophagocytic lymphohistiocytosis and fungal sepsis , rather than due to milrinone use . the utility of chronic continuous milrinone infusion for heart failure as bridge therapy to heart transplantation was proposed in a recent adult study.6 ) mcmahon et al.29 ) demonstrated that long - term support with milrinone was safe and effective in infants with cardiomyopathy awaiting heart transplantation . outpatient continuous parenteral inotropic therapy , including milrinone , has also been used in inotropic - dependent children with advanced heart failure.30 ) although these studies used small patient populations , the incidence of complications was sufficiently low to indicate the safe and effective potential of milrinone use in infants and children with heart diseases . this study had a retrospective design which did not have a control group containing patients who did not receive milrinone . moreover , all arrhythmias could not be included due to the study 's retrospective nature . furthermore , because the exclusion criteria of this study were relatively strict to appropriately clarify the efficacy and safety of milrinone use and reduce confounding factors , the patients who would be more susceptible to milrinone use could not be included . in surgically treated patients with congenital heart disease , we should have also considered the natural improvement of cardiac function after the corrective operation , which could be a confounding factor for evaluating the efficacy of milrinone use in this study . finally , only a few echocardiographic data including ejection fraction and fractional shortening were used to evaluate milrinone efficacy due to the retrospective study design . if other echocardiographic data , such as tissue doppler imaging findings , were available , a more accurate evaluation of the hemodynamic effects of milrinone would have been possible . this is the largest retrospective study , to date , to evaluate the safety and efficacy of long - term milrinone use ( 3 days ) in pediatric patients with cardiac diseases . such long - term milrinone use is common in actual clinical practice , and milrinone is generally used for > 35 hours in infants and children with heart disease . our data revealed that the use of milrinone for 3 days was effective in preventing low cardiac output after cardiac surgery when combined with other inotropes . this study had a retrospective design which did not have a control group containing patients who did not receive milrinone . moreover , all arrhythmias could not be included due to the study 's retrospective nature . furthermore , because the exclusion criteria of this study were relatively strict to appropriately clarify the efficacy and safety of milrinone use and reduce confounding factors , the patients who would be more susceptible to milrinone use could not be included . in surgically treated patients with congenital heart disease , we should have also considered the natural improvement of cardiac function after the corrective operation , which could be a confounding factor for evaluating the efficacy of milrinone use in this study . finally , only a few echocardiographic data including ejection fraction and fractional shortening were used to evaluate milrinone efficacy due to the retrospective study design . if other echocardiographic data , such as tissue doppler imaging findings , were available , a more accurate evaluation of the hemodynamic effects of milrinone would have been possible . this is the largest retrospective study , to date , to evaluate the safety and efficacy of long - term milrinone use ( 3 days ) in pediatric patients with cardiac diseases . such long - term milrinone use is common in actual clinical practice , and milrinone is generally used for > 35 hours in infants and children with heart disease . our data revealed that the use of milrinone for 3 days was effective in preventing low cardiac output after cardiac surgery when combined with other inotropes .	background and objectivesmilrinone is often used in children to treat acute heart failure and prevent low cardiac output syndrome after cardiac surgery . due to the lack of studies on the long - term milrinone use in children , the objective of this study was to assess the safety and efficacy of the current patterns of milrinone use for 3 days in infants and children with heart diseases.subjects and methodswe retrospectively reviewed the medical records of patients aged < 13 years who received milrinone for 3 days from january 2005 to december 2012 . patients ' characteristics including age , sex , height , weight , and body surface area were recorded . the following parameters were analyzed to identify the clinical application of milrinone : initial infusion rate , maintenance continuous infusion rate , total duration of milrinone therapy , and concomitantly infused inotropes . the safety of milrinone was determined based on the occurrence of adverse events such as hypotension , arrhythmia , chest pain , headache , hypokalemia , and thrombocytopenia.resultswe assessed 730 admissions ( 684 patients ) during this period . ventricular septal defects were the most common diagnosis ( 42.4% ) in these patients . milrinone was primarily used after cardiac surgery in 715 admissions ( 97.9% ) . the duration of milrinone treatment varied from 3 to 64.4 days ( 7 days in 149 admissions ) . ejection fraction and fractional shortening of the left ventricle improved in patients receiving milrinone after cardiac surgery . dose reduction of milrinone due to hypotension occurred in only 4 admissions ( 0.5% ) . although diverse arrhythmias occurred in 75 admissions ( 10.3% ) , modification of milrinone infusion to manage arrhythmia occurred in only 3 admissions ( 0.4% ) . multivariate analysis indicated that the development of arrhythmia was not influenced by the pattern of milrinone use.conclusionmilrinone was generally administered for 3 days in children with heart diseases . the use of milrinone for 3 days was effective in preventing low cardiac output after cardiac surgery when combined with other inotropes , suggesting that milrinone could be safely employed in pediatric patients with heart diseases .
You are an expert at summarizing long articles. Proceed to summarize the following text: researchers in many biological fields are often confronted with classification problems concerning biological sequences . for example , analyzing promoter sequences often requires the classification in transcription factor binding sites and background sequence parts ( 1,2 ) . for a given set of exons or splice sites one might be interested in predicting which of these are alternatively spliced ( 3,4 ) . state - of - the - art machine - learning approaches extract various features from these sequences and perform classification on the feature vectors instead of the original sequences . bayesian networks ( bn ) have recently attracted considerable attention for data modeling and classification ( 5,6 ) since they can cope with features of various value ranges and can learn dependencies between features . bns have been successfully used for modeling of gene expression to derive genetic regulatory networks ( 79 ) , for discovering pathogenic snps ( 10 ) , for identifying missing enzymes in metabolic pathways ( 11 ) , for protein folding ( 12 ) , genetics and phylogeny analysis ( 5 ) , as well as for predicting the effect of missense mutations ( 13 ) . another large and rather new application area of bns are biological sequence data ( 2,1417 ) . compared to profile hidden markov models ( hmms ) ( 18 ) , which are often used to model conserved sequence families such as protein domains as in the pfam database ( 19 ) , they allow for more modeling flexibility w.r.t . first , they allow a more flexible scheme of dependencies between variables . in profile hmms , in contrast , multiple dependencies are allowed in bns , and there is no fixed ordering of the variables . this has been shown to be especially important to model regulatory like tf binding sites ( 14 ) . second , bayesian network allow to integrate arbitrary features , which is not possible for hmms . this has been shown to be important to integrate structural properties in the recognition of regulatory sequence ( 2,20 ) . and third , the network structure ( i.e. the set of all dependencies to be considered ) must be given as an input to profile hmms , whereas they are automatically learned in the bn approach . to the best of our knowledge , there is no web - based application of bn modeling that is tailored to the analysis of biological sequences . to facilitate the use of bns in this context this web application allows to perform a wide spectrum of analysis from automatic feature generation and selection , to bn learning and application of the learned model to new input data and for probabilistic inference . furthermore , biobayesnet accepts any user - defined features as input , which extends its application range to various scientific areas . in this section , we briefly describe the methods applied by biobayesnet in the order in which they occur in the processing chain . a feature is a measurable property of a single input data sample ( e.g. an input sequence ) . each feature has its own set of possible values which we denote as the feature range . for each feature , there is a well - defined feature value for each single input data sample . given that a class label is assigned to each input sample , biobayesnet tries to detect exactly that feature subset which is optimal in predicting the class label of so far unseen samples . the typical usage of biobayesnet assumes that the user defines a large bunch of features which might be useful for characterizing sequences of the different classes . for each sequence the value of every feature is calculated leading to a feature vector for each sequence . all further processing of the user input only requires the feature vectors , not the sequences . the next step is the search of a subset among all defined features which is optimal with respect to its ability to discriminate between feature vectors of different classes . for this purpose we apply the sequential feature subset selection algorithm ( sffs ) ( 21 ) which searches the space of feature subsets with respect to a special quality measure . starting from an initially empty subset , this algorithm successively adds that feature which best improves the quality measure . after each insertion step the algorithm deletes previously added features as long as this does not worsen the quality measure . these deletion steps are necessary for avoiding the search path being trapped in local optima since the whole set of defined features can contain redundant features . for instance , a single feature which has been added in the last step could perform better together with another selected feature and make a formerly selected third feature dispensable . the algorithm stops if neither insertion of another feature nor the deletion of features can improve the quality measure . in order to calculate the quality of a particular feature subset we perform a 10-fold cross validation . successively , 90% of the feature vectors are used to learn a bayesian network classifier . for the remaining 10% of the samples this value expresses the strength of evidence given by a feature vector for predicting its own class . finally , we obtain the quality measure value by summing up the information loss for the 10 runs of the cross validation . the core of biobayesnet is the probabilistic modeling of the resulting feature subset in bayesian classifiers ( bcs ) ( 22 ) which is a special class of bns . in general , a bn is a graphical representation of the joint probability distribution over a set of random variables . each feature f is represented by a discrete random variable which defines a probability distribution over the feature range of f. formally , a bn is a pair b = ( g , p ) . its first component g is an annotated directed acyclic graph whose vertices correspond to random variables f1 , f2 , it contains probability parameters pfi \| fi = pb ( fi = fi \| fi = fi ) for each possible value fi of random variable fi and each configuration fi of the set of parent variables fi . thus , a bn b defines a unique joint probability distribution over all concerned random variables f = { f1 , f2 , , fd } given by beside random variables for the features , a bc also contains an additional variable , the class variable c , which is parent of every feature variable . obviously , the range of this class variable is the set of the different class labels c1 , , ck . for a given feature vector f = f1 , , fd ( i.e. observations of values for all considered features ) , a bc classifies with respect to the conditional probabilities of having a sample of class ck . thus , class c is predicted so that we further restrict the structure ( i.e. the edges ) of the bn in allowing at the most one parent feature variable for each feature . these specially structured networks are called tree - augmented networks ( tan ) ( 21 ) . the restriction is done due to the higher robustness of the learning procedure when confronted with small data sets and the existence of efficient structure learning algorithms for this subclass of bns . learning a bayesian classifier from a set of feature vectors comprises two steps : ( i ) the structure learning and ( ii ) the probability parameter estimation . for structure learning , we apply the algorithm chow and liu ( 23 ) which reduces that problem to the finding of a minimal spanning tree using the conditional mutual information content ( mic ) between the distributions of two features as edge weights . to avoid the insertion of edges between features which only show weak correlation we slightly have modified this procedure by setting up a mic threshold and only including edges with weights above this threshold . once the structure of the network is determined , the ( conditional ) probability distributions over the feature values of each feature given the class label and optionally the value of the parent feature are estimated straightforward from count statistics derived from learning data . since the usage of bns requires that there do not occur zero probabilities , we use dirichlet priors for smoothing the probability distributions . the conditional probability in the previously illustrated bc - decision rule is an instance of what is called bayesian inference , the querying of probabilities for some variable value in presence of observed values for other ( not necessarily all ) variables . it is one advantage of bns that such queries ( marginalizations ) can be approximately calculated by efficient algorithms . in biobayesnet optionally , one may specify a subsequence ( for example , a protein binding site within an entire promoter sequence ) which allows to use relative positions in the next step . to generate the features from these sequences , the user is redirected to step 1.2 , where the server allows the selection of a wide range of features . there are five main groups of features : nucleotides at particular positions : features of this group all have the same range , namely the four different nucleotides . a nucleotide feature for position i is the analogue of the ith column of a position weight matrix ( pwm).dna structural parameters which express the sequence - dependent local variation of geometrical or physiochemical dna properties at a subsequence . examples are the average helical twist between two base pairs , the dna bendability or the average melting temperature of the subsequence . a feature value for a subsequence is calculated as the mean of all dinucleotide steps in this subsequence . we provide 38 different dna properties that can be calculated from a user - defined subsequence.rna single - strandedness measures the probability for a given rna subsequence to be completely single - stranded ( i.e. not part of a secondary structure ) . for that we use rnaup from the vienna rna package ( 27).subsequence nucleotide contents : these features measure the fraction a subset of nucleotides in a user - defined subsequence . an example is the fraction of pyrimidines in the subsequence from position 10 to 20.consensus matches : features of this group decide whether there is a match of a given subsequence to a given consensus sequence . nucleotides at particular positions : features of this group all have the same range , namely the four different nucleotides . a nucleotide feature for position i is the analogue of the ith column of a position weight matrix ( pwm ) . dna structural parameters which express the sequence - dependent local variation of geometrical or physiochemical dna properties at a subsequence . examples are the average helical twist between two base pairs , the dna bendability or the average melting temperature of the subsequence . a feature value for a subsequence is calculated as the mean of all dinucleotide steps in this subsequence . we provide 38 different dna properties that can be calculated from a user - defined subsequence . rna single - strandedness measures the probability for a given rna subsequence to be completely single - stranded ( i.e. not part of a secondary structure ) . subsequence nucleotide contents : these features measure the fraction a subset of nucleotides in a user - defined subsequence . an example is the fraction of pyrimidines in the subsequence from position 10 to 20 . consensus matches : features of this group decide whether there is a match of a given subsequence to a given consensus sequence . features of all groups can be restricted to particular subsequences or positions in the sequences . if a subsequence is specified the positions refer to a location relative to the subsequence . for example , position -5 refers to the 5 nucleotides upstream of the start of the specified subsequence . features of groups 2 , 3 and 4 describe continuous properties of sequences . in order to derive a finite feature range , the continuous ranges are discretized using the entropy - based , supervized discretization algorithm by fayyad and irani ( 28 ) . this procedure finds a partition of the continuous range which best separates the different classes . the second possibility is to input user - given feature vectors for each data sample in c4.5 format ( 29 ) . this allows full flexibility as the user can input any prior computed feature . for example , one might input pre - computed features about protein sequences and/or structures to analyze protein data . the first file contains the class labels and feature names with possible feature values , whereas the second file contains the data samples ( table 1 ) . table 1.an example of user - given feature vectors describing potentially discriminative features of alternatively and constitutively spliced exonsfile 1 : class labels and feature namesfile 2 : data samplesalternative , constitutive.3.4 , 100 , high , yes , alternative.donor_splice_site_score : continuous.5.7 , 67 , medium , no , alternative.exon_length : continuous.7.4 , 167 , high , yes , alternative.flanking_intron_conservation : high , medium , low.13 , 231 , low , no , constitutive.length_divisible_by_3 : yes , no.9.5 , 189 , medium , yes , constitutive.7.8 , 345 , low , no , constitutive.the first line of the first file has to contain the class labels ( alternative and constitutive ) . the features are given in the order of the first file and the class label is given at the end of each line . an example of user - given feature vectors describing potentially discriminative features of alternatively and constitutively spliced exons the first line of the first file has to contain the class labels ( alternative and constitutive ) . the features are given in the order of the first file and the class label is given at the end of each line . after the data input , the user can select which features are used to learn the bn ( step 2 ) . apart from manual selection , this process is assisted by an automatic feature selection method ( see methods section ) , which selects the most discriminative features from all generated or user - given features . this step also provides an overview of the value ranges and the empirical probability distribution . the selected features are used in the next step ( step 3 ) to learn a bayesian classifier with tan structure . after learning , this includes two quality measures ( information loss function and the average posterior probability for the correct class ) and the final classification of the input data . furthermore , the power of the individual features is estimated by computing the loss of quality if this feature is omitted during learning . the server also produces a graphical representation of the network structure , which allows the exploration of learned dependencies between the features ( figure 2 ) . figure 2.graphical overview of a bn and the dependencies between feature variables . besides this graphical overview , an interesting information is the distribution of a single feature , given particular values for some of the other features ( variables ) . to this end , our tool allows to set some variables to particular values and query the a posteriori probability distribution of another variable given this setting . furthermore , one can view the feature values for each data sample and how these samples were classified by the bn . the final bn can be downloaded as a file in the bayesian interchange format ( bif ) to use it for further data classification or to use it in bayesian network software such as javabayes ( 30 ) . in the next optional step ( step 4 ) , if a bn has been learned in advance , the server also allows classification after the upload of the bn in bif format . in each case , the user has to upload new input data ( either fasta sequences or feature vectors ) . after the data input , the user can select which features are used to learn the bn ( step 2 ) . apart from manual selection , this process is assisted by an automatic feature selection method ( see methods section ) , which selects the most discriminative features from all generated or user - given features . this step also provides an overview of the value ranges and the empirical probability distribution . the selected features are used in the next step ( step 3 ) to learn a bayesian classifier with tan structure . this includes two quality measures ( information loss function and the average posterior probability for the correct class ) and the final classification of the input data . furthermore , the power of the individual features is estimated by computing the loss of quality if this feature is omitted during learning . the server also produces a graphical representation of the network structure , which allows the exploration of learned dependencies between the features ( figure 2 ) . figure 2.graphical overview of a bn and the dependencies between feature variables . graphical overview of a bn and the dependencies between feature variables . besides this graphical overview , an interesting information is the distribution of a single feature , given particular values for some of the other features ( variables ) . to this end , our tool allows to set some variables to particular values and query the a posteriori probability distribution of another variable given this setting . furthermore , one can view the feature values for each data sample and how these samples were classified by the bn . the final bn can be downloaded as a file in the bayesian interchange format ( bif ) to use it for further data classification or to use it in bayesian network software such as javabayes ( 30 ) . in the next optional step ( step 4 ) , the user can classify new input data using the learned bn . if a bn has been learned in advance , the server also allows classification after the upload of the bn in bif format . in each case , the user has to upload new input data ( either fasta sequences or feature vectors ) . the user interacts with this application via html pages which are dynamically generated using java server pages ( jsp ) . input given by the user is directed to java servlets which validate the input and generate objects which are conducted to the algorithmic layer of the application . the servlets further take the result objects of the algorithmic layer and redirect it to java server pages which again produce html output for the user . as a java - based web application , the implementation of the bns and related algorithms partly rely on third - party apis , namely javabayes ( 30 ) and jbnc ( 32 ) . we have developed the web server biobayesnet that enables an easy use of bayesian network models for the analysis of biological sequence data . we are working on extending the set of automatically generated features , especially to include protein - related features and a greater variety of rna structural features .	biobayesnet is a new web application that allows the easy modeling and classification of biological data using bayesian networks . to learn bayesian networks the user can either upload a set of annotated fasta sequences or a set of pre - computed feature vectors . in case of fasta sequences , the server is able to generate a wide range of sequence and structural features from the sequences . these features are used to learn bayesian networks . an automatic feature selection procedure assists in selecting discriminative features , providing an ( locally ) optimal set of features . the output includes several quality measures of the overall network and individual features as well as a graphical representation of the network structure , which allows to explore dependencies between features . finally , the learned bayesian network or another uploaded network can be used to classify new data . biobayesnet facilitates the use of bayesian networks in biological sequences analysis and is flexible to support modeling and classification applications in various scientific fields . the biobayesnet server is available at http://biwww3.informatik.uni - freiburg.de:8080/biobayesnet/.
You are an expert at summarizing long articles. Proceed to summarize the following text: a 5-year - old boy was admitted to a district hospital with diagnosis of a right hydrocele . patient never had any respiratory problems and was taken up for surgery , but at the time of induction of anesthesia , the patient developed severe respiratory distress , so operation was postponed . later , chest x - ray done showed a dense homogenous opacity at left middle and lower zone , arising from the left paracardiac region [ figure 1 ] . x - ray of thorax revealing large mass in left mediastinum computed tomography ( ct ) scan of the chest revealed a well - defined hypodense moderately enhancing non - calcified posterior mediastinal mass ( 4.9 4.6 6 cm ) in the left paravertebral region [ figure 2 ] . magnetic resonance imaging ( mri ) of the chest showed no extension of the tumor into the spinal canal [ figure 3 ] . thus , excision of the mass was done by left posterior lateral thoracotomy [ figure 4 ] . thirteen months after surgery , he is asymptomatic with normal radiology . computed tomography scan of thorax showing mass in the left posterior mediastinum region mri of thorax showing posterior mediastinal mass with no spinal extension excised specimen of posterior mediastinal mass	ganglioneuroma is a rare benign neurogenic tumor which represents the final maturation stage of neuroblast tumors . here , we are discussing an interesting case of incidentally detected posterior mediastinal ganglioneuroma which should be kept in mind when dealing with any child with respiratory distress .
You are an expert at summarizing long articles. Proceed to summarize the following text: infants born small for gestational age ( sga ) are at increased risk of perinatal morbidity , persistent short stature and metabolic alterations in later life1 ) . although approximately 70%90% of sga infants show catch - up growth during the first years of life , individuals born sga may continue to have a short stature in adulthood23 ) . the fetal origins hypothesis states that sga children have a higher risk of developing metabolic syndrome ( mets ) later in adult life4 ) . there have been many recent reports of metabolic alterations in sga children in later life , even in adolescence . in this report the definition of sga has been variably set at the 3rd or 10th percentile , or at less than 2 standard deviations ( sds ) from the mean . weight below the 10th percentile is used by neonatologists because it captures those at risk of perinatal morbidity and mortality5 ) . the incidence of sga births in each country is not exactly known , because birth anthropometric data and gestational age are rarely recorded in most national databases6 ) . the prevalence of sga ( 11.4% ) in the 5th korean national health and nutrition examination survey 201020117 ) , conducted on korean adolescents , is similar to that of other countries , including japan , norway , and the united states , using weight below the 10th percentile to define sga8910 ) . fetal growth depends on oxygen supply and blood vessel formation in the placenta as well as endocrine regulation of cellular expansion . the etiology of most sga births remains unknown ; however , several factors involving the fetus and placenta have been evaluated6111213 ) . maternal factors include poor nutrition , chronic disease and infections61314 ) , as well as potential environmental toxins ( e.g. , smoking and alcohol consumption ) . paternal factors including diabetes may also contribute to being born sga15 ) . among these causes , lack of nutritional supply to the fetus is believed to be the primary cause of reduced fetal growth16 ) . between 3% and 10% of all live neonates worldwide are born sga . the majority of infants born sga experience catch - up growth in the first few months , followed by a normal pattern of development . catch - up growth of infants born sga mainly occurs from 6 months to 2 years and approximately 85% of sga children will have caught up by age 2 years2171819 ) . sga children are at high - risk of developing permanent short stature , and 10% continue to fall below the 3rd percentile of height into adulthood20 ) . we reported significant positive relationships between birth weight ( bw ) for gestational age and the current height - standard deviation score ( sds ) and weight - sds in adolescents aged 1018 years in korea7 ) . the growth hormone / insulin - like growth factor ( gh / igf ) axis has a major role in promoting human fetal growth , as well as growth during infancy and childhood . mean serum levels of igf1 and igf - binding protein-3 of sga children at birth are known to be around 1 sd lower than for appropriate for gestational age ( aga ) births . however , the serum levels of igf1 of sga children at later ages are contradictory . some reports showed that sga children have a higher igf1 level than aga children after catch - up growth2122 ) . recently , igf1 gene deletions , point mutations , and polymorphisms have been described in populations born sga2425 ) . these long - term abnormalities of igf1 in sga may be implicated in the association with metabolic disease in later life222326 ) . general postnatal growth pattern can be divided into three phases : infancy , childhood , and puberty . failure of growth in any of these phases can reduce growth potential and eventually cause adult short stature2728 ) . sga children who fail to catch up do not reach their target height range , and remain short throughout childhood and into adulthood2172930 ) . the finding of higher basal gh levels suggested hypersecretion as a factor in early catch - up growth31 ) . on the other hand , bw , birth length , gestational age , and midparental height puberty in sga tends to have a normal or slightly early onset3032 ) , although age at menarche seems to be within the normal range32 ) . small variations from the normal pubertal growth pattern have been reported3334 ) , but overall the final height prognosis in short children born sga does not seem to be altered by the time of onset and/or progress of puberty293334 ) . being born sga without adequate postnatal catch - up growth is a condition responsible for short stature in childhood and reduced adult height35 ) ; for adults with short stature , 22% were reported to be born sga , if based on birth length2 ) . mets is often referred to as the combination of central obesity , impaired glucose tolerance or overt type 2 diabetes mellitus , dyslipidemia , and hypertension36 ) . for children , there are slight differences in the definition and basic criteria for mets ( table 1)5 ) . excess visceral fat is strongly associated with free fatty acid ( ffa ) release and high ffa concentration can induce insulin resistance in muscle and the liver . visceral adipose tissue is also prone to inflammation and inflammatory cytokine production , which contributes impairment in insulin signaling . the " thrifty phenotype " hypothesis suggests that the fetus adapts to an adverse intrauterine environment giving rise to changes in insulin sensitivity and a predisposition to type 2 diabetes in later life4 ) . the " fetal salvage " hypothesis also indicates the association between abnormal insulin sensitivity and a characteristic of subjects with intrauterine growth retardation37 ) . in 1962 , neel38 ) suggested that genes promote survival and growth of the fetus in poor prenatal environments and induce the development of insulin resistance , given sufficient nutritional support after birth . recently , several candidate genes have been regarded as contributing factors for developing insulin resistance39 ) . vu - hong et al.40 ) showed the interaction between severe fetal growth restriction and the insulin gene variable number of tandem repeats locus , which were associated with insulin resistance in young adults born sga . recent studies have also focused on the association between bw and later body composition ( table 2 ) . some reports suggest that fetal nutrition , as reflected by bw , may have an inverse programing effect on abdominal adiposity later in life . this inverse association between bw and abdominal adiposity in adults may contribute to insulin resistance . byberg et al.41 ) reported that bw has a negative association with hypertension , insulin resistance and trunk fat in later life . laitinen et al.42 ) suggest sga itself is a risk factor for central obesity in female adults . vaag et al.43 ) indicate that being born sga and with low bw is associated with type 2 diabetes in a nongenetic manner , and programming of muscle insulin action and signaling represents an early mechanism responsible for this association . rasmussen et al.44 ) report that low bw subjects had a significantly higher total abdominal fat mass and a higher proportion of trunk and abdominal fat mass but less leg fat relative to total fat mass . in spite of similar body mass index ( bmi ) and body composition , szalapska et al.46 ) observed a high frequency of mets in polish sga children aged 5 to 9 years . the association of low bw was found to be significantly associated with such components of mets as systolic blood pressure , diastolic blood pressure , triglycerides , insulin level , and insulin resistance , even in healthy japanese high school girls47 ) . children born large for gestational age ( lga ) seem to have a larger body size but harmonic body composition and adequate body fat distribution . being sga at birth could program excess abdominal fat deposition in children , which is a major component in the clustering of cardiovascular disease risk factors defining mets . labayen et al.49 ) reported that impaired fetal growth , measured by bw , may be related to central fat distribution in spanish boys . labayen et al.36 ) also reported that adjusted bw z - score was inversely associated with central adiposity in male and female spanish adolescents . adjusted bw z - score was inversely associated with central adiposity , negatively associated with abdominal regional fat mass index independent of total fat mass , and inversely associated with the subscapular to triceps skinfolds ratio in boys5051 ) . in 2014 , american children with intrauterine growth restriction were reported to have higher waist circumference , higher insulin , higher homeostasis model assessment for insulin resistance ( homa - ir ) , and lower adiponectin levels in adolescence , independent of other childhood and maternal factors52 ) . choi et al.53 ) suggest that the association between low bw and insulin resistance is not mediated by abdominal obesity . size at birth was positively associated with adult height and weight , but shows only weak association with bmi , and is not associated with waist / hip ratio when adjusted for socio - economic and lifestyle factors54 ) . in data we previously reported , the prevalence of mets was 1.2% and there were no differences in mets components between sga and aga or lga groups in 792 korean adolescents7 ) . therefore , further studies are needed on the relationship between being born with low bw and metabolic risk . rapid weight gain during sga infancy seemed to be associated with increased fat mass rather than lean mass5556575859 ) ( table 3 ) . early catch - up growth after sga birth rather than sga itself has been noted as a cardiovascular risk factor in later life60 ) . stevens et al.61 ) reported that catch - up sga children are at high risk of cardiometabolic disease . deng et al.62 ) report that homa - ir of term catch - up sga children is higher than term aga children . in a study on mice , forced catch - up growth after fetal protein restriction was reported to influence the adipose gene expression program63 ) . during recovery from wasting diseases and protein - energy malnutrition in children and adults , dulloo et al.64 ) noted that the insulin resistance seen in sga catch - up growth is related to aforementioned phenomenon . this thrifty " catch - up fat phenotype " may be caused by complex interactions between earlier reprograming and a modern lifestyle characterized by nutritional abundance and low physical activity . the development of this catch - up fat phenotype is a central event that predisposes sga children with catch - up growth to abdominal obesity , type 2 diabetes , and cardiovascular disease65 ) . ong et al.66 ) showed that sga children who showed catch - up growth between 0 and 2 years of age were fatter and had more central fat distribution at 5 years than other children . in sga children , total and abdominal fat mass at 4 years was more closely related to the rate of weight gain between 0 and 2 years than between 2 and 4 years67 ) . leunissen et al.68 ) also report that weight gain during childhood is an important determinant of body composition in young adulthood , whereas birth size is less important . kerkhof et al.69 ) demonstrates that a higher gain in weight for length in the first 3 months of life is associated with a higher prevalence of mets at 21 years , whereas low bw is not . wells et al.70 ) reported associations between rapid weight gain and fat mass in brazilian adolescents . it is not clear whether this is due to low bw itself , rapid postnatal catch - up growth , or a combination of both56 ) . catch - up growth has certain advantages in improved neurodevelopment , enhanced immune function , and final adult height . however , there are also certain disadvantages such as mets , type 2 diabetes mellitus , cardiovascular disease , increased fat mass , and obesity . therefore , early feeding of sga children requires particular caution . in clinical practice , excess weight gain in sga children should be prevented . growth of sga children should be measured every 3 months in the first year , and regular assessment of catch - up fat is necessary . further studies are needed to prevent the complications of sga as well as to develop and promote feeding guidelines for sga children .	infants born small for gestational age ( sga ) are at increased risk of perinatal morbidity , persistent short stature , and metabolic alterations in later life . recent studies have focused on the association between birth weight ( bw ) and later body composition . some reports suggest that fetal nutrition , as reflected by bw , may have an inverse programing effect on abdominal adiposity later in life . this inverse association between bw and abdominal adiposity in adults may contribute to insulin resistance . rapid weight gain during infancy in sga children seemed to be associated with increased fat mass rather than lean mass . early catch - up growth after sga birth rather than sga itself has been noted as a cardiovascular risk factor in later life . children who are born sga also have a predisposition to accumulation of fat mass , particularly intra - abdominal fat . it is not yet clear whether this predisposition is due to low bw itself , rapid postnatal catch - up growth , or a combination of both . in this report , we review the published literature on central fat accumulation and metabolic consequences of being sga , as well as the currently popular research area of sga , including growth aspects .
You are an expert at summarizing long articles. Proceed to summarize the following text: the concept of endometriosis is based on histological confirmation of ectopic implants of glands and/or endometrial stroma sensitive to hormones but not including those located in the myometrium.123 the pathogenesis of the disease is probably multifactorial . retrograde menstruation is the most widespread theory that explains the implants.4 the development of endometriosis from the metaplasia of the pluripotential coelomic epithelium may also serve as an explanation . the disease affects between 8% and 15% of women in childbearing age.56 epidemiological data are conflicting , and clinical manifestations of this illness are usually nonspecific , making the profiles of high - risk patients difficult to establish.27 implants can be unique or may occur in various parts of the body . they are commonly found in the ovaries , fallopian tubes , pouch of douglas , uterosacral ligaments , pelvic peritoneum , uterus , sigmoid colon , rectum , ileum , appendix , bladder , ureter , cecum , rectovaginal septum , and vagina.89101112 the presence of endometriosis in lymph nodes and other sites are less frequent.89131415161718192021 a lesion infiltrating 5 mm or more beyond the peritoneal epithelium is considered deep pelvic endometriosis.22 intestinal endometriosis is the most common extra genital disease that affects between 3% and 37% of women with endometriosis.811 up to 95% of intestinal endometriosis is found in the rectum and sigmoid colon . in addition , it may be present in more than one intestinal segment in 39.1% of patients or be found isolated , without being present in other pelvic sites in 20.6% of cases.8101223242526 deep invasion of the intestinal wall is frequent , with infiltration of the muscularis propria or even of the submucosa . the mucosa is infiltrated in less than 5% of intestinal lesions.92227 intestinal endometriosis is difficult to diagnose and should be considered a severe disease . an adequate diagnosis of deep endometriotic lesions remains a challenge28 and usually occurs only years after the onset of symptoms . the time elapsed from the first complaints until the diagnosis of endometriosis is 7.0 ( range 3.5 - 12.1 ) years.29 the lack of specific signs and symptoms can lead to errors in diagnosis and treatment.73031 even for cases showing signs , symptoms , and/or tests suggestive of endometriosis , other intestinal diseases , such as intestinal malignant neoplasm , should be ruled out to avoid delay or wrong medical treatment.171832 the main gynecological clinical manifestations include chronic pelvic pain , back pain , menstrual disorders , and infertility.679182733 among women with endometriosis , up to 60% present chronic , not necessarily cyclic , intestinal symptoms . diarrhea , constipation , tenesmus , nausea , vomiting , fever , anorexia , weight loss , and hematochezia may be present at different intensities.334 even without parietal invasion , an endometriotic lesion adjacent to any intestinal segment may cause digestive symptoms.25 gynecological pelvic exam is considered essential for evaluating the extent of pelvic lesions.35 through vaginal and rectal touch examination , thickening or nodularity in the pouch of douglas , uterosacral ligaments , and/ or the rectovaginal septum is the most significant data.3336 however , the absence of positive signs does not rule out the disease.3738 in the presence of intestinal infiltration , clinical treatment is not effective , and the chronic use of systemic therapy can lead to side effects.7253139 for surgical treatment of symptomatic pelvic endometriosis , laparoscopic surgical resection of all identified lesions is currently the best method of choice.253340 a preoperative map is crucial for the management of the disease.10 at the presence of lesions in intestinal or urinary organs , a gastrointestinal or urologic surgeon is respectively recommended . different surgical approaches are available for intestinal lesions : superficial skinning , partial longitudinal resection ( with linear stapler ) , nodulectomy ( with an endorectal circular stapler or with partial surgical resection of the wall ) , or segmentectomy ( figure 1 ) . the proper choice of surgical technique depends on the extension , position , and depth of the lesion , which must be previously well defined through imaging methods.2833404142 macroscopic aspect of intestinal endometriosis ( segmentectomy of the sigmoid ) . diagnostic tools , including transrectal ultrasound ( trus ) ( figure 2 ) , magnetic resonance imaging ( mri ) ( figure 3 ) , transvaginal ultrasound ( tvus ) ( figure 4 ) , barium enema ( figure 5 ) , and colonoscopy ( figure 6 ) , play significant roles in determining a precise preoperative diagnosis of the disease.18404344454647484950 these data are useful in avoiding unnecessary laparoscopic approaches . moreover , they are used for preoperative prediction and discussion of surgical plan , as well as possible complications with the patient ( table 1).51 endometriotic infiltrating lesion in the intestinal wall ( trus ) . main questions to be defined preoperatively for a better treatment ( surgical or clinical ) plan51 mri is very useful in the complete evaluation of the pelvis ( pelvic floor , bladder , ureter , and muscles ) . it is the best option for the evaluation of ovarian endometriosis and for the accurate diagnosis of deep implants in the intestinal wall or rectovaginal septum.4344 due to low cost and easy access , several authors pointed out that tvus should be the first examination for the diagnosis of various gynecological diseases , including intestinal endometriosis.464852 barium enema presents 88% of sensitivity in the detection of deep intestinal lesions ; however , its specificity is very low ( 54%).3545 colonoscopy provides specific signs of endometriosis in only 50% of deep intestinal lesions , such as subephitelial lesions that promote deformation and reduction of the lumen.53 sometimes , the mucosa that covers the subepithelial lesion presents edema , enanthema , friability , irregularity of surface , and/or vascular patterns.5051 given the high sensitivity and specificity obtained from using different preoperative diagnostic tools , the laparoscopic approach of endometriosis should be reserved for surgical treatment of the disease.54 in gastrointestinal practice , trus is considered the test choice to assess lesions infiltrating the intestinal wall with high accuracy in the determination of depth and histology.25262846535556575859606162 however , trus is not widely used in the management of intestinal endometriosis . this review aims to provide knowledge and references to endoscopic ultrasonographers for the improvement of trus and fine - needle aspiration ( fna ) in the algorithm of the diagnosis of endometriosis . articles in pubmed were searched in english and in french . for relevant clinical points , gynecological and gastrointestinal reference books in english and in portuguese were consulted . for technical review , the literature search was conducted prior to march 1 2012 , not limited to publication year . the keywords used in the pubmed search include the following : endometriosis with transrectal ultrasonography , endoscopic ultrasonography , and endorectal ultrasonography . this review focuses on the accuracy of trus and its comparison with other diagnostic tools for intestinal endometriosis . trus was considered a diagnostic method for detecting the presence of deep rectal endometriosis . initially , we compared preoperative trus with the histology of the specimens obtained during open or laparoscopic surgery . table 2 shows the effectiveness of trus in predicting intestinal infiltration.43444546536364656667686970 studies that evaluated the endometriosis use of endorectal ultrasonography for predicting rectal infiltration of deep pelvic endometriosis in 2007 , bazot et al . compared trus with tvus for the infiltration of the rectovaginal septum and intestinal wall in 81 patients ( table 3).48 tvus was performed without bowel preparation using a 5 to 9 mhz rigid probe , whereas trus was performed using a 7.5 to 12 mhz flexible echoendoscope . transvaginal ultrasonography vs. trus for the diagnosis of deep endometriosis bergamini compared trus with tvus through water contrast in the rectum using a 6.5 mhz curvilinear rigid probe in both examinations . the results include sensitivities of 88.2% and 96% , specificities of 80% and 80% , positive predictive values of 95.7% and 98% , and negative predictive values of 57.1% and 81.8% for trus and tvus , respectively.71 the introduction of mri in the evaluation of patients with endometriosis led to the comparison of this technique with trus . the studies that compared both methods are listed in table 4.4472 comparison between mri and trus for the diagnosis of deep endometriosis in 2007 , bazot compared mri with endoscopic ultrasound ( eus ) for the diagnosis of deep infiltrating endometriosis in different locations for 88 patients . mri performed better than eus , except for the diagnosis of intestinal endometriosis ( table 5).73 comparison between mri and trus performance for the diagnosis of deep infiltrating endometriosis in different locations73 only one article compared the performance of mri , eus , and tvus for the diagnosis of deep infiltrating endometriosis of 92 patients . the results are shown in table 6.74 comparison among mri , trus , and tvs performance for the diagnosis of deep infiltrating endometriosis in different locations74 in terms of technical review , few studies described in detail any special trus technical procedure . most studies performed trus using a 7.5 mhz to 12 mhz radial flexible echoendoscope without special tricks for the procedure . few studies used rigid probes through different techniques and equipment , and only one study used miniprobes . only one detailed description was available for linear rigid probes , and it is summarized below.636465666768697071727374 the patient should be positioned in the left lateral decubitus with flexion of the thighs and legs . first , a deep rectal touch examination should be performed to check for anorectal stenosis and/or nodules in the regions of the anus , rectum , rectovaginal septum , pouch of douglas , cervix , and paracervical regions . subsequently , the rigid probe ( figure 7 ) should be introduced through the anus and immediately pointed to the back of the patient . the probe should then be slid over the sacrum for up to approximately 7 cm to 10 cm in the rectal lumen . at this point , a balloon coupled over the probe is filled with water ( at least 40 ml ) . the probe is then pushed up gently with short up and down movements until the distal sigmoid colon . in this position , the right and left iliac vessels ( figure 8) and sometimes the bifurcation of abdominal aorta can be observed ( figure 9 ) . evaluation of the intestinal wall and surrounding tissues , including pelvic organs and iliac vessels , is performed using movements of introduction , traction , and rotation of the probe on its longitudinal axis ( clockwise and counterclockwise ) , as well as by compression or decompression of the transducer against the wall . hitachi rigid linear probe ( eup u 33 ) used in the study for intestinal endosonography . trus : transrectal ultrasound . to determine the depth of the endometriotic lesions , the presence of hypoechogenic , irregular , homogeneous or heterogeneous lesions , around or infiltrating pelvic structures or the intestinal wall shown in table 7 , only one study proposed a standard classification for the determination of the depth ( figure 11 ) and location ( figure 12 ) of intestinal parietal invasion.7576 trus hypoechogenic and heterogeneous lesions infiltrating the intestinal wall . echo - logic classification of intestinal endometriosis75 echo - logic schematic classification of the depth of intestinal infiltration ( uet1-t5).7576 echo - logic schematic classification according to pelvic site ( uel1-l5).7576 endometriotic lesion uet1 ( trus ) . only five studies employed fna : four retrospectives studies with few cases and one prospective with 97 patients.7778798081 all except one used flexible eus probes for fna without any comment about special techniques . rossini employed the rigid trus - fna technique using a transvaginal probe , with a guide to perform fna ( figure 18).81 according to the author , trus - fna must be performed only in intestinal lesions , which infiltrate , at least , the deep muscular layer ( uet3 ) , avoiding seeding implants in the path of the needle ( figure 19 ) . in addition , the author stated that prophylaxis antibiotic is not necessary because the needle does not pass beyond the thickness of the affected intestinal wall . if the lesion is adherent to a cystic ovarian lesion , fna with cystic penetration must be avoided , and prophylaxis antibiotic is recommended . during the puncture , chiba needles ( 19 or 22 gauge ) , measuring at least 20 cm in length , or flexible standard needles for eus ( 19 or 22 gauge ) can be used with the rigid transducer . rigid probe hitachi eup v-33 and dchn-22 - 20 needle used in the study for trus - fna . endometriosis is a disease affecting women 's health with high prevalence between menarche and menopause.5840 intestinal endometriosis occurs in 3% to 37% of women with endometriosis.8 an appropriate treatment for the disease could be selected by considering essential parameters , such as staging and histological confirmation.128 until recently , the absence of a correct preoperative diagnosis frequently leads to unnecessary surgeries.9 current available imaging examinations provide an accurate preoperative idea of the presence and level of lesions that infiltrate the intestinal wall and other pelvic structures . the most used methods are mri , tvus , colonoscopy , barium enema , and trus.2528324144 comparative studies showed better results by using either turs or tvus in the evaluation of lesions that infiltrate the intestinal wall ( table 3).4852 however , these data should be analyzed with caution because published studies evaluated only selected patients with high probability of deep endometriosis , and sonographers were not blinded about the clinical data of the patients . in addition , most studies did not compare all the different diagnostic methods in the same study . moreover , the type of transducer and the generation of the technology used for trus and other imaging methods vary from one publication to another . the terminology used in most studies does not adopt a standard classification system concerning the depth of intestinal infiltration in layers and topographical distribution in the pelvis . finally , the median size of the lesion is different , and percentage of the circumference of the intestinal infiltration was not mentioned in any paper.26548283 information and uniformity are lacked in the studies ; hence , comparison of data among different diagnostic tools is difficult . therefore , during initial medical investigation , patients following different algorithms according to the main clinical manifestation have three types . patients with predominant gastrointestinal symptoms will naturally follow gastrointestinal algorithms , those with predominant gynecological symptoms will probably follow gynecological algorithms , and those with occasional incidentalomas may follow other algorithms depending on the suspicion on the images . mri has lower sensitivity and specificity than trus and tvus in determining the extent of infiltration on the intestinal wall and does not allow histological diagnosis ( tables 46).43448485 mri has the capacity to evaluate all pelvic organs and has high specificity for differentiating endometriosis from other ovarian cystic lesions . thus , this method is usually performed in all cases of suspected deep pelvic endometriosis , allowing complete mapping of pelvic lesions . in addition , mri may be used in re - evaluating images after the test . hence , we suggest that mri should be the first test in the diagnosis algorithm of deep endometriosis . for cases when mri results show specific sites of endometriosis or are negative , more specific tests focusing on the clinical and mri results ( e.g. , trus for intestinal infiltration ) should be done to obtain adequate data about the lesions . it may also be used in determining the level of infiltration of the rectum , distal sigmoid colon , and rectovaginal septum in patients with deep endometriosis858687 ( table 6).74 in most cases , transvaginal transducers could be placed at an appropriate focal length from the lesion because intestinal endometriotic lesions are usually located near the posterior fornix of the vagina . however , histological diagnosis using tvus - fna still presents limitations , i.e. , the risk of peritoneal and/or vaginal implants in the path of the needle . however , techniques for the evaluation of deep pelvic lesions are not widely used because they require special training , learning curve , and dedicated group of interest . these facts are well exposed in data from clinical practice and literatures . before a correct diagnosis can be achieved , patients have already spent many years ( time elapsed ) and have undergone various tvus.29 barium enema has a low specificity in the diagnosis of infiltration of the intestinal wall and does not allow for histological diagnosis.4588 colonoscopy has a low sensitivity in providing the depth of infiltration of the intestinal wall and can only permit histological diagnosis in 5% of cases.72530318990 nevertheless , up to 60% of patients with deep endometriosis present nonspecific chronic intestinal signs and symptoms.2 thus , in all these cases , colonoscopy is an essential test for ruling out the suspicion of inflammatory and malignant epithelial diseases of the colon and rectum.2794050899091929394 once symptoms indicate colonoscopy , performing colonoscopy and trus in the same procedure with a unique intestinal cleansing and sedation seems to be a better technical and cost effective approach than performing the two methods separately . in gastrointestinal practice , trus is the standard test in determining the depth of invasion of intestinal wall lesions.56 the results obtained in determining the presence , depth , and other data regarding endometriotic lesions of the sigmoid , rectum , and rectovaginal septum justify its clinical application.445372 although less frequent , inflammatory diseases , epithelial and subepithelial neoplasm , or invading extrinsic tumors of the intestinal wall can mimic the sonographic features of endometriosis . although some of these features are nonspecific , they help differentiate the lesions.959697 endometriotic lesions are greater in depth and do not infiltrate the mucosal layer . c format often found in advanced stages of intestinal endometriosis due to fibrosis retraction normally does not occur in malignant diseases.5375 other subepithelial benign lesions usually do not infiltrate more than one intestinal layer . trus is the standard technology for fna in subepithelial and surrounding intestinal lesions.565758 in 2010 , rossini performed trus - fna in 85 patients with suspected endometriotic lesions , characterizing the histological findings of endometriosis in 97%.98 this number established better results than the results of pishvaian that , in a retrospective study , evaluated five patients and obtained histological results of endometriosis in only one case.60 however , in that study , only three patients were operated . therefore , comparison of the results between fna and surgical specimens is impossible . the results of the first study are also higher than those obtained generally in subepithelial lesions of the intestinal wall.565758 the author may have gotten better results because fna was performed with five punctures in each lesion . the hypothetical risk of seeding of these structures was avoided because trus fna was performed without the penetration of the peritoneal cavity , and no other organs were transfixed . in asymptomatic or oligosymptomatic patients , histological confirmation of intestinal endometriosis using trus - fna , a minimally invasive procedure , rules out the diagnosis of neoplasm . although rare , if not diagnosed early , neoplasm can bring about disastrous consequences to the patient . with a correct histological diagnosis , the asymptomatic or oligosymptomatic disease could be safely controlled through clinical and imaging examinations . the same approach is valid in symptomatic patients who do not agree with intestinal resection . after surgical intestinal resections , staplers can lead to an inflammatory reaction and produce an infiltrative process . trus - fna can be useful in post surgical intestinal resections for differentiating the inflammatory process from a recurrence of the disease in the anastomosis region , thereby helping in the therapeutic decision . the possibility of obtaining the histological pattern ( stromal , glandular , and mixed ) and the degree of histological differentiation of the disease ( non - differentiated , well differentiated , and mixed ) before beginning the treatment should stimulate the development of more precise medical therapeutics focusing on this information.99100 in addition , intestinal lesion samples may be used for research on alternative treatments based on immunohistochemical or other available biological markers . therefore , special interest should be placed on this technology as a possible tool to precisely place microparticles of slow - release drugs , such as hormones and/or anti - inflammatory agents , directly at the site of the lesion . the use of stem cells could also be a potential method for conservative treatment at the lesion site of the intestinal disease through fine - needle inoculation .	the widespread use of endoscopic ultrasound has facilitated the evaluation of subepithelial and surrounding lesions of the gastrointestinal tract . deep pelvic endometriosis , with or without infiltration of the intestinal wall , is a frequent disease that can be observed in women in their fertile age . patients of this disease may present nonspecific signs and symptoms or be completely asymptomatic . laparoscopic surgical resection of endometriotic lesions is the treatment of choice in symptomatic patients . an accurate preoperative evaluation is indispensable for therapeutic decisions mainly in the suspicion of intestinal wall and/or urinary tract infiltration , and also in cases where we need to establish histological diagnosis or to rule out malignant disease . diagnostic tools , including transrectal ultrasound , magnetic resonance image , transvaginal ultrasound , barium enema , and colonoscopy , play significant roles in determining the presence , depth , histology , and other relevant data about the extension of the disease . diagnostic algorithm depends on the clinical presentation , the expertise of the medical team , and the technology available at each institution . this article reviews and discusses relevant clinical points in endometriosis , including techniques and outcomes of the study of the disease through transrectal ultrasound and fine - needle aspiration .
You are an expert at summarizing long articles. Proceed to summarize the following text: carcinoembryonic antigen ( cea ) and cytokeratin 19 fragments ( cyfra 21 - 1 ) are the most commonly investigated tumor markers in non - small - cell lung cancer ( nsclc ) . they have been investigated for the purpose of early detection , prognosis stratification , treatment monitoring and selection , and recurrence monitoring . in nsclc , adjuvant platinum - based chemotherapy is considered the standard treatment for stage ii and iii . therefore , a current challenge in nsclc is to identify patients that might benefit from adjuvant treatment . several studies have suggested that cea and cyfra 21 - 1 were independent prognostic factors and good tools for choosing candidates for adjuvant chemotherapy [ 3 - 10 ] . we postulated that cea and cyfra 21 - 1 , which seem to be associated with patient prognosis , might be related to pathologic factors . this study focused on the association between preoperative serum cea and cyfra 21 - 1 levels and pathologic parameters in relation to prognosis in patients with resected nsclc . the records of 982 patients who underwent pulmonary resection of nsclc between january 1999 and december 2006 were reviewed . patients who received preoperative induction therapy and those with histology other than squamous cell , adenocarcinoma , and large cell lung cancer were excluded for the purpose of exact pathologic and histologic correlation . the serum cea level was measured from 1999 and cyfra 21 - 1 was measured from 2004 at severance hospital . the group contained 142 females and 385 males with a median age of 64.0 years ( range , 36 to 82 years ) . the preoperative serum level was measured in 526 patients for cea and 162 for cyfra 21 - 1 . patient evaluation before surgery included medical history , physical examination , chest radiography , and blood tests . computed tomography scans of the chest and upper abdomen , abdominal sonography , and bone scintigraphy were routinely performed . the extent of the primary lesion was carefully assessed , and systematic dissection of all hilar and mediastinal lymph nodes was performed in each case . the institutional review board ( irb ) of the yonsei university college of medicine approved this retrospective study . the need for subsequent individual consent of patients whose records were evaluated was waived because individuals were not identified in this study . blood samples were obtained by peripheral venous puncture on admission to the unit prior to any staging or resection . serum cea or cyfra 21 - 1 levels were measured as part of routine clinical examination . cea was assessed by unicel dxi 800 immunoassay ( beckman coulter , brea , ca , usa ) , and cyfra 21 - 1 by elecsys 2010 system ( boehringer mannheim , mannheim , germany ) according to the manufacturer 's instructions . serum levels < 5.0 ng / ml were defined as normal for cea and < 3.3 ng / ml for cyfra21 - 1 . the mean serum cea and cyfra21 - 1 levels for each variable were compared using a t - test or one - way analyses of variance ( anova ) . the association between serum cea and cyfra 21 - 1 levels was examined for variables that had p - values of less than 0.05 in a t - test or one - way anova using multiple linear regression analysis . the tumor size and cyfra 21 - 1 level were analyzed as continuous variables in multiple linear regression analysis . the records of 982 patients who underwent pulmonary resection of nsclc between january 1999 and december 2006 were reviewed . patients who received preoperative induction therapy and those with histology other than squamous cell , adenocarcinoma , and large cell lung cancer were excluded for the purpose of exact pathologic and histologic correlation . the serum cea level was measured from 1999 and cyfra 21 - 1 was measured from 2004 at severance hospital . the group contained 142 females and 385 males with a median age of 64.0 years ( range , 36 to 82 years ) . the preoperative serum level was measured in 526 patients for cea and 162 for cyfra 21 - 1 . patient evaluation before surgery included medical history , physical examination , chest radiography , and blood tests . computed tomography scans of the chest and upper abdomen , abdominal sonography , and bone scintigraphy were routinely performed . the extent of the primary lesion was carefully assessed , and systematic dissection of all hilar and mediastinal lymph nodes was performed in each case . the institutional review board ( irb ) of the yonsei university college of medicine approved this retrospective study . the need for subsequent individual consent of patients whose records were evaluated was waived because individuals were not identified in this study . blood samples were obtained by peripheral venous puncture on admission to the unit prior to any staging or resection . serum cea or cyfra 21 - 1 levels were measured as part of routine clinical examination . cea was assessed by unicel dxi 800 immunoassay ( beckman coulter , brea , ca , usa ) , and cyfra 21 - 1 by elecsys 2010 system ( boehringer mannheim , mannheim , germany ) according to the manufacturer 's instructions . serum levels < 5.0 ng / ml were defined as normal for cea and < 3.3 ng / ml for cyfra21 - 1 . chicago , il , usa ) . the mean serum cea and cyfra21 - 1 levels for each variable were compared using a t - test or one - way analyses of variance ( anova ) . the association between serum cea and cyfra 21 - 1 levels was examined for variables that had p - values of less than 0.05 in a t - test or one - way anova using multiple linear regression analysis . the tumor size and cyfra 21 - 1 level were analyzed as continuous variables in multiple linear regression analysis . the mean serum cea and cyfra 21 - 1 levels prior to surgery were 6.823.1 mg / dl ( range , 0.01 to 390.8 mg / dl ) and 5.412.3 mg / dl ( range , 0.65 to 140.2 mg / dl ) . the serum cea and cyfra 21 - 1 levels were broken down according to clinicopathologic parameters in tables 1 and 2 . serum cea levels were associated with tumor ( t ) stage ( t1 vs. t2 vs. t3/4 , p=0.032 ) and n stage ( n0 vs. n1 vs. n2/3 , p<0.001 ) and histology ( adenocarcinoma vs. squamous cell vs. large cell , p=0.032 ) but not with sex , age , smoking status , or tumor size . t and n stage and histology were analyzed by multivariate analysis to further assess their association with preoperative serum cea levels . multiple linear regression analysis indicated that t ( t3/4 vs. t1 : =8.463 , p=0.010 ) and n stage ( n2/3 vs. n0 : =9.208 , p<0.001 ) and histology ( adenocarcinoma vs. squamous cell : =6.838 , p=0.001 ) were correlated with preoperative cea levels ( table 1 ) . serum cyfra 21 - 1 levels were associated with t stage ( t1 vs. t2 vs. t3/4 , p=0.010 ) , tumor size ( <3 vs. 3 , p<0.002 ) , and histology ( adenocarcinoma vs. squamous cell vs. large cell , p=0.003 ) . these factors were analyzed by multivariate analysis to further assess their association with preoperative serum cyfra 21 - 1 levels . multiple linear regression analysis indicated that tumor size ( =2.579 , p<0.001 ) and histology ( squamous cell vs. adenocarcinoma : =4.420 , p=0.020 ) were correlated with preoperative cyfra 21 - 1 levels ( table 2 ) . the mean serum cea and cyfra 21 - 1 levels prior to surgery were 6.823.1 mg / dl ( range , 0.01 to 390.8 mg / dl ) and 5.412.3 mg / dl ( range , 0.65 to 140.2 mg / dl ) . the serum cea and cyfra 21 - 1 levels were broken down according to clinicopathologic parameters in tables 1 and 2 . serum cea levels were associated with tumor ( t ) stage ( t1 vs. t2 vs. t3/4 , p=0.032 ) and n stage ( n0 vs. n1 vs. n2/3 , p<0.001 ) and histology ( adenocarcinoma vs. squamous cell vs. large cell , p=0.032 ) but not with sex , age , smoking status , or tumor size . t and n stage and histology were analyzed by multivariate analysis to further assess their association with preoperative serum cea levels . multiple linear regression analysis indicated that t ( t3/4 vs. t1 : =8.463 , p=0.010 ) and n stage ( n2/3 vs. n0 : =9.208 , p<0.001 ) and histology ( adenocarcinoma vs. squamous cell : =6.838 , p=0.001 ) were correlated with preoperative cea levels ( table 1 ) . serum cyfra 21 - 1 levels were associated with t stage ( t1 vs. t2 vs. t3/4 , p=0.010 ) , tumor size ( <3 vs. 3 , p<0.002 ) , and histology ( adenocarcinoma vs. squamous cell vs. large cell , p=0.003 ) . these factors were analyzed by multivariate analysis to further assess their association with preoperative serum cyfra 21 - 1 levels . multiple linear regression analysis indicated that tumor size ( =2.579 , p<0.001 ) and histology ( squamous cell vs. adenocarcinoma : =4.420 , p=0.020 ) were correlated with preoperative cyfra 21 - 1 levels ( table 2 ) . cea was mainly elevated in adenocarcinoma and cyfra 21 - 1 in squamous cell carcinoma . tumor markers such as cea and cyfra 21 - 1 have been studied for the purpose of early cancer detection , prognostic stratification , and monitoring of the treatment response and cancer recurrence , although the use of these markers for lung cancer detection or monitoring is not currently recommended or encouraged . the guidelines of the national comprehensive cancer network on nsclc do not include preoperative cea or cyfra 21 - 1 in pretreatment evaluation . adjuvant chemotherapy might be considered the standard treatment in stage ii and iii lung cancer with the evidence that it improves patient survival . stratifying patients who will benefit from adjuvant treatment for stage ib is the current issue . the possible roles of cea and cyfra 21 - 1 in nsclc are expected to stratify the prognosis . several studies have reported that patients with elevated preoperative serum levels of cea and cyfra 21 - 1 had a shorter overall survival compared to those with normal marker concentrations [ 3 - 10 ] . even more tumor marker index ( the square root of cyfra 21 - 1 concentration/3.3 ng / mlcea concentration/5.0 ng / ml ) based on cyfra 21 - 1 and cea was suggested as a prognostic factor in nsclc . however , other studies have found that elevated preoperative serum levels of cea and cyfra 21 - 1 were completely lacking in prognostic value [ 11 - 13 ] . according to our data , elevated cea and cyfra 21 - 1 levels both showed poor prognosis . however , in multivariate analysis , neither had any significance . only well - known prognostic factors such as t and n stage and tumor size were significant ( data not shown ) . based on these findings , we believed that serum levels of cea and cyfra 21 - 1 might be closely correlated with pathologic parameters , which could explain the poor prognosis of elevated cea and cyfra 21 - 1 . we found that the serum cea level was correlated with the t and n stage and cyfra 21 - 1 with tumor size . although it is generally accepted that serum cea and cyfra 21 - 1 levels are associated with more advanced stage [ 6,17 - 20 ] , some studies have suggested that these levels are not always related to tnm stage and their prognostic significance might be due to different mechanisms ; accordingly cea and cyfra 21 - 1 were independent prognostic factors and could be used to stratify prognosis [ 21 - 23 ] . in summary , our results indicate that preoperative serum levels of cea and cyfra 21 - 1 seem to be associated with pathologic parameters . cea was mainly elevated in adenocarcinoma and cyfra 21 - 1 in squamous cell carcinoma . these findings might be helpful in predicting pathologic status in preoperative nsclc but could not provide additional information to predict patient prognosis and develop a treatment plan .	backgroundthis study focused on the association between preoperative serum carcinoembryonic antigen ( cea ) and cytokeratin 19 fragment ( cyfra 21 - 1 ) levels and pathologic parameters in patients with resected non - small - cell lung cancer ( nsclc).materials and methodsthe records of 527 patients who underwent pulmonary resection of nsclc were reviewed . the association between preoperative serum cea and cyfra 21 - 1 levels and variables that had p - values of less than 0.05 in a t - test or one - way analyses of variance was analyzed by multiple linear regression.resultsthe mean serum cea and cyfra 21 - 1 levels prior to surgery were 6.823.1 mg / dl ( range , 0.01 to 390.8 mg / dl ) and 5.412.3 mg / dl ( range , 0.65 to 140.2 mg / dl ) . the serum cea levels were associated with tumor ( t ) and lymph node ( n ) stage and histology . the serum cyfra 21 - 1 levels were associated with t stage , tumor size , and histology . multiple linear regression indicated that serum cea levels were associated with t ( t3/4 vs. t1 : =8.463 , p=0.010 ) and n stage ( n2/3 vs. n0 : =9.208 , p<0.001 ) and histology ( adenocarcinoma vs. squamous cell : =6.838 , p=0.001 ) , and serum cyfra 21 - 1 levels were associated with tumor size ( =2.579 , p<0.001 ) and histology ( squamous cell vs. adenocarcinoma : =4.420 , p=0.020).conclusionserum cea level was correlated with t and n stage , and cyfra 21 - 1 with tumor size . cea and cyfra 21 - 1 showed histologic correlation . cea is mainly elevated in adenocarcinoma and cyfra 21 - 1 in squamous cell carcinoma . these results might be helpful for predicting pathologic status in preoperative nsclc .
You are an expert at summarizing long articles. Proceed to summarize the following text: we established laboratory - based fever surveillance at the 3 clinics providing healthcare in gonaves after the passage of hurricane jeanne . febrile patients ( core temperature 38.5c when first assessed ) were asked to provide blood for a serum sample and thick and thin malaria smears . the attending physician recorded each patient s medical history , conducted a physical examination , and reported the discharge diagnosis and the therapy that was provided . we asked patients to return in 2 weeks so that a convalescent - phase serum sample could be collected . malaria smears were stained and read by using standard methods ( 1 ) at cdc . to diagnose dengue , we used nested pcr and the taqman assay to detect dengue viral rna in serum samples obtained 5 days after onset of symptoms ( 2,3 ) . in addition , we used an immunoglobulin m ( igm ) antibody - capture ( mac)elisa to detect anti - dengue igm antibodies in all serum specimens ( 4 ) at cdc . a result was considered positive when optical density , after comparison to negative serum and control antigen , was > 0.20 . all serum specimens were also tested for the presence of igg antibodies to determine previous exposure to flaviviruses by using an igg elisa . in paired samples , because of cross - reactivity between anti - flavivirus antibodies , we used a microsphere - based immunoassay ( mia ) with a quadratic discrimination analysis ( 6 ) and a plaque reduction neutralization test ( prnt ) to distinguish between infecting flaviviruses . for the prnt , serial dilutions of heat - inactivated serum were incubated with defined amounts of west nile , saint louis encephalitis , and dengue viruses 14 for 2 hours at room temperature . the nonneutralized viral fraction was subsequently adsorbed onto a monolayer of vero cells for 1 hour . the resultant plaques were counted and compared with results for the control virus with no serum . the endpoint of the titration was the highest dilution of serum that reduced the number of plaques 90% compared with the control results . from november 15 through december 22 , 2004 , 116 acutely febrile patients were identified and included in our surveillance . ages ranged from 4 months to 71 years ( median 4 years ) ; 52% were female . seventy - one patients ( 61% ) appeared for treatment with a chief complaint of fever with cough , 35 ( 30% ) had fever with no apparent source , 6 ( 5% ) reported fever with diarrhea , and 4 ( 3% ) reported fever with rash . patients sought treatment a median of 3 days after the onset of fever ( range 028 days ) . in addition to fever , the most commonly reported symptoms were cough ( 77 , 66% ) , abdominal pain ( 57 , 49% ) , and headache ( 56 , 48% ) . thirty - nine patients ( 34% ) had at least 1 clinical sign of dehydration ; 16 patients ( 14% ) were hypotensive on physical examination . the most common clinical diagnoses were upper respiratory infection ( 35 , 30% ) , malaria ( 34 , 29% ) , pneumonia ( 21 , 18% ) , and typhoid fever ( 13 , 11% ) . fifty - eight patients ( 50% ) were treated with oral antimicrobial drugs ; 13 patients ( 11% ) were prescribed chloroquine , and 2 patients ( 2% ) received an antihelminthic drug . of the 116 thick and thin smears , 3 ( 3% ) samples showed a high level of parasitemia with plasmodium falciparum . malaria was suspected in 2 of the patients by their clinical symptoms ; the third patient was thought to have typhoid and was treated with trimethoprim - sulfamethoxazole . two patients ( 2% ) had acute , secondary dengue infections that were confirmed as positive by both igm and igg serologic tests . both patients had a chief report of fever with no source , but malaria was suspected by the attending physician , and 1 patient was treated with chloroquine . we were not able identify dengue viral particles in the serum specimens of these patients . however , 79 patients ( 68% ) were positive for anti - dengue igg , which suggests a high level of flavivirus transmission in this area in the recent past ( figure ) . results of immunoglobulin g ( igg ) elisa for antiflavivirus antibodies among patients exhibiting fever , gonaves , haiti , october 2004 ( n = 105 ) . * two patients ( 2% ) had mia results consistent with acute west nile virus infection . both patients were febrile in the clinic ; 1 was a 13-year - old boy and the other was an infant girl < 1 year of age . in addition to fever , the 13-year - old reported headache and abdominal pain , while cough was reported in the infant . the older child received chloroquine , while the younger child received only acetaminophen for fever control . this surveillance program was established to assess the incidence of vectorborne diseases in the wake of hurricane jeanne . a total of 116 acutely febrile patients had blood drawn to determine whether a mosquitoborne disease was the etiologic agent of fever . our data are consistent with previously published reports , which indicate that the incidence of arboviral infections rarely increases after water - related disasters ( e.g. , floods , hurricanes ) ( 79 ) . however , malaria outbreaks are common in such settings ( 911 ) . despite the absence of an outbreak , specifically , we diagnosed 3 cases of acute malaria , 2 cases of acute dengue , and 2 cases of acute west nile virus infection . we also detected a high seroprevalence of dengue infections in children , which suggests substantial local dengue transmission in the gonaves area in the recent past . the high seroprevalence of dengue and the low smear - positive rate of malaria from our surveillance were consistent with previously reported studies in this region of haiti ( 12,13 ) . the identification of 2 patients with positive west nile virus results in haiti is new . the only other human west nile virus infections identified in the caribbean basin were 1 case reported in a cayman islands resident in 2001 ( 14 ) and 2 cases reported in cuba , 1 in 2003 and the other in 2004 ( 15 ) . have identified west nile virus in bird species native to the dominican republic , located to the east of haiti on the island of hispaniola . the fact that the rate of west nile virus infection was equal to the rate of acute dengue infection among our participants is of concern . moreover , because both viruses can cause a nonlocalizing fever , the potential for confusion with malaria exists . differentiating the cause of acute nonlocalizing febrile illnesses by examining malaria smears before initiating therapy , especially in an area with a history of low smear positivity , is therefore important .	after hurricane jeanne in september 2004 , surveillance for mosquitoborne diseases in gonaves , haiti , identified 3 patients with malaria , 2 with acute dengue infections , and 2 with acute west nile virus infections among 116 febrile patients . these are the first reported human west nile virus infections on the island of hispaniola .
You are an expert at summarizing long articles. Proceed to summarize the following text: influenza a and b cause highly contagious , acute respiratory illness , associated with high morbidity and mortality among persons with underlying diseases . the causes of death in the more severe forms of influenza are ( a ) severe pneumonia with respiratory distress , ( b ) neurological complications , and ( c ) secondary bacterial pneumonia . outbreaks in children units , senior facilities , cancer centers , neonatal units , pulmonary rehabilitation centers , emergency departments , and others have been described . large nosocomial outbreaks in large tertiary referral hospitals that provide care to large numbers of patients with advanced aids have not been frequently described . roosevelt hospital is a large teaching , university tertiary referral hospital in guatemala city , with 850 beds capacity . more than 3,500 aids patients were in followups , and 1561 treated with antiretroviral drugs at the time when the outbreak was detected in march 2006 ; all of whom were at potential risk to develop severe forms of influenza . 35% of the patients have less than 50 cd4 cells / mm and 68% less than 200 cd4 cells / mm , at the time the hiv infection diagnosis is made at roosevelt hospital . the main admission diagnosis in the internal medicine department in the men wards is aids ( on average 25/66 beds are occupied by patients with aids ) . throughout the country mortality rate at the time of the first hospital admission in these advanced aids patients has decreased from 85% to 89% in the pre - haart era ( 19902000 ) , to 18%21% after the year 2000 . rapid dissemination of influenza virus is more likey in closed areas with poor ventilation ( air exchanges less than 6 per hour ) , no policies for health care worker vaccination and suboptimal awareness about the clinical presentation of severe influenza in immunocompromised persons may contribute to the magnitude of the outbreaks . the mortality rates in immunocompromised patient can be high , as we observed in this group of patients , with fulminant pneumonia and respiratory distress as the final cause of death . during the months of february to april 2006 , a large outbreak of influenza a was detected at roosevelt hospital ; health care workers and hospitalized patients were affected in this large teaching hospital in guatemala city . during the first 5 days of the initial suspicion of a possible respiratory outbreak , after 3 consecutive deaths in aids patients who were stabilized for different opportunistic infections , the first results of nasopharyngeal swabs were positive for influenza a virus , with no other pathogens found . the patients had been hospitalized for diagnosis and treatment , developed acute respiratory failure , and died within 1836 hours from the beginning of symptoms ; testing for legionella , rapid antigen test for influenza a , influenza b , and parainfluenza virus in regional or national labs , and cultures for common bacterial causes for nosocomial pneumonia in our microbiology laboratory were negative . an extensive triage and surveillance program in health care workers ( hcws ) was initiated . we could establish that the medical students and the internal medicine residents in the ward had a clinical diagnosis of influenza . we began to test hcw and patients in all internal medicine wards and 3 days after in all wards of the hospital . influenza diagnosis was established by clinical case definition and rapid test for influenza a ; viral cultures and histopathological examination of tissues from dead patients were also instituted . patients were considered as having nosocomially acquired infection if they had been admitted at least 72 hours before the onset of the symptoms . clinical triage was established in the emergency room for the early detection of new influenza cases from the community . interventions to interrupt the transmission were implemented and includedbarrier methods ( n95 masks , respiratory isolation measures , etc . ) and strengthening of hand hygiene , vaccination of healthy health care workers ( hcws ) and furloughing of sick hcw for 3 to 5 days , antiviral use for treatment or prophylaxis of hospitalized immunosuppressed patients , initially with amantadine , and after several failures , and the results of susceptibility tests obtained from collaboration with the us cdc , with oseltamivir , daily active surveillance for early detection of influenza cases in patients and hcw , daily active surveillance for early detection of influenza a cases in new patients before admission from the emergency rooms , no family visits to the internal medicines wards were permitted for 3 weeks , no elective surgery was permitted during the last 10 days of the outbreak . barrier methods ( n95 masks , respiratory isolation measures , etc . ) and strengthening of hand hygiene , vaccination of healthy health care workers ( hcws ) and furloughing of sick hcw for 3 to 5 days , antiviral use for treatment or prophylaxis of hospitalized immunosuppressed patients , initially with amantadine , and after several failures , and the results of susceptibility tests obtained from collaboration with the us cdc , with oseltamivir , daily active surveillance for early detection of influenza cases in patients and hcw , daily active surveillance for early detection of influenza a cases in new patients before admission from the emergency rooms , no family visits to the internal medicines wards were permitted for 3 weeks , no elective surgery was permitted during the last 10 days of the outbreak . patient 1 presented during the first week in march with acute respiratory failure and died within 24 hours . his diagnosis prompted a reevaluation of three recent deaths ; all of whom tested positive in histopathology , resulting in the recognition of the outbreak . in the period from february to april 2006 , 59 hospitalized patients were diagnosed with influenza a ; 19 of them were aids patients ( mortality rate : 71% ) while 5/40 ( 12.5% ) had other underlying diseases including cancer ( 3 ) , severe cardiac failure ( 1 ) , and severe malnutrition ( 1 ) . the final attack rate at one month was 21% in doctors and medical students and 10.5% in other hcws ( figures 3 and 4).a selective emergency vaccination plan was instituted in 5 days : 1,720 of 3,100 hcws ( 56% ) were reached ( figure 1).a daily active surveillance plan for early detection of influenza cases in hospitalized patients and hcw was implemented.after 3 weeks of the implementation of the control plan , deaths were stopped , and after 3 more weeks no more cases were detected in hcw ( figure 2 ) . a selective emergency vaccination plan was instituted in 5 days : 1,720 of 3,100 hcws ( 56% ) were reached ( figure 1 ) . a daily active surveillance plan for early detection of influenza cases in hospitalized patients and hcw after 3 weeks of the implementation of the control plan , deaths were stopped , and after 3 more weeks no more cases were detected in hcw ( figure 2 ) . influenza a can cause a very severe disease , with a high mortality rate in advanced aids patients . the clinical presentation was characterized by the accelerated evolution to death from the beginning of symptoms ( average 50 hours ) and affected mainly the more advanced aids cases , with a mortality rate among this group of 74% , compared with the 12.5% mortality in the non - aids patients . it is important to consider the possibility of influenza in the differential diagnosis in advanced cases of aids that are admitted to the general internal medicine wards , who are under treatment for opportunistic infections and develop acute respiratory distress . the rapid evolution to death and the risk of transmission to other immunosuppressed patients can be stopped , if we implement general isolation measures and use antiviral drugs like oseltamivir as prophylaxis or therapy early in the course of the disease . the protection conferred by the available vaccines is uncertain , and the information in the aids population is limited . all patients had concomitant severe opportunistic infections , but the histopathological findings showed in more than 90% of the patients in whom an autopsy was performed the typical pathology caused by influenza virus in the respiratory epithelium previously described . amantadine failed to protect patients exposed to influenza in the hospital , due to the resistance that was documented during the evolution of the outbreak . the influenza a virus in advanced aids patient could be considered an acute and severe opportunistic infection , that requires rapid actions to limit the negative impact in morbidity and mortality in this population . in addition to these points , several aspects of this outbreak are unique , and they deserved a discussion / comment . few outbreaks of severe influenza have been described in tropical or subtropical regions ; the fact that this one follows the seasonal pattern of the northern hemisphere season is worthy of a comment . this is one of the largest outbreaks in hospitalized patients with advanced aids and highlights the high risk of severe disease and mortality in these patients . several aspects of the control plan instituted have been described as potential control measures for the control of outbreaks . respirators , respiratory precautions , hand hygiene , and early diagnosis and furloughing of health care workers have been described . this plan shows that institution of all the measures may be necessary to control outbreaks . vaccination of health care workers has been advocated but only mandatory programs have achieved 100% compliance . it would be good to know what the rate of vaccination in health care workers in the years after the outbreak has been . it is very urgent to investigate about the role of vaccination in the control of this outbreak , since it takes a few weeks to develop immunity after vaccination . the role of oseltamivir treatment and prophylaxis in the control of this outbreak also deserves some comment . a rapid , comprehensive plan for the control of nosocomial epidemic influenza a outbreaks is essential to limit severe morbidity and mortality in hospitals who attend large immunocompromised populations , including aids patients . a multidisciplinary approach is important to prevent possible future outbreaks , especially with increasing reports of human infection with highly pathogenic avian influenza viruses or other novel viruses that could become pandemic in the near future .	objective . to describe the characteristics and interventions to control a large epidemiological influenza a outbreak . methods . during the months of february to april 2006 , a large outbreak of influenza a was detected , which affected health care workers and hospitalized patients in a large teaching hospital in guatemala city . interventions to interrupt transmission were implemented and included barrier methods ( n95 masks , respiratory isolation measures , etc . ) and enhanced hand hygiene , vaccination of healthy health care workers ( hcw ) , restrictions for patient visits . results . from february to april 2006 , 59 hospitalized patients diagnosed with influenza a. 19 aids patients ( mortality : 71% ) and 5/40 ( 12.5% ) in other diseases : cancer ( 3 ) , severe cardiac failure ( 1 ) and severe malnutrition ( 1 ) . the attack rate at day 20 in doctors and medical students was 21% while in other hcw it was 10.5% . within 3 weeks of the beginning of the plan , deaths were stopped and no more cases in hcw were detected after 3 additional weeks . conclusion . a rapid , comprehensive plan for the control of nosocomial epidemic influenza a outbreaks is essential to limit severe morbidity and mortality in hospitals who attend large immunocompromised populations , including aids patients . hcw regular vaccinations programs are mandatory .
You are an expert at summarizing long articles. Proceed to summarize the following text: titanium ( ti ) and ti alloy are useful material for dental implants due to its biocompatibility and mechanical properties similar to bone.1,2 among ti alloys , ti-6al-4v alloy is considered to be physiologically inert , and to have high mechanical properties such as high strength and high wear resistance.3,4,5 however , metal ions released from ti alloys into body fluids have been reported to be associated with implant failure.6,7,8 coating method has been considered as one approach for preventing and reducing these problems . liu and mattews reported that physical vapour deposition ( pvd ) nitride coatings on ti-6al-4v alloy significantly reduced the corrosion rate and enhanced wear resistance compared to non - coated surface of ti-6al-4v alloy.9 coatings of other non - toxic metals , such as tantalum ( ta ) , niobium ( nb ) and zirconium ( zr ) were also considered to prevent the metal ion release . these non - toxic metals react with oxygen at room temperature , forming a thin coating of metallic oxide surface.10 this coating plays a protective role as a barrier between the metal and host tissues . the use of zr as a biomaterial has increased due to its good chemical and dimensional stability.11,12,13,14 zr has a good corrosion resistance to acid and other chemicals . it was reported that ti - zr alloy showed enhanced cell response.15 recently , several researches have introduced the use of zr or zirconium oxide ( zro2 ) in surface modifications.14,16,17,18 kurell and dahotre showed that zro2 coating on ti-6al-4v alloy led to a phase transformation on the surface and changed the surface roughness.16 they also pointed out that such a physical and chemical transformation by zro2 coating could be effective for cells and tissues . zro2 film on titanium produced by cathodic arc deposition showed enhanced osteoblastic response.17 it was reported that zro2 coating enhanced dental implant osseointegration.18 among various coating techniques including plasma spraying , electrophoretic deposition , chemical vapour deposition and sol - gel method , radio frequency ( rf ) magnetron sputtering produced a smooth , uniform film and did not change surface roughness.19 the thickness of titanium substrate was thinner than other methods.20,21 also , the adhesion strength of coatings obtained by rf magnetron sputtering was 46 mpa , which is expected to be strong enough to endure a torque of 30 ncm . taken together , zr coatings on ti - based metals is thought to increase the life expectancy of surgical implants and prosthesis due to its greater wear and corrosion resistance and its better cell response than pure titanium alloys . however , cell responses to zr coated surface on ti - based metals by rf magnetron sputtering have poorly been studied . thus , the aim of this study was to evaluate on the surface characteristics and the biocompatibility of zr - coating on ti-6al-4v alloy by rf magnetron sputtering . ti-6al-4v discs were fabricated ( 15 mm and 25 mm diameter , 1 mm thickness , provided by the school of materials science and engineering , chonnam university , gwangju , korea ) . all discs were ground with 240 grit silicon carbide papers to remove debris and deposits of surfaces , and then ultrasonically cleaned in acetone and ethanol for 10 minutes each . group ii was a zr - coated surface by rf magnetron sputtering ( zr - coating group ) . the zr deposition by rf magnetron sputtering was performed for 20 minutes at room temperature using l-210hs - f ( anelva corp , kanagawa , japan ) . the power was 100 w , the base pressure was 3 10 pa and the working gas was argon ( ar ) and oxygen ( o2 ) . the inlet flow rate was 100 standard cubic centimeter per minute ( sccm ) . during deposition , the ar flow rate was fixed at 120 sccm and the o2 flow rate was varied from 0 to 30 sccm , which caused a change in the total pressure in the chamber in the range from 1.5 to 1.7 pa . the surface morphology and the surface composition was evaluated using scanning electron microscopy ( sem , s-4700 , hitachi , tokyo , japan ) equipped with energy dispersive spectroscopy ( eds , emax , horiba , kyoto , japan ) . atomic force microscopy ( afm , mnafm-2 , digital instruments , santa barbara , ca , usa ) was used to evaluate surface microprofile and surface microroughness . roughness test was performed in five samples from each group , using an electronic portable surface roughness tester ( diavite dh-7 , asmeto ag , richterswil , switzerland ) . the mean surface roughness was calculated and represented as arithmetical mean roughness ( ra ) . the water contact angle was analyzed using image analyzing software ( surftens qa 3.0 , oeg gmbh , frankfurt , germany ) . the image of the water droplet was captured at 30 seconds of the delivery using image analyzing microscope ( camscope , sometech inc . , the surface energy was calculated using the good & van oss model.22 - s : dispersive component ( lifshitz - van der waals interactions ) - s = 2(s s ) : polar component ( polar interactions , lewis acid - base ) - s : lewis acid , s : lewis base s , s and s were calculated using following equation : l(1 + cos ) = 2[(s l ) + ( s l ) + ( l gs ) ] the equation was calculated from measured contact angle ( ) and known components ( table 1 ) of 3 different liquids , which are known as polar ( distilled water and formamide ) and dispersive components ( diiodomethane ) . the contact angle for each solvent was measured for 3 samples per group , thus the surface energy was calculated for 3 samples per group . potentiodynamic polarization test was performed to analyze the corrosion behavior using a potentiostat ( parstat 2273 , princeton applied research , oak ridge , tn , usa ) . the reference electrode was a saturated calomel electrode , a counter - electrode was a platinum wire , and a working electrode was the exposed surface of the ti-6al-4v and zr - coating discs . the samples were anodically polarized from -1 v to 2 v at a scan rate of 100 mv / min . discs ( 15 mm and 25 mm diameter ) for evaluation of biologic response were placed in the bottom of culture dishes ( 12-well and 6-well , respectively ) , rinsed in 70% ethanol for 3 times , exposed to uv light for 1 hour and airdried in a laminar flow . cultures of mouse mc3e3-t1 cells ( atcc , rockville , md , usa ) were grown in alpha minimum essential medium ( -mem , invitrogen corp . , carlsbad , ca , usa ) supplemented with 10% heat - inactivated fetal bovine serum ( fbs , invitrogen corp . , carlsbad , ca , usa ) , 100 mg / ml penicillin , and 100 mg / ml streptomycin ( invitrogen corp . carlsbad , ca , usa ) at 37 in humidified atmosphere of 5% co2 - 95% air . cells were cultured on samples in 12-well plate at a density of 2 10 cells / ml with -mem containing 10% fbs . after incubation for 1 hour , the dishes were washed with phosphate buffered saline ( pbs , invitrogen corp . , carlsbad , ca , usa ) for three times and fixed with 2.5% glutaraldehyde ( sigma , st . louis , mo , usa ) in 100 mm cacodylate buffer ( sigma , st . samples were dehydrated in ethanol ( 30% , 60% , 95% , and 100% , in order ) , immersed in hexamethyldisilazane ( sigma , st . the extent of cell adhesion and spreading were classified into four stages according to rajaraman et al.23 as follows : stage 1 , rounded cells in initial contact with the surface via a few filopodia ; stage 2 , cells exhibiting centrifugal growth of filopodia ; stage 3 , cells exhibiting cytoplasmic webbing ; and stage 4 , fully spread cells in round or polygonal shape . the number of cells at stage 3 and 4 in 6 random fields on 3 samples per group were counted using sem at a magnification of 500 . the mean number of cells at each stage was expressed as a percentage of the total number of cells present on the samples . the cell proliferation was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ( mtt ) assay ( celltiter 96 aqueous , promega , fitchburg , wi , usa ) using mc3e3-t1 cells at day 1 , 3 and 5 . cells were cultured on samples in 12-well plates at a density of 2 10 cells / ml with -mem medium . the number of viable cells can be estimated from the amount of reduced fomazan product . an enzyme - linked immunoabsorbant assay ( elisa ) plate reader ( versamax , molecular devices , sunnyvale , ca , usa ) was used for the quantification of fomazan accumulation by absorbance at 490 nm . all experiments were performed for 3 times and 4 samples per group were used for each experiment . alkaline phosphatase ( alp ) activity was determined to assess the differentiation of cells using mc3t3-e1 cells at day 7 . cells were grown in 12-well plates at a density of 2 10 /ml with -mem media containing 10% fbs , 40 g / ml ascorbate and 20 g / ml -glycerol phosphate . the mixture was incubated in the oven at 60 for 60 minutes . after 7 days of incubation , alp activity was estimated by measurement of absorbance at 405 nm using a spectrophotometer ( smartspec , biorad , hercules , ca , usa ) . all experiments were repeated 3 times and 2 samples per group were used for each experiment . gene expressions of bone sialoprotein ( bsp ) , collagen type-1 ( col-1 ) and osteocalcin ( ocn ) were evaluated to study the molecular events using reverse transcription - polymerase chain reaction ( rt - pcr ) . mc3t3-e1 cells were grown in 6-well plates at a density of 1 10 /ml in -mem media containing 10% fbs , 40 g / ml ascorbate and 20 g / ml -glycerol phosphate . first - strand cdna was synthesized from rna extracted at day 7 in an amplitron ii thermocycler using superscript ii ( invitrigen , usa ) . louis , mo , usa ) for the amplification of genes used in this study are listed in table 2 . all rt - pcr products were detected by agarose gel electrophoresis . a gel - doc imaging system ( biorad , hercules , ca , usa ) was used for the visualization . these experiments were repeated 2 times and 2 samples per group were used for each experiment . surface roughness , water contact angle , surface energy , cell proportion , cell proliferation and alp activity were evaluated for significant differences between two groups using one - way analysis of the variance ( spss v.22.0 , ibm , armonk , ny , usa ) . fig . 1 shows afm images and sem images of ti-6al-4v and zr - coating group . eds profiles showed peaks of zr in zr - coating group ( inserted figure in fig . profile roughness measurements revealed that zr - coating group was significantly rougher than ti-6al-4v group ( 0.34 and 0.27 mm , respectively , table 3 ) . in cross - sectional view of sem ( fig . 2 ) , the coating produced by rf magnetron sputtering was uniform in the thickness . in addition , the coating combined with the substrate without a gap . there were significant differences in the water contact angle and the surface energy between zr - coating group and ti-6al-4v group ( fig . zr - coating group showed significantly lower water contact angle and significantly higher surface energy ( 71.44 4.40 degree and 40.13 30.02 mn / m , respectively ) than ti-6al-4v group ( 86.39 2.40 degree and 24.06 4.27 mn / m , respectively ) . the polarization curves for ti-6al-4v group and zr - coating group were shown in fig . ti-6al-4v group shows unstable state in comparison with zr - coating group ( arrow heads ) . after that , as the potential ( v ) increases , both groups maintained passive state . at high potential , the result shows that zr - coating group has faster formation of passive film and better stability compared to control group . mc3e3-t1 cells cultured on all samples spread well and present normal osteoblast - like morphology . any difference in cell morphology was not observed between ti-6al-4v group and zr - coating group , showing polygonal - shaped cells with connecting projections on the surfaces of both groups . 6 shows the mean proportion of spreading cells of stage 3 and 4 in ti-6al-4v group and zr - coating group . at 1 hour incubation , the mean proportion of spreading cells of stage 3 was significantly lower in zr - coating group than ti-6al-4v group ( 23% and 56% , respectively , p<.05 ) , while the mean proportion of spreading cells of stage 4 was significantly higher in zr - coating group than ti-6al-4v group ( 77% and 23% , respectively , p<.05 ) . both group showed good cell viability , as shown increased number of viable cells during the culture period ( p<.05 ) . at day 1 , 3 and 5 , zr - coating group showed significantly higher cell proliferation level with respect to ti-6al-4v group ( 136% , 132% and 117% compared to that of ti-6al-4v group , respectively , p<.05 ) . alp activity of zr - coating group significantly increased to 140 % , compared to that of ti-6al-4v group ( p<.05 ) . 9 shows the mrna expression of bsp , col - i and ocn from cells cultured on ti-6al-4v and zr - coating group at day 7 . the genes of bsp and ocn were highly expressed in zr - coating group than in ti-6al-4v group ( approximately 1.2-fold and 2.1-fold , respectively ) , while the gene of col - i showed similar expression in ti-6al-4v and zr - coating group . because the biologic response of bone tissues to implant materials is mediated by implant surface characteristics , such as surface morphology and surface chemistry , surface modification has been reported to enhance the success rate of implant materials.24,25 the key physical properties of implant materials should be remained , while the surface is modified to improve the biologic response between implant and host tissues . the coating technique is well - established as one of surface modifications . among various coating techniques , rf magnetron sputtering method was used in this study , because it has been reported to form a uniform and thin coating layer with excellent bonding strength.19 rf magnetron sputtering has been introduced for calcium phosphate coating on the titanium implant surface . however , there is no study to evaluate the effect of zr coating by rf magnetron sputtering in implant dentistry . thus , the present study was to assess the surface characteristics and the biocompatibility of zr coating on ti-6al-4v alloy by rf magnetron sputtering methods . zr - coating group showed a surface with irregularities , indicating that zr - coating changed the surface topography . the coating uniformly combined with the substrate without a gap , indicating that the deposition by rf magnetron sputtering was successfully performed . the surface roughness of zr - coating group was significantly higher than that of ti-6al-4v group ( p<.05 ) . surface roughness can affect the adsorption of protein and the proliferation of osteoblast cells.26,27 this result can explain the enhanced cell response , such as cell proliferation and alp activity , in this study . high surface energy promote the adhesion of proteins.28 in the present study , zr - coating reduced the contact angle and increased the surface energy . increased surface roughness and the alteration of surface chemical composition are related with these results . this result could help to resolve a concern about metal ions release of ti alloys in body fluids . however , there was a difference in proportions of cells at stage 3 and 4 between groups . the higher proportion of fully - spread cells on zr coating group indicates that zr - coated surface are more cytocompatibile , leading to higher cell proliferation level compared with that of ti-6al-4v group . mtt assay showed cell proliferation increasing from day 1 to day 5 in both groups ( p<.05 ) . zr - coating group had significantly higher proliferation than ti-6al-4v group at day 1 , 3 and 5 ( p<.05 ) . the formation of stable passive layer might have improved biocompatibility , because the passive layer prevents the release of harmful metal ions from discs in culture media . in addition , improved initial cell attachment and cell spreading can result in increased cell proliferation . since alp is associated with bone mineralization , alp activity can be used as a biomarker for the differentiation of osteoblast.29 zr - coating group showed 140% higher alp levels compared to ti-6al-4v group . from the result of alp activity , zr - coating group could increase cell differentiation , thereby enhancing bone apposition on the implant surface . the expressions of bone - associated markers were evaluated by semi - quantitative pcr at day 7 . col - i expression is necessary before mineralized matrix formation . in this study , mrna level of col - i on ti-6al-4v and zr - coating group expressed well . this result indicated that ti-6al-4v and zr - coating group did not inhibit mineralization of mc3t3-e1 cells . bsp and ocn are known to regulate calcification and maturation of osteoblasts.30,31,32 zr - coating group increased the expressions of bsp and ocn . therefore , it can be said that more differentiated phenotype of osteoblasts was cultured on zr - coating group than on ti-6al-4v group . cell response can be affected by surface properties , such as surface topography , surface roughness , hydrophilicity , surface energy and surface chemistry.33 in the present study , zr - coating group showed enhanced cell response , that is increased number of fully - spread cells , increased cell proliferation , increased alp activity and increased expression of bsp mrna and ocn rna . these results can be explained by increased surface roughness , decreased water contact angle and increased surface energy of zr - coating group . modified surface topography and surface chemistry , shown in sem and afm images , can also contribute to enhanced cell response , because it has been reported that surface properties can affect cell attachment and proliferation.28 the limitation of this study is that the experimental time period was short for evaluating the effect of zr - coating on the osseointegration . however , it was sufficient to assess the changes in osteoblast proliferation , differentiation , and maturation , which are important events in bone remodeling . therefore , it can be assumed that zr - coating might enhance bone remodeling . to clarify this , this study showed that zr - coating on ti-6al-4v could enhance the early osteoblast responses , which are important for the subsequent cell interactions and bone healing in vivo . enhanced cell response on zr coating surface could make non - toxic metal coatings on ti-6al-4v alloy suitable for orthopedic and dental implants .	purposethe purpose of this study was to assess the surface characteristics and the biocompatibility of zirconium ( zr ) coating on ti-6al-4v alloy surface by radio frequency ( rf ) magnetron sputtering method.materials and methodsthe zirconium films were developed on ti-6al-4v discs using rf magnetron sputtering method . surface profile , surface composition , surface roughness and surface energy were evaluated . electrochemical test was performed to evaluate the corrosion behavior . cell proliferation , alkaline phosphatase ( alp ) activity and gene expression of mineralized matrix markers were measured.resultssem and eds analysis showed that zirconium deposition was performed successfully on ti-6al-4v alloy substrate . ti-6al-4v group and zr - coating group showed no significant difference in surface roughness ( p>.05 ) . surface energy was significantly higher in zr - coating group than in ti-6al-4v group ( p<.05 ) . no difference in cell morphology was observed between ti-6al-4v group and zr - coating group . cell proliferation was higher in zr - coating group than ti-6al-4v group at 1 , 3 and 5 days ( p<.05 ) . zr - coating group showed higher alp activity level than ti-6al-4v group ( p<.05 ) . the mrna expressions of bone sialoprotein ( bsp ) and osteocalcin ( ocn ) on zr - coating group increased approximately 1.2-fold and 2.1-fold respectively , compared to that of ti-6al-4v group.conclusionthese results suggest that zirconium coating on ti-6al-4v alloy could enhance the early osteoblast responses . this property could make non - toxic metal coatings on ti-6al-4v alloy suitable for orthopedic and dental implants .
You are an expert at summarizing long articles. Proceed to summarize the following text: pheochromocytoma ( pheo ) and paraganglioma ( pgl ) are neural - crest derived neoplasms , primarily found in the adrenal gland with a prevalence of 0.1% to 0.6% in patients affected by hypertension . tumors of adrenal medulla predominantly secrete norepinephrine over epinephrine , instead adrenal medulla normally secretes 80% of epinephrine . hypertension , either paroxysmal or sustained , is the most consistent finding in neoplasms , and the classical triad of symptoms ( headache , palpitations , and diaphoresis ) is present in more than 50% of patients . in severe cases , a patient can present with myocardial infarction , heart failure , pulmonary oedema , arrhythmias , or intrachranial hemorrhage . the coexistence of pheo and parkinson 's disease or parkinsonism is very rare , with only 3 cases reported in literature . a 70-year - old man with history of parkinsonism and diabetes mellitus presented to the specialized center of secondary hypertension , university of rome la sapienza , rome , italy for an evaluation of hypertension and an adrenal incidentaloma that was detected on abdomen ultrasonography ( us ) and confirmed by magnetic resonance imaging ( mri ) ( 3 2 cm round mass with the presence of necrotic areas ; fig . ( a ) magnetic resonance imaging ( mri ) : mass in the right adrenal gland ( 3 2 cm ) with the presence of necrotic areas . ( b ) thorax scintiscan with 123-i metaiodio benzilguanidine ( 123-i - mibg ) showed a severely reduced mibg cardiac uptake , with a heart to mediastinum ( hm ) ratio of 1.38 . ( c ) scintiscan with 123-i metaiodio benzilguanidine ( 123-i - mibg ) shows raised activity within the right adrenal gland . at the age of 67 years the patient begun to exhibit gait deficits and bradykinesia of the left lower limb , followed by stiffness of the trunk and amimica facies and limitation in upward gaze . an 123-i - fp - cit ( dat - scan)-spect showed a reduction in the physiological concentration in brain presynaptic dopamine transporters with consequent reduction of the striatal structures . levodopa and benserazide therapy was started , subsequently replaced with levodopa and carbidopa at a dose of 750 mg per daily . after starting treatment with levodopa and carbidopa , he did not report any complaints of episodic headaches , palpitations , sweating , and chest pain . on examination , patient 's pulse rate was 67 beats min , blood pressure ( bp ) was 160/100 mm hg , with postural drop ( 140/80 mm hg ) . his height was 181 cm , and his weight was 75 kg , with a body mass index of 22.8 kg m. no cardiac murmurs or abdominal bruits were revealed . his average 24-hr - ambulatory - bp ( abpm ) was 130/90 mm hg , with nondipping profile . the ecg was normal and mild left ventricular concentric remodeling was showed by an echocardiography . the patient was under treatment with irbesartan , nebivolol , metformin , levodopa , and carbidopa . routine blood tests were normal except for fasting blood glucose ( 138 mg dl ; normal range 70100 mg dl ) . after replacing nebivolol and irbesartan with nifedipine ( 60 mg per daily ) and doxazosin ( 8 mg per daily ) bp decreased to normal values ( 135/85 mm hg ) , and biochemical tests to determine functional hormone secretion were performed . investigation for adrenal hormones , including low - dose dexamethasone suppression test , plasma aldosterone levels were normal , while 2 repeated 24-hr - urinary metanephrines measurements were elevated ( 721 and 782 g/24 hr ; normal range 20345 g/24 hr ; table 1 ) . endocrinological data considering the probability of adrenal pheo , a 123-i- metaiodobenzylguanidine ( 123-i - mibg ) spect scintiscan was performed ; 185 mbq of 123 i - mibg was i.v . administered and planar images of thorax were obtained at 20 min and 4 hr , while images of abdomen were obtained at 4 and 24 hr . thorax scan showed a severely reduced mibg cardiac uptake , with a heart to mediastinum ( hm ) ratio of 1.38 ( hm cut off : 2 ) , highly suggestive of a parkinson 's disease ( fig . 1b ) ; whereas , abdomen scan revealed raised activity within the right adrenal gland , concordant with the mass ( fig . a surgical consult was requested , and the patient , now diagnosed with pheo , was to undergo a surgical resection ; however , the surgery was postponed , and the patient was prescribed with 4 mg of doxazosin twice a day , followed by 5 mg of nebivolol daily after testing for the adequacy of the -blockade in order to prevent paroxysmal increases of bp during surgery . one month later , with a bp of 135/80 mm hg , the patient underwent a laparoscopic tumor resection . the patient has been in regular follow - up for the 12 months , and in treatment with levodopa and carbidopa in addition to doxazosin ( 4 mg per daily ) . during the follow - up adrenal hormone tests were run ( table 1 ) . office and abpm showed optimal control of bp ( average systolic and diastolic bp 125/75 mm hg ) , and laboratory analysis showed normal values of fasting glicemia ( 89 mg dl ) without metformin treatment . since the introduction of imaging techniques in medical practice , abnormalities of unknown clinical significance were found more often . pathology of adrenal incidentaloma may vary from simple benign cyst or lipoma to adrenal carcinoma . the differential diagnosis of the adrenal mass includes several conditions , such as adenoma , myelolipoma , cyst , lipoma , pheo , hyperplasia , adrenal cancer , and metastatic cancer . in order to differentiate the adrenal mass detected on abdominal imaging studies , this hormonal evaluation can be difficult with patients with comorbidities , or with patients who are prescribed with interfering medications . in this article , we discuss the case of pheo in parkinsonian patient , in treatment with dopaminergic medications , that presented with an adrenal incidentaloma . the first case reported by metha et al is a 59-year - old american man with a 7-year history of parkinson 's disease , presented episodes of sudden severe headaches with neck pain , tachycardia , sweating , and paleness associated with marked elevation of bp . these symptoms suggested a condition of hypercathecolaminism , and even though further tests revealed normal values of plasma and urinary metanephrines , an 123-i - mibg - single photon ct ( spect ) was positive for increased uptake in the left adrenal region concordant with the nodule showed in the mri scan . the histopathological examination , after laparoscopic adrenalectomy , revealed an adrenal medullary hyperplasia . the second case reported by collier et al is about a 63-year - old american man , with a 5-year history of parkinson 's disease and a left adrenal incidentaloma . the urinary metabolities of catecholamines were elevated , and 123-i - mibg confirmed an increased activity within the left adrenal gland . histological examination following laparoscopic surgical excision showed the presence of a composite pheo / pgl / ganglioneuroma . the third case reported by shimodaira et al is about a 75-year - old japanese man , affected by parkinson 's disease and paroxysmal hypertension associated with vague abdominal symptoms and right adrenal mass showed during abdominal us . urine analysis revealed elevated levels of catecholamines and their metabolites , and 123-i - mibg scintigraphy showed increased uptake in the right adrenal gland concordant with computed tomography ( ct ) . after laparoscopic adrenalectomy , histopathological examination analysis of the mass confirmed the diagnosis of pheo . parkinson 's disease is a chronic neurodegenerative disorder characterized by dopaminergic dysfunction and disturbances in neurotransmitter system with motor system disorders including tremor , rigidity , slowness of movement , and impaired balance or coordination . levodopa is converted peripherally to other cathecolamines , such as norepinephrine , epinephrine , and their metabolites , and medications containing levodopa may cause false - positive results in endocrine testing for pheo . the clinical presentation and biohumoral markers of pheo depend on the capacity of the neoplasm to synthesize , metabolize , and release catecholamines and their metabolites into circulation . initial biochemical tests for pheo , recommended by clinical guidelines subcommittee of endocrine society , should include measurements of plasma - free metanephrines or urinary fractionated metanephrines . in fact , traditional biochemical tests , including measurements of urine and plasma cathecolamines , and urinary vanilmandelic acid , may be unreliable because catecholamine secretion in pheo is often episodic or even negligible in asymptomatic patients . the higher diagnostic accuracy of metanephrines can be attributed to continuous intratumoral production and secretion of metanephrines into circulatory compartment . particularly , the measurements of urine metanephrines by mass spectrometry provide excellent sensitivity ( 97% ) and specificity ( 91% ) for diagnosis of pheo . several factors have to be taken into account in order to attain a correct interpretation of biochemical test results . preanalytical factors may affect the results , such as exercise , posture , food , stress , and medications ; these factors may alter production or disposition of catecholamines and their metabolites . particularly , some drugs ( acetaminophen , labetalol , buspirone , mesalazine , sulfasalazine , tricyclic antidepressants , and levodopa ) can interfere analytically or pharmacodynamically with measurements of plasma and urinary catecholamines and metabolites , which may result in false - positive test results . particularly , levodopa causes falsely elevated urine normetanephrine , and it can also cause mildly raised values of urine metanephrines . regarding our patient , the dopaminergic medications ( levodopa and carbidopa ) may have interfered in the measurement of free urinary metanephrines ; as it was impossible to discontinue these medications , we performed determination of urinary metanephrines only . another important data showed in these case report ( comprised our case ) were that in all parkinsonian patients with suspected diagnosis of pheo and in treatment with dopaminergic drugs the 123-i - mibg was performed . the mibg scintigraphy is based on evidence that norepinephrine and mibg have the same mechanisms for uptake , storage , and release . radiolabeled i - mibg demonstrate high uptake both in normal sympathetically innervated tissues , such as the heart and salivary glands , and in tumors that express the neurohormone transporters , specifically those of neural crest and neuroendocrine origin . currently , 123-i - mibg is considered the gold standard in diagnosing these tumors . particularly , 123-i - mibg scintigraphy is used as a diagnostic tool for the detection of pheo . the sensitivity of 123-i - mibg scintigraphy in pheo is reported to be 95% , whereas the specificity is 80% to 90% . however , tumors smaller than 1.5 cm in diameter and with extensive necrosis or hemorrhage may yield false - negative results due to poor uptake of the tracer . only limited reports of false - positive uptake in other lesions have been published , and 1 major cause of false - positive findings is urinary tract retention , since the reagent is excreted in the urine . recently , jacobson et al , in a recent meta - analysis of 123-mibg , concluded that although results in clinical practice will likely be a few percentages lower , the long history of successful use of this technique and the recent prospective clinical trial support that continued utility of 123-i - mibg imaging in the diagnosis and management of patients with pheo . another finding observed in our parkinsonian patient during i - mibg ( spect ) scan was the reduced cardiac uptake of the ligand , which was consistent with the postganglionic sympathetic denervation which is frequent in parkinson 's disease . in fact , in recent years , cardiac scintigraphy with mibg labeled with iodine ( 123-i ) have been used in parkinson 's disease for evaluating noradrenergic activity of myocardium . this method provides a functional analysis of the sympathetic postganglionic pathway to evaluate in vivo the noradrenergic neurotransmission of the heart . in conclusion , a feature of parkinson 's disease appears to be an inverse correlation with all types of cancer excluding malignant melanoma . interestingly , the melanocytes and the cells of the pheo derived both from the neural crest . moreover , these 2 types of cells and neurons of the substantia nigra , ascribed to the pathogenesis of parkinson 's disease , are all pigmented cells . this is the only association in contrast to the finding that neurodegenerative diseases have a lower risk of developing neoplasms .	abstractto evaluate the diagnostic route of pheochromocytoma ( pheo ) in a patient under dopaminergic treatment.a 70-year - old man with parkinsonism and under treatment with levodopa and carbidopa came to our observation for evaluation of arterial hypertension and right adrenal mass discovered incidentally.to evaluate adrenal hormone levels we performed a dexamethasone suppression test , plasma aldosterone levels and 24-hr urinary metanephrine , which revealed elevated levels of catecholamines metabolities . 123-i - metaiodobenzylguanidine spect scintiscan revealed raised activity within the right adrenal gland concordant with the mass . the diagnosis of pheo was posed and an elective laparoscopic adrenalectomy was performed ; histopathological examination confirmed the pheo diagnosis.recently the coexistence of pheo and parkinsonism is a very rare association of diseases , with only 3 cases reported in literature . in this article , another case is reported and diagnostic procedures are discussed .
You are an expert at summarizing long articles. Proceed to summarize the following text: in december 2008 , the journal of cell biology ( jcb ) launched the jcb dataviewer , an online repository for original image data in the life sciences ( fig . 1 ) . to our knowledge , this system is the first open repository that enables routine archiving and sharing of original image datasets supporting published scientific articles . one key attribute of the jcb dataviewer that distinguishes it from past and current data repositories is that the original binary data and metadata , additional information captured by acquisition software about an image , such as the instruments used , acquisition settings , image size , and resolution , are preserved and accessible by the community . as of this writing , the jcb dataviewer contains 6,446 multidimensional ( 5d ; including space , channel , and time ) images in support of 186 published articles . the jcb dataviewer is a customized application based on the open source and open development open microscopy environment ( ome ) remote objects ( omero ) and bio - formats projects , released by the ome consortium ( http://openmicroscopy.org ) . an example of original image data associated with this paper , viewed in the jcb dataviewer . the image shows the following : a 3d stack of a fixed hela cell stained with dapi ( blue ) , anti - incenp ( red ) , and anti - tubulin ( green ) , recorded using a wide - field microscope ; a time - lapse video of a c. elegans embryo expressing gfp - tubulin , recorded using a multiphoton microscope ; a transmission electron microscope ( tem ) image of bacteriophages visualized using negative stain ; a 3d stack of a fixed hela cell stained with anti - tubulin , recorded using an omx 3d structured illumination microscope ; a tem image of rb bound to dna ; and a 5d image of gfp - coilin and yfp - histone h2b in a hela cell , recorded by wide - field microscopy ( platani et al . , 2000 ) . note that available metadata differ substantially between the different images , depending on the metadata that are stored in the original files . these images and their associated metadata are available at http://jcb - dataviewer.rupress.org / jcb / browse/2859/. one goal of the jcb dataviewer was to initiate the development of a functional , scientifically valuable online image repository . the first step was to make original data available alongside a publication , available for examination by reviewers and readers of a submitted or published manuscript . currently , the jcb dataviewer allows access to original data for viewing , simple measurement , and review , but users can not download the original data files , and sophisticated image analysis and querying tools are not included in the application . in the next update , users will be able to download video versions of data stored in the jcb dataviewer , and original image data will be available in an open , standardized data format that preserves the original image metadata ( ome tagged image file format [ tiff ] ) . authors will also retain access to their original data , thereby making the jcb dataviewer an archive where authors can store their own published data . these updates represent one more step toward the development of a fully functional data repository . the data in the jcb dataviewer are freely available to the public immediately upon publication , without a subscription to the jcb . in the future , as image repositories mature , we plan to merge the data held in the jcb dataviewer with whatever resources emerge as the definitive public repository of image data in the life sciences . the jcb dataviewer is one of a growing number of image data repositories that are now available , each focused on providing access not only to results but also to some combination of sophisticated visualization , analysis , and mining of these complex data ( table i and fig . each of these efforts has emphasized specific applications and functionality and reflects the simple fact that the diversity of scientific exploration and images can not yet be addressed by a single resource . however , there are ongoing efforts to align data models where possible , and perhaps most importantly , simplify submission and subsequent processing through the definition and use of file formats that support standardized metadata . these are examples of real progress toward the goals that many have discussed and that have recently been reiterated ( cosepup , 2009 ; field et al . , 2009 ; schofield et al . , scientific image data repositories for cell and developmental biology slif , subcellular location image finder ; pslid , protein subcellular location image database . in development as of 2010 . recommendations for ome compliant image metadata . the image and instrument elements from the ome data model , with attributes and hierarchies shown in diagrammatic form . the image element contains core metadata that can be used for display and processing of the associated binary image data . currently , an ome compliant image completes all of the metadata in the image element . by the end of 2010 , we aim to include the instrument element in the ome compliant specification . the bio - formats library provides support for writing ome - xml either as a stand - alone file or within the header of an ome - tiff file . updates to the ome data model are announced on the project s roadmap site ( http://ome-xml.org/roadmap ) . in summary , significant effort by peer - reviewed , competitively funded groups in the us and europe has produced image informatics tools that the research community uses . the tools and resources are by no means finished , and our current status seems analogous to the state of the genomics resources in the mid-1980 s , when individual authors submitted their own sequence data to genbank , swissprot , and others . the diversity of imaging platforms , experiments , techniques , and data makes this analogy only partially correct and undoubtedly makes the challenge of building and running scientifically useful image repositories harder . regardless , the sophistication of centralized scientific image resources is growing , and as a result , so will the value they deliver to the scientific community . those resources that depend on submissions from the community will require the development , adoption , and use of standardized file formats that support as rich a metadata structure as possible . this is why the development and use of standardized image data and metadata formats are so important . many laboratories have at least one sophisticated imaging system , and many large shared - use facilities provide access to an array of imaging systems . after many years of innovation and development , modern digital imaging systems enable temporally and spatially resolved , multichannel measurement and visualization of molecular and ion concentrations in cells and tissues . emerging imaging techniques such as multispectral , polarization , fluorescence lifetime , and fluorescence correlation are extending the complexity of analysis of biological cells and tissues . however , most digital microscope imaging systems , whether commercial products or laboratory prototypes , are usually run by custom software that saves and processes data using a pff . in general , every new imaging platform comes with a new pff , so rapid advances in imaging simultaneously make data exchange and access more difficult . to realize the dream of open data access and sharing , we first must solve the basic problem of accessing the data contained in pffs . any solution will not directly lead to new scientific insights , but it is a prerequisite for submission to repositories and the discoveries they enable through reanalysis . for example , if the data from cell - based phenotypic screens were available , they could be reanalyzed for aberrations that were not of interest to the investigators who did the original screen . generally speaking , image data are written in formats that include the binary data and the actual image measurement , along with some representation of the metadata : the size of the binary data , its dimensions , acquisition system settings , and any other information that the developer of the acquisition software considered useful . in our experience , storage of binary data in many commercial microscopy formats is based on common formats ( tiff , hdf5 , and ole2 , etc . ) or other formats that most software tools can read ( although there are some notable , extreme exceptions ) . because standards are not yet agreed upon , microscope and imaging companies define their own metadata formats in their pffs , and these are often incompatible with those from competing companies . since 2000 , the ome has been dedicated to building tools for specification , management , and sharing of biological light microscopy data ( swedlow et al . , 2003 , 2009 ; 2 ) , which covers most of the metadata in pffs from many sources and includes most of the fundamental imaging metadata in cell and developmental biology . this specification , used within the context of a tiff file ( ome - tiff ) , provides a simple , easy to use format for microscope imaging data that can be used by any software that reads the tiff file format . a popular tool ( > 13,000 installations worldwide ) is bio - formats , a software library that interfaces with a large number of software tools ( such as imagej ) , enables the reading of > 75 pffs , and supports output to ome - tiff . for many years , the imaging community has expressed a desire to move away from the current ad hoc approach toward more defined standards for metadata representation ( goldberg et al . , 2005 ) . however , creating a reasonable standard takes years of community discussion and effort . for the standard to be successful , it must be widely used and functional enough to be worth the effort of conformance , and it takes time for the snowball effect to occur . given the diversity and rapid evolution of imaging applications in biology , we do nt believe that standards can be mandated by any one entity . instead , we argue that standards for biological imaging must be supported and developed , and once they are valuable for scientific discovery and data sharing , and have demonstrated the ability to rapidly adapt to new technologies , the community must demand the support of these formats in the commercial platforms they purchase . under the umbrella of the ome , we have been collecting community feedback for several years now , and our recommendations for this process are detailed in box 1 . recommendations for use of pffs image metadata must be associated with the binary image data , preferably as a single file . microscope systems must not store metadata in proprietary databases that are available only on the data acquisition system . metadata must be readable by third party software using a common , openly accessible software package or library . pff developers must work with developers of open translation libraries to ensure their format is correctly interpreted . if compression is supported , the user must be given the option of saving uncompressed or losslessly compressed images ( which allows the exact original data to be reconstructed after compression ) . if compression or encryption is used , the algorithm and parameters must be stated and stored in the metadata . commercial software programs must provide data export to an open metadata specification . to ensure that commercial software writes these formats correctly , open public and charity funding for imaging systems must include a requirement that the system writes data in an open , accessible format , wherever possible . when pffs must be used , new versions must be announced to the scientific community , and users and funding bodies must predicate their purchases on this type of support for the scientific community . once a standardized repository is available , journals must require deposition of original data supporting scientific manuscripts . in some cases , however , in our experience with bio - formats , omero , and the jcb dataviewer , most of the data we have seen could be recorded in an open , standardized , multidimensional file format . as the number of imaging systems and the rate of innovation grows , maintaining a tool like bio - formats , simply because commercial vendors do not use standardized file formats , becomes increasingly untenable . reverse engineering is slow and inherently error prone , as metadata stored in pffs are decoded and translated . as popular as bio - formats is , it is time to reconsider the value pffs deliver for a specific commercial product against the costs , which are paid for by public and charity funding : lost time for scientific researchers , inhibited collaborations , and impeded access to data using the aforementioned emerging data repositories . many scientific funding bodies now require the published output from the work they fund to be deposited in open access repositories . the same open access principle should be extended to the data generated through their funding to enable broad dissemination and further analysis . as with other forms of data , there is no requirement to publish all images associated with a paper , just the ones that form the definitive representation of the reported discovery . the ome , international society for advancement of cytometry ( http://www.isac-net.org ) , and digital imaging and communications in medicine ( http://medical.nema.org/dicom/ ) formats are all well developed , supported , and available for use . it may be that no single format can satisfy every requirement or data type , but our experience demonstrates that the vast majority of the data used to support scientific publications can be properly stored in these formats . we can support a range of open file formats with bio - formats , thus allowing interconversion between open file formats where necessary . we have developed the ome metadata standards through extensive direct experience and discussion with the user and commercial developer communities . we plan to use them as we progress to the development of a public repository but remain open to suggestions about how they can be improved . as noted in the box 1 , the use and adoption of these file formats wo nt happen by itself , the community must work to drive their adoption . individual scientists and their funding bodies must require support for these formats when they purchase or fund new imaging systems . the argument for this concerted action is based on a simple , practical goal : scientific data , funded by the public and nonprofit charities , must be publicly available . over the next few years , the technical capabilities in image repositories will mature . data to fill these repositories must be open , accessible , and ready for use .	data sharing is important in the biological sciences to prevent duplication of effort , to promote scientific integrity , and to facilitate and disseminate scientific discovery . sharing requires centralized repositories , and submission to and utility of these resources require common data formats . this is particularly challenging for multidimensional microscopy image data , which are acquired from a variety of platforms with a myriad of proprietary file formats ( pffs ) . in this paper , we describe an open standard format that we have developed for microscopy image data . we call on the community to use open image data standards and to insist that all imaging platforms support these file formats . this will build the foundation for an open image data repository .
You are an expert at summarizing long articles. Proceed to summarize the following text: nevus sebaceous also known as organoid nevus is a hamartoma that is generally found on the scalp at birth . although the nevus as such has an uneventful course , many benign or malignant tumors are known to develop in about one third of the patients with nevus sebaceous . however , apocrine hidrocystoma arising from a sebaceous nevus is rare . a 37-year - old woman with asymptomatic raised hairless lesion over the scalp since birth presented with complaints of change in the morphology of the lesions associated with itching and irritation for the past one month . the patient had not received any treatment for the lesion . there was no history suggestive of any systemic involvement . on examination , multiple well - defined hyperpigmented verrucous plaques coalescing with each other were seen over the right parietal region of the scalp associated with alopecia . a single well - defined soft skin - colored cystic swelling of size 1 2 cm was seen interspersed within the plaque [ figure 1 ] . a clinical diagnosis of nevus sebaceous was made and a biopsy of the nevus and the nodule was done in view of suspected malignancy . biopsy report revealed a large cyst lined by columnar and myoepithelial cells in the dermis . the columnar cells at a few places showed decapitation secretion giving the impression of apocrine hidrocystoma [ figures 2 and 3 ] . post - excision of the cyst , histopathological examination correlated with clinical diagnosis of nevus sebaceous [ figures 4 and 5 ] . cystic lesion arising from the nevus sebaceous over the right parietal region of the scalp h and e ( 10)multiloculated cystic lesion in the dermis lined by epithelium h and e ( 40)double layer of columnar cells with decapitation secretions post nevus excision and double opposing rotation flap h and e ( 10)nevus sebaceous showing multiple immature sebaceous glands in the upper dermis nevus sebaceous , also known as nevus sebaceous of jadasohn or organoid nevus , is a hamartoma comprised predominantly of sebaceous glands . in 1904 , albrecht used the word hamartoma for a tumor that developed due to overdevelopment of some kind of tissue , which normally belonged at the site where it was formed or to any abnormal relationship of a normally situated tissue element . they are cell nests or collection of abnormal number of normal cells that can be epidermal or dermal sebaceous , apocrine , or eccrine . the sebaceous nevus usually presents as a linear , yellow , hairless , waxy , and verrucous plaque . it can be flat at birth but as the person ages , it undergoes surface changes . during puberty , due to the hormonal changes , it becomes thickened , verrucous , or papillomatous . tumors can arise within the nevus sebaceous ; the most common being syringocystadenoma papilliferum and trichoblastoma . tumors arising from nevus sebaceous apocrine hidrocystomas or cystadenomas are benign cystic tumors that arise from the secretory portion of apocrine sweat glands . they usually occur as solitary cystic lesions from the adenomatous cystic proliferation of apocrine glands . the most common sites of predilection are the head and neck with occurrence on the scalp being extremely rare . hidrocystomas may show eccrine or apocrine differentiation with the classical differentiating feature being the presence of secretory cells showing decapitation secretion in case of apocrine hidrocystomas . apocrine hidrocystoma developing from a sebaceous nevus over the scalp is a very rare entity . till date , only three other cases of an apocrine hidrocystoma arising on the scalp have been reported ; this being the first case report from the indian subcontinent . to conclude , apocrine hidrocystoma should be considered as a differential diagnosis for any large cystic subcutaneous mass that occurs on the scalp .	nevus sebaceous is a hamartoma with an uneventful course since birth but many benign or malignant tumors are known to develop in about one third of the patients . a 37-year - old woman with asymptomatic hairless raised lesion over the scalp since birth presented with change in the morphology of the lesions associated with itching and irritation since one month . on examination , multiple well - defined hyperpigmented verrucous plaques coalescing with each other were seen over the right parietal scalp associated with alopecia . a single well - defined soft skin - colored cystic swelling of size 1 2 cm was seen interspersed within the plaque . after a clinical diagnosis of nevus sebaceous , a biopsy of the cyst was done , which revealed a large cyst lined by columnar and myoepithelial cells in the dermis . the columnar cells at a few places showed decapitation secretion giving the impression of apocrine hidrocystoma . post - excision of the cyst , biopsy of the entire nevus was done and the histopathological diagnosis correlated with the clinical diagnosis of nevus sebaceous . apocrine hidrocystoma developing from a sebaceous nevus over the scalp is a rarity with only three other cases of it arising on the scalp being reported and none of them developed from a sebaceous nevus .
You are an expert at summarizing long articles. Proceed to summarize the following text: malignant neoplasm of lymphoid cell is lymphomas which is divided into 2 groups : hodgkin and non - hodgkin . primarily hodgkin 's lymphoma is lymph nodes 's disease , which has been known with the presence of two nuclear cells called reed - sternberg cells and lymphoid stroma composed of many non - neoplastic cells . non - hodgkin 's lymphomas are a group of prevalent neoplasms that originate primarily from lymph nodes , but also extranodeal non - hodgkin 's lymphomas are found that constitute 20 - 40% of non - hodgkin 's lymphomas in usa and approximately half of those in asian countries . the majority of head and neck maxillofacial lymphomas arise in lymphoid tissue , especially the cervical group of lymph nodes and waldeyer 's ring , followed by the vestibule and gingiva , mandible , palatal soft tissue , maxilla , and tongue . non - hodgkin lymphoma generally originates from the two groups b and t lymphocytes 85% of non - hodgkin lymphoma derived from b lymphocytes but t - cell origin tumors are less common . anaplastic large - cell lymphoma ( alcl ) is a subgroup of non - hodgkin malignant lymphoma ( ml ) , originated from t or nk cells that initially described by stein et al . in 1985 . the lesion is characterized by proliferation of anaplastic large lymphoid cells with abundant cytoplasm that strongly express cd30 antigen . primary alcl in the oral cavity is extremely rare , with only 10 other cases known to have been reported . we report a male patient with oral involvement ( posterior of the hard palate ) as the first sign of systemic alcl . we also discuss the clinicopathologic and immunohistochemical profiles compared with those in previously reported cases . a 32-year - old man was referred to the department of oral surgery , dental school of isfahan in 2010 . patient 's chief complaint was swelling and scarring of the posterior hard palate about three weeks before visiting and after the extraction of maxillary left second and third molars . on physical examination , the patient had scar with raised edges and a yellow - white membrane in posterior of the hard palate [ figure 1 ] . the patient declared a history of lymphoma from 1.5 years ago in the neck lymph nodes which diagnosis was anaplastic larg cell lymphoma , that had been receiving chemotherapy . clinical view of the lesion severe alveolar ridge resorption with irregular border were found in left maxilla by an x - ray examination [ figure 2 ] . panoramic view of patient the clinical signs and symptoms of patient raised probability of diagnosis of ulcers caused by chemotherapy and tumor 's metastasis . after that , incisional biopsy was done and was sent to oral and maxillofacial pathology department after embedding in 10% formalin fixative . microscopically , the proliferation of large and bizarre form neoplastic cells with hyperchromatic and angular nuclei , and numerous bizarre tumor giant cells with atypical mitotic figures which had been located between necrotic tissue and degenerated minor salivary glands as seperated foci was seen . surface of this lesion had been covered with the fibrinoleukocyter membrane [ figure 3 ] . histopathological view : proliferation of large and bizzare form neoplastic cells ( h and e , staining 100 ( a ) , 400 ( b ) ) the histologic findings suggested an alcl , and differential diagnoses included metastasis of lymphoma , poorly differentiated carcinoma and malignant melanoma . the antibodies used to determine the definitive diagnosis were included : lca , ck , cd20 , cd30 and cd3 . the following results were obtained [ figure 4 ] : immunohistochemical staining : cytokeratin ( a ) , leukocyte common antigen ( b ) , cd30 ( c ) , cd3 ( d ) based on the immunohistochemical findings , the lesion was diagnosed as an metastatic alcl . the patient was transfered to omid 's hospital of isfahan . despite consecutive follow - up , unfortunately the patient did nt corporate about presenting treatment plan and refused from referring to oral pathology department . non - hodgkin 's lymphomas are a group of lymphoid neoplasms with a wide range of behavior ( some are indolent , some are very aggressive and if untreated can be fatal ) . head and neck area , especially waldeyer 's ring is second common site of non - hodgkin 's lymphoma . in 1985 stein et al . described a series of 45 diffuse large - cell lymphoma strongly expressing the ki-1 antigen ( cd30 ) and exhibiting prominent sinusoidal invasion , most of which had previously been diagnosed as malignant histiocytosis or anaplastic carcinoma . as hodgkin 's disease ( hd ) is also characterized by strong expression of cd30 , a common origin of these two entities was initially proposed . however any relationship between these two entities was then disproved in several different studies . in 1988 , , were included as a new clinicopathological entity in the revised kiel classification under the denomination of large cell anaplastic lymphoma . the alcls are further subdivided into 3 categories according to clinical criteria and immunohistochemistry : ( 1 ) primary systemic anaplastic lymphoma kinase ( alk ) positive alcl ; ( 2 ) primary systemic anaplastic lymphoma kinase ( alk ) negative alcl ; and ( 3 ) primary cutaneous alcl . the alk expression is predominantly caused by a t(2;5 ) translocation genetic abnormality , in which the nucleophosmin ( npm ) gene at 5q35 is translocated with the alk gene at 2p23 , resulting in the formation of p80npm / alk fusing protein . the alk(+ ) alcls usually occur in the first decades of life and are more prevalent in males . they response to chemotherapy and have a good prognosis , whereas the alk ( _ ) alcls occur in elderly individuals ( most common in 6 decade and male predominance ) and have a comparably poor prognosis . common involved extranodal sites include skin ( 21% ) , bone ( 17% ) , soft tissues ( 17% ) , lung ( 11% ) , and liver ( 8% ) , and involvement of the gut and central nerve system is rare . involvement of bone marrow in alcl can be varied from 10 to 40% and depends on a methods of immunohistochemical and morphological study . in addition , in about 50% of extranodal systemic alcl , 2 or more sites are involved . several oral alcl cases have been reported , although some were the b - cell phenotype that now are classified as an anaplastic type of diffuse large b - cell lymphoma , we found only 9 cases of oral alcl reported in the english - language literature ; the mean age of the patients was 54.6 years old ( range 12 to 77 years ) that in comparison with our patient ( 32 years ) were considerably higher and the gender distribution was equal . most reported cases have been occurred in the gingiva and in addition of our patient only one case of oral alcl have been reported in the hard palate . all of the reported patients with oral alcl complained from swelling occasionally combined with ulceration and pain as a first symptom , which made it difficult to distinguish from other oral inflammatory disorders . alcl typically shows a broad spectrum of morphologic features , ranging from small - cell neoplasms to cases with very large and anaplastic cells predominance but almost all the cases , share a common feature , which is the presence of a variable number of so called hallmark cells. these are large cells with abundant cytoplasm and eccentric lobulated horse shoe or kidney shaped nuclei ; an intense eosinophilic region corresponding to the golgi apparatus is seen near the nucleus , and this region is often surrounded by the nucleus itself . the size of the hallmark cells is usually large , but in small - cell variant cases , smaller elements with the same morphologic features can be present . along with these highly characteristic and almost diagnostic hallmark cells , neoplastic elements with different morphology are usually seen . in some cases nuclei multinucleated cells may be present , but cells resembling typical reed - sternberg cells are uncommon . moreover , in alcl nucleoli are smaller than in hd diagnostic cells . in our case , we observed the proliferation of large and bizarre form neoplastic cells with hyperchrome and angular nuclei associated , with numerous bizarre tumor giant cells and atypical mitotic figures which had been located between necrotic tissue and degenerated minor salivary glands as seperated foci . the histologic appearance of an alcl can sometimes be problematic and so confuse with that of a poorly differentiated carcinoma , amelanotic melanoma , or hodgkin 's disease . various immunohistochemical markers have been studied in this neoplasm , including positive staining for cd3 in 57% , cd30 in 100% , and lca in 75% of all cases . in this case , reactivity of tumor cells for lca , cd3 , cd30 , and to a lesser degree cd20 was observed . alcl should be differentiated from other cd30 positive lesions such as malignant melanoma , hodgkin 's lymphoma , anaplastic large b - cell lymphoma . for example , tumor cells in melanoma are positive for s-100 and hmb45 unlike alcl . although alcl is an aggressive tumor , it is responsive well to single or combined chemotraphy with 77% having 5 year survival rate .	lymphoma is a malignant neoplasm of lymphoid tissue which is divided into 2 groups : hodgkin and non - hodgkin . about 85% of non - hodgkin lymphomas are b - cell lymphomas , and t - cell lymphomas are unusual . anaplastic large cell lymphoma ( alcl ) is a kind of non - hodgkin lymphoma with t or nk cell origin that is rarely seen in the oral cavity and only 10 cases have been reported up to now . here we present a case of alcl metastasized to the oral cavity in a 32- year- old man with pervious history of alcl which caused an ulceration in the posterior area of the hard palate . radiography showed irregular resorption of alveolar bone . histopathologic examination of the incisional biopsy revealed neoplastic proliferation of large and bizarre cells with hyperchromatic nuclei and numerous giant cells and atypical mitoses . immunohistochemistry markers ( ck , lca , cd3 , cd30 , cd20 ) confirmed the diagnosis of alcl .
You are an expert at summarizing long articles. Proceed to summarize the following text: forearm rotation occurs around an axis connecting the center of the radial head and the fovea of the distal ulna . various treatments for malunion have been reported , but the optimal method for reduction remains controversial . we planned this study to determine numerical values indicative of healing treatment during deformation of the forearm . we therefore investigated cases in which corrective osteotomy was performed for malunion without dislocation of the elbow or wrist . our hypothesis was that increased differences between the axes of forearm and proximal radius would be associated with increased deterioration of forearm rotational motion . data from patients with corrective osteotomies for malunited forearm fractures without dislocation of the elbow or wrist were reviewed retrospectively . patient demographics were reviewed , including age , sex , and interval between injury and surgery . mean interval between initial injury and surgery was 21 months ( range , 347 months ) . mean duration of follow - up was 12 months ( range , 622 months ) . this retrospective study included eight cases ( 6 men , 2 women ) , and mean patient age was 15 years ( range , 1021 years ) . fracture type was radioulnar shaft fracture in five cases and radial shaft fracture in three cases . initial treatment of forearm fractures comprised conservative treatment in five cases and operative treatment in three cases . pre- and postoperative ranges of motion were obtained from clinical charts . we performed corrective osteotomy of the radius alone in five cases , ulna alone in one case , and both radius and ulna in two cases . intraoperatively , we attempted to restore the normal shape of both bones according to intraoperative fluoroscopic images and anteroposterior and lateral radiographs . we evaluated plain radiographic images using medical image analysis software ( rapideye ; toshiba medical systems , tochigi , japan ) . anteroposterior and lateral radiographs of the forearm were obtained using the same position of forearm rotation ( in the neutral position , if possible ) , with the elbow in 90 of flexion , and the wrist in neutral alignment . two lines were drawn : the axis of the proximal radial head ; and the forearm axis . the angle between these two lines was then measured on both lateral and anteroposterior radiographs ( fig . if the tuberosity of the radius and styloid were not on opposite sides of the bone , we determined malrotation by plain radiography . with the ulna , the coronoid process of the ulna and the ulnar styloid process are normally on opposing sides , so we used this relationship to assess malrotation of the ulna . the longitudinal ( rotational ) axis of the forearm runs from the center of the radial head proximally to the fovea of the distal ulna . the axis of the proximal radius runs between the center of the radial head and the radial neck . proximal radial tilt angle ( ) represents the angle between the rotational axis of the forearm and the axis of the proximal radius . differences in forearm rotation and in radiological assessments were analyzed using the mann - whitney u test . we evaluated plain radiographic images using medical image analysis software ( rapideye ; toshiba medical systems , tochigi , japan ) . anteroposterior and lateral radiographs of the forearm were obtained using the same position of forearm rotation ( in the neutral position , if possible ) , with the elbow in 90 of flexion , and the wrist in neutral alignment . two lines were drawn : the axis of the proximal radial head ; and the forearm axis . the angle between these two lines was then measured on both lateral and anteroposterior radiographs ( fig . if the tuberosity of the radius and styloid were not on opposite sides of the bone , we determined malrotation by plain radiography . with the ulna , the coronoid process of the ulna and the ulnar styloid process are normally on opposing sides , so we used this relationship to assess malrotation of the ulna . the longitudinal ( rotational ) axis of the forearm runs from the center of the radial head proximally to the fovea of the distal ulna . the axis of the proximal radius runs between the center of the radial head and the radial neck . proximal radial tilt angle ( ) represents the angle between the rotational axis of the forearm and the axis of the proximal radius . differences in forearm rotation and in radiological assessments were analyzed using the mann - whitney u test . mean forearm rotation increased from 81 ( range , 0135 ) preoperatively to 138 ( range , 108175 ) postoperatively . mean proximal radial tilt angle improved from 14 to 9.3 , compared to 3.3 on the normal side . postoperative rotation correlated with proximal radial tilt angle , and severe malunion affected the range of forearm rotation ( fig . 2 ) . three patients were considered to show radial malrotation and no patients displayed ulnar malrotation . mean rotation in malrotation cases was 128 17.2 , compared to 145 26.9 in the remaining cases . the forearm is composed of the radius and ulna , which are linked by the interosseous membrane and intercalated between the elbow and wrist . the forearm rotation axis runs through the center of the radial head to the ulnar head , and radial motion around the ulna results in forearm rotation . angular deformity of the forearm affects forearm rotation , so the treatment for malunion of the forearm should be provided by treating the radius and ulna as bones of a joint . although corrective osteotomy can achieve good rotation within 1 year after injury , the factors contributing to clinical results remain unclear and no reports have clarified how deformity of the axis of rotational motion affects forearm rotation . the acceptable range of deformity at initial treatment for fracture remains contentious , particularly in pediatric cases , due to good remodeling ability . our series included skeletally immature cases , but a previous report showed that in diaphyseal fractures , the distal radial epiphyseal plate realigned well only in children under 10 years of age , so our results appear reasonable . some recent papers have reported three - dimensional computed tomography ( 3dct ) and computer - assisted osteotomy for malunion . indeed , we think that malunion of the forearm should be treated in 3d , but we investigated the indicators for corrective osteotomy only on plain radiographs in consideration of radiation exposure and usability . we tried to reduce malrotation , and only three cases showed malunion and the degrees of deformity were mild . differences in each parameter were also relatively small and the small sample size could have limited the statistical power of the analyses . bones , ligaments and soft tissues would affect rotation , but the rigid body element must provide the primary effects on forearm rotation . we evaluated the results of corrective osteotomy for forearm fracture malunion using plain radiography . to improve the range of rotation we think the angle between the axis of rotation of the forearm and the axis of the proximal radius offers a useful indicator for corrective osteotomy .	abstractforearm rotation occurs around an axis connecting the center of the radial head and the fovea of the distal ulna . the purpose of the present study was to demonstrate the usefulness of the difference between forearm and proximal radial axis in the treatment of malunited forearm fractures . we reviewed the results of eight corrective osteotomies for malunited fractures of the forearm without dislocations of the wrist or elbow . subjects were 6 men and 2 women ( mean age , 15 years ; range , 1021 years ) . corrective osteotomy was performed at the fracture site . preoperatively and at final follow - up , the arc of forearm rotation was recorded and anteroposterior and lateral x - rays were taken . proximal radius tilt was defined as the angle between the rotational axis of the forearm and the axis of the proximal radius . corrective osteotomy improved proximal radius tilt in all cases . three patients were considered to have malrotation . postoperative rotational arc correlated with proximal radial tilt ( r = 0.83 ) . no significant difference in rotational arc was evident between malunited cases and the remaining cases . to improve forearm rotation , corrective osteotomy should be planned to minimize proximal radius tilt.key words : forearm fracture , corrective osteotomy , malunion , axis
You are an expert at summarizing long articles. Proceed to summarize the following text: management of a case of incomitant strabismus from a paralyzed or missing extraocular muscle is a major surgical challenge . transposition of functioning muscles into the vector of the deficiency is a standard procedure but is not always an option , such as when those muscles are also abnormal or when anterior segment ischemia is a concern . in such cases alignment in primary position is possible by completely eliminating the function of the antagonist muscle by ( 1 ) fixating it to the orbital wall or by ( 2 ) tethering the globe itself to the periosteum of the orbit on the side of the paralyzed / missing muscle . the aim of this article was to provide an overview of indications and techniques for these two procedures . we reviewed the literature in pubmed and google scholar using the following keywords : globe anchor , periosteal anchor , muscle fixation , fixation procedures of the globe . the two most common indications for these two procedures are oculomotor nerve palsy and co - contraction - retraction syndrome . other indications include congenital fibrosis of the extraocular muscle and other paralytic and restrictive strabismus . the surgical correction of strabismus in cases of complete oculomotor nerve palsy is a formidable challenge since all the muscles are paralyzed except the lateral rectus and superior oblique . transposition procedures of either the lateral rectus muscle or the superior oblique muscle to the medial rectus muscle have been advocated by some surgeons but the results can be unpredictable , and complications and inadequate correction are not infrequent.12345 in addition , lateral rectus transposition may not be possible in cases where the lateral rectus muscle has developed contracture due to longstanding deviation . in such cases , globe fixation to the medial orbital wall periosteum is a viable surgical option . a variety of techniques and use of various materials have been described for this operation . the concept of fixation of the globe to the orbital margin was initially developed with the idea of improving ocular motility where a silicone band was used as an eye muscle prosthesis.67 scott et al . , first used this technique for improving the rotation of the globe in cases of the lateral rectus and superior oblique muscle palsy.6 they used the silicone band to fix the globe to the adjacent periosteum.6 bicas used silicone tubes on the antagonist muscle and fixed it to superior and inferior orbital margin on either side of the midline based on the side of the paretic muscle.7 the silicone tube acted as a sling to maintain alignment in the primary position.7 the band ( or tube ) would stretch on the contraction of the antagonist muscle , and on the relaxation of antagonist , the band would move the eye back to its resting position allowing some ocular rotation.7 among the five cases described by bicas,7 two had third nerve palsy , and three had sixth nerve palsy . although fair postoperative alignment was achieved , the ocular rotation was limited in cases of the third nerve palsy.7 the major concern in such cases is regulation of the strength and tension of the silicone band which is a complicated mathematical exercise . currently , oculomotor nerve palsy is the major indication for anchoring of the globe where the aim is to tether the globe and maintain it fixed in primary position rather than improve ocular motility . various autogenous and allogenous materials have been tried , using either skin , retro - caruncular or precaruncular incisions for accessing the medial orbital wall periosteum for fixation.89101112131415161718 a summary of various techniques for the fixation of the globe is presented in table 1 . various techniques for the fixation of the globe for oculomotor palsy salazar - len et al . , first described the current technique of anchoring the globe to the nasal periosteum in 1994.8 they sutured one end of fascia lata to the medial aspect of the globe and other to the nasal periosteum.8 they used a skin incision to approach the nasal periosteum at the site of the insertion of the medial canthal tendon , where one end of the fascia lata was sutured with 50 silk sutures ; the other end was then passed subconjuctivally and sutured to the insertion of the medial rectus muscle.8 they combined this procedure with the large lateral rectus muscle recession.8 the advantages of fascia lata are that it is well - tolerated and is inexpensive . however , the surgery is time - consuming and leaves a scar over the second site , which can cause complications . additionally , it can not be used in children < 2-year - old . to overcome these drawback , had described the use of the superior oblique tendon as a tethering material for globe fixation.9 they procured approximately 1214 mm of the superior oblique tendon which was fixed with mersilene suture on either side.9 the tendon length adjusted to fixate the globe in primary position in the first few cases.9 however they realized the problem of exodrift and modified their technique to leave the tethered eye in the adducted position.9 they also combined the procedure with the maximal recession of the lateral rectus and resection of the medial rectus.9 an alternative is to use the superior oblique muscle as a tethering material since it can correct the co - existing hypotropia in cases of isolated third nerve palsy and the procedure does not require a second surgical site as in cases of fascia lata . however , the technically challenging part of this approach is procuring a large superior oblique tendon and need for extensive surgery . goldberg et al . , presenting an interesting concept of creating a periosteal flap and using it as tethering material.10 although the previous two methods require the use of permanent sutures to fixate the material on both sides , the use of periosteal flap requires a suture on the scleral side only . the procedure involves making a conjunctival incision in the fornix overlying the paretic muscle . to create a lateral periosteal flap , the dissection is performed through the orbital fat to the lateral rim . to create an inferior periosteal flap , the dissection follows the plane of the lower eyelid retractors to the floor and orbital rim . to create a medial flap , the incision is located at the lateral edge of the caruncle . for superior flap , once the orbital rim is reached , a wide based periosteal flap is created with dissection carried out up to the midway to the orbit . the flap is then secured with a double - armed suture through the tip . the muscle insertion is then exposed and the periosteal flap is then passed through subconjunctival space with the help of a suture and is then attached to the muscle 's insertion . the major limitation of this surgery is the extensive dissection that is required to harvest the periosteal flap . in addition , the flap is friable tissue that may be damaged during the procedure . the other autogenous materials that have been used for tethering are the temporalis fascia11 and the tendon of the medial rectus muscle itself.12 the autogenous materials have their advantages in terms of fewer chances of inflammation and extrusion . however , all the procedures described above require either extensive multiplanar orbital dissection or two - site surgery . this increases the duration of the surgery and increases postoperative inflammation.1012 additionally , there may be a flattening of the medial canthal area and swelling on the nasal conjunctiva that may require conjunctival excision.1012 allogenous materials that have been used for fixation of the globe , other then what we describe above , include a screw system,13 50 polyester suture141516 and titanium t - plate.17 bone anchors and screws have been developed to fixate soft tissue to the bone . advantages include precise placement for vector force determination as fixation is done directly to the bone , and the fact that bone fixation has greater strength compared to periosteum fixation.13 the disadvantages of bone anchors and screws include risk of extrusion , inflammation , infection and progressive loosening.13 some authors have described the successful use of a nonabsorbable suture such as 50 polyester for anchoring the globe directly to periosteum.141516 the orbital dissection required in this procedure is less extensive ( surgical technique presented below ) and easier than procuring an apical periosteal flap or superior oblique tendon ; also , it avoids complications seen with silicone band or screw systems.16 recently , tse et al . , described the use of the titanium t - plate anchoring system.17 the concept is based on the principle of providing more physiological pull vector with the help of coupling suture that simulates the rectus muscle . the t - plate is implanted in the subperiosteal space with its long end pointing toward the orbital apex while the cross bar is fixed to the nasal bone with screws . a suture is then tied from the insertion of the muscle to the long end of the t - plate , which serves as a coupling to generate pull in the direction of the physiological vector . saxena et al . , described the use of a similar concept in 2009 , for correcting hypertropia using a silicone band and a titanium plate.18 the technique does not offer any added advantage over the other methods in terms of improvement in ocular movements ; however , it does has a potential to serve as a base model for development of a system that can be used as an eye muscle prosthesis . anchoring procedures have used a skin approach since it gives good exposure of the structures at the medial canthal area.19 however , the incisions placed between the medial canthus and the nasal dorsum are prone to scarring and web formation.19 to avoid the cosmetic disadvantage the other approach to reach the medial orbital wall is the transcaruncular approach in which the incision is made lateral to caruncle between plica and caruncle . both the approaches allow the attachment of sutures anteriorly at the anterior lacrimal crest , causing delayed healing , chemosis and fullness of the medial canthal region persisting postoperatively for months.20 in the transcaruncular approach , there is edema , erythema , and irritation in the caruncle.21 approach to the medial wall through incision in the medial tenon 's capsule has also been described in a case report.22 in designing a surgical approach to the medial orbit , the goal should be to encounter the posterior lacrimal crest with minimum dissection . approaching the bone anterior to this structure exposes the posterior limb of the medial canthal tendon and the lacrimal sac to the risk of injury.21 the precaruncular approach initially described by moe provides an avascular path along with a direct approach to the posterior lacrimal crest without injuring angular vessels and the medial canthal tendon . the authors have used both approaches and found that the precaruncular approach is associated with rapid healing , minimal postoperative medial canthal fullness and has obvious cosmetic advantages . while oculomotor nerve palsy remains the major indication for the fixation of the globe , the procedure has been used for other forms of strabismus including sixth nerve palsy71017 and congenital fibrosis of extraocular muscle.10 saxena et al . , have described anchoring of the globe inferiorly in a case of posttraumatic inferior rectus disinsertion.18 in this case , the globe was fixed to the floor of the orbit with a silicone band and titanium orbital plate [ figures 1 and 2 ] . a titanium plate was bent at 90 at one end and the other end of the plate and a silicone band was secured through one of the holes with a 40 prolene suture . the bent end of the plate was then fixed at the outer aspect of the orbital rim using titanium screws so that the longer part of the plate with the attached silicone band would be parallel to the orbital floor . two single arm 40 prolene sutures were passed through the free end of the band and were anchored to the globe at the site of insertion of the inferior rectus . before tying the final knot , the position of the globe was aligned at the primary position . this directed the vector of the force generated by the pull of silicone band inferiorly and posteriorly similar to the physiological force generated by the inferior rectus muscle . however , similar to any other anchoring procedure elevation and depression of the eye were limited . schematic diagram of periosteal fixation of the globe inferiorly with the help of titanium plate and silicone band ( a ) preoperative photograph of the patient with posttraumatic inferior rectus laceration , before undergoing inferior globe fixation , ( b ) postoperative picture of the same patient schematic diagram showing medial periosteal fixation of the globe . ( a ) incision at precaruncular area , ( b ) exposure of posterior lacrimal crest , ( c ) passing of nonabsorbable sutures through posterior lacrimal crest , ( d ) exposure of medial rectus muscle through limbal conjunctival incision , ( e ) creating a subtenon tunnel with the tenotomy scissors , ( f ) the nonabsorbable suture are passed medially with blunt forceps all the above - mentioned globe fixation procedures provide similar results in terms of ocular alignment . they vary only in terms of ease and duration of surgery , and the complications related to the tethering material used . the authors have been using a precaruncular approach to reach the medial periosteum and use a nonabsorbable suture as a tethering agent . forced duction test is repeated to confirm the tight lateral rectus muscle . using the limbal conjunctival incision 1216 mm of the lateral rectus muscle recession the amount of recession is adjusted to ensure a free forced duction test for adduction intraoperatively . the caruncular area is exposed using stay sutures through the skin near the medial canthus . after identifying and dilating the two puncta using nettleship 's punctum dilator , bowman 's lacrimal probes are placed to secure the canaliculi . the probes act as landmarks to identify the canaliculi so that they are not inadvertently damaged during surgery . to decrease intraoperative bleed and postoperative pain , subsequently a curved superficial incision ( approximately 78 mm ) is created at the junction of conjunctiva and canthal skin [ figure 3a ] . after anatomical localization of the lacrimal system with the help of lacrimal probes , blunt dissection is performed posteriorly and nasally to reach the periosteum posterior to the posterior lacrimal crest [ figure 3b ] . through the exposed periosteum , two double - armed 50 nonabsorbable - coated braided polyester sutures are passed [ figure 3c ] , and a gentle pull is applied to the sutures to test the strength of the tissue bite . the lacrimal probes are then removed . using a limbal conjunctival incision , the medial rectus muscle is hooked and dissected [ figure 3d ] . through this incision , straight tenotomy scissors are passed towards the medial canthus to create a tunnel [ figure 3e ] . blunt tipped serrated forceps are passed through this incision , and the needles of ethibond sutures are pulled out laterally adjacent to the medial rectus muscle [ figure 3f ] . these sutures are then anchored to the sclera on either end of the medial rectus muscle . figure 4a and b show the preoperative and the postoperative photograph of a patient of complete occulomotor nerve palsy . ( a ) preoperative photograph of the patient of complete third nerve palsy , ( b ) postoperative photograph of the same patient schematic diagram of the periosteal anchoring of the lateral rectus muscle to the lateral periosteum the vertical strabismus can be corrected simultaneously either by adjusting the insertion of the nonabsorbable suture below or above the insertion of the medial rectus muscle or by operating on the vertical muscles . the surgical correction of strabismus in cases of complete oculomotor nerve palsy is a formidable challenge since all the muscles are paralyzed except the lateral rectus and superior oblique . transposition procedures of either the lateral rectus muscle or the superior oblique muscle to the medial rectus muscle have been advocated by some surgeons but the results can be unpredictable , and complications and inadequate correction are not infrequent.12345 in addition , lateral rectus transposition may not be possible in cases where the lateral rectus muscle has developed contracture due to longstanding deviation . in such cases , globe fixation to the medial orbital wall periosteum is a viable surgical option . a variety of techniques and use of various materials have been described for this operation . the concept of fixation of the globe to the orbital margin was initially developed with the idea of improving ocular motility where a silicone band was used as an eye muscle prosthesis.67 scott et al . , first used this technique for improving the rotation of the globe in cases of the lateral rectus and superior oblique muscle palsy.6 they used the silicone band to fix the globe to the adjacent periosteum.6 bicas used silicone tubes on the antagonist muscle and fixed it to superior and inferior orbital margin on either side of the midline based on the side of the paretic muscle.7 the silicone tube acted as a sling to maintain alignment in the primary position.7 the band ( or tube ) would stretch on the contraction of the antagonist muscle , and on the relaxation of antagonist , the band would move the eye back to its resting position allowing some ocular rotation.7 among the five cases described by bicas,7 two had third nerve palsy , and three had sixth nerve palsy . although fair postoperative alignment was achieved , the ocular rotation was limited in cases of the third nerve palsy.7 the major concern in such cases is regulation of the strength and tension of the silicone band which is a complicated mathematical exercise . currently , oculomotor nerve palsy is the major indication for anchoring of the globe where the aim is to tether the globe and maintain it fixed in primary position rather than improve ocular motility . various autogenous and allogenous materials have been tried , using either skin , retro - caruncular or precaruncular incisions for accessing the medial orbital wall periosteum for fixation.89101112131415161718 a summary of various techniques for the fixation of the globe is presented in table 1 . various techniques for the fixation of the globe for oculomotor palsy salazar - len et al . , first described the current technique of anchoring the globe to the nasal periosteum in 1994.8 they sutured one end of fascia lata to the medial aspect of the globe and other to the nasal periosteum.8 they used a skin incision to approach the nasal periosteum at the site of the insertion of the medial canthal tendon , where one end of the fascia lata was sutured with 50 silk sutures ; the other end was then passed subconjuctivally and sutured to the insertion of the medial rectus muscle.8 they combined this procedure with the large lateral rectus muscle recession.8 the advantages of fascia lata are that it is well - tolerated and is inexpensive . however , the surgery is time - consuming and leaves a scar over the second site , which can cause complications . additionally , it can not be used in children < 2-year - old . to overcome these drawback , had described the use of the superior oblique tendon as a tethering material for globe fixation.9 they procured approximately 1214 mm of the superior oblique tendon which was fixed with mersilene suture on either side.9 the tendon length adjusted to fixate the globe in primary position in the first few cases.9 however they realized the problem of exodrift and modified their technique to leave the tethered eye in the adducted position.9 they also combined the procedure with the maximal recession of the lateral rectus and resection of the medial rectus.9 an alternative is to use the superior oblique muscle as a tethering material since it can correct the co - existing hypotropia in cases of isolated third nerve palsy and the procedure does not require a second surgical site as in cases of fascia lata . however , the technically challenging part of this approach is procuring a large superior oblique tendon and need for extensive surgery . goldberg et al . , presenting an interesting concept of creating a periosteal flap and using it as tethering material.10 although the previous two methods require the use of permanent sutures to fixate the material on both sides , the use of periosteal flap requires a suture on the scleral side only . the procedure involves making a conjunctival incision in the fornix overlying the paretic muscle . to create a lateral periosteal flap , the dissection is performed through the orbital fat to the lateral rim . to create an inferior periosteal flap , the dissection follows the plane of the lower eyelid retractors to the floor and orbital rim . to create a medial flap , the incision is located at the lateral edge of the caruncle . for superior flap , once the orbital rim is reached , a wide based periosteal flap is created with dissection carried out up to the midway to the orbit . the flap is then secured with a double - armed suture through the tip . the muscle insertion is then exposed and the periosteal flap is then passed through subconjunctival space with the help of a suture and is then attached to the muscle 's insertion . the major limitation of this surgery is the extensive dissection that is required to harvest the periosteal flap . in addition , the flap is friable tissue that may be damaged during the procedure . the other autogenous materials that have been used for tethering are the temporalis fascia11 and the tendon of the medial rectus muscle itself.12 the autogenous materials have their advantages in terms of fewer chances of inflammation and extrusion . however , all the procedures described above require either extensive multiplanar orbital dissection or two - site surgery . this increases the duration of the surgery and increases postoperative inflammation.1012 additionally , there may be a flattening of the medial canthal area and swelling on the nasal conjunctiva that may require conjunctival excision.1012 allogenous materials that have been used for fixation of the globe , other then what we describe above , include a screw system,13 50 polyester suture141516 and titanium t - plate.17 bone anchors and screws have been developed to fixate soft tissue to the bone . advantages include precise placement for vector force determination as fixation is done directly to the bone , and the fact that bone fixation has greater strength compared to periosteum fixation.13 the disadvantages of bone anchors and screws include risk of extrusion , inflammation , infection and progressive loosening.13 some authors have described the successful use of a nonabsorbable suture such as 50 polyester for anchoring the globe directly to periosteum.141516 the orbital dissection required in this procedure is less extensive ( surgical technique presented below ) and easier than procuring an apical periosteal flap or superior oblique tendon ; also , it avoids complications seen with silicone band or screw systems.16 recently , tse et al . , described the use of the titanium t - plate anchoring system.17 the concept is based on the principle of providing more physiological pull vector with the help of coupling suture that simulates the rectus muscle . the t - plate is implanted in the subperiosteal space with its long end pointing toward the orbital apex while the cross bar is fixed to the nasal bone with screws . a suture is then tied from the insertion of the muscle to the long end of the t - plate , which serves as a coupling to generate pull in the direction of the physiological vector . saxena et al . , described the use of a similar concept in 2009 , for correcting hypertropia using a silicone band and a titanium plate.18 the technique does not offer any added advantage over the other methods in terms of improvement in ocular movements ; however , it does has a potential to serve as a base model for development of a system that can be used as an eye muscle prosthesis . anchoring procedures have used a skin approach since it gives good exposure of the structures at the medial canthal area.19 however , the incisions placed between the medial canthus and the nasal dorsum are prone to scarring and web formation.19 to avoid the cosmetic disadvantage the other approach to reach the medial orbital wall is the transcaruncular approach in which the incision is made lateral to caruncle between plica and caruncle . both the approaches allow the attachment of sutures anteriorly at the anterior lacrimal crest , causing delayed healing , chemosis and fullness of the medial canthal region persisting postoperatively for months.20 in the transcaruncular approach , there is edema , erythema , and irritation in the caruncle.21 approach to the medial wall through incision in the medial tenon 's capsule has also been described in a case report.22 in designing a surgical approach to the medial orbit , the goal should be to encounter the posterior lacrimal crest with minimum dissection . approaching the bone anterior to this structure exposes the posterior limb of the medial canthal tendon and the lacrimal sac to the risk of injury.21 the precaruncular approach initially described by moe provides an avascular path along with a direct approach to the posterior lacrimal crest without injuring angular vessels and the medial canthal tendon . the authors have used both approaches and found that the precaruncular approach is associated with rapid healing , minimal postoperative medial canthal fullness and has obvious cosmetic advantages . while oculomotor nerve palsy remains the major indication for the fixation of the globe , the procedure has been used for other forms of strabismus including sixth nerve palsy71017 and congenital fibrosis of extraocular muscle.10 saxena et al . , have described anchoring of the globe inferiorly in a case of posttraumatic inferior rectus disinsertion.18 in this case , the globe was fixed to the floor of the orbit with a silicone band and titanium orbital plate [ figures 1 and 2 ] . a titanium plate was bent at 90 at one end and the other end of the plate and a silicone band was secured through one of the holes with a 40 prolene suture . the bent end of the plate was then fixed at the outer aspect of the orbital rim using titanium screws so that the longer part of the plate with the attached silicone band would be parallel to the orbital floor . two single arm 40 prolene sutures were passed through the free end of the band and were anchored to the globe at the site of insertion of the inferior rectus . before tying the final knot , the position of the globe was aligned at the primary position . this directed the vector of the force generated by the pull of silicone band inferiorly and posteriorly similar to the physiological force generated by the inferior rectus muscle . however , similar to any other anchoring procedure elevation and depression of the eye were limited . schematic diagram of periosteal fixation of the globe inferiorly with the help of titanium plate and silicone band ( a ) preoperative photograph of the patient with posttraumatic inferior rectus laceration , before undergoing inferior globe fixation , ( b ) postoperative picture of the same patient schematic diagram showing medial periosteal fixation of the globe . ( a ) incision at precaruncular area , ( b ) exposure of posterior lacrimal crest , ( c ) passing of nonabsorbable sutures through posterior lacrimal crest , ( d ) exposure of medial rectus muscle through limbal conjunctival incision , ( e ) creating a subtenon tunnel with the tenotomy scissors , ( f ) the nonabsorbable suture are passed medially with blunt forceps all the above - mentioned globe fixation procedures provide similar results in terms of ocular alignment . they vary only in terms of ease and duration of surgery , and the complications related to the tethering material used . the authors have been using a precaruncular approach to reach the medial periosteum and use a nonabsorbable suture as a tethering agent . the procedure is explained below . under anesthesia , forced duction test is repeated to confirm the tight lateral rectus muscle . using the limbal conjunctival incision the amount of recession is adjusted to ensure a free forced duction test for adduction intraoperatively . the caruncular area is exposed using stay sutures through the skin near the medial canthus . after identifying and dilating the two puncta using nettleship 's punctum dilator , the probes act as landmarks to identify the canaliculi so that they are not inadvertently damaged during surgery . to decrease intraoperative bleed and postoperative pain , 0.20.5 ml of 1:1000 adrenaline with 2% xylocaine subsequently a curved superficial incision ( approximately 78 mm ) is created at the junction of conjunctiva and canthal skin [ figure 3a ] . after anatomical localization of the lacrimal system with the help of lacrimal probes , blunt dissection is performed posteriorly and nasally to reach the periosteum posterior to the posterior lacrimal crest [ figure 3b ] . through the exposed periosteum , two double - armed 50 nonabsorbable - coated braided polyester sutures are passed [ figure 3c ] , and a gentle pull is applied to the sutures to test the strength of the tissue bite . the medial rectus muscle is hooked and dissected [ figure 3d ] . through this incision , straight tenotomy scissors are passed towards the medial canthus to create a tunnel [ figure 3e ] . blunt tipped serrated forceps are passed through this incision , and the needles of ethibond sutures are pulled out laterally adjacent to the medial rectus muscle [ figure 3f ] . these sutures are then anchored to the sclera on either end of the medial rectus muscle . figure 4a and b show the preoperative and the postoperative photograph of a patient of complete occulomotor nerve palsy . ( a ) preoperative photograph of the patient of complete third nerve palsy , ( b ) postoperative photograph of the same patient schematic diagram of the periosteal anchoring of the lateral rectus muscle to the lateral periosteum the vertical strabismus can be corrected simultaneously either by adjusting the insertion of the nonabsorbable suture below or above the insertion of the medial rectus muscle or by operating on the vertical muscles . globe fixation procedure typically requires weakening procedures of the antagonist muscle ( i.e. , the muscle working opposite to the paralyzed / damaged muscle ) . this antagonist muscle typically has undergone secondary fibrotic changes , and any surgical attempt to regain ocular alignment requires its weakening . the same is true for restrictive strabismus such congenital extraocular muscle fibrosis , where profound weakening of the muscle which is an antagonist to the nonfunctioning muscle is required ( typically the lateral rectus ) . however , it is not uncommon that the even supramaximal recession is not sufficient and leads to recurrence . the most common cause of unsatisfactory results in cases of oculomotor nerve palsy and exotropic duane retraction syndrome ( drs ) is the tight lateral rectus muscle.232425 although myotomies or myectomies may completely detach the muscle from the globe , the results are unpredictable due to the muscle 's tendency to reattach to the globe.26 a complete inactivation of lateral rectus muscle force by orbital wall fixation rather than conventional strabismus surgery eliminates all residual lateral rectus function and prevents reattachment to the globe . as the muscle is still retrievable , the procedure is reversible if required . another indication for the procedure is the deactivation of an inappropriately - innervated muscle and thus conversion of a complicated abnormal co - contraction case into a more straightforward paralytic strabismus ( e.g. , in some cases of duane syndrome ) . extraocular muscle fixation to the orbital wall using a limbal conjunctival incision , the lateral rectus muscle is exposed and isolated on a muscle hook the globe is then retracted medially , and a blunt dissection is performed outside the muscle cone to expose the adjacent periosteum approximately 5 mm posterior to the lateral orbital rim . the muscle is then attached to the adjacent orbital periosteum . the tenon capsule is then closed over the muscle with 80 polyglactin , to avoid any reattachment [ figure 5 ] . velez et al . , retrospectively evaluated the results of lateral rectus orbital fixation in three cases of oculomotor nerve palsy and two cases of drs.27 for oculomotor nerve palsy they combined the procedure with large medial rectus muscle resection.27 for duane syndrome , they combined the procedure with a partial vertical rectus muscle transposition ( vrt).27 in oculomotor nerve palsy cases , the mean preoperative and postoperative deviation was not significantly different , nor was there any significant change in head posture . both the cases of duane syndrome showed improvement in the amount of deviation as well as head posture . sukhija et al . , suggested a modification of periosteal anchoring of the lateral rectus muscle by fixating it to the lateral canthal tendon for exotropic duane syndrome.31 they retrospectively compared the results of this procedure with y split recession and found that both are equally effective.31 sharma et al . , prospectively evaluated the effect of periosteal fixation of the lateral rectus in exotropic duane syndrome.30 they compared periosteal fixation of the lateral rectus muscle alone with periosteal fixation combined with partial vrt where the temporal halves of vertical rectus muscles were used to reduce the risk of anterior segment ischemia . there was a significant improvement in ocular movements , globe retraction , and upshots and down shoots in both groups . the complete deactivation of the lateral rectus muscle appears to be an effective procedure to eliminate the paradoxical innervation of the lateral rectus during adduction . this improves the exodeviation in the primary position and hence , anomalous head posture , as well as the range of adduction . the abduction can be improved by performing partial vrt after periosteal fixation of the lateral rectus . in cases of the third nerve palsy , it needs to be combined with either a supramaximal resection of the medial rectus muscle or the medial anchoring of the globe . velez et al . , in their study showed that in cases of third nerve palsy there was no improvement of adduction while there was residual abduction despite inactivation of the lateral rectus muscle and supramaximal resection of the medial rectus muscle , which suggest that the connective tissue also undergo secondary contracture in cases of longstanding deviation in general , and specifically , oculomotor nerve palsy.27 there was no difference in the preoperative and postoperative deviation with the above - mentioned procedure . 's , retrospective case series reported better results for their cases of oculomotor nerve palsy.28 in a recently published case series , fixation of both the rectus muscles to the periosteum was done to achieve satisfactory alignment.32 however it should be noted that medial anchoring of the globe along with the lateral rectus muscle weakening in the form of supramaximal recession is an effective procedure . the principle of profound weakening by periosteal fixation has been applied to other muscles as well . reported the results of the fixation of the inferior oblique muscle in cases of superior oblique palsy ( sop ) , primary inferior oblique overaction with exotropia and dissociated vertical deviations ( dvd ) . there was marked improvement in the v pattern and inferior oblique over action.29 the cases with primary inferior oblique overaction and dvd showed marked improvement in hypertropia in the primary position.29 however the cases with sop did not show much change in hypertropia , neither there was significant change in torsion.29 postoperative complication included y pattern exotropia in two patients.29 using a limbal conjunctival incision , the lateral rectus muscle is exposed and isolated on a muscle hook . the globe is then retracted medially , and a blunt dissection is performed outside the muscle cone to expose the adjacent periosteum approximately 5 mm posterior to the lateral orbital rim . the muscle is then attached to the adjacent orbital periosteum . the tenon capsule is then closed over the muscle with 80 polyglactin , to avoid any reattachment [ figure 5 ] . velez et al . , retrospectively evaluated the results of lateral rectus orbital fixation in three cases of oculomotor nerve palsy and two cases of drs.27 for oculomotor nerve palsy they combined the procedure with large medial rectus muscle resection.27 for duane syndrome , they combined the procedure with a partial vertical rectus muscle transposition ( vrt).27 in oculomotor nerve palsy cases , the mean preoperative and postoperative deviation was not significantly different , nor was there any significant change in head posture . both the cases of duane syndrome showed improvement in the amount of deviation as well as head posture . sukhija et al . , suggested a modification of periosteal anchoring of the lateral rectus muscle by fixating it to the lateral canthal tendon for exotropic duane syndrome.31 they retrospectively compared the results of this procedure with y split recession and found that both are equally effective.31 sharma et al . , prospectively evaluated the effect of periosteal fixation of the lateral rectus in exotropic duane syndrome.30 they compared periosteal fixation of the lateral rectus muscle alone with periosteal fixation combined with partial vrt where the temporal halves of vertical rectus muscles were used to reduce the risk of anterior segment ischemia . there was a significant improvement in ocular movements , globe retraction , and upshots and down shoots in both groups . the complete deactivation of the lateral rectus muscle appears to be an effective procedure to eliminate the paradoxical innervation of the lateral rectus during adduction . this improves the exodeviation in the primary position and hence , anomalous head posture , as well as the range of adduction . the abduction can be improved by performing partial vrt after periosteal fixation of the lateral rectus . in cases of the third nerve palsy , it needs to be combined with either a supramaximal resection of the medial rectus muscle or the medial anchoring of the globe . velez et al . , in their study showed that in cases of third nerve palsy there was no improvement of adduction while there was residual abduction despite inactivation of the lateral rectus muscle and supramaximal resection of the medial rectus muscle , which suggest that the connective tissue also undergo secondary contracture in cases of longstanding deviation in general , and specifically , oculomotor nerve palsy.27 there was no difference in the preoperative and postoperative deviation with the above - mentioned procedure . 's , retrospective case series reported better results for their cases of oculomotor nerve palsy.28 in a recently published case series , fixation of both the rectus muscles to the periosteum was done to achieve satisfactory alignment.32 however it should be noted that medial anchoring of the globe along with the lateral rectus muscle weakening in the form of supramaximal recession is an effective procedure . the principle of profound weakening by periosteal fixation has been applied to other muscles as well . reported the results of the fixation of the inferior oblique muscle in cases of superior oblique palsy ( sop ) , primary inferior oblique overaction with exotropia and dissociated vertical deviations ( dvd ) . there was marked improvement in the v pattern and inferior oblique over action.29 the cases with primary inferior oblique overaction and dvd showed marked improvement in hypertropia in the primary position.29 however the cases with sop did not show much change in hypertropia , neither there was significant change in torsion.29 postoperative complication included y pattern exotropia in two patients.29 globe fixation to the medial periosteum along with supramaximal recession of the lateral rectus muscle is a preferred procedure in the treatment of complete oculomotor nerve palsy . the procedure should be reserved for cases where there has not been any recovery . in these latter cases of the various procedures described for anchoring of the globe , no single procedure is better than the other in terms of ocular alignment . the fixation with the nonabsorbable suture through precaruncular approach is the author 's procedure of choice because of its ease and shorter duration . the orbital fixation of the lateral rectus muscle is emerging as a preferred surgical procedure for exotropic drs because it completely abolishes the action of the misinnervated lateral rectus and corrects exotropia simultaneously . however , in the absence of definitive results from a randomized control trial comparing it to y split and recession of the lateral rectus either option can be used .	managing a case of incomitant strabismus from nerve palsy or extraocular muscle loss is a major challenge . among possible management options are globe or extraocular muscle fixation to the orbital wall coupled with weakening or strengthening of the relevant antagonist . extraocular muscle fixation to the orbital wall can also be used in cases of abnormal synkinesis to eliminate the abnormal eye movements of a misfiring extraocular muscle , which thereby allows the use of standard paralytic strabismus surgery techniques . this review article summarizes indications and techniques of periosteal fixation procedures for incomitant strabismus .
You are an expert at summarizing long articles. Proceed to summarize the following text: nitrogen gas ( n2 ) , as a major inert gas of the atmosphere , is liquefied to liquid nitrogen ( ln2 ) on cooling to -196 and easily vaporizes at room temperature . known to be harmless with the exception of potential frostbite injury , ln2 is widely used in laboratories and in industry for freezing , filling , or cleaning purposes ( 1 , 2 ) . the few reported cases of accidental harm from ln2 ( 3 - 5 ) were caused by careless management , which may have involved sudden ln2 evaporation leading to oxygen depletion in limited spaces . however , those reports ( 3 - 5 ) did not reveal indisputable evidence of the cause of asphyxia even though they included complete autopsies , toxicological analysis , and blood gas analysis . in this case report , a postgraduate student was found dead in an underground dry area where a cylinder of ln2 had been disposed . by a complete autopsy , we analyzed the atmosphere gas of the dry area through a reconstruction of the accidental scene in order to help define the cause of death . a 27-yr - old postgraduate student was found lying in a right lateral decubitis position on the latticed plastic pallets paving the floor of an underground dry area adjacent to a research building , approximately 12:00 p.m. on a day in june ( temperature , 21.9 - 27.2 ; mean wind velocity , 2.4 m / sec ; and mean humidity , 75.5% ) . beside him was a cap - removed , empty dewar - flask ( 10 l ) , connected to a valve - opened , empty cylinder of ln2 ( 150 l ) via a copper infusion tube ( fig . 1 ) . there was no leak defect in the cylinder , the infusion tube , or the dewar - flask . the dry area , measuring 300130260 cm in dimensions , had a communication to the basement of the research building by a window measuring 9060 cm in size at 130 cm above the base , as well as a drain hole located on the floor ( fig . his last videogram was taken within his laboratory room at 07:17 a.m. , when he was just going outside with the empty dewar - flask in order to fill it with ln2 . a college officer mentioned that the ln2 cylinder was fully filled on the day before the accident . dark red livor mortis was seen in the dependent areas of the cadaver , and the heart was filled with dark red liquid blood . a few lymph nodes in the mesentery of the small intestine were slightly enlarged , determined to be reactive hyperplasia by histological examination . scene reconstruction and atmosphere gas analysis ( xp-302 ii e , new cosmos electric co. , osaka , japan ) were performed approximately 10:00 a.m. , on a sunny day in september ( temperature , 22.6 - 28.7 ; mean wind velocity , 3.5 m / sec ; and mean humidity , 70.9% ) , approximately 2 months after the accident ( fig . 4 ) . in order to reproduce the circumstances of the accident as closely as possible , concentrations of o2 , co , and h2s were measured at a level of 2 m below the ground and 60 cm above the base , while opening the valve of the cylinder filled with ln2 , which was linked to an opened dewar - flask . the o2 concentration dropped to 12.0% in 3 min and 10 sec , 10.0% in 8 min and 53 sec , 6.0% in 18 min and 40 sec , and 4.2% in 20 min and 28 sec ( fig . a 27-yr - old postgraduate student was found lying in a right lateral decubitis position on the latticed plastic pallets paving the floor of an underground dry area adjacent to a research building , approximately 12:00 p.m. on a day in june ( temperature , 21.9 - 27.2 ; mean wind velocity , 2.4 m / sec ; and mean humidity , 75.5% ) . beside him was a cap - removed , empty dewar - flask ( 10 l ) , connected to a valve - opened , empty cylinder of ln2 ( 150 l ) via a copper infusion tube ( fig . 1 ) . there was no leak defect in the cylinder , the infusion tube , or the dewar - flask . the dry area , measuring 300130260 cm in dimensions , had a communication to the basement of the research building by a window measuring 9060 cm in size at 130 cm above the base , as well as a drain hole located on the floor ( fig . his last videogram was taken within his laboratory room at 07:17 a.m. , when he was just going outside with the empty dewar - flask in order to fill it with ln2 . a college officer mentioned that the ln2 cylinder was fully filled on the day before the accident . dark red livor mortis was seen in the dependent areas of the cadaver , and the heart was filled with dark red liquid blood . a few lymph nodes in the mesentery of the small intestine were slightly enlarged , determined to be reactive hyperplasia by histological examination . scene reconstruction and atmosphere gas analysis ( xp-302 ii e , new cosmos electric co. , osaka , japan ) were performed approximately 10:00 a.m. , on a sunny day in september ( temperature , 22.6 - 28.7 ; mean wind velocity , 3.5 m / sec ; and mean humidity , 70.9% ) , approximately 2 months after the accident ( fig . 4 ) . in order to reproduce the circumstances of the accident as closely as possible , concentrations of o2 , co , and h2s were measured at a level of 2 m below the ground and 60 cm above the base , while opening the valve of the cylinder filled with ln2 , which was linked to an opened dewar - flask . the o2 concentration dropped to 12.0% in 3 min and 10 sec , 10.0% in 8 min and 53 sec , 6.0% in 18 min and 40 sec , and 4.2% in 20 min and 28 sec ( fig . however , it is known that a small amount of ln2 can vaporize rapidly to large volumes of n2 ( a liter of ln2 will produce 0.7 m of n2 ) , and sudden evaporation of ln2 to n2 in a limited space can lead to o2 depletion in the air ( 2 ) . if the o2 concentration of atmosphere drops below 10% , a human becomes unconscious immediately and unable rescue oneself from asphyxia ( 6 ) . the dry area of this accident had been used to dispose the ln2 for 2 yr without the awareness of such danger , due to the misconceptions of both n2 being an innoxious gas and the dry area being an open space outside of the building . therefore , it is a very important principle that ln2 must be disposed and used in an open and well - ventilated place ( 1 , 2 ) , and guidelines are needed to minimize the likelihood of injury and illness occurring from the use and storage of ln2 . within the categories of asphyxia , this case can be treated as an environmental suffocation with no specific autopsy findings ( 7 ) . however , external findings did include petechiae in the conjunctiva and periorbital skin , and internal findings included dark red liquid blood in the heart and congestion of visceral organs . petechiae in the conjunctiva and periorbital skin of the decedent were unusual in that such petechiae in an asphyxiated cadaver generally suggests a sudden and strong break of venous return , as is commonly seen as a result of mechanical compression of the neck . this raises doubt as to whether petechiae are truly absent in cases of environmental suffocation ( 8) . frostbite was not present , owing to the plastic pallets at the base that left a gap between his body and the floor while ln2 was overflowing and evaporating . scene reconstruction was performed on a day in september , approximately 2 months later , with weather conditions similar to the day of the accident . in conclusion , this is a noteworthy case highlighting the risk of environmental suffocation due to sudden evaporation of ln2 even in an open space , and the circumstances of death were eventually reproduced in scene reconstruction and confirmed by atmosphere gas analysis .	a 27-yr - old postgraduate student was found lying at the floor of an unsealed underground dry area , where a valve - opened empty cylinder of liquid nitrogen ( 150 l ) was connected to a cap - removed empty dewar - flask ( 10 l ) via a copper infusion tube . no injury was found externally or internally . there were petechiae in the bilateral conjunctivae and periorbital skin . the dry area , measuring 300130260 cm , had a communication to the basement of the research building by a window measuring 9060 cm in size at 130 cm above the floor . the scene reconstruction and atmosphere gas analysis revealed that the o2 concentration at 60 cm above the base dropped to 12.0% in 3 min and 10 sec , 10.0% in 8 min and 53 sec , 6.0% in 18 min and 40 sec , and 4.2% in 20 min and 28 sec . the primary cause of death was asphyxia by evaporated liquid nitrogen .
You are an expert at summarizing long articles. Proceed to summarize the following text: dehumanization , by which they mean the thing that occurs when a subject , s , perceives people who belong to some cultural outgroup , g , as having a lesser degree of humanity than herself and others she identifies with . their inquiry is partly motivated by the conjecture which they credit to the psychologist gordon allport , and the philosopher hannah arendt that dehumanization can lead to mass , ethnically motivated human rights abuses , like those of the holocaust . the principal contribution of their article is to articulate a more detailed ( hypothetical ) account of how dehumanization alters the cognition of affected subjects , which they do by synthesizing contemporary findings in neuroscientific research on empathy and psychological research on prejudice . they contend that where subject s has a dehumanized view of group g , s 's neural mechanisms of empathy exhibit a dampened response to the suffering of members of g , and s 's judgments , vis - - vis the degree of humanity of members of g , are largely non - conscious , ie not a product of s 's conscious beliefs , but rather a product of s 's conditioned associations connecting g to sub - human traits . if this is how dehumanization works then it 's plain to see why it 's so dangerous . affected subjects feel less disquiet about certain people 's suffering , and consequently they 're less averse to inflicting or permitting that suffering , and these dispositions are difficult to modify , because they 're borne of subjects implicit associations and not their conscious beliefs . dehumanization , thus characterized , is a phenomenon that societies should take urgent measures to counteract , even at some cost to other values . in what follows , i 'll provisionally grant murrow and murrow 's account of how dehumanization operates once it 's in effect . what i want to examine are the ramifications they seek to trace from this for questions about the legitimacy of laws restricting hate speech , ie speech that expresses or incites hatred toward people on the basis of some aspect of their identity , eg their ethnicity , nationality , or religion . murrow and murrow do n't claim to be advancing a justification for general prohibitions on hate speech ; what they purport to offer , rather , is a theory regarding how hate speech might be threatening to its targets in ways which jurists , scholars , and scientists have not perhaps previously been aware. they summarize the part of their account that 's relevant in connection with this concern as follows : if hate speech conditions an implicitly dehumanized view of its human targets , and , if this reduces empathy for targets that motivates prosocial behavior toward them , then , in legal terms , it also reduces the sense of equality that conspecifics have toward the targets and thus deprives the latter of equal protection of their rights , which is provided not simply by positive law , but by the capacity to provoke empathy . therefore it may pose a true threat to such targeted groups safety or human rights . here i 'll question whether murrow and murrow 's account of dehumanization in fact has the implications for anti - hate speech law that they suggest . i 'll begin by sketching different candidate justifications for different kinds of anti - hate speech laws , and indicating the point at which an account like murrow and murrow 's has the potential to make an impact on the case for anti - hate speech law . i 'll then briefly outline the views advanced by a few other scholars interested in the malign effects of identity - prejudicial speech , and in so doing flesh out a distinction that becomes salient in examining such views one that 's also crucial for an assessment of murrow and murrow 's proposal between ( i ) accounts of the nature of the harm effected by identity prejudice , and ( ii ) accounts of how hate speech contributes to the harms of identity prejudice . i 'll then explain why murrow and murrow 's proposal is properly construed as an account of type ( i ) , and explain why accounts of this type , even if they 're plausible and evidentially well supported , have limited ramifications in relation to justifications for anti - hate speech law . we should denounce the views of people who express identity - prejudicial sentiments , but we should n't legally restrict such expression except in cases where it does a discernible , non - trivial harm to some identifiable victim(s ) . this premise is n't predicated upon a commitment to any strong free - speech principle , of the kind that underpins american first amendment jurisprudence , and toward which murrow and murrow ( and many others ) are skeptical . rather , to say that we should only penalize harmful hate speech is just to accept the tenet that the law should be used to remedy harms done to others , not to censure pernicious attitudes or penalize wrongs per se . i 'll assume that tenet henceforth , without any defense except to observe that hate speech is one area of law in which non - harm - based justifications are especially at risk of devolving into expedient scapegoating . assuming that hate speech may only be restricted when it harms others , it 's then important to distinguish between putative justifications for anti - hate speech law that claim that specific acts of hate speech cause harm to others andputative justifications that claim that , in general , hate speech contributes to harm to others . putative justifications for anti - hate speech law that claim that specific acts of hate speech cause harm to others and putative justifications that claim that , in general , hate speech contributes to harm to others . vis - - vis ( i ) , someone might claim that being confronted with face - to - face hate speech can cause distress of a magnitude sufficient to qualify as psychological harm ( cause in a counterfactual sense , ie but for the relevant acts , the harm would n't have occurred ) . if this claim is evidentially well supported , it seems sufficient to justify , in principle , an anti - hate speech statute narrowly aimed at restricting instances of hate speech that inflict the relevant harms . by contrast , vis - - vis ( ii ) , someone might claim that all hate speech even where it is n't counterfactually responsible for harming others contributes to the existence of de facto social hierarchies which inflict harm upon targets of group - based identity prejudice . what does roughly , the idea is that eliminating hate speech would increase the likelihood of the de facto social hierarchies being eradicated , but that holding other factors constant , this intervention alone would n't be sufficient to eradicate the hierarchies . claims along these lines are much harder to substantiate , but if one were well supported , it would seem sufficient to justify again , at least in principle a broad - scope statute aimed at legally restricting all instances of hate speech . claims of the type that are necessary to underwrite the first type of putative justification for anti - hate speech law are highly plausible . only the most extreme free - speech zealot would deny that some hate speech can do some harm to some of its targets . granted , there 's room for disagreement about how exactly we should formulate laws restricting such directly harmful hate speech . nonetheless , the more significant question about the in - principle justifiability of anti - hate speech law is whether any putative justification for restrictions of the second type can be sustained , eg whether it 's plausible to say that instances of hate speech that are individually harmless nevertheless contribute to some sort of socially mediated harm , in a way that renders all hate speech legitimately liable to legal restriction . if murrow and murrow 's account of how dehumanization operates has any impact to make on the case in favor of anti - hate speech law , those debates are the place in which its conclusions need to register . in the literature on identity - prejudicial speech and its malign effects , we observe efforts to describe both ( i ) the nature of the harm that such speech ( allegedly ) contributes to , and ( ii ) the route via which such speech ( allegedly ) makes its contribution . where a putative justification for anti - hate speech law is purporting to show that all hate speech contributes to a socially mediated harm , an account needs to be given in regards to both points . a quick sketch of some prominent recent work in the legal philosophical literature on identity - prejudicial speech will illuminate the nature of this demand that i 'm outlining . so , for example , in philosophical and legal theoretic work on the silencing effects of sexist expression , we get ( i ) an account of the nature of a certain kind of harm namely , people being rendered unable to perform important speech acts that they intend to perform , ie suffering illocutionary disablementand ( ii ) an account of the route via which sexist expression makes a crucial contribution to that harm namely , by subverting certain key audience expectations which need to be in place in order for the important speech acts in question to be reliably and successfully performed . or , in jeremy waldron 's work on hate speech , we get ( i ) an account of the nature of a certain kind of harm namely , people losing their sense of assurance that they are fully socially enfranchised members of their society and ( ii ) an account of the route via which racist expression makes a crucial contribution to that harm namely , by making it unavoidably salient to people in targeted outgroups that they are held in contempt by others in their society . or , in jason stanley 's work on propaganda , we get ( i ) an account of the nature of a certain kind of harm namely , disadvantage stemming from systematic identity - based discrimination across multiple areas of social policy and ( ii ) an account of the route via which a certain form of racist propaganda makes a key contribution to that harm namely , by effectively misrepresenting systematically identity - prejudicial practices as if they were egalitarian and meritocratic . although the proponents of these accounts hold different views about the justifiability of legally restricting the expressive practices they 're examining , each of them supplies the elements that would be needed in order to formulate a case for restriction . in each account , we get an analysis of the nature of a complex socially mediated harm , plus an explanation of how the conditions that facilitate the harm are created and sustained , and crucially this explanation is one that indicates how the relevant form of expression might be making an identifiable , distinct , and important contribution to those conditions . if murrow and murrow 's analysis of dehumanization is to be usefully employed in an argument for anti - hate speech law , it likewise needs to supply each of these elements . murrow and murrow 's paper does supply the first of these elements ; it presents an account of the nature of a complex , socially mediated harm . what their discussion does n't supply is an explanation of why we should suppose that hate speech makes a crucial contribution to that harm . the mere fact that there exist instances of hate speech that manifest the speaker 's dehumanized view of a certain group obviously , people sometimes say things that overtly or covertly betray a view of groups as essentially sub - human . but the question that matters for our purposes here is whether such expressions are actually responsible , by themselves or alongside other factors , for non - trivial numbers of people coming to accept a dehumanized view of others . i do n't think we 're in a position to speak confidently in the affirmative . even if we could show that the incidence of dehumanizing attitudes and dehumanizing hate speech reliably co - vary across cultural and historical circumstances , this maybe an increase in dehumanizing hate speech in public discourse is responsible for an increase in people 's having dehumanized views ; but then maybe dehumanizing attitudes flourish in a political milieu for other reasons , and they are a cause , rather than a consequence , of increases in dehumanizing hate speech in public discourse . or alternatively probably this is the safest conjecture to advance from the armchair the causal arrows crisscross in multiple directions simultaneously . in any case , if we have credible alternative hypotheses about what could be the crucial contributing factors in the inculcation of dehumanizing attitudes ( and we clearly do have such hypotheses to consider , eg historical enmities , short - term conflicts borne of economic crises , innate tendencies toward ethnic outgroup enmity , various combinations of the above ) , then it 's conjectural to attribute a proliferation of dehumanized attitudes to the influence of hate speech . granted , there is work in social psychology that aims to shift questions about hate speech 's effects away from the realms of intractable sociological speculation , into more controlled experimental conditions , but the all - things - considered implications of this work are , i think it 's fair to say , uncertain . the natural reply to this , for murrow and murrow , is to reiterate that they only ever promised an account of how hate speech threatens its targets in ways jurists and scholars haven't paid close attention to previously . but that is , i 'd contend , a subtle mischaracterization of what their analysis can and does achieve . having advanced an explanation of how dehumanization works and why it 's so dangerous ( by my lights , one that 's plausible on both fronts ) what their account entails for political practice really ought to be described schematically . dehumanization carries significant threats to people 's basic rights , which ( arguably ) have previously been underappreciated , and therefore the acts or practices that make a significant contribution to dehumanization whatever those acts may be , precisely endanger people 's rights in a way that calls for an urgent response . murrow and murrow 's account tells us something noteworthy about dehumanization 's dangers , but rather less about its originating sources . my point in all this is n't to endorse the idea that in general hate speech does n't contribute significantly to dehumanization , it 's to say we do n't know to what extent hate speech is involved here , and that where there are milieus in which it 's a driving causal force , we know little about what it is within those milieus that facilitates the uptake of the dehumanizing attitudes being promulgated in hate speech . none of this should detract from the primary implications of murrow and murrow 's theses about how cognition is altered for subjects affected by dehumanization . dehumanization is dangerous ; it 's plausible to suppose that it 's some part of the explanation of mass state violence against ethnic outgroups , both in cases like nazi germany , where racialized justifications for violence were espoused forthrightly , and in cases like contemporary mass incarceration in the united states , where racialized violence runs amok even while overtly identity - prejudicial justifications for this state of affairs are largely confined to the political fringes . however , the gravity of such wrongs and the urgency of redress mean that the standards we apply , in assessing explanations of how the wrongs occur and what redress would require , should be more exacting , not less . in this i 'm echoing henry louis gates worry , that calls to curb racist speech may encourage societies to downplay the deeper , less - easily remediable , economic underpinnings of identity - based social hierarchies . i 'm also betraying a sympathy for martha minow 's claim that if the goal is to eradicate the dehumanization of the hated group , attention would more fruitfully turn to the surrounding social traditions and practices that have made and continue to make that group subject to dehumanization. these ideas are n't new , but they bear repeating . i should close by noting one area in which claims about hate speech 's dehumanizing influence are not so conjectural , but instead empirically well informed . international relations theorists and political philosophers trying to diagnose the causes of mass atrocity crimes , as in rwanda in 1994 , have identified intervention in dehumanizing propaganda as being , in at least some cases , a key preventative strategy . the intersection between this work , with its empirical insights into the origins of dehumanized attitudes ( at least in certain kinds of contexts ) , and murrow and murrow 's account of how exactly dehumanization modifies the cognition of affected subjects , is likely to be a fruitful space for inquiry .	murrow and murrow offer a novel account of dehumanization , by synthesizing data which suggest that where subject s has a dehumanized view of group g , s 's neural mechanisms of empathy show a dampened response to the suffering of members of g , and s 's judgments about the humanity of members of g are largely non - conscious . here i examine murrow and murrow 's suggestions about how identity - based hate speech bears responsibility for dehumanization in the first place . i identify a distinction between ( i ) accounts of the nature of the harm effected by identity prejudice , and ( ii ) accounts of how hate speech contributes to the harms of identity prejudice . i then explain why murrow and murrow 's proposal is more aptly construed as an account of type ( i ) , and explain why accounts of this type , even if they 're plausible and evidentially well - supported , have limited implications in relation to justifications for anti - hate speech law .
You are an expert at summarizing long articles. Proceed to summarize the following text: morphological differences based on general body type or unusual anatomical forms have been used to distinguish and compare among species and groups ( strass & bond , 1990 ) . both truss ( strass & bookstein , 1982 ) and classical ( hubbs & lagler , 1947 ) dimensions have been used to describe fish body shape . classical dimensions are the most used in studies of morphometric characteristics of fish ( strass & bond , 1990 ; park et al . truss dimensions , which include components of body depth and length along the longitudinal axis , have theoretical advantages over classical morphometric characters in discriminating among groups ( humphries et al . , 1981 ; strass & bookstein , 1982 ; winans , 1984 ; currens et al . , 1989 ; park et al . , 2001a , 2004 ) . basic understanding of morphometric characteristics has been based on three aspects : ( i ) identifying unidentified taxa such as unknown hybrids , and distinguishing sexes or species ; ( ii ) investigating mutated forms of groups and species ; and ( iii ) identifying and classifying biotypic associations ( strass , 1985 ; winans , 1985 ; taylor et al . , 1986 ; park et al . , 1997 , 2001a , 2001b , 2003 , 2004 , 2006a , 2006b ) taxonomically , the dark banded rockfish , sebastes inermis belongs to the scorpaeniformes ( family scorpaenidae ) and is an ovoviviparous teleost . it is distributed throughout the seas of korea and southern hokkaido ( japan ) ( jung , 1977 ; choi et al . , 2002 ) . it is an economically important species in coastal environments and is also reared in aquaculture . as dark banded rockfish is abundant it is possible to collect the fish throughout the year on the southern coast of korea , and it is a promising species for resources enhancement , including marine ranching ( jung , 1977 ; lee & kim , 1992 ) . the black rockfish , s. schlegeli is also ovoviviparous and a member of the scorpaenidae , and is distributed throughout the korea , japan , china and yellow seas ; in korean waters it is a resident coastal fish ( jung , 1977 ; national fisheries research & development agency , 1994 ) . the black rockfish occurs throughout winter in all coastal waters of korea because it is large , exhibits rapid growth amongst rockfish types , and is resilient to low temperatures . it is thus an appropriate target species for aquaculture and marine ranching ( park et al . , 2004 ) . the striped shiner , pungtungia herzi is a far eastern freshwater species belonging to the cypriniformes ( family gobioninae ) , and is widely distributed throughout korea , china , and japan . the slender shiner , pseudopungtungia tenuicorpa has the same taxonomic affiliation , but is an endemic korean species restricted to the han and imjin rivers ( kim & park , 2002 ) . 2012 ) reported reproduction and embryonic development , early growth and eye development of dark banded rockfish . in addition , microstructural growth of larval black rockfish was reported in 2000 ( lee & kim , 2000 ) . comparative study of striped shiner and slender shiner has been made of their phylogenetic relationships , based on urohyal characters ( kim & kang , 1989 ) . however , detailed comparative morphological studies of the striped and slender shiner have not been conducted . dark banded rockfish and black rockfish are one of seawater fish inhabited widely , and are breeding widely in korea ( lee & kim , 1992 ) . in addition , external morphology of two rockfish is similar , so that need to research two rockfish ( lee & kim , 2000 ; park et al . , 2012 ) . striped shiner and slender shiner are one of freshwater fish inhabited widely , and differences of morphometric characteristic between striped shiner and slender shiner are not shown nearly ( kim & kang , 1989 ) . therefore , in this study we investigated and compared the morphological features of these species in korea , using both classical and truss dimensions . the objectives were to identify those morphometric characteristics that differ significantly between the two scorpaenidae species , and to assess the origin of the two shiner species . dark banded rockfish , sebastes inermis and black rockfish , s. schlegeli were reared and maintained at the fishery genetics & breeding science laboratory , korea maritime and ocean university ( kmou ) , korea . the rockfish were reared in 1100 l frp circular culture tanks ( 118 cm diameter , 101 cm height ) , each of which contained 50 fish . during rearing ml / l , the ph was 7.528.32 , and the water temperature was maintained at 20.50.5. the fish were fed twice daily with extruded flounder pellets ( type ep , jeil feed , korea ) . specimens of striped shiner , pungtungia herzi and slender shiner , pseudopungtungia tenuicorpa were collected in july 2010 from a headwater tributary of the imjin river ( jinsangri , gunnam - myeon , yeonchen - gun , gyenggi - do , korea ) , which discharges into soyang lake , and from bukcheon ( buk - meon , inje - gun , gangweon - do , korea ) . specimens were also reared at the fishery genetics & breeding science laboratory , kmou , korea . digital pictures were taken for selected samples of each species using copystand and a nikon d80 camera ( d80 , nikon , japan ; figs . 3 and 4 ) . fish feeding was halted one day prior to morphometric analysis . fifty fish of each species were collected and anaesthetized with a mixture of 500 ppm lidocaine - hcl ( hongseong pharmaceuticals , korea ) and 1,000 ppm nahco3 ( sigma , usa ) , following the method of park et al . ( 2004 ) . the morphometric characteristics ( including both classical and truss dimensions ) used in an experiments concerning starvation in the chinese minnow , rhynchocypris oxycephalus , were applied in the morphometric analysis in the present study ( park et al . the morphometric characteristics of each species were measured to the nearest 1.0 mm , 0.1 mm using a digital vernier caliper ( cd-20cp , mitutoyo , japan ) , respectively . nine classical dimensions were measured for the rockfish species ( dalps , dalad , dalaa , dalav , dalmo , dalpd , dalbp , dalpa , and ch ) , while for the shiner species 12 measurements were made ( dalps , dalad , dalaa , dalav , dalmo , daldc , dalap , dalpm , dadav , dpdpl , ch , and dplpa ) ( tables 1 and 2 ; figs . ( a ) classical dimensions : 1 , dalps ; 2 , dalad ; 3 , dalmo ; 4 , dalpd ; 5 , dalbp ; 6 , dalav ; 7 , dalpa ; 8 , dalaa ; 9 , ch . ( b ) truss dimensions : 1 , dalps ; 2 , dpsmo ; 3 , dadpd ; 4 , dadpa ; 5 , dadaa ; 6 , davaa ; 7 , davpd ; 8 , daapa ; 9 , daapd ; 10 , dpdpa ; 11 , ch . ( a ) classical dimensions : 1 , dalps ; 2 , dalad ; 3 , daldc ; 4 , dalaa ; 5 , dalav ; 6 , dalap ; 7 , dalpm ; 8 , dalmo ; 9 , dadav ; 10 , dpdpl ; 11 , ch ; 12 , dplpa . ( b ) truss dimensions : 1 , dalps ; 2 , dalpm ; 3 , dpsad ; 4 , dpsav ; 5 , dpsap ; 6 , dpspm ; 7 , dadpd ; 8 , dadaa ; 9 , dadav ; 10 , dadap ; 11 , dpddc ; 12 , dpdvc ; 13 , dpdpa ; 14 , daapd ; 15 , davpd ; 16 , ch ; 17 , ddcpa ; 18 , dvcpa ; 19 , daapa ; 20 , davaa ; 21 , davap ; 22 , dappm . refer to table 2 for details of the dimensions . body shape dimensions for the dark banded rockfish , sebastes inermis and the black rockfish , s. schlegeli eleven truss dimensions were measured for the rockfish species ( dalps , dpsmo , dadpd , dadpa , dadaa , davaa , davpd , daapa , daapd , dpdpa , and ch ) , while for the shiner species 22 measurements were made ( dalps , dalpm , dpsad , dpsav , dpsap , dpspm , dadpd , dadaa , dadav , dadap , dpddc , dpdvc , dpdpa , daapd , davpd , ch , ddcpa , dvcpa , daapa , davaa , davap , and dappm ) ( tables 1 and 2 ; figs . 1b and 2b ) . in addition , the standard length ( ls ) was measured for each species ( tables 1 and 2 ; figs . 1 and 2 ) , and the eye diameter ( ed ) was measured for the rockfish species ( table 2 ; fig . body shape dimensions for the striped shiner , pungtungia herzi and the slender shiner , pseudopungtungia tenuicorpa data on the morphometric traits of each species were arc sin square root transformed , and analyzed relative to the standard length ( ls ) of each species ( park et al . , 2001a , 2001b , 2007 ) . to assess the statistical significance of differences in measurements and average values of each parameter we used a one - way anova ( spss 9.0 , spss inc . we used duncan s multiple range test ( p < 0.05 ) for the rockfish species , and for the shiner species the sidak pairwise test was used for multiple comparisons ; differences between means were regarded as significant at p < 0.01 . dark banded rockfish , sebastes inermis and black rockfish , s. schlegeli were reared and maintained at the fishery genetics & breeding science laboratory , korea maritime and ocean university ( kmou ) , korea . the rockfish were reared in 1100 l frp circular culture tanks ( 118 cm diameter , 101 cm height ) , each of which contained 50 fish . during rearing ml / l , the ph was 7.528.32 , and the water temperature was maintained at 20.50.5. the fish were fed twice daily with extruded flounder pellets ( type ep , jeil feed , korea ) . specimens of striped shiner , pungtungia herzi and slender shiner , pseudopungtungia tenuicorpa were collected in july 2010 from a headwater tributary of the imjin river ( jinsangri , gunnam - myeon , yeonchen - gun , gyenggi - do , korea ) , which discharges into soyang lake , and from bukcheon ( buk - meon , inje - gun , gangweon - do , korea ) . specimens were also reared at the fishery genetics & breeding science laboratory , kmou , korea . digital pictures were taken for selected samples of each species using copystand and a nikon d80 camera ( d80 , nikon , japan ; figs . 3 and 4 ) . fish feeding was halted one day prior to morphometric analysis . fifty fish of each species were collected and anaesthetized with a mixture of 500 ppm lidocaine - hcl ( hongseong pharmaceuticals , korea ) and 1,000 ppm nahco3 ( sigma , usa ) , following the method of park et al . ( 2004 ) . the morphometric characteristics ( including both classical and truss dimensions ) used in an experiments concerning starvation in the chinese minnow , rhynchocypris oxycephalus , were applied in the morphometric analysis in the present study ( park et al . the morphometric characteristics of each species were measured to the nearest 1.0 mm , 0.1 mm using a digital vernier caliper ( cd-20cp , mitutoyo , japan ) , respectively . nine classical dimensions were measured for the rockfish species ( dalps , dalad , dalaa , dalav , dalmo , dalpd , dalbp , dalpa , and ch ) , while for the shiner species 12 measurements were made ( dalps , dalad , dalaa , dalav , dalmo , daldc , dalap , dalpm , dadav , dpdpl , ch , and dplpa ) ( tables 1 and 2 ; figs . ( a ) classical dimensions : 1 , dalps ; 2 , dalad ; 3 , dalmo ; 4 , dalpd ; 5 , dalbp ; 6 , dalav ; 7 , dalpa ; 8 , dalaa ; 9 , ch . ( b ) truss dimensions : 1 , dalps ; 2 , dpsmo ; 3 , dadpd ; 4 , dadpa ; 5 , dadaa ; 6 , davaa ; 7 , davpd ; 8 , daapa ; 9 , daapd ; 10 , dpdpa ; 11 , ch . refer to table 1 for details of the dimensions . ( a ) classical dimensions : 1 , dalps ; 2 , dalad ; 3 , daldc ; 4 , dalaa ; 5 , dalav ; 6 , dalap ; 7 , dalpm ; 8 , dalmo ; 9 , dadav ; 10 , dpdpl ; 11 , ch ; 12 , dplpa . ( b ) truss dimensions : 1 , dalps ; 2 , dalpm ; 3 , dpsad ; 4 , dpsav ; 5 , dpsap ; 6 , dpspm ; 7 , dadpd ; 8 , dadaa ; 9 , dadav ; 10 , dadap ; 11 , dpddc ; 12 , dpdvc ; 13 , dpdpa ; 14 , daapd ; 15 , davpd ; 16 , ch ; 17 , ddcpa ; 18 , dvcpa ; 19 , daapa ; 20 , davaa ; 21 , davap ; 22 , dappm . refer to table 2 for details of the dimensions . body shape dimensions for the dark banded rockfish , sebastes inermis and the black rockfish , s. schlegeli eleven truss dimensions were measured for the rockfish species ( dalps , dpsmo , dadpd , dadpa , dadaa , davaa , davpd , daapa , daapd , dpdpa , and ch ) , while for the shiner species 22 measurements were made ( dalps , dalpm , dpsad , dpsav , dpsap , dpspm , dadpd , dadaa , dadav , dadap , dpddc , dpdvc , dpdpa , daapd , davpd , ch , ddcpa , dvcpa , daapa , davaa , davap , and dappm ) ( tables 1 and 2 ; figs . in addition , the standard length ( ls ) was measured for each species ( tables 1 and 2 ; figs . 1 and 2 ) , and the eye diameter ( ed ) body shape dimensions for the striped shiner , pungtungia herzi and the slender shiner , pseudopungtungia tenuicorpa data on the morphometric traits of each species were arc sin square root transformed , and analyzed relative to the standard length ( ls ) of each species ( park et al . , 2001a , 2001b , 2007 ) . to assess the statistical significance of differences in measurements and average values of each parameter we used a one - way anova ( spss 9.0 , spss inc . we used duncan s multiple range test ( p < 0.05 ) for the rockfish species , and for the shiner species the sidak pairwise test was used for multiple comparisons ; differences between means were regarded as significant at p < 0.01 . the average ls was 13.61.05 cm for dark banded rockfish , sebastes inermis , 14.91.31 cm for black rockfish , s. schlegeli , 68.24.34 cm for striped shiner , pungtungia herzi , and 53.13.56 cm for slender shiner pseudopungtungia tenuicorpa , respectively . the comparative results for the ls and the classical and truss dimensions for all species are shown in tables 3 and 4 . means and standard deviations of classical and truss dimensions for the dark banded rockfish , sebastes inermis and the black rockfish , s. schlegeli , and the results of an anova - test for differences among groups refer to table 1 for details of dimensions . data ( meanssd , n = 50 ) were analyzed using a one - way anova on data arcsine square root transformed . the measured values of the classical dimensions dalps/ ls , dalad / ls , dalpd / ls , dalav / ls and dalpa / ls for the dark banded rockfish were larger than those for the black rockfish . the value of dark banded rockfish for classical dimension ( namely measurement items of body length based on body axis ) was larger than that of black rockfish of body ( table 3 ; fig . 3 ) . there was no significant difference between dark banded rockfish and black rockfish for the classical traits dalbp and dalaa ( from the premaxilla to the basal area of the pectoral fin and the start of the base of the anal fin , respectively ; table 3 ; fig . the results for measurement of classical dimensions in the two shiner species are shown in table 4 . the values of dalps / ls , dalad / ls , daldc / ls , dalaa / ls , dalav/ ls , dalap / ls , dalmo / ls , dadav / ls , and ch / ls were significantly greater for the striped shiner than the slender shiner ( p < 0.01 ) , whereas the opposite was found for the values of dpdpl / ls and dplpa / ls . we found no significant difference between the values of dalpm / ls between the two shiner species . classical and truss dimensions for the striped shiner , pungtungia herzi and the slender shiner , pseudopungtungia tenuicorpa see table 1 for details of dimensions . data ( means sd , n = 50 ) were analyzed using a one - way anova on data arcsine square root transformed . some of the measured classical dimension were common to both the rockfish and shiners , ( dalps , dalad , dalmo , dalav , dalaa , and ch ; tables 1 and 2 ; figs . as shown in tables 3 and 4 , the value of dalmo / ls was significantly greater for the rockfish than the shiner , whereas the opposite was found for the values of dalad/ ls and dalav / ls . thus , the length from the lip to the opecular cover was longer in rockfish than in shiner , and the lengths from the lip to the dorsal and ventral fins were longer in shiner than in rockfish ( figs 3 and 4 ) . these results show that the body length relative to the head region is greater in shiners than rockfish . classical dimensions have commonly been assessed in studies of the morphometric characteristics of fish bodies . these dimensions are focused on characteristics of the body length , depth , and width , and are mainly studied with respect to the anterior posterior axis of the body , including the tail and head regions ( strass & bond , 1990 ; park et al . , 2001a , 2004 , 2007 ) . the dalps / ls and ch measurements were common to both the classical and truss dimensions , and their values for dark banded rockfish were greater than for black rockfish ( p < 0.05 ; table 3 ) . as the ch / ls ( caudal peduncle height ) value for the dark banded rockfish is greater than that for the black rockfish , the upper side of the black rockfish from the dorsal fin to the caudal fin is curved slightly down ( fig . 3 ) , while in the dark banded rockfish it is almost a straight line . the ed / ls ( head ) value was greater ( 12.4% ) for the dark banded rockfish than for the black rockfish ( 9.3% ) ( p < 0.05 ) . the dalmo / ls and dpsmo / ls values for the head in the dark banded rockfish ( 35.1% and 17.4% , respectively ) were less than for the black rockfish ( 36.5% and 18.4% , respectively ) ( tables 2 and 3 ) ( p < 0.05 ) . these results show that size of the eye as a functionof head size is large in the dark banded rockfish relative to the black rockfish . lines of each picture are classical dimension and truss dimension having significantly difference ( p > 0.05 ) . ( a ) classical dimension : 1 , dalad ; 2 , dalmo ; 3 , dalpd ; 4 , dalpa ; 5 , ch . ( b ) truss dimension : 1 , dalps ; 2 , dpsmo ; 3 , davpd ; 4 , daapd ; 5 , dpdpa . black line : dark banded rockfish > black rockfish ; white line : dark banded rockfish < black rockfish . as shown in table 3 , the values of dalmo / ls ( classical dimension ) and dpsmo / ls ( truss dimension ) were greater for the black rockfish than for the dark banded rockfish ( p < 0.05 ) . the length from the premaxilla to the end of the opercular of the operculum in the black rockfish was longer than in the dark banded rockfish ( fig . the truss and classical dimensions for most of the head and body region , and the caudal peduncle height , were significantly greater for the striped shiner , whereas measurements of the caudal region in relation to the anterior posterior body axis were significantly greater in the slender shiner ( fig . ( 2004 ) investigated eye traits as head measurements is that clarify width between two eyes / distances between head length or premaxilla and two eyes / morphometrics of head length in catfish ( siluridae ) . lines of each picture are classical dimension ( a ) and truss dimension ( b ) having significantly difference ( p > 0.05 ) . ( a ) classical dimension : 1 , dalps ; 2 , dalad ; 3 , dalaa ; 4 , dpdpl ; 5 , dplpa . ( b ) truss dimension : 1 , dpsav ; 2 , dpsap ; 3 , dpddc ; 4 , davpd ; 5 , ddcpa ; 6 , dvcpa . black line : striped shiner > slender shiner ; white line : slender shiner < striped shiner . katoh & tokimura ( 2001 ) compared measurements among the marbled rockfish , s. marmoratus , the red marbled rockfish , s. tertius , and the yellow barred red rockfish , s. albofasciatus , which are related to the two rockfish used in the present study . for these species the distance between the anterior upper jaw and the base of the dorsal fin differed , but no difference was found for the distance between the start of the base of the dorsal fin and the start of the base of the anal fin . in addition , they reported that the distance between the anterior upper jaw and the start of the base of the dorsal fin was greater in the marbled rockfish than in the red marbled rockfish . we found a similar trend in comparisons between the dark banded rockfish and the black rockfish . ( 2007 ) conducted a 12-week starvation experiment in olive flounder , paralichthys olivaceus . in terms of truss dimensions , starvation in this predator resulted in a relative increase in body depth . , while in terms of classical dimensions starvation resulted in a decrease in the values of traits related to the anterior posterior axis of body , and an increase in the value of traits related to the head . truss dimensions have also been applied to understanding the morphometric characteristics of chinese minnow , rhynchocypris oxycephalus in relation to starvation and predation . under these conditions changes occurred in the characteristics of the body , rear body , and tail parts . it can identify whether various feed supply due to habitat difference and constant under head part is used as taxonomic indicators of rhynchocypris sp . at starvation and predation experiment in chinese minnow , inversely . as these fishes show variable measurements following habitat modification ( especially starvation ) and changes in nutritional status ( such as food supplementation ) , it is essential to establish which morphometric characteristics in which species do not change as a function of variations in feed and environmental conditions ( park et al . of those measurements for which the values were greater in the dark banded rockfish than in the black rockfish , the truss dimensions davpd / ls , daapa / ls , daapd / ls , and dpdpa / ls were largely related to the body depth from the start of the base of the ventral fin to the end of the base of the dorsal fin ( table 3 ; fig . the dark banded rockfish did not differ significantly from the black rockfish with respect to the measurement from the start of the base of the dorsal fin to the end of the base of dorsal fin of posterior body , the start of the base of the dorsal fin and the end of the base of the dorsal fin , and from the start of the base of the ventral fin to point for the base of the caudal fin , as there were no significant differrences in truss dimensions between the dark banded rockfish and the black rockfish for the values of dadpd / ls , dadpa / ls , dadaa/ ls , and davaa / ls ( p > 0.05 ) ( table 3 ; fig . the truss dimensions for the two shiner species are shown in table 4 . amongst these the values of dalps / ls , dpsav / ls , dpsap / ls , dpspm / ls , dadaa / ls , dadav / ls , dadap / ls , dpdpa / ls , daapd / ls , davpd / ls , ch / ls , davaa / ls , and dappm / ls were significantly greater in the striped shiner than in the slender shiner ( p < 0.01 ) , the values for dpddc / ls , ddcpa / ls , and dvcpa / ls were significantly greater in the slender shiner ( p > 0.01 ) , and no significant difference was found between the species for the values of dalpm / ls , dpsad / ls , dadpd / ls , dpdvc / ls , daapa / ls , and davap / ls . comparing morphometric characteristics between dark banded rockfish and black rockfish , the classical dimensions dalad , dalpd , dalpa and ch of dark banded rockfish were higher than those of black rockfish , and dalmo of dark banded rockfish was lower than black rockfish ( table 3 and fig . the truss dimensions dalps , davpd , daapd and dpdpa of dark banded rockfish were higher than black rockfish , and dpsmo of dark banded rockfish was lower than black rockfish ( table 3 and fig . 3b ) . comparing morphometric characteristics between striped shiner and slender shiner , the classical dimensions dalps , dalad and dalaa of striped shiner were higher than those of slender shiner , and dpdpl and dplpa of striped shiner was lower than slender shiner ( table 4 and fig . the truss dimensions dpsav , dpsap and davpd of striped shiner were higher than slender shiner , and dpddc , ddcpa and dvcpa of striped shiner was lower than slender shiner ( table 4 and fig . the truss dimensions dalps , padpd , dadaa , davaa , davpd , daapa , daapd , dpdpa and ch were common to all species in the study ( tables 1 and 2 ; figs . 1 and 2 ) . as shown in tables 3 and 4 , the truss measurements dadpd / ls , dadaa / ls , davaa / ls , davpd / ls , daapa / ls , and daapd / ls were significantly greater in the rockfish than in the shiner , whereas the dpdpa / ls value was significantly greater in the shiner than the rockfish . thus , the lengths between the dorsal fins , from the dorsal fin to the ventral and anal fins , between the anal fins , and from the ventral to the anal fin were longer in the rockfish than in the shiner , whereas the vertical length of the tail region was longer in the shiner than in the rockfish ( figs . 3 and 4 ) . these results indicate that shiners have an almost straight body line from head to tail , but rockfish have a relatively curved body shape . in addition , the rockfish generally had greater truss dimension values compared with the shiner ( tables 3 and 4 ) , indicating that the body depth is greater in rockfish than in shiners . ( 2004 ) reported that for three truss dimensions the slender catfish , silurus microdorsalis had greater values than the far eastern catfish , s. asotus . park et al . ( 2006c ) reported a similar finding for comparison of the bull - head torrent catfish , liobagrus obesus and the korean torrent catfish , l. andersoni with the yellow catfish , l. mediadiposalis . they suggested that truss dimensions are appropriate taxonomic indicators for discriminating among species of the siluridae and the amblycipitidae . for more than 30 years , most morphometric investigations of fish have based character selection on the classical dimensions of length , depth , and width , primarily in the head and tail regions ( hubbs & lagler , 1947 ) . these dimensions are concentrated along the anterior posterior body axis and in the head caudal regions , producing an uneven and biased coverage of the entire body form ( li et al . , 1993 ) . to describe the shape of a fish using a uniform network of distance measures , humphries et al . ( 1981 ) suggested a criss - cross pattern along the body form , termed the truss dimensions . in a comparison of rockfish , shiner and catfish , the anal fin and caudal peduncle height of striped shiner were greatest than the other species , but the ed of slender catfish and the head region of slender shiner were smallest ( park et al . , 2004 ) . in addition , the lengths between the lip and the dorsal fin , and between the lip and the ventral fin were significantly smaller in catfish relative to the other species , particularly shiner . our results also indicate that certain truss or classical dimensions may be useful as taxonomic indicators for discriminating among species of rockfish and shiner . furthermore , comparison with other species may be useful when similarities and differences are evident . in addition , caudal region dimensions ( and some truss and classical dimensions that have been used as taxonomic indicators and in relation to embryology , ecology and physiology in salmonid fry , chinese minnow and far eastern catfish , respectively ) may also prove useful in discriminating among species of rockfish and shiner ( currens et al . our findings illustrate that this set of truss dimensions facilitates the detection of differences in shape in oblique , longitudinal and vertical directions , as noted by strass & bond ( 1990 ) . the configuration of landmarks reconstructed from measured distances that result in no loss of information has advantages over the use of classical morphometric characters in discriminating in rockfish and shiner . our results indicate that the use of the truss network as a character set enforces representative coverage across the body form , enhancing discrimination among species .	measurements of closely related sets of classical and truss dimensions were analyzed to discriminate species of scorpaenidae including the dark banded rockfish , sebastes inermis , the black rockfish , s. schlegeli , and gobioninae including the striped shiner , pungtungia herzi , and the slender shiner , pseudopungtungia tenuicorpa . the measurements of the dimensions were arc sin square root transformed , and compared as a function of the standard length of each species for statistical analysis . for values of the classical dimensions of the rockfish , 6 were greater for the dark banded rockfish than for the black rockfish , 1 value was smaller for the former , and for 2 values there was no statistically significant difference ( p > 0.05 ) . for values of the classical dimensions of the shiners , 9 values were greater for the striped shiner than for the slender shiner , 2 values were smaller for the former , and for 1 value there was no statistically significant difference ( p > 0.01 ) . for values of the truss dimensions of the rockfish , 6 were greater for the dark banded rockfish than for the black rockfish , 1 was smaller for the former , and for 4 values there was no statistically significant difference ( p > 0.05 ) . for values of the truss dimensions of the shiners , 13 values were greater for the striped shiner than for the slender shiner , 3 values were smaller for the former , and for 6 values there was no statistically significant difference ( p > 0.01 ) . the dimension sets used in this study may be useful as taxonomic indicators for discriminating among fish species in korea .
You are an expert at summarizing long articles. Proceed to summarize the following text: their frequency varies with the type of cancer and is especially high in patients with malignant brain tumors ; germ cell tumors ; and adenocarcinomas of the ovary , pancreas , colon , stomach , lung , and prostate [ 1 , 2 ] . in most cases , the thrombi are associated with surgery , central venous catheter insertion , or the use of chemotherapeutic agents such as cisplatin . sometimes , a thrombus develops because of tumor embolization , vascular compression by the tumor mass , or primary tumor metastasis [ 4 - 7 ] . we encountered 2 interesting cases of thromboembolic events that were not associated with chemotherapy , central venous catheter insertion , or underlying coagulation factor abnormalities in 2 girls with germ cell tumors . a 12-year - old girl presented with a 3-week history of fever and myalgia and a 4-day history of a palpable neck mass . her weight was 40.15 kg ( 60th percentile ) ; height , 157 cm ( 80th percentile ) ; and body mass index ( bmi ) , 16.29 kg / m . a non - painful , palpable firm mass , the size of an adult fist , was detected on her left lower abdomen . a small mass was also detected on the right side of her neck ; it was superficial and movable , but not tender . abdominal computed tomography ( ct ) indicated a large mass on the left ovary ( 108 cm ) , and neck doppler ultrasonography revealed an expansile thrombus in the right internal jugular vein ( ijv ) ( fig . the coagulation profile results were as follows : prothrombin time ( pt ) , 14.8 s ; activated partial thromboplastin time ( aptt ) , 32 s ; fibrinogen level , 1,150 mg / dl ; level of fibrinogen degradation products , 5 - 20 g / ml ; d - dimer level , 2.5 mg / l ; protein - c level , 113% ; protein - s level , 82% ; antithrombin iii level , 66% ; and lupus anticoagulant , positive . levels of serum alpha fetoprotein ( afp ) , beta - human chorionic gonadotropin ( -hcg ) , and lactate dehydrogenase ( ldh ) were 770.3 ng / ml , < 0.1 miu , and 278 iu / l , respectively . the patient underwent left salpingo - oophorectomy , and pathological examination indicated an endodermal sinus tumor . the salpinx and appendix were normal , but the omentum showed chronic inflammation with fibrosis and mesothelial hyperplasia . because whole body positron emission tomography ( pet)- ct and chest ct did not show evidence of distant metastasis , we started postoperative chemotherapy without management of the ijv thrombus and decided to observe the latter during serial follow - up visits , unless it caused any symptoms or became enlarged . after 2 cycles of chemotherapy with bleomycin , etoposide , and cisplatin , the patient was discharged from hospital without any complications related to the thrombus . one month after the completion of chemotherapy , neck ultrasonography indicated that the size of thrombus in the ijv had decreased . three months later , even without chemotherapy , the thrombus disappeared and the flow in the vein normalized ( fig . the patient has been followed - up for more than 3 years , without recurrence of the thrombus as well as the primary tumor . a 14-year - old girl presented with a 1-month history of polydipsia and hypersomnia . her weight was 55.15 kg ( 75th percentile ) ; height , 153 cm ( 25th percentile ) ; and bmi , 22.57 kg / m . the patient had been taking synthroid , desmin , and hydrocortisone for panhypopituitarism , and a metastatic work - up was performed after surgery . there proved to be no evidence of metastasis , but chest ct and a pet - ct scan revealed an acute thromboembolism with inflammatory changes and ground glass opacity on the right lower lobe ( fig . the coagulation profile results were as follows : pt , 11.9 s ; aptt , 33 s ; d - dimer level , 0.12 mg / l ; and protein s level , 55% . the serum afp level was 1.6 ng / ml , the -hcg level was < 0.1 miu , and the ldh level was 220 hormonal levels , including luteinizing hormone , follicular stimulating hormone , progesterone , and estradiol , were within the normal ranges . before postoperative chemotherapy , we started oral heparin ( 2 mg / day ) and subcutaneous warfarin ( 5,000 iu / day ) on a 2-week schedule . after 7 days , pt ( international normalized ratio , inr ) had risen to 2.06 ; therefore , administered warfarin only for the remaining 7 days . pt and aptt remained within the normal range for the next 7 days , at the end of which , a chest ct scan showed that the pulmonary thromboembolism had disappeared ( fig . thereafter , a central venous catheter was inserted and we started chemotherapy for a pure germinoma , with carboplatin , etoposide , and cyclophosphamide , followed by cranial radiotherapy . the patient has been well for 1 year , without recurrence of the thrombus as well as the primary tumor . a 12-year - old girl presented with a 3-week history of fever and myalgia and a 4-day history of a palpable neck mass . her weight was 40.15 kg ( 60th percentile ) ; height , 157 cm ( 80th percentile ) ; and body mass index ( bmi ) , 16.29 kg / m . a non - painful , palpable firm mass , the size of an adult fist , was detected on her left lower abdomen . a small mass was also detected on the right side of her neck ; it was superficial and movable , but not tender . abdominal computed tomography ( ct ) indicated a large mass on the left ovary ( 108 cm ) , and neck doppler ultrasonography revealed an expansile thrombus in the right internal jugular vein ( ijv ) ( fig . the coagulation profile results were as follows : prothrombin time ( pt ) , 14.8 s ; activated partial thromboplastin time ( aptt ) , 32 s ; fibrinogen level , 1,150 mg / dl ; level of fibrinogen degradation products , 5 - 20 g / ml ; d - dimer level , 2.5 mg / l ; protein - c level , 113% ; protein - s level , 82% ; antithrombin iii level , 66% ; and lupus anticoagulant , positive . levels of serum alpha fetoprotein ( afp ) , beta - human chorionic gonadotropin ( -hcg ) , and lactate dehydrogenase ( ldh ) were 770.3 ng / ml , < 0.1 miu , and 278 iu / l , respectively . the patient underwent left salpingo - oophorectomy , and pathological examination indicated an endodermal sinus tumor . the salpinx and appendix were normal , but the omentum showed chronic inflammation with fibrosis and mesothelial hyperplasia . because whole body positron emission tomography ( pet)- ct and chest ct did not show evidence of distant metastasis , we started postoperative chemotherapy without management of the ijv thrombus and decided to observe the latter during serial follow - up visits , unless it caused any symptoms or became enlarged . after 2 cycles of chemotherapy with bleomycin , etoposide , and cisplatin , the patient was discharged from hospital without any complications related to the thrombus . one month after the completion of chemotherapy , neck ultrasonography indicated that the size of thrombus in the ijv had decreased . three months later , even without chemotherapy , the thrombus disappeared and the flow in the vein normalized ( fig . the patient has been followed - up for more than 3 years , without recurrence of the thrombus as well as the primary tumor . her weight was 55.15 kg ( 75th percentile ) ; height , 153 cm ( 25th percentile ) ; and bmi , 22.57 kg / m . the patient had been taking synthroid , desmin , and hydrocortisone for panhypopituitarism , and a metastatic work - up was performed after surgery . there proved to be no evidence of metastasis , but chest ct and a pet - ct scan revealed an acute thromboembolism with inflammatory changes and ground glass opacity on the right lower lobe ( fig . the coagulation profile results were as follows : pt , 11.9 s ; aptt , 33 s ; d - dimer level , 0.12 mg / l ; and protein s level , 55% . the serum afp level was 1.6 ng / ml , the -hcg level was < 0.1 miu , and the ldh level was 220 hormonal levels , including luteinizing hormone , follicular stimulating hormone , progesterone , and estradiol , were within the normal ranges . before postoperative chemotherapy , we started oral heparin ( 2 mg / day ) and subcutaneous warfarin ( 5,000 iu / day ) on a 2-week schedule . after 7 days , pt ( international normalized ratio , inr ) had risen to 2.06 ; therefore , administered warfarin only for the remaining 7 days . pt and aptt remained within the normal range for the next 7 days , at the end of which , a chest ct scan showed that the pulmonary thromboembolism had disappeared ( fig . thereafter , a central venous catheter was inserted and we started chemotherapy for a pure germinoma , with carboplatin , etoposide , and cyclophosphamide , followed by cranial radiotherapy . the patient has been well for 1 year , without recurrence of the thrombus as well as the primary tumor . in children , thromboembolism is characteristically seen in combination with serious underlying medical disorders and the incidence is very low . studies report that the incidence of venous thromboembolism is 8.6 - 57:100,000 and that of pulmonary thromboembolism is 0.007 - 0.53:100,000 in hospitalized children , whereas the incidence of venous thromboembolism in all children in the community is estimated to be 0.14 - 0.9:100,000 . this is due to a combination of heightened awareness regarding thromboembolism in the pediatric population ; increased utilization of vascular access devices in intensive care units ; and increased use of indwelling catheters for intravenous antibiotics , parenteral nutrition , and chemotherapy . the most common causes of thromboembolism in children with cancer are the effect of the tumor mass and tumor - associated operations or procedures . the incidence of thromboembolism is significantly lower in children than in adults [ 4 - 8 ] . cisplatin is thought to initiate degenerative processes in vessel walls and also to alter the balance between thrombosis and the dissolution of blood clots , eventually causing occlusive vascular disease . the incidence of germ cell tumor - associated thromboembolism is not known and there are only scattered reports of such cases . thromboembolisms in germ cell tumors could be associated with elevated serum -hcg levels , obesity , and high serum ldh levels [ 12 , 13 ] . these are the reasons for frequent venous thromboembolisms in gliomas , which are usually accompanied by elevated serum -hcg levels . coagulation abnormalities such as protein c and s deficiency or antithrombin deficiency , thrombocythemia , elevated homocysteine levels , and abnormal lipid profile with obesity could also cause thromboembolism in children . in this study , both patients had normal bmis and no coagulation abnormalities . one of the patients had a high afp level , but -hcg levels , which are related to tumor - associated thromboembolisms , were within the normal range in both patients . a further point of interest is that the thromboembolisms in our patients did not seem to be associated with surgery or any kind of procedure . although one of the patients ( patient 2 ) underwent osteoclastic cranioplasty prior to detection of the pulmonary embolism , thromboembolisms due to brain surgery are rarely reported and they tend to occur near the operation site [ 4 - 8 ] . the initial and standard pharmacological approach for patients with thromboembolisms is intravenous administration of unfractionated heparin ( ufh ) followed by long - term administration of warfarin . warfarin should be initiated at 0.2 mg / kg / dose with dose adjustments based on inr . ufh requires laboratory monitoring and has major side effects such as bleeding complications , immune thrombocytopenia , and osteoporosis . it would be measured every 4 h until 2 consecutive aptts are within the goal range , and thereafter , every 24 h . anticoagulation may be required for 3 - 6 months , and longer treatment is indicated in patients with ongoing thrombotic disease . recently , ufh has been replaced by subcutaneously administered low molecular - weight heparin , which is as effective as ufh but safer and can be administered in fixed , weight - adjusted doses . if anticoagulation therapy is not effective , thrombolysis with recombinant tissue plasminogen activator is recommended . the thromboembolism resolved spontaneously in one of our patients . in the other , we administered heparin and warfarin combination therapy for 7 days , and thereafter , only warfarin for the remaining 7 days because of the increased pt ( inr ) . in principle , this treatment was insufficient for the pulmonary thromboembolism , but the patient 's chest ct improved and she has had no symptoms of thromboembolism since then . herein , we describe 2 cases of thromboembolisms found in association with pediatric germ cell tumors , which differ from many other cases in that there was no evidence of underlying coagulation abnormalities or contributory procedures or drugs .	we describe 2 cases in which radiographic evidence of thromboembolic events was obtained during germ cell tumor diagnosis . there was no evidence of coagulation factor abnormalities or contributory procedures or drugs in either patient . we used anticoagulation therapy for thrombolysis in one patient , but in the other , the thromboembolism resolved spontaneously .
You are an expert at summarizing long articles. Proceed to summarize the following text: as part of a broad effort to define the human virome , we performed high - throughput sequencing ( genome analyzer iix ; illumina inc . , san diego , ca , usa ) on several plasma samples from children with febrile illness ( k.m . the human research protection office , washington university ( st . louis , mo , usa ) approved this study . the case report in this article describes results generated from study of a 20-month - old boy with a history of transient and resolved neutropenia . louis children s hospital for petechial rash ( 3-day history ) , fever < 40c ( 1-day history ) , cough , and nasal congestion . the evaluation included a leukocyte count , with results ( 7.8 10 cells / mm ) within the reference values and with a differential count of 26% bands , 59% neutrophils , 8% lymphocytes , 6% monocytes , and 1% atypical lymphocyte ; blood culture results were negative . nasopharyngeal swab specimen was negative for respiratory syncytial virus , influenza types a and b , parainfluenza , and adenovirus by fluorescent antibody testing , and culture results were negative for respiratory viruses . chest radiograph was interpreted as showing mild peribronchial thickening , which may represent a viral process . in addition , plasma or blood samples from the patient were subjected to a battery of pcr screenings for the following viruses , the results of which were all negative : adenovirus ; enteroviruses ( enterovirus asr ; cepheid inc . , sunnyvale , ca , usa ) ; human herpesvirus 6 and 7 ; parvovirus b19 ( realstar parvovirus b19 pcr kit 1.0 ; altona diagnostics , hamburg , germany ) ; human bocavirus ; cytomegalovirus ( whole blood ) ; epstein - barr virus ( whole blood ) ; and jc , bk , wu , and ki polyomaviruses . total nucleic acid was extracted from 100 l of the patient s plasma by using the roche ( indianapolis , in , usa ) magna pure system and randomly amplified by using a sequence - independent pcr strategy as described ( 12 ) . amplicons were sheared and , following standard library construction , were sequenced by using the genome analyzer iix ( illumina inc . ) according to the manufacturer s protocol . when present in the sheared amplicons , the primer used for random amplification was removed , resulting in 83-nt sequences . from all reads , 238 had > 80% nt identity to the partial mlb2 sequence in genbank ( gq502192.1 ) when aligned by using cross_match software ( www.phrap.org/phredphrapconsed.html#block_phrap ) . in addition , 374 sequence reads with similarity to anelloviruses were detected in this sample by alignment of the reads to the genbank nt and nr databases , using cross_match and blastx ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) , respectively . anelloviruses are commonly detected in human blood ( 13 ) and have no known disease association . no reads aligned with any other viruses , except endogenous human retrovirus sequences . given the number of sequence reads from the plasma sample that could be aligned with the 3,280-nt sequence of mlb2 ( accession no . gq502192.1 ) in genbank , we reasoned that additional reads were likely to be present from parts of the mlb2 genome that had not yet been sequenced . to provide a complete reference genome for such an analysis , we sequenced the complete mlb2 genome from a previously described isolate ( genbank accession no . gq502192.1 ) ( 3 ) from a stool sample by using a combination of reverse transcription pcr ( rt - pcr ) , 3 and 5 rapid amplification of cdna ends , and pyrosequencing on a genome sequencer ( roche ) as described ( 4 ) . the complete mlb2 genome of 6,119 nt , excluding the polya tail , was confirmed by sanger sequencing of overlapping rt - pcr amplicons and has been deposited in genbank ( accession no . comparison of the high - throughput sequencing reads from the plasma to the complete genome yielded an additional 199 reads with > 80% nt identity . assembly of all reads yielded 10 contigs , with an average length of 305 bp , which aligned throughout the mlb2 genome ( figure ) . conventional rt - pcr and quantitative taqman rt - pcr independently confirmed the presence of mlb2 in the plasma sample . the complete sequence of the capsid ( open reading frame 2 ) of this plasma - derived mlb2 strain was obtained by rt - pcr ( genbank jf742760 ) by using primers designed from the stool - derived mlb2 strain . the capsid of the plasma - derived mlb2 strain has 99% nt identity with the stool - derived mlb2 strain . because of limited quantities of the plasma sample , we were unable to sequence the complete genome of the plasma - derived mlb2 . map of 10 plasma - derived astrovirus mlb2 strain contigs generated by high - throughput sequencing ( genome analyzer iix ; illumina inc . orf , open reading frame . to quantify the mlb2 virus load in the plasma specimen , we developed a quantitative rt - pcr taqman assay targeting the capsid ( forward primer lg0169 5-acaactggccctacattgaattc-3 , reverse primer lg0170 5-ccgacacgcacatctcgat-3 , and probe fam - tcgggtcttggcgcgcgat - tam ) . we used the maxiscipt kit ( ambion , austin , tx , usa ) to generate in vitro transcribed rna from a plasmid containing the region of interest to establish a standard curve for the assay . on the basis of the results of this assay , this sample has 4.5 10 copies of mlb2 per ml of plasma . to evaluate how frequently astroviruses may be present in human plasma , we screened archived plasma samples from 90 children with fever and 98 afebrile controls by using an astrovirus consensus rt - pcr ( 3 ) . all 188 plasma samples were negative , which suggests that astrovirus mlb2 viremia is relatively rare , at least in the cohort analyzed . the role of novel astrovirus mlb2 in human health and disease and the clinical consequence of mlb2 viremia are not yet known . this case report raises the possibility that astrovirus mlb2 may be a cause of febrile illness . in addition , the finding of mlb2 viremia suggests that astrovirus mlb2 may have effects outside the enteric system . these data , combined with the recent detection of an astrovirus in brain tissue of an immunocompromised patient ( 14 ) and the brain tissue of mink with shaking mink syndrome ( 15 ) , demonstrate a broader distribution of astroviruses in the body than previously recognized . for example , no other known pathogen was detected in the patient in this case report , and he had mostly upper respiratory signs , raising the possibility that mlb2 may play a role in respiratory illness .	astroviruses cause diarrhea , but it is not known whether they circulate in human plasma . astrovirus mlb2 was recently discovered in diarrhea samples from children . we detected mlb2 in the plasma of a febrile child , which suggests that mlb2 has broader tropism than expected and disease potential beyond the gastrointestinal tract .
You are an expert at summarizing long articles. Proceed to summarize the following text: the pharmaceutical field over the past decade has faced continuing challenges in bringing new drug entity to market . in addition , the cost of developing new drug entity keeps rising and today stands at more than us$ 800 m per new drug entity . drug delivery research continues to find new therapies for the prevention and treatment of exiting and new diseases . so , a valuable role is played by drug delivery system by providing optimized products for existing drugs in terms of either enhanced or improved presentation of drug to the systemic circulation [ 1 , 2 ] . treatment of an acute disease or a chronic illness has been mostly accomplished by delivery of drugs to patients using various pharmaceutical dosage forms . traditionally , the oral drug delivery has been most widely utilized route of administration among all the routes that have been explored for the systemic delivery of drugs . conventional oral drug delivery systems are known to provide an immediate release of drug , in which one can not control the release of the drug and can not maintain effective concentration at the target site for longer period of time . the oral bioavailability of some drug by conventional drug delivery is very low due to presence of food , in stabilization at ph of the gi tract , degradation by enzymes of gi fluid , change in gi motility , and so forth [ 3 , 4 ] . controlled drug delivery systems offer temporal and/or spatial control over the release of drug . oral controlled drug delivery systems represent the most popular form of controlled drug delivery systems for the obvious advantages of oral route of drug administration . these dosage forms offer many advantages , such as nearly constant drug level at the site of action , prevention of peak - valley fluctuations , reduction in dose of drug , reduced dosage frequency , avoidance of side effects , and improved patient compliance [ 5 , 6 ] . the oral controlled release system shows a typical pattern of drug release in which the drug concentration is maintained in between the minimum effective concentration ( mec ) and maximum safe concentration ( msc ) for a prolonged period of time , thereby ensuring sustained therapeutic action ( figure 1 ) . osmotic devices are most promising strategy - based systems for controlled drug delivery [ 79 ] . osmosis can be defined as the net movement of water across a selectively permeable membrane driven by a difference in osmotic pressure across the membrane . it is driven by a difference in solute concentrations across the membrane that allows passage of water , but rejects most solute molecules or ions . osmotic pressure created by osmogen is used as driving force for these systems to release the drug in controlled manner . these systems can be used for both route of administration , that is , oral and implantation . osmotic pump offers many advantages over other controlled drug delivery systems , that is , they are easy to formulate and simple in operation , improved patient compliance with reduced dosing frequency and more consistence , and prolonged therapeutic effect with uniform blood concentration . moreover they are inexpensive and their production scaleup is easy [ 10 , 11 ] . osmotic drug - delivery systems suitable for oral administration typically consist of a compressed tablet core that is coated with a semipermeable membrane coating . this coating has one or more delivery ports through which a solution or suspension of the drug is released over time . the core consists of a drug formulation that contains an osmotic agent and a water swellable polymer . the rate at which the core absorbs water depends on the osmotic pressure generated by the core components and the permeability of the membrane coating . as the core absorbs water , it expands in volume , which pushes the drug solution or suspension out of the tablet through one or more delivery ports [ 12 , 13 ] . the key distinguishing feature of osmotic drug delivery systems ( compared with other technologies used in controlled - release formulations ) is that they release drug at a rate that is independent of the ph and hydrodynamics of the external dissolution medium . the result is a robust dosage form for which the in vivo rate of drug release is comparable to the in vitro rate , producing an excellent in vitro / in vivo correlation . another key advantage of the present osmotic systems is that they are applicable to drugs with a broad range of aqueous solubilities [ 14 , 15 ] . the historical development of osmotic systems includes seminal contributions such as the rose - nelson pump , the higuchi - leeper pumps , the alzet and osmet systems , the elementary osmotic pump , and the push - pull or gitsr system . recent advances include the development of the controlled porosity osmotic pump [ 21 , 22 ] , systems based on asymmetric membranes [ 2325 ] , and other approaches . ( 1 ) semipermeable membranesince the membrane in osmotic systems is semipermeable in nature , any polymer that is permeable to water but impermeable to solute can be selected . acetyl content is described by the degree of substitution ( ds ) , that is , the average number of hydroxyl groups on the anhydroglucose unit of the polymer replaced by substituting group . some of the polymers that can be used for above purpose include cellulose esters such as cellulose acetate , cellulose diacetate , cellulose triacetate , cellulose propionate , cellulose acetate butyrate , and cellulose ethers like ethyl cellulose . apart from cellulose derivatives , some other polymers such as agar acetate , amylose triacetate , betaglucan acetate , poly(vinyl methyl ) ether copolymers , poly(orthoesters ) , poly acetals and selectively permeable poly(glycolic acid ) , poly(lactic acid ) derivatives , and eudragits can be used as semipermeable film - forming materials . since the membrane in osmotic systems is semipermeable in nature , any polymer that is permeable to water but impermeable to solute can be selected . acetyl content is described by the degree of substitution ( ds ) , that is , the average number of hydroxyl groups on the anhydroglucose unit of the polymer replaced by substituting group . some of the polymers that can be used for above purpose include cellulose esters such as cellulose acetate , cellulose diacetate , cellulose triacetate , cellulose propionate , cellulose acetate butyrate , and cellulose ethers like ethyl cellulose . apart from cellulose derivatives , some other polymers such as agar acetate , amylose triacetate , betaglucan acetate , poly(vinyl methyl ) ether copolymers , poly(orthoesters ) , poly acetals and selectively permeable poly(glycolic acid ) , poly(lactic acid ) derivatives , and eudragits can be used as semipermeable film - forming materials . ( 2 ) hydrophilic and hydrophobic polymers these polymers are used in the formulation development of osmotic systems for making drug containing matrix core . the highly water soluble compounds can be coentrapped in hydrophobic matrices and moderately water soluble compounds can be coentrapped in hydrophilic matrices to obtain more controlled release . generally , mixtures of both hydrophilic and hydrophobic polymers have been used in the development of osmotic pumps of water - soluble drugs . the selection is based on the solubility of the drug as well as the amount and rate of drug to be released from the pump . mostly , swellable polymers are used for the pumps containing moderately water - soluble drugs . since they increase the hydrostatic pressure inside the pump due to their swelling nature , the nonswellable polymers are used in case of highly water - soluble drugs . ionic hydrogels such as sodium carboxymethyl cellulose are preferably used because of their osmogenic nature . more precise controlled release of drugs can be achieved by incorporating these polymers into the formulations . hydrophilic polymers such as hydroxy ethyl cellulose , carboxy methylcellulose , hydroxy propyl methylcellulose , high - molecular - weight poly(vinyl pyrrolidone ) , and hydrophobic polymers such as ethyl cellulose and wax materials can be used for this purpose . these polymers are used in the formulation development of osmotic systems for making drug containing matrix core . the highly water soluble compounds can be coentrapped in hydrophobic matrices and moderately water soluble compounds can be coentrapped in hydrophilic matrices to obtain more controlled release . generally , mixtures of both hydrophilic and hydrophobic polymers have been used in the development of osmotic pumps of water - soluble drugs . the selection is based on the solubility of the drug as well as the amount and rate of drug to be released from the pump . mostly , swellable polymers are used for the pumps containing moderately water - soluble drugs . since they increase the hydrostatic pressure inside the pump due to their swelling nature , the nonswellable polymers are used in case of highly water - soluble drugs . ionic hydrogels such as sodium carboxymethyl cellulose are preferably used because of their osmogenic nature . more precise controlled release of drugs can be achieved by incorporating these polymers into the formulations . hydrophilic polymers such as hydroxy ethyl cellulose , carboxy methylcellulose , hydroxy propyl methylcellulose , high - molecular - weight poly(vinyl pyrrolidone ) , and hydrophobic polymers such as ethyl cellulose and wax materials can be used for this purpose . ( 3 ) wicking agentsa wicking agent is defined as a material with the ability to draw water into the porous network of a delivery device . the wicking agents are those agents which help to increase the contact surface area of the drug with the incoming aqueous fluid . the use of the wicking agent helps to enhance the rate of drug released from the orifice of the drug . physisorption is a form of absorption in which the solvent molecules can loosely adhere to surfaces of the wicking agent via van der waals interactions between the surface of the wicking agent and the adsorbed molecule . the function of the wicking agent is to carry water to surfaces inside the core of the tablet , thereby creating channels or a network of increased surface area . a wicking agent is defined as a material with the ability to draw water into the porous network of a delivery device . the wicking agents are those agents which help to increase the contact surface area of the drug with the incoming aqueous fluid . the use of the wicking agent helps to enhance the rate of drug released from the orifice of the drug . physisorption is a form of absorption in which the solvent molecules can loosely adhere to surfaces of the wicking agent via van der waals interactions between the surface of the wicking agent and the adsorbed molecule . the function of the wicking agent is to carry water to surfaces inside the core of the tablet , thereby creating channels or a network of increased surface area . ( 4 ) solubilizing agentsfor osmotic drug delivery system , highly water - soluble drugs would demonstrate a high release rate that would be of zero order . thus , many drugs with low intrinsic water solubility are poor candidates for osmotic delivery . addition of solubilizing agents into the core tablet dramatically increases the drug solubility . for osmotic drug delivery system , highly water - soluble drugs would demonstrate a high release rate that would be of zero order . thus , many drugs with low intrinsic water solubility are poor candidates for osmotic delivery . nonswellable solubilizing agents are classified into three groups , agents that inhibit crystal formation of the drugs or otherwise act by complexation with the drugs ( e.g. , pvp , poly(ethylene glycol ) ( peg 8000 ) and -cyclodextrin),a micelle - forming surfactant with high hlb value , particularly nonionic surfactants ( e.g. , tween 20 , 60 , and 80 , polyoxyethylene or poly ethylene containing surfactants and other long - chain anionic surfactants such as sls),citrate esters ( e.g. , alkyl esters particularly triethyl citrate ) and their combinations with anionic surfactants . the combinations of complexing agents such as polyvinyl pyrrolidone ( pvp ) and poly(ethylene glycol ) with anionic surfactants such as sls are mostly preferred . agents that inhibit crystal formation of the drugs or otherwise act by complexation with the drugs ( e.g. , pvp , poly(ethylene glycol ) ( peg 8000 ) and -cyclodextrin ) , a micelle - forming surfactant with high hlb value , particularly nonionic surfactants ( e.g. , tween 20 , 60 , and 80 , polyoxyethylene or poly ethylene containing surfactants and other long - chain anionic surfactants such as sls ) , citrate esters ( e.g. , alkyl esters particularly triethyl citrate ) and their combinations with anionic surfactants . the combinations of complexing agents such as polyvinyl pyrrolidone ( pvp ) and poly(ethylene glycol ) with anionic surfactants such as sls are mostly preferred . upon penetration of biological fluid into the osmotic pump through semipermeable membrane , osmogens are dissolved in the biological fluid , which creates osmotic pressure buildup inside the pump and pushes medicament outside the pump through delivery orifice . generally combinations of osmogens are used to achieve optimum osmotic pressure inside the system ( table 1 ) . upon penetration of biological fluid into the osmotic pump through semipermeable membrane , osmogens are dissolved in the biological fluid , which creates osmotic pressure buildup inside the pump and pushes medicament outside the pump through delivery orifice . generally combinations of osmogens are used to achieve optimum osmotic pressure inside the system ( table 1 ) . they produce an integral composite that is useful for making the wall of the device operative . the surfactants act by regulating the surface energy of materials to improve their blending into the composite and maintain their integrity in the environment of use during the drug release period . typical surfactants such as poly oxyethylenated glyceryl recinoleate , polyoxyethylenated castor oil having ethylene oxide , glyceryl laurates , and glycerol ( sorbiton oleate , stearate , or laurate ) are incorporated into the formulation . they produce an integral composite that is useful for making the wall of the device operative . the surfactants act by regulating the surface energy of materials to improve their blending into the composite and maintain their integrity in the environment of use during the drug release period . typical surfactants such as poly oxyethylenated glyceryl recinoleate , polyoxyethylenated castor oil having ethylene oxide , glyceryl laurates , and glycerol ( sorbiton oleate , stearate , or laurate ) are incorporated into the formulation . ( 7 ) coating solventssolvents suitable for making polymeric solution that is used for manufacturing the wall of the osmotic device include inert inorganic and organic solvents that do not adversely harm the core and other materials . the typical solvents include methylene chloride , acetone , methanol , ethanol , isopropyl alcohol , butyl alcohol , ethyl acetate , cyclohexane , carbon tetrachloride , and water . the mixtures of solvents such as acetone - methanol ( 80 : 20 ) , acetone - ethanol ( 80 : 20 ) , acetone - water ( 90 : 10 ) , methylene chloride - methanol ( 79 : 21 ) , methylene chloride - methanol - water ( 75 : 22 : 3 ) can be used . solvents suitable for making polymeric solution that is used for manufacturing the wall of the osmotic device include inert inorganic and organic solvents that do not adversely harm the core and other materials . the typical solvents include methylene chloride , acetone , methanol , ethanol , isopropyl alcohol , butyl alcohol , ethyl acetate , cyclohexane , carbon tetrachloride , and water . the mixtures of solvents such as acetone - methanol ( 80 : 20 ) , acetone - ethanol ( 80 : 20 ) , acetone - water ( 90 : 10 ) , methylene chloride - methanol ( 79 : 21 ) , methylene chloride - methanol - water ( 75 : 22 : 3 ) can be used . ( 8) plasticizersin pharmaceutical coatings , plasticizers , or low molecular weight diluents are added to modify the physical properties and improve film - forming characteristics of polymers . plasticizers can turn a hard and brittle polymer into a softer , more pliable material , and possibly make it more resistant to mechanical stress . plasticizers lower the temperature of the second order - phase transition of the wall or the elastic modules of the wall and also increase the workability , flexibility , and permeability of the coating solvents . generally from 0.001 to 50 parts of a plasticizer or a mixture of plasticizers are incorporated into 100 parts of costing materials . peg-600 , peg-200 , triacetin ( ta ) , dibutyl sebacate , ethylene glycol monoacetate , ethylene glycol diacetate , triethyl phosphate , and diethyl tartrate used as plasticizer in formulation of semipermeable membrane [ 38 , 39 ] . in pharmaceutical coatings , plasticizers , or low molecular weight diluents are added to modify the physical properties and improve film - forming characteristics of polymers . plasticizers can turn a hard and brittle polymer into a softer , more pliable material , and possibly make it more resistant to mechanical stress . plasticizers lower the temperature of the second order - phase transition of the wall or the elastic modules of the wall and also increase the workability , flexibility , and permeability of the coating solvents . generally from 0.001 to 50 parts of a plasticizer or a mixture of plasticizers are incorporated into 100 parts of costing materials . peg-600 , peg-200 , triacetin ( ta ) , dibutyl sebacate , ethylene glycol monoacetate , ethylene glycol diacetate , triethyl phosphate , and diethyl tartrate used as plasticizer in formulation of semipermeable membrane [ 38 , 39 ] . ( 9 ) pore - forming agentsthese agents are particularly used in the pumps developed for poorly water - soluble drugs and in the development of controlled porosity or multiparticulate osmotic pumps . the microporous wall may be formed in situ by a pore - former by its leaching during the operation of the system . the pore - formers can be inorganic or organic and solid or liquid in nature . for example , alkaline metal salts such as sodium chloride , sodium bromide , potassium chloride , potassium sulphate , potassium phosphate , and so forth , alkaline earth metals such as calcium chloride and calcium nitrate , carbohydrates such as sucrose , glucose , fructose , mannose , lactose , sorbitol , and mannitol , and diols and polyols such as poly hydric alcohols , polyethylene glycols , and polyvinyl pyrrolidone can be used as pore - forming agents . triethyl citrate ( tec ) and triacetin ( ta ) are also used to create pore in the membrane . these agents are particularly used in the pumps developed for poorly water - soluble drugs and in the development of controlled porosity or multiparticulate osmotic pumps . the microporous wall may be formed in situ by a pore - former by its leaching during the operation of the system . the pore - formers can be inorganic or organic and solid or liquid in nature . for example , alkaline metal salts such as sodium chloride , sodium bromide , potassium chloride , potassium sulphate , potassium phosphate , and so forth , alkaline earth metals such as calcium chloride and calcium nitrate , carbohydrates such as sucrose , glucose , fructose , mannose , lactose , sorbitol , and mannitol , and diols and polyols such as poly hydric alcohols , polyethylene glycols , and polyvinyl pyrrolidone can be used as pore - forming agents . triethyl citrate ( tec ) and triacetin ( ta ) are also used to create pore in the membrane . osmotic delivery systems contain at least one delivery orifice in the membrane for drug release . the size of delivery orifice must be optimized in order to control the drug release from osmotic systems . on the other hand , size of delivery orifice should not also be too large , otherwise , solute diffusion from the orifice may take place . if the size of delivery orifice is too small , zero - order delivery will be affected because of development of hydrostatic pressure within the core . this hydrostatic pressure may not be relieved because of the small orifice size and may lead to deformation of delivery system , thereby resulting in unpredictable drug delivery . optimum orifice diameter is in the range of 0.0750.274 mm . at orifice size of 0.368 mm and above , control over the delivery rate delivery orifices in the osmotic systems can be created with the help of a mechanical drill . laser drilling is one of the most commonly used techniques to create delivery orifice in the osmotic tablet . laser beam is fired onto the surface of the tablet that absorbs the energy of the beam and gets heated ultimately causing piercing of the wall and , thus forming orifice . it is possible to control the size of the passageway by varying the laser power , firing duration ( pulse time ) , thickness of the wall , and the dimensions of the beam at the wall . in some of the oral osmotic systems the system described consists of a incorporation of pore - forming agents into the coating solution . pore - forming agents are water soluble : upon contact with the aqueous environment , they dissolve in it and leach out from membrane , creatingorifice . rose and nelson , the australian scientists , were initiators of osmotic drug delivery . in 1955 , they developed an implantable pump for the delivery of drugs to the sheep and cattle gut . the rose - nelson implantable pump shown in figure 2 is composed of three chambers : a drug chamber , a salt chamber holding solid salt , and a water chamber . the movement of water from the water chamber towards salt chamber is influenced by difference in osmotic pressure across the membrane . conceivably , volume of salt chamber increases due to water flow , which distends the latex diaphragm dividing the salt and drug chambers : eventually , the drug is pumped out of the device . the kinetics of pumping from rose nelson pump is given by the following equation : ( 1)dmtdt=(dvdt)c , where dmt / dt is the drug release rate , dv / dt is the volume flow of water into the salt chamber , and c represents the concentration of drug in the drug chamber . ( 2)dmtdt = acl , where , a is the area of semi permeable membrane , is the osmotic pressure gradient , is the permeability of semipermeable membrane , and l is the thickness of semi permeable membrane.these basic equations are applicable to the osmotically driven controlled drug delivery devices . the saturated salt solution created a high osmotic pressure compared to that pressure required for pumping the suspension of active agent . therefore , the rate of water entering into the salt chamber remains constant as long as sufficient solid salt is present in die salt chamber to maintain a saturated solution and thereby a constant osmotic pressure driving force is generated . the major problem associated with rose - nelson pumps was that the osmotic action began whenever water came in contact with the semipermeable membrane . this needed pumps to be stored empty and water to be loaded prior to use . higuchi and leeper have proposed a number of variations of the rose - nelson pump and these designs have been described in us patents [ 46 , 47 ] , which represent the first series of simplifications of the rose - nelson pump made by the alza corporation . the higuchi - leeper pump has no water chamber , and the activation of the device occurs after imbibition of the water from the surrounding environment . this variation allows the device to be prepared loaded with drug and can be stored for long prior to use . higuchi - leeper pumps contain a rigid housing and a semi permeable membrane supported on a perforated frame ; a salt chamber containing a fluid solution with an excess of solid salt is usually present in this type of pump . upon administration / implantation , surrounding biological fluid penetrates into the device through porous and semipermeable membrane and dissolves the mgso4 , creating osmotic pressure inside the device that pushes movable separator toward the drug chamber to remove drug outside the device . this type of pump is implanted in body of an animal for delivery of antibiotics or growth hormones to animals . pulsatile delivery could be achieved by using higuchi leeper pump ; such modifications are described and illustrated in figure 4 . the pulsatile release of drug is achieved by drilling the orifice in elastic material that stretches under the osmotic pressure . pulse release of drug is obtained after attaining a certain critical pressure , which causes the orifice to open . the pressure then reduces to cause orifice closing and the cycle repeats to provide drug delivery in a pulsatile fashion . the orifice should be small enough to be substantially closed when the threshold level of osmotic pressure is not present . higuchi and theeuwes in early 1970s developed another variant of the rose - nelson pump , even simpler than the higuchi - leeper pump . this device is illustrated in figure 5 . in this device , the rigid housing consisted of a semipermeable membrane . this membrane is strong enough to withstand the pumping pressure developed inside the device due to imbibition of water . the drug is loaded in the device only prior to its application , which extends advantage for storage of the device for longer duration . the release of the drug from the device is governed by the salt used in the salt chamber and the permeability characteristics of the outer membrane . small osmotic pumps of this form are available under trade name alzet made by alza corporation in 1976 . they are used frequently as implantable controlled release delivery systems in experimental studies requiring continuous administration of drugs . such a implantable alzet pump is shown in figure 6 . rose - nelson pump was further simplified in the form of elementary osmotic pump [ 20 , 52 ] , which made osmotic delivery as a major method of achieving controlled drug release . elementary osmotic pump shown in figure 7 was invented by theeuwes in 1974 and it essentially contains an active agent having a suitable osmotic pressure ; it is fabricated as a tablet coated with semi permeable membrane , usually cellulose acetate [ 32 , 53 ] . when this coated tablet is exposed to an aqueous environment , the osmotic pressure of the soluble drug inside the tablet draws water through the semi permeable coating and a saturated aqueous solution of drug is formed inside the device . the membrane is nonextensible and the increase in volume due to imbibition of water raises the hydrostatic pressure inside the tablet , eventually leading to flow of saturated solution of active agent out of the device through a small orifice . the pump initially releases the drug at a rate given by the following equation ; ( 3)dmtdt=(dvdt)cs , where dv / dt depicts the water flow into the tablet and cs is the solubility of the agent inside the tablet . push - pull osmotic pump is delivered both poorly water soluble and highly water soluble drugs at a constant rate . one layer ( the upper layer ) contains drug in a formulation of polymeric , osmotic agent , and other tablet excipients . this polymeric osmotic agent has the ability to form a suspension of drug in situ . when this tablet later imbibes water , the other layer contains osmotic and colouring agents , polymer and tablet excipients . these layers are formed and bonded together by tablet compression to form a single bilayer core . after the coating has been applied , a small hole is drilled through the membrane by a laser or mechanical drill on the drug layer side of the tablet . when the system is placed in aqueous environment , the osmotic attraction in the drug layer pulls water into the compartment to form in situ a suspension of drug . the osmotic agent in the nondrug layer simultaneously attracts water into that compartment , causing it to expand volumetrically , and the expansion of nondrug layer pushes the drug suspension out of the delivery orifice [ 20 , 52 ] . it is an osmotic tablet wherein the delivery orifices ( holes ) are formed in situ through leaching of water soluble pore - forming agents incorporated in semipermeable membrane ( spm ) ( e.g. , urea , nicotinamide , sorbitol , etc . ) . drug release rate from cpop depends on various factors like coating thickness , solubility of drug in tablet core , level of leachable pore - forming agent(s ) and the osmotic pressure difference across the membrane [ 54 , 55 ] . the stomach irritation problems are considerably reduced , as drug is released from the whole of the device surface rather from a single hole . further , no complicated laser - drilling unit is required because the holes are formed in situ . various l - oros systems available to provide controlled delivery of liquid drug formulations include l - oros hardcap , l - oros softcap , and a delayed liquid bolus delivery system . each of these systems includes a liquid drug layer , an osmotic engine or push layer , and a semipermeable membrane coating . when the system is in contact with the aqueous environment , water permeates across the rate - controlling membrane and activates the osmotic layer ( figure 11 ) [ 9 , 57 ] . the expansion of the osmotic layer results in the development of hydrostatic pressure inside the system , thereby forcing the liquid formulation to be delivered at the delivery orifice . whereas l - oros hardcap and l - oros softcap systems are designed to provide continuous drug delivery , the l - oros delayed liquid bolus delivery system is designed to deliver a pulse of liquid drug ( figure 10 ) [ 34 , 58 ] . the delayed liquid bolus delivery system comprises three layers : a placebo delay layer , a liquid drug layer , and an osmotic engine , all surrounded by a rate - controlling semipermeable membrane ( spm ) . the delivery orifice is drilled on the placebo layer end of the capsule shaped device . when the osmotic engine expands , the placebo is released first , delaying release of the drug layer ( figure 10 ) . drug release can be delayed from 1 to 10 hours , depending on permeability of the rate - controlling membrane and the size of placebo . figure 12 shows that sandwiched osmotic tablet is composed of polymeric push layer sandwiched between two drug layers with two delivery orifices . when placed in the aqueous environment , the middle push layer containing the swelling agents ' swells and the drug is released from the two orifices situated on opposite sides of the tablet ; thus sandwiched osmotic tablets ( sots ) can be suitable for drugs prone to cause local irritation of the gastric mucosa ( table 2 ) [ 32 , 55 , 60 ] . osmotic drug delivery systems typically consist of a drug core containing osmogen that is coated with a semipermeable membrane . this coating has one or more delivery ports through which a solution or suspension of the drug is released over time . various osmotic systems include rose - nelson pump , the higuchi - leeper pumps , the alzet and osmet systems , the elementary osmotic pump , and the push - pull pump . recent advances include the development of the controlled porosity osmotic pump , l - oros pump , and sandwiched osmotic tablet . in future , various attempts are made to produce successful osmotic system like pulsatile delivery based on expandable orifice , lipid osmotic pump , telescopic capsule containing mini osmotic pump for delayed release , osmotic bursting osmotic pump , and so forth .	conventional drug delivery systems are known to provide an immediate release of drug , in which one can not control the release of the drug and can not maintain effective concentration at the target site for longer time . controlled drug delivery systems offer spatial control over the drug release . osmotic pumps are most promising systems for controlled drug delivery . these systems are used for both oral administration and implantation . osmotic pumps consist of an inner core containing drug and osmogens , coated with a semipermeable membrane . as the core absorbs water , it expands in volume , which pushes the drug solution out through the delivery ports . osmotic pumps release drug at a rate that is independent of the ph and hydrodynamics of the dissolution medium . the historical development of osmotic systems includes development of the rose - nelson pump , the higuchi - leeper pumps , the alzet and osmet systems , the elementary osmotic pump , and the push - pull system . recent advances include development of the controlled porosity osmotic pump , and systems based on asymmetric membranes . this paper highlights the principle of osmosis , materials used for fabrication of pumps , types of pumps , advantages , disadvantages , and marketed products of this system .
You are an expert at summarizing long articles. Proceed to summarize the following text: we used 99 paraffin - embedded bladder tccs and 10 normal bladder tissues that had been collected at the department of pathology at dongguk university gyeongju hospital . in addition , the normal bladder epithelial tissues were obtained from cases of chronic cystitis . the tumor was graded in accordance with the world health organization / international society of urological pathology ( who - isup ) classification , and the pathological t stage ( pt , depth of invasion ) was also determined.11 the age distribution of the patients ranged between 30 and 87 years old , and the male to female ratio was 6.1:1 . urinary bladder sections of 4 m thickness were made and they were spread on poly - l - lysine coated slides . the paraffin sections were immersed in three changes of xylene and they were hydrated using a graded series of alcohol solutions . antigen retrieval was routinely performed by immersing the sections in a 0.01 m citrate buffer ( ph 6.0 ) in an autoclave for 15 minutes . this was followed by the incubation of the sections with primary antibody for two hours at room temperature , where the primary antibodies include mouse monoclonal anti - pedf antibody ( 1:200 , merck millipore , billerica , ma , usa ) and anti - cd34 antibody ( 1:200 , dako , santa barbara , ca , usa ) . immunohistochemical staining was done with an envision kit ( dako ) and the color was developed with 3 , 3'-diaminobenzidine tetrahydrochloride ( zymed laboratories , inc . , south san francisco , ca , usa ) as a chromogen . the extensity was graded according to a 4-point scale based on the percentage of stained tumor cells : 0 ( the percentage of stained tumor cells , 0 - 10% ) , 1 ( the percentage of stained tumor cells , 11 - 20% ) , 2 ( the percentage of stained tumor cells , 21 - 30% ) , and 3 ( the percentage of stained tumor cells , > 30% ) . in addition , intensity was also graded based on a 3-point scale : 1 ( mild ) , 2 ( moderate ) , and 3 ( strong ) . based on the sum of extensity and intensity , our cases were divided into two groups : the negative group ( 1 - 2 ) and the positive group ( 3 - 6 ) . the mvd was calculated with the identification and quantification of the cross - sections of cd34-positive lumens in five random fields per tumor at a magnification rate of 400 , as reported by weidner.12 to identify the correlation between the expression of pedf and mvd , our cases were divided into three categories based on the mvd and these include low ( mvd<11 ) , middle ( 11<mvd<40 ) , and high ( mvd>40 ) . we have attempted to perform an immunohistochemical staining for vegf and transforming growth factor- in several cases of colon cancers or bladder tcc . statistical analysis was done with chi - square test , fisher 's exact test , t - test and one - way anova . we used 99 paraffin - embedded bladder tccs and 10 normal bladder tissues that had been collected at the department of pathology at dongguk university gyeongju hospital . in addition , the normal bladder epithelial tissues were obtained from cases of chronic cystitis . the tumor was graded in accordance with the world health organization / international society of urological pathology ( who - isup ) classification , and the pathological t stage ( pt , depth of invasion ) was also determined.11 the age distribution of the patients ranged between 30 and 87 years old , and the male to female ratio was 6.1:1 . urinary bladder sections of 4 m thickness were made and they were spread on poly - l - lysine coated slides . the paraffin sections were immersed in three changes of xylene and they were hydrated using a graded series of alcohol solutions . antigen retrieval was routinely performed by immersing the sections in a 0.01 m citrate buffer ( ph 6.0 ) in an autoclave for 15 minutes . this was followed by the incubation of the sections with primary antibody for two hours at room temperature , where the primary antibodies include mouse monoclonal anti - pedf antibody ( 1:200 , merck millipore , billerica , ma , usa ) and anti - cd34 antibody ( 1:200 , dako , santa barbara , ca , usa ) . immunohistochemical staining was done with an envision kit ( dako ) and the color was developed with 3 , 3'-diaminobenzidine tetrahydrochloride ( zymed laboratories , inc . , south san francisco , ca , usa ) as a chromogen . the extensity was graded according to a 4-point scale based on the percentage of stained tumor cells : 0 ( the percentage of stained tumor cells , 0 - 10% ) , 1 ( the percentage of stained tumor cells , 11 - 20% ) , 2 ( the percentage of stained tumor cells , 21 - 30% ) , and 3 ( the percentage of stained tumor cells , > 30% ) . in addition , intensity was also graded based on a 3-point scale : 1 ( mild ) , 2 ( moderate ) , and 3 ( strong ) . based on the sum of extensity and intensity , our cases were divided into two groups : the negative group ( 1 - 2 ) and the positive group ( 3 - 6 ) . the mvd was calculated with the identification and quantification of the cross - sections of cd34-positive lumens in five random fields per tumor at a magnification rate of 400 , as reported by weidner.12 to identify the correlation between the expression of pedf and mvd , our cases were divided into three categories based on the mvd and these include low ( mvd<11 ) , middle ( 11<mvd<40 ) , and high ( mvd>40 ) . we have attempted to perform an immunohistochemical staining for vegf and transforming growth factor- in several cases of colon cancers or bladder tcc . statistical analysis was done with chi - square test , fisher 's exact test , t - test and one - way anova . our cases comprised 39 cases of stage pta , 31 cases of pt1 , and 29 cases of pt2 . there were 44 cases of low grade tumor , and 55 cases of high grade tumor . the expression of pedf had a granular pattern in the cytoplasm of normal urothelium and tumor cells ( fig . 1 ) . the positive immunoreactivity for pedf was seen in normal urothelium at a proportion of 60% ( 6/10 ) and tcc at a rate of 13% ( 13/99 ) ( fig . the degree of pedf expression was significantly higher in normal bladder mucosa as compared with tcc ( p=0.025 ) . the positive rate of pedf expression was seen in 14% ( 6/44 ) of total cases of a low grade tumor and in 13% ( 7/55 ) of those of a high grade one . in addition , it was also seen in 13% ( 5/39 ) of the pta tumors , 16% ( 5/31 ) of the pt1 ones , and 10% ( 3/29 ) of the pt2 ones . the expression of pedf was not significantly correlated with tumor grade and tumor invasion ( p>0.05 ) . in addition , it was not also significantly correlated with gender and age ( data not shown ) . overall , the mean mvd was 24.01.3 in our clinical series ( range , 4 to 57 ; standard deviation , 12.6 ) . in addition , it was 19.22.0 in low grade tumors and 27.61.5 in high grade ones . furthermore , it was 19.02.0 in the pta tumors , 24.02.0 in the pt1 ones and 30.02.1 in the pt2 ones . these results indicate that the mean mvd was significantly higher in high grade tcc as compared with their low grade counterparts ( p=0.001 ) . in addition , it was significantly higher in the pt2 tumors as compared with both the pta and pt1 ones ( p<0.05 ) . there were 12 cases ( 12% ) of the low degree of mvd , 76 cases ( 77% ) of the middle degree , and 11 cases ( 11% ) of the high degree . 2 , the expression of pedf had a positive correlation with low mvd at a proportion of 42% ( 5/12 ) , a middle mvd at a proportion of 11% ( 8/76 ) , and a high mvd at a proportion of 0% ( 0/11 ) . angiogenesis is the complex biological process that is involved in the development and formation of new blood vessels and it plays a critical role in the growth and metastasis of tumor . tumors release both angiogenic factors and angiogenic inhibitors ; the latter include angiostatin , thrombospondin , endostatin , and pedf.5,13 - 15 pedf directly inhibits the proliferation and migration of endothelial cells and it also induces apoptosis in activated endothelium . in addition , it also has an anti - angiogenic effect based on the derangement of vegf signaling pathway.16 it has been reported that pedf is a more powerful inhibitor than any other known anti - angiogenic factors , whose potency is more than twice higher than angiostatin and more than seven times higher than endostatin.5 there is a significant correlation between the pedf expression and a low mvd in such malignancies as pancreatic ductal cancer , breast cancer or non - small cell lung cancer.7,17,18 it has recently shown that there is an inverse correlation between the expression of pedf and vegf in bladder tcc.10 our results also showed that there was an inverse correlation between pedf expression and mvd . pedf exerts an anti - migratory activity in a number of tumor cell lines , whose mechanism can be mediated with the downregulation of matrix metalloproteinase-9 that binds to collagen type i and iii and by inducing the release of chemoattractants with anti - migratory effect.16,19 in addition , pedf promotes the differentiation of tumors of neuronal origin.20 study has therefore been conducted to examine the relationship of pedf expression with tumor differentiation and pathological t stage . in the current study , however , we could not identify any significant correlations between them . according to a recent study , there was a correlation between the decreased pedf expression and a higher grade of the tumor but it was not correlated with a higher stage of the bladder tcc.10 in pancreatic ductal cancer , a lower degree of the pedf expression was associated with a liver metastasis and a shorter survival , but its expression was not correlated with the depth of invasion and histopathological grading.17 the relationship between pedf expression and clinicopathlogic parameters in breast cancer was also seen and its pattern was consistent with that seen in pancreatic ductal cancer.18 as a whole , pedf has effect on the migration and differentiation of tumor cells in a cell - type dependent manner . our results showed that the degree of pedf expression was significantly higher in normal bladder urothelium than bladder tcc . this was also seen in a recent study.10 pedf triggers apoptosis in several tumor cell lines.8,21 our results could not clarify the mechanisms by which pedf is involved in apoptosis in normal urothelium . our results indicate , however , that pedf expression in normal urothelium may protect epithelial cells by sensitizing cells to stress - induced apoptosis and it can also promote apoptosis indirectly by disrupting angiogenesis . it can therefore be inferred the bladder tcc would initially occur if there is a lack of the pedf expression . further studies are warranted to examine the mechanisms by which the expression of pedf is involved in the occurrence of bladder tcc . to summarize , our results showed that the degree of pedf expression is significantly higher in normal bladder urothelium than bladder tcc ; it is inversely correlated with the angiogenesis ; and it is not related to the differentiation and progression of tcc . it can therefore be concluded that bladder tcc would initially occur if there is lack of the pedf expression .	backgroundpigment epithelium - derived factor ( pedf ) is an anti - angiogenic factor . the purpose of this study is to examine the involvement of pedf in the angiogenesis and biological behavior of bladder transitional cell carcinoma ( tcc).methodswe examined the expression of pedf in 99 bladder tccs and ten non - neoplastic tissues , and evaluated microvessel density ( mvd).resultsthe positive immunoreactivity for pedf was seen in normal urothelium in 60% ( 6/10 ) and tcc in 13% ( 13/99 ) . the pedf expression had a significant correlation with mvd , i.e. , a low mvd in 42% ( 5/12 ) , a middle mvd in 11% ( 8/76 ) and a high mvd 0% ( 0/11 ) of tumors . the pedf expression was not significantly correlated with the differentiation and invasion of tcc , but the degree of mvd was significantly higher in both high grade tcc and the pt2 tumors.conclusionsthe degree of pedf expression is significantly higher in normal bladder urothelium than bladder tcc ; it is inversely correlated with the angiogenesis ; and it is not related to the differentiation and progression of tcc . it can therefore be concluded that bladder tcc would initially occur if there is a lack of the pedf expression .
You are an expert at summarizing long articles. Proceed to summarize the following text: during storage of grains , fruits , vegetables , silage , and processed foods , the contamination with molds and yeasts may cause spoilage , which can be associated with substantial economic losses and potential health hazards . to extend the shelf life of susceptible food and feed , considerable amounts of chemical preservatives are used . the development of natural preservatives , consisting of microorganisms generally recognized as safe ( gras ) , might form an alternative to the chemicals . both lactic acid bacteria ( lab ) and propionibacteria are safe , well - characterized bacteria , commonly used in many industrial processes [ 1 , 2 ] . the antifungal activity of lab ( reviewed in ) is explored in both applied systems [ 46 ] and at substance level [ 79 ] . the use of propionibacteria as a biopreservative culture has been tested alone [ 10 , 11 ] and also in combination with lab [ 1215 ] . glycerol is a colorless , odorless liquid , widely used in a great number of applications ( e.g. , skin care products and drug solvents ) . the rapid increase in biodiesel production seen in recent years provides an abundant and inexpensive source of glycerol as a residue . previously , studies on the antifungal activity of lab found that addition of glycerol enhanced the antifungal effect of certain species . in lab , the coenzyme b12-dependent glycerol / diol dehydratase is involved in the conversion of glycerol into 1,3-propanediol . an intermediate in the process is 3-hydroxypropionialdehyde , also known as reuterin , a potent antimicrobial compound . the presence of a diol dehydratase in propionibacterium freudenreichii has been demonstrated , but a comparison with a number of species belonging to the genera enterobacteriaceae indicated that the diol dehydratase of p. freudenreichii is different from the enterobacteria enzyme . growth of propionibacteria on glycerol increases propionic acid production , but the effect on the antifungal activity of these bacteria when using glycerol as single carbon source has not been previously described . this study aimed at investigating the effect of glycerol on the antifungal activity of five different dairy propionibacteria species , as well as their metabolite profile when grown in the presence of glycerol . nmr spectroscopy was used to elucidate the conversion pathway and the end products , using c - labeled glycerol fed to cultures of propionibacteria . the propionibacteria used in this study were the type strains of the following dairy propionibacteria species , obtained from deutsche sammlung von mikroorganismen und zellkulturen gmbh ( dsmz ) : propionibacterium acidipropionici dsmz 4900 , p. freudenreichii subsp . the fungi used in the overlay assay and the microtitre plate assay were the yeast rhodotorula mucilaginosa j350 ( cfsqe 63 ) and the molds penicillium commune j236 ( ibt 10763 ) and penicillium roqueforti j268 ( ibt 6754 ) . all fungi are part of the culture collection of the department of microbiology , swedish university of agricultural sciences . cultures of propionibacteria were grown on modified sodium lactate ( sl ) medium ( 1% sodium lactate ; sigma - aldrich , steinheim , germany , 1% tryptone ; oxoid ltd . , hampshire , england , 0.5% yeast extract ; oxoid ltd . and 0.5% kh2po4 ) at 30c in anaerobic jars ( bbl , becton , dickinson and co. , sparks , md , usa ) under co2 + n2 atmosphere ( gaspak system , bbl , becton , dickinson and co ) . for growth experiments with glycerol , the same medium was used , but the sodium lactate was replaced by 1% glycerol ( merck , darmstadt , germany ) ( gly ) . the yeast and molds were kept on malt extract ( me ) agar ( oxoid ltd . ) the yeast was cultured in me broth ( becton , dickinson and co. ) on a rotary shaker ( infors ag , bottmingen - basel , switzerland ) at 120 rpm at 25c overnight , while the molds were surface spread on fresh me agar ( oxoid ltd . ) the conidia ( asexual spores ) were then harvested from the slants using sterile peptone water . yeast cells and mold conidia were counted using a brker counting chamber ( marienfeld , lauda - koenigshofen , germany ) . the propionibacteria were inoculated in two parallel 2-cm streaks on sl plates ( six per strain ) and incubated at 30c under anaerobic conditions for 72 hours . soft agar ( 0.15% malt extract ( becton , dickinson and co. ) and 1% agar base ( oxoid ltd . ) ) with different concentrations of glycerol ( 0 , 10 , 50 , 100 , 200 , and 500 mm ) was cooled to 45c before fungal cells or conidia were added to obtain a concentration of 10 sporesml . after incubation at 30c for 48 to 72 hours under aerobic conditions , the plates were examined visually . the plates were prepared in almost the same way as for the overlay assay , but the overlaid soft agar contained either 0 mm or 100 mm glycerol and no fungal cells or conidia were added . after the second incubation ( 48 hours at 30c under aerobic conditions ) , the agar between the bacterial streaks was removed with a scalpel and mixed with sterile water to achieve a dilution of 1 : 10 . the fluid was homogenized in a laboratory blender ( stomacher 400 , seward ltd . , worthington , uk ) for 60 seconds , followed by a soaking period of 3060 minutes . the fluid was transferred to vials and centrifuged ( 4500 rpm , 10 minutes ) to obtain agar - free liquid . standard solutions of lactic , acetic , and propionic acids at concentrations of 0.1 , 0.5 , 1.0 , 5.0 , 10 , and 15 mm were included in the analysis , performed on a c-18 column ( zorbax sb - c18 , agilent technologies , waldbronn , germany ) at 30c . as mobile phase 20 mm h3po4 , at a flow rate of 1.0 ml min , was used and the eluate was monitored with a uv detector ( agilent 1100 series , agilent technologies ) at 210 nm . all experiments were repeated four times , and the values presented are the mean values . propionibacteria were counted using a petroff - hausser cell counter ( hausser scientific partnership , horsham , pa ) and inoculated to achieve a final concentration of 10 cellsml in sl and gly broth ( four replicates for each combination ) . the cultures were incubated as still cultures at 30c for 72 hours . for viable bacterial count , one ml aliquots were serial diluted ( 1 : 10 ) six times with sterile peptone water , and 100 l of the two lowest dilutions were spread on sl agar plates and incubated at 30c under anaerobic conditions . the remainings of the fermented broths were centrifuged ( 4500 rpm , 10 minutes ) and filtered through 0.45 m filter ( nalgene nunc int . ) to obtain cell - free supernatant . all experiments were repeated four times , and the values presented are the mean values . the supernatants from the liquid cultures were also tested for antifungal activity using a microtitre plate assay . for each culture , two wells were prepared by adding 50 l of supernatant to 50 l of a cell or conidium suspension ( prepared as previously described ) to achieve a final concentration of 5 10 ml . uninoculated sl , gly , and me media were used as controls ( 50 l of broth + 50 l of cell or conidium suspension ) . the plates were incubated at 30c in plastic bags , supplemented with a moist paper tissue to maintain humidity , and visually examined for fungal growth inhibition after 48 to 72 hours . to correlate the growth stage and antifungal activity , freudenreichii and p. jensenii were washed in 0.8% nacl solution and counted using a petroff -hausser counting chamber . a concentration of 10 bacteria ml was inoculated in gly broth and incubated anaerobically as still cultures at 30c . after 2 , 8 , 12 , 24 , 36 , 48 , 56 , 72 , 80 , and 98 hours , 1 ml samples were withdrawn , and one aliquota was diluted and counted using a petroff -hausser counting chamber . the remaining of the sample was centrifuged ( 12 000 rpm , 10 min ) and the supernatant was collected and kept at 20c until further analysis . the supernatants were then diluted with sterile water two , four , and eight times . aliquots ( 50 l ) of all dilutions were added to two microtitre plate wells containing 50 l of a p. roqueforti conidial suspension . eight wells were also prepared with 50 l me broth and 50 l conidial suspension as growth controls . the final supernatant concentration in the wells was thus 50% ( for the pure supernatant ) , 25% , 12.5% , and 6.25% and the conidium concentration was 5 10 ml . plates were incubated at 30c in plastic bags containing a moist paper tissue to maintain humidity . after 48 hours , the plates were examined visually , and the degree of inhibition was compared to control wells and rated according to the following scale : 0 , no inhibition , 1 , weak visible inhibition , 2 , obvious inhibition , 3 , strong inhibition , but still visible growth , and 4 , complete inhibition . the glycerol conversion pathways in propionibacteria were studied by growing the cells in c - labeled glycerol , and analyzing the spent growth medium with nmr . based on results from the previous experiment , the setup was the same as in the correlation experiment above , except for the medium which contained c - labeled glycerol ( 50% 1,3-labeled and 50% 2-labeled ; larodan fine chemicals ab , malm , sweden ) instead of glycerol . the cell number was counted , and the remaining of the sample was centrifuged ( 12 000 rpm , 10 min ) , filtered ( 0.45 m ) , and frozen at 20c until further analysis . the supernatants were analyzed for organic acids and low - molecular - mass metabolites with hplc and c nmr spectroscopy . the hplc analysis was performed on a cation exclusion column ( rezex roa - organic acid , phenomenex inc . , torrance , ca , usa ) at 25c , using 5 mm h2so4 as mobile phase at a flow rate of 0.6 ml min . the eluate was monitored with a refractive index detector ( agilent 1100 series , agilent technologies ) . standard solutions of lactic , acetic , and propionic acid at concentrations of 10 , 25 , 50 , and 100 mm were included in the analysis . the c nmr samples were prepared by mixing aliquots ( 600 l ) of each supernatant with d2o ( 100 l ) . the samples were analysed by c nmr spectroscopy ( 100 mhz ) at 30c on a bruker drx-400 nmr spectrometer ( bruker biospin gmbh , rheinstetten , germany ) equipped with a 5-mm qnp probe head . data from 128 scans were accumulated , and the spectral width was 240 ppm . the ph of the supernatants was recorded using a phm92 ph meter ( radiometer , copenhagen , denmark ) . differences in bacterial growth ( when monitored ) , ph , and acid production were analyzed for each propionibacteria when grown in different media , for both agar and broth methods , by two - way analysis of variance using bonferroni posttests ( prism4 , graph pad software ) . all five type strains of propionibacteria were tested against three different target fungi ( two molds and one yeast ) at glycerol concentrations between 0 mm and 500 mm . freudenreichii ( figure 1 ) , as well as by the other tested propionibacteria ( results not shown ) when the bacteria was grown in the presence of glycerol , with increasing concentrations of glycerol enhancing the antifungal effect . the indicator mold penicillium commune was the most sensitive fungi tested , and it was completely inhibited in the presence of 500 mm glycerol by most propionibacteria strains . penicillium roqueforti was only slightly inhibited by p. acidipropionici and p. thoenii even at high glycerol concentrations , but with p. freudenreichii subsp . the yeast r. mucilaginosa was the most resistant organism to the inhibitory activity of propionibacteria . from the results obtained , only p. jensenii showed visible inhibitory effects against r. mucilaginosa in the presence of glycerol , at concentrations of 200 and 500 mm the results of the acid analysis and ph measurements from the agar extractions are shown in table 1 . to evaluate the extraction efficiency of propionic acid from the agar , the analysis was first performed with plates containing 50 and 100 mm pure propionic acid . the procedure proved itself to be adequate since similar amounts of propionic acid were quantified in the extracts analyzed ( data not shown ) . from plates without bacteria , only lactic acid ( 120 mm ) and/or glycerol ( 30 mm ) were extracted from the medium . the initial ph of the uncultured plates , with or without glycerol , was 5.5 . the comparison between plates with and without glycerol for each propionibacterium revealed significant difference in the remaining amount of lactic acid only for p. jensenii ( p < .01 ) with a smaller amount remaining on the plates without addition of glycerol . p. thoenii also showed a tendency towards less lactic acid remaining on plates without glycerol , but since the results from glycerol overlaid plates represented only two measurements , no reliable statistical analysis could be done . for p. freudenreichii subsp . shermanii , there was a significant difference in production of propionic acid , with higher amounts produced in the presence of glycerol ( p < .001 and p < .05 , resp . ) . the content of glycerol decreased in the medium after bacterial growth for all strains , but to a minor extent with p. acidipropionici . there was a significant difference in the ph for all of the strains when their growth in the presence of glycerol was compared ( p < .001 ) . production of acids and change in ph were recorded for the five propionibacteria strains grown in sl and gly broths ( table 2 ) . the initial ph of uncultured sl broth was 5.5 , while gly broth had a ph of 6.0 . lactic and acetic acid were only detected in cultures of sl medium and the production of propionic acid was significantly higher in these cultures ( p < .001 for p. freudenreichii , and p. jensenii and p < .01 for p. acidipropionici ) with the exception of p. thoenii ( p > .05 ) . final counts cfu ml did only differ significantly between sl and gly for p. freudenreichii subsp . the final ph was noticeably lower in the gly medium ( p < .001 for all strains ) ( table 2 ) . the supernatants from the liquid culture experiment were tested for antifungal activity in a microtitre plate assay ( table 2 ) . supernatants from cultures grown in sl medium , did not inhibit growth of any of the tested fungi , while growth of propionibacteria in gly medium gave a clear inhibitory effect . the molds were inhibited by p. acidipropionici , p. thoenii , and p. jensenii , but not by p. freudenreichii subsp . all three fungi were able to grow in uncultured sl and gly broths ( data not shown ) . freudenreichii and p. jensenii against penicillium roqueforti was evaluated during bacterial growth , and the results can be seen in figure 2 . no antifungal activity was detected before the stationary growth phase ( 48 h ) was achieved . however , after 48 h of incubation , the effect increased with time , reaching the highest level at 80 h. to demonstrate the increasing antifungal activity of the supernatants with time , they were diluted in sterile water two , four , and eight times . ( 1 on the scale ) against penicillium roqueforti after 48 h of incubation when twofold diluted . at this dilution , maximum inhibition was seen at 80 h. when the culture filtrate was diluted four times , inhibition of penicillium roqueforti was weak even at 56 h but increased after 72 h and was maintained at the higher level throughout the experiment . freudenreichii . when the culture filtrate of p. jensenii was diluted two times , complete inhibition ( 4 on the scale ) was seen already at 48 h. with a fourfold dilution of the same culture filtrate , complete inhibition was reached at 56 h. when it was diluted eight times , clear inhibition of penicillium roqueforti was recorded after 72 h , with maximum inhibition achieved at 80 h and maintained until the end of the experiment . no further increase in inhibitory activity was observed between 80 and 98 h. the experiment was repeated with the same results ( not shown ) . a fresh culture of p. jensenii was grown for 96 h in gly broth prepared with c - labeled glycerol . samples were withdrawn at 0 , 24 , 48 , and 96 h and analyzed with respect to ph , bacterial counts , glycerol , and production of acids ( table 3 ) . the ph of the broth at the beginning of the experiment was 6.2 , and after 24 h of incubation with p. jensenii only a slight reduction to 6.1 was observed . after 48 h of incubation , the ph dropped to 4.9 and at the last sampling point , 96 h , it was 4.6 . initially , hplc analysis only detected glycerol in the gly broth , but with each following sampling point , the level of propionic acid increased at the expense of the glycerol concentration . however , the decrease in glycerol concentration was faster than the production of propionic acid , indicating the utilization of glycerol for bacterial growth supporting pathways . each sample was also analyzed with c nmr spectroscopy to follow the glycerol conversion , and propionic acid was the only c - labeled metabolite detected ( figure 3 ) . the concentration of propionic acid increased over time , with the highest concentration detected in the sample harvested after 96 h. figure 3(a ) shows c - labeled glycerol , where asterisks denote the labeled carbons . the labeling pattern of the propionic acid formed is also shown by asterisks in figure 3(d ) . the signals from c - labeled glycerol decreased over time , and at 48 h ( figure 3(c ) ) , small signals from c - labeled propionic acid appeared . figure 3(d ) shows signals for propionic acid produced after 96 h of incubation . it also presents magnified regions of the c nmr spectrum and schematic pictures of the propionic acid formed with labeling at c1 and c2 , c1 , and c3 , and a single label at c2 . labeling at both c1 and c2 resulted in doublet signals for both c1 and c2 , caused by spin - spin coupling ( jc , c 53 hz ) of the neighboring c nuclei . labeling at both c1 and c3 did not result in any observable signal splitting , due to the small values for jc , c in aliphatic carboxylic acids ( often ~1 hz ) . the antifungal activity of dairy propionibacteria type strains was evaluated in the presence of glycerol . studies were performed on both liquid and solid media and complemented with a glycerol conversion study using c - labeled glycerol . mold inhibition in the overlay assay was observed with all bacteria , and by increasing the glycerol concentration , the inhibitory effect was enhanced . however , with the overlay assay , the inhibitory activity of the different bacteria against the yeast r. mucilaginosa was hardly affected by the increasing concentration of glycerol . in broth , molds were only inhibited by the supernatant of gly medium cultured with p. acidipropionici , p. jensenii , and p. thoenii . in contrast to the solid matrix assay , the yeast under evaluation was completely inhibited by all propionibacteria when the supernatant of gly medium was used . there is one important difference between the two experimental systems that needs to be considered . in broth cultures , the bacterial biomass is removed after 72 hours of incubation , resulting in a constant ph and metabolite concentration for the following assay , while the agar plate assay produces a continuous supply of metabolites from the growing bacteria , diffusing into both layers of agar and lowering the ph . while the continuous diffusion of propionic acid in the overlay method favored the inhibition of mold growth , the yeast was not affected to the same extent . it is known that propionic acid , as well as sodium , potassium , and calcium propionate , is an effective inhibitor of many molds but may show only weak activity against yeasts and bacteria . when comparing an agar diffusion method and a broth microdilution test for determining the minimal inhibitory concentration ( mic ) values of different antibiotics against brachyspira hyodysenteriae , rohde et al the mic values obtained were , on average , one dilution step lower for the broth dilution method . the difference observed was explained based on the divergent characteristics of the solid and liquid media , which provide different conditions for the diffusion of antibiotics or other substances . the specific growth characteristics of the unicellular yeasts and the filamentous molds may also lead to different responses to antifungal conditions in diverse environments . however , the levels of glycerol added to the agar in the plate assays gave no measurable reduction in water activity ( data not shown ) . indeed , the addition of 100 mm glycerol to water only decreased the water activity from 1.000 to 0.995 , so a much higher glycerol concentration would be needed to cause any fungal growth inhibition . the final ph of liquid bacterial cultures grown in the presence of glycerol was significantly lower which might have contributed to the enhanced effect observed with these cultures . the composition of the media plays an important role on the final ph of the cultures . addition of acid to this medium lowers the ph ( 4.7 after addition of 50 mm propionic acid ) but not as much as compared to acid addition to pure water ( ph 2.9 with the same acid ) , due to the buffering capacity of sodium lactate . glycerol has no buffering capacity , so acids produced by propionibacteria in gly medium decrease the ph more efficiently . because propionic acid has a pka of 4.87 , at the final ph achieved in the cultured broths ( ph of 4.34.7 ) , more than 50% of the total propionic acid content occurs in undissociated form . the inhibitory effect of weak acids ( i.e. , propionic acid ) is often attributed to the undissociated molecules . however , the exact mode of action is still not fully understood and a number of theories exist . one suggests the prevention of growth by inhibition of the active transport into the cells , while another involves the negative effects of pumping protons from the acid by the plasma membrane h - atpase pump , blocking further growth - supporting action . previously , the sensitivity of eight spoilage fungi to three weak acids at different ph values has been reported . for propionic acid at ph 5 , the mic reported for r. mucilaginosa was 30 mm , which clearly explains the suppressed growth of this yeast by all propionibacteria tested in liquid gly cultures ( table 2 ) . for molds used in this study , lind et al . reported that propionic acid had an mic of 40 mm at ph 5.0 , which is also in accordance with the results reported here for liquid cultures . shermanii produced only 26 mm propionic acid , which was insufficient for total growth inhibition of the molds tested at ph around 5.0 . the cultures grown in sl medium displayed a higher final ph , close to 6 , which requires increased propionic acid concentrations for inhibition of fungal growth , since only approximately 7% of the propionic acid is present in its undissociated form at this ph . when production of acids in the two systems used for bacterial growth ( liquid and overlay assay ) is considered , the two methods can not be directly compared . supernatants from broth cultures are homogenous and contain the total amount of the acids determined by analysis . in gel plugs , the two layers of different substrate are mixed together for acid extraction , and the extract contains the mean value from both agar substrates . in solid medium , the amount of propionic acid produced was significantly higher for three of the five strains tested when glycerol was present in the substrate . considering that the bacteria were grown on sl agar have grown on sl for 72 hours and then provided with an additional carbon source ( overlaid glycerol ) , the higher propionic acid yield was not surprising , also visible in table 1 . in contrast , growth in liquid sl medium resulted in more propionic acid than growth in liquid gly medium . strains belonging to p. freudenreichii species showed a more pronounced difference , producing less than half of the propionic acid amount in gly than in sl broth . since the buffering capacity of sl medium ( sodium lactate ) is absent in gly medium , the production of propionic acid immediately lowers the ph , which can promote an inhibiting environment even for the propionibacteria itself . the results indicate a tendency toward a homofermentative pathway producing only propionic acid when glycerol was the energy source ( table 2 ) . earlier studies have shown that the use of glycerol as carbon source results in higher yield of propionic acid and less diversity in end - product composition compared to the use of glucose or lactic acid . a similar observation was also made in a comparison of glycerol and glucose as carbon sources for two species of propionibacteria in batch cultures . the observed c labeling pattern of propionic acid agrees with a previously suggested metabolic pathway for the formation of propionic acid from glycerol . in this pathway , glycerol is transformed to pyruvate , via dihydroxyacetone phosphate and phosphoenolpyruvate ( figure 4 ) . oxaloacetate is transformed to malate and then to succinate , and finally co2 is eliminated from succinate to produce propionic acid . thus , during growth on c glycerol , a portion of the co2 released by the bacteria is expected to be c - labeled . if c - labeled co2 , derived from a labeled glycerol molecule , is added to pyruvate , propionic acid c - labeled on both c1 and c2 may be formed ( figure 4 ) , as observed in the present study ( figure 3 ) . the conversion of glycerol into 3-hydroxypropionaldehyde , also known as reuterin , in lab , involves a coenzyme b12-dependent glycerol / diol dehydratase . this enzyme is found in species of enterobacteriaceae and propionibacteriaceae , but the enzymes are immunologically distinct from each other . to investigate the possibility that propionibacteria produce a reuterin - like antimicrobial compound similar to that found in lab shermanii digested with bamhi , with two adjacent p - labeled ecori - fragments derived from l. coryniformis si3 according to standard methods . the two fragments , together constituting approximately 5500 bp , contained the complete pdua , the two pdub , the pduc , pdud , and pdue - genes . however , no signal was obtained even at low , stringency conditions ( data not shown ) . combinations of antifungal propionibacteria and glycerol might be used as biopreservation systems by the food and feed industry , where fungal spoilage are of concern . in a recent study , suhr and nielsen found that propionate was an effective mold inhibitor , except against p. roqueforti , p. commune , and eurotium rubrum , as long as the ph and aw were not too high . both glycerol and propionic acid are approved food additives , and propionibacteria are today commonly used as starter cultures in dairy products and bread . therefore , the use of glycerol as part of a fungal inhibitory system along with propionibacteria could provide additional positive properties , since glycerol often is used as an additive to reduce the aw . besides , the biodiesel industry would also benefit from new uses of the increasing surplus of glycerol . finding a qualified combination of propionibacteria and glycerol for the application as a biopreservation system in the food and feed industry is an interesting challenge for future research .	dairy propionibacteria are widely used in starter cultures for swiss type cheese . these bacteria can ferment glucose , lactic acid , and glycerol into propionic acid , acetic acid , and carbon dioxide . this research examined the antifungal effect of dairy propionibacteria when glycerol was used as carbon source for bacterial growth . five type strains of propionibacteria were tested against the yeast rhodotorula mucilaginosa and the molds penicillium commune and penicillium roqueforti . the conversion of 13c glycerol by propionibacterium jensenii was followed with nuclear magnetic resonance . in a dual culture assay , the degree of inhibition of the molds was strongly enhanced by an increase in glycerol concentrations , while the yeast was less affected . in broth cultures , decreased ph in glycerol medium was probably responsible for the complete inhibition of the indicator fungi . nmr spectra of the glycerol conversion confirmed that propionic acid was the dominant metabolite . based on the results obtained , the increased antifungal effect seen by glycerol addition to cultures of propionibacteria is due to the production of propionic acid and ph reduction of the medium .
You are an expert at summarizing long articles. Proceed to summarize the following text: radiofrequency ( rf ) radiation has long been used for different types of information exchange . mobile phones which are low power , single channel two - way radios , emit signals via electromagnetic waves . widespread use and increased popularity of these modern communication devices have caused a growing public concern about possible health effects of electromagnetic fields ( emfs)[1 - 5 ] . although mobile phones and mobile base stations emit the same type of radiation , the role of mobile phones in human exposures is estimated to be significantly higher than that of the towers . although the output power of towers is two to three orders of magnitude greater than that of mobile phones , the phones are held just a few centimeters from sensitive parts of the body such as the brain and the eyes . it is estimated that approximately 50 - 70% of the output power of a phone is absorbed by the user . the bioeffects of exposure to electromagnetic fields on the function of different glands of endocrine system such as pineal , pituitary gland[8 - 10 ] , adrenal , hypothalamus , and thyroid gland , as well as of the endocrine pancreas , testicles[15 - 17 ] , and ovaries , have been widely investigated . insulin plays important roles such as maintenance of sufficient energy stores to allow for development , growth , and reproduction and serving as a feedback regulator of plasma glucose . although it is known that long term exposure to extremely low frequency electromagnetic fields ( elfemf ) can be associated with biological effects such as increased size of pancreatic islets and decreased glucose level , the effects of short - term exposure to radiofrequency radiations used in mobile communication ( 900/1800 mhz ) on the insulin level and the structure of liver and pancreas are not clearly understood . over the past years , our laboratory has focused on studying the health effects of exposure of laboratory animals and humans to some common and/or occupational sources of electromagnetic fields including mobile phones [ 12,20 - 26 ] . forty two female adult sprague dawly rats ( 200 - 250 g ) were randomly divided into 4 groups of 14 or 7 animals each . the rational for this design was this point that there was no exposure in the both of sham - exposure groups . the animals were kept in special cages with controlled temperature ( 22 2c ) , humidity ( 50 10% , ) and lighting ( fluorescent lighting was provided for 12 h daily ) . all animal experiments were considered and approved by the animal experimentation ethics committee of shiraz university of medical sciences prior to commencing work . the animals in the first group were exposed to rf radiation 6 hours per day for 7 days . the 2nd group received sham exposure ( 6 hours per day for 7 days ) . the 3rd and 4th groups received rf radiation 3 hours per day for 7 days and sham exposure ( 3 hours per day ) , respectively . a nokia 1200 gsm mobile phone in talk mode was used for rf irradiation . during the rf exposure , the distance between the antenna of the mobile phone and animal s head was 5 cm . the specific absorption rate ( sar ) of rf was 2.0 w / kg . these organs were cut by sagital plane and stored in buffered 10% formalin solution . after routing processing , sections with 5m thickness were stained with hematoxylin and eosin ( h & e ) respectively and were studied under light microscope . the difference among the mean insulin levels of different groups was evaluated by the non - parametric tests . a value of p<0.05 ( 2-sided ) forty two female adult sprague dawly rats ( 200 - 250 g ) were randomly divided into 4 groups of 14 or 7 animals each . the rational for this design was this point that there was no exposure in the both of sham - exposure groups . the animals were kept in special cages with controlled temperature ( 22 2c ) , humidity ( 50 10% , ) and lighting ( fluorescent lighting was provided for 12 h daily ) . all animal experiments were considered and approved by the animal experimentation ethics committee of shiraz university of medical sciences prior to commencing work . the animals in the first group were exposed to rf radiation 6 hours per day for 7 days . the 2nd group received sham exposure ( 6 hours per day for 7 days ) . the 3rd and 4th groups received rf radiation 3 hours per day for 7 days and sham exposure ( 3 hours per day ) , respectively . a nokia 1200 gsm mobile phone in talk mode was used for rf irradiation . during the rf exposure , the distance between the antenna of the mobile phone and animal s head was 5 cm . the specific absorption rate ( sar ) of rf was 2.0 w / kg . these organs were cut by sagital plane and stored in buffered 10% formalin solution . after routing processing , sections with 5m thickness were stained with hematoxylin and eosin ( h & e ) respectively and were studied under light microscope . the difference among the mean insulin levels of different groups was evaluated by the non - parametric tests . a value of p<0.05 ( 2-sided ) the mean insulin level in the 1st group before exposure to rf radiation was 0.340.22 ui / dl , while after exposure ( 6 hours per day for 7 days ) it was 0.160.05 ui / dl ( p=0.001 ) . on the other hand , the mean insulin level in the 2nd group before sham exposure to rf radiation was 0.530.37 ui / dl , while after sham exposure ( 6 hours per day for 7 days ) it was 0.260.17 ui / dl ( p=0.028 ) . in animals of the 3rd group , the mean insulin level before exposure to rf radiation was 0.220.26 ui / dl , while after exposure ( 3 hours per day for 7 days ) it was 0.230.14 ui / dl ( p=0.423 ) . on the other hand , the mean insulin level in the 4th group before sham exposure to rf radiation was 0.280.28 ui / dl , while after sham exposure ( 6 hours per day for 7 days ) it was 0.270.15 ui / dl ( p=0.917 ) . in spite of the observed differences , the baseline ( before the exposure ) insulin levels in all groups were within the acceptable levels for these animals and the differences in the baseline insulin levels were not statistically significant . in this study , as shown in figure 1 , no histological abnormalities were observed in the liver of the sham exposed groups ( groups 2 and 4 ) . the histological sections of the liver of group 1 ( 6 h exposure per day for 7 days ) showed severe infiltration of mononuclear cells , mainly lymphocytes in the portal spaces of the hepatic lobules with penetration of the cells into the limiting plate of portal space figure 2 . the sections of the liver in the group 3 ( 3 h exposure per day for 7 days ) showed mild mononuclear cellular infiltration in the portal spaces with no penetration into the limiting plates figure 3 . in both of the above groups no histologic abnormalities were observed in the central veins , hepatocyte cytoplasm and nuclei , liver sinosuids and kuppfer cells . no histological abnormalities can be observed in the histological sections ( a 160 , b 400 ) . micrographs of the liver of group 1 ( 6 h exposure per day for 7 days ) . severe infiltration of mononuclear cells , mainly lymphocytes in the portal spaces of the hepatic lobules with penetration of the cells into the limiting plate of portal space is observed . the sections of the liver in the group 3 ( 3 h exposure per day for 7 days ) show mild mononuclear cellular infiltration in the portal spaces with no penetration into the limiting plates . no histologic abnormalities can be observed in the central veins , hepatocyte cytoplasm and nuclei , liver sinosuids and kuppfer cells ( a 160 , b 400 ) . no histological abnormalities were observed in the pancreas of the sham exposed groups ( figure 4 ) . the histopathologic changes of the pancreas in the group 2 ( 6 h exposure per day for 7 days ) showed moderate diffuse dissociation of the endocrine cells of the islet cells of pancreas from each other ( figure 5 ) . the sections of the pancreas in the sham exposed group showing normal acini and normal islet cells of the langerhance ( a 160 , b 250 ) . the sections of the pancreas in the group 2 ( 6 h exposure per day for 7 days ) showing dissociation of most of the islet cells of the langerhance ( a 160 , b 250 ) . the sections of the pancreas in the group 4 ( 3 h exposure per day for 7 days ) showed mild focal dissociation of the cells in the islet cells of the langerhance . the exocrine portion of the pancreas and pancreatic duct and blood vessels in both of groups 2 and 4 were normal ( figure 6 ) . the sections of the pancreas in the group 4 ( 3 h exposure per day for 7 days ) show mild focal dissociation of the cells in the islet cells of the langerhance . exocrine portion of the pancreas and pancreatic duct and blood vessels in both of groups 2 and 4 are normal ( a 160 , b 250 ) . in this study , as shown in figure 1 , no histological abnormalities were observed in the liver of the sham exposed groups ( groups 2 and 4 ) . the histological sections of the liver of group 1 ( 6 h exposure per day for 7 days ) showed severe infiltration of mononuclear cells , mainly lymphocytes in the portal spaces of the hepatic lobules with penetration of the cells into the limiting plate of portal space figure 2 . the sections of the liver in the group 3 ( 3 h exposure per day for 7 days ) showed mild mononuclear cellular infiltration in the portal spaces with no penetration into the limiting plates figure 3 . in both of the above groups no histologic abnormalities were observed in the central veins , hepatocyte cytoplasm and nuclei , liver sinosuids and kuppfer cells . no histological abnormalities can be observed in the histological sections ( a 160 , b 400 ) . micrographs of the liver of group 1 ( 6 h exposure per day for 7 days ) . severe infiltration of mononuclear cells , mainly lymphocytes in the portal spaces of the hepatic lobules with penetration of the cells into the limiting plate of portal space is observed . the sections of the liver in the group 3 ( 3 h exposure per day for 7 days ) show mild mononuclear cellular infiltration in the portal spaces with no penetration into the limiting plates . no histologic abnormalities can be observed in the central veins , hepatocyte cytoplasm and nuclei , liver sinosuids and kuppfer cells ( a 160 , b 400 ) . no histological abnormalities were observed in the pancreas of the sham exposed groups ( figure 4 ) . the histopathologic changes of the pancreas in the group 2 ( 6 h exposure per day for 7 days ) showed moderate diffuse dissociation of the endocrine cells of the islet cells of pancreas from each other ( figure 5 ) . the sections of the pancreas in the sham exposed group showing normal acini and normal islet cells of the langerhance ( a 160 , b 250 ) . the sections of the pancreas in the group 2 ( 6 h exposure per day for 7 days ) showing dissociation of most of the islet cells of the langerhance ( a 160 , b 250 ) . the sections of the pancreas in the group 4 ( 3 h exposure per day for 7 days ) showed mild focal dissociation of the cells in the islet cells of the langerhance . the exocrine portion of the pancreas and pancreatic duct and blood vessels in both of groups 2 and 4 were normal ( figure 6 ) . the sections of the pancreas in the group 4 ( 3 h exposure per day for 7 days ) show mild focal dissociation of the cells in the islet cells of the langerhance . exocrine portion of the pancreas and pancreatic duct and blood vessels in both of groups 2 and 4 are normal ( a 160 , b 250 ) . findings of this study showed that exposure to rf radiation ( 6 hours per day for 7 days ) significantly decreased the mean insulin level in the 1st group ( 0.340.22 ui / dl before exposure and 0.160.05 ui / dl after exposure , p=0.001 ) . it is worth mentioning that the mean insulin level in the 2nd group that were sham exposed to rf radiation ( 6 hours per day for 7 days ) also decreased after sham exposure ( 0.530.37 ui / dl before sham exposure and 0.260.17 ui / dl after sham exposure , p=0.028 ) . interestingly decreasing the exposure time from 6 hours per day to 3 hours per day ( for 7 days ) did not affect the insulin level ( there was no any statistical significant difference between before exposure / sham exposure and after exposure / sham exposure insulin levels ) . to the best of our knowledge , our study is the first survey to assess the associations between exposure to 900 mhz gsm mobile phone radiations and alterations in the levels of insulin hormone as well as the histopathological changes of liver and pancreas . however , there are some published reports on the effects of extremely low frequency radiations ( elf ) on insulin level in laboratory animals . our findings are in contrast with those reported by gholampour et al . who showed that the insulin level of the exposed rats ( continuous exposure to 50 hz extremely low frequency emf 24 h / day for 135 days ) was increased . according to their report first of all , we used 900 mhz gsm mobile phone radiations while 50 hz extremely low frequency emf was used in the study of gholampour and his colleagues . on the other hand , the duration of exposure in our study was much shorter than that of gholampour et al . ( 3 or 6 hours per day for 7 days versus continuous exposure to 50 hz extremely low frequency emf 24 h / day for 135 days ) . these basic variations in the study design and methods can easily explain the observed different findings . interestingly , sakuarai et al had previously suggested that the exposure to extremely low frequency magnetic fields ( continuous exposure to 60 hz elf , magnetic flux densities of 400 t , 1 mt or 5 mt for either 10 or 15 min ) can be clinically used as a novel inhibitory method of excessive insulin secretion in treatment of type 2 diabetes . also studied the effects of exposure to magnetic field ( exposure to 50hz elf , 500t , 10 h / day for 2 months ) on energy metabolism in rats , divided 45 adult male rats into 3 equal groups . serum insulin and cholesterol levels in the emf exposed group were less than those of other groups , while serum glucose level was significantly higher in the exposed animals . these authors also reported that based on their findings exposure to emf has a potential role in clinical use . this study showed that rf radiation emitted from mobile phones can induce mild to severe inflammatory changes in the portal spaces of the liver of rat depending on the duration of the exposure from 3 to 6 hours per day for 7 days . no definite hepatic histological changes have been reported in the literature so far . however , regarding the bioeffects of exposure to extremely low frequency electromagnetic fields , there are some published reports . have previously shown that continuous exposure of rats to 50 hz extremely low frequency emf 24 h / day for 135 days alters insulin secretion by affecting the structure of pancreas . enref_34 . also the rf radiation of mobile phones can induce damage in the cells of islet of langerhans as separation of the cells from each other with mild focal to moderate and diffuse depending on the duration of exposures from 3 to 6 hours per day for 7 days . further large - scale research is required to clarify the extent of alterations caused by mobile phone use on the insulin level in humans . findings of this study showed that exposure to rf radiation ( 6 hours per day for 7 days ) significantly decreased the mean insulin level in the 1st group ( 0.340.22 ui / dl before exposure and 0.160.05 ui / dl after exposure , p=0.001 ) . it is worth mentioning that the mean insulin level in the 2nd group that were sham exposed to rf radiation ( 6 hours per day for 7 days ) also decreased after sham exposure ( 0.530.37 ui / dl before sham exposure and 0.260.17 ui / dl after sham exposure , p=0.028 ) . interestingly decreasing the exposure time from 6 hours per day to 3 hours per day ( for 7 days ) did not affect the insulin level ( there was no any statistical significant difference between before exposure / sham exposure and after exposure / sham exposure insulin levels ) . to the best of our knowledge , our study is the first survey to assess the associations between exposure to 900 mhz gsm mobile phone radiations and alterations in the levels of insulin hormone as well as the histopathological changes of liver and pancreas . however , there are some published reports on the effects of extremely low frequency radiations ( elf ) on insulin level in laboratory animals . our findings are in contrast with those reported by gholampour et al . who showed that the insulin level of the exposed rats ( continuous exposure to 50 hz extremely low frequency emf 24 h / day for 135 days ) was increased . according to their report first of all , we used 900 mhz gsm mobile phone radiations while 50 hz extremely low frequency emf was used in the study of gholampour and his colleagues . on the other hand , the duration of exposure in our study was much shorter than that of gholampour et al . ( 3 or 6 hours per day for 7 days versus continuous exposure to 50 hz extremely low frequency emf 24 h / day for 135 days ) . these basic variations in the study design and methods can easily explain the observed different findings . interestingly , sakuarai et al had previously suggested that the exposure to extremely low frequency magnetic fields ( continuous exposure to 60 hz elf , magnetic flux densities of 400 t , 1 mt or 5 mt for either 10 or 15 min ) can be clinically used as a novel inhibitory method of excessive insulin secretion in treatment of type 2 diabetes . also studied the effects of exposure to magnetic field ( exposure to 50hz elf , 500t , 10 h / day for 2 months ) on energy metabolism in rats , divided 45 adult male rats into 3 equal groups . serum insulin and cholesterol levels in the emf exposed group were less than those of other groups , while serum glucose level was significantly higher in the exposed animals . these authors also reported that based on their findings exposure to emf has a potential role in clinical use . this study showed that rf radiation emitted from mobile phones can induce mild to severe inflammatory changes in the portal spaces of the liver of rat depending on the duration of the exposure from 3 to 6 hours per day for 7 days . no definite hepatic histological changes have been reported in the literature so far . however , regarding the bioeffects of exposure to extremely low frequency electromagnetic fields , there are some published reports . have previously shown that continuous exposure of rats to 50 hz extremely low frequency emf 24 h / day for 135 days alters insulin secretion by affecting the structure of pancreas . enref_34 . also the rf radiation of mobile phones can induce damage in the cells of islet of langerhans as separation of the cells from each other with mild focal to moderate and diffuse depending on the duration of exposures from 3 to 6 hours per day for 7 days . further large - scale research is required to clarify the extent of alterations caused by mobile phone use on the insulin level in humans . based on the results obtained in this study it can be concluded that mobile phones signal strength can not significantly alter the accuracy of home blood glucose monitors . more studies using blood glucose monitors and mobile phones made by different manufactures are needed to better understand the role of mobile phone signal strength on the occurrence of emi .	background : the rapidly increasing use of mobile phones has led to public concerns about possible health effects of these popular communication devices . this study is an attempt to investigate the effects of radiofrequency ( rf ) radiation produced by gsm mobile phones on the insulin release in rats . methods : forty two female adult sprague dawley rats were randomly divided into 4 groups . group1 were exposed to rf radiation 6 hours per day for 7 days . group 2 received sham exposure ( 6 hours per day for 7 days ) . groups 3 and 4 received rf radiation 3 hours per day for 7 days and sham exposure ( 3 hours per day ) , respectively . the specific absorption rate ( sar ) of rf was 2.0 w / kg . results : our results showed that rf radiations emitted from mobile phone could not alter insulin release in rats . however , mild to severe inflammatory changes in the portal spaces of the liver of rats as well as damage in the cells of islet of langerhans were observed . these changes were linked with the duration of the exposures . conclusion : rf exposure can induce inflammatory changes in the liver as well causing damage in the cells of islet of langerhans .
You are an expert at summarizing long articles. Proceed to summarize the following text: the medial canthal ligament plays an important role in maintaining shape and function of the eyelids . many factors might cause rupture of the medial canthal ligament , such as canthal trauma , cancer resection , and some craniofacial fractures . in the process of oculoplastic surgery , accidental avulsion of the medial canthal ligament might lead to deformed appearance of the eyelid . disruption of the medial canthal ligament might also result in medial telecanthal deformities , including shortened palpebra , obtuse - angled medial canthi with infraplacement , increased intercanthal distance , and an absent naso - orbital valley . meanwhile , rebuilding of the drainage system and recovery of the function remain a big challenge . to improve the treatment of upper nasolacrimal duct obstruction or absence , jones initialized to apply a surgery named conjunctivodacryocystorhinostomy ( cdcr ) in 1962 . the procedure of cdcr includes rebuilding a new drainage system between the conjunctiva and the nasal cavity using a tear drainage tube and bypassing upper lacrimal system . although cdcr with a tear drainage tube placement is a reliable method for patients with upper lacrimal system obstruction or damage , it remains some problems postoperatively . to our knowledge , assessment of medial canthoplasty combined with cdcr is rare in clinical study . in this research , we aimed at evaluating clinical efficacy of medial canthoplasty - combined cdcr in patients with medial telecanthal deformities and lacrimal drainage system obstruction . twenty - two eyes of 22 patients with surgery of medial canthoplasty combined with cdcr during june 2012 to june 2014 were enrolled in this retrospective comparative study . patients with < 3-month follow - up and without regular show - up in follow - up were excluded from the study . the study was conducted in accordance with the declaration of helsinki and was approved by the ethical committees of the department of ophthalmology , beijing tongren hospital , capital medical university . the direction and ideal position of the medial canthus were marked on the skin [ figure 1a ] . to acquire symmetric effect to the contralateral side , overreduction of 1 mm was adopted . along the medial canthus to the marked point , a reverse y - shaped incision was used . scar tissues around the canthus under the canthal skin were dissected to reduce the resultant tension and avoid stretch of the tissue attachment . ( a ) the normal position of the medial canthus was marked on the skin . ( b ) a microscrew was propelled into the anterior lacrimal crest on its posterior aspect . next , a self - tapping titanium microscrew was driven into the solid bone on the posterior aspect of the anterior lacrimal crest at attached position of the medial canthal ligament [ figure 1b ] . the 3 - 0 wire suture was surrounded neck of screw and passed through the stump of the medial canthal ligament by twice . after that , wire above on skin surface was cut and tucked into soft tissue . nasal decongestion was facilitated by packing neurosurgical cottonoids soaked in 50/50 mixture of 40% lidocaine and oxymetazoline solution into the middle meatus . further hemostasis was achieved by direct infiltration of lidocaine with epinephrine into the site of the initial osteotomy using a 22-gauge spinal needle . a 4 mm kerrison rongeur was used to create the initial osteotomy [ figure 2a ] . it should be cautious to avoid traumatizing the nasal septum or surrounding mucosa during all endonasal manipulations , as this might cause obstruction of medpor - coated ( porex surgical , inc . the desired position of the medpor - coated tube was marked on the conjunctiva [ figure 2b ] . it corresponded to a site 2.5 mm posterior to the medial commissure at the junction between the caruncle and plica semilunaris . an 18-gauge needle was then used to create a tract from the conjunctival side to the right nasal cavity . the angle of entry into the nasal cavity was approximately 45. using simultaneous endoscopic monitoring , the 18-gauge needle could be visualized through the osteotomy site . a 23-gauge stainless steel guidewire was then placed into the lumen of the 18-gauge needle that was previously used . after that , outside part of the 18-gauge needle was clamped by a hemostat to measure the medpor - coated tube . the length of the clamped hemostat was measured with a caliper and the appropriately sized medpor - coated tube was selected . the proximal and distal part of medpor - coating part was separated from the glass tube [ figure 2d ] . further , the conjunctival tract was enlarged with a 15-gauge though the guidewire to widen the conjunctival tract before placement of medpor - coated tube . after a few minutes , the 15-gauge needle was removed and medpor - coated tube selected early was passed over the guidewire [ figure 2e ] . the visualization with endoscopic confirmed the correct position of medpor - coated tube [ figure 2f ] . ( a ) a 4 mm kerrison rongeur was used to create the initial osteotomy . ( b ) the desired placement of the medpor - coated tubes was marked on the conjunctiva . ( c ) the 18-gauge needle was then used to create a tract from the conjunctival side to the right nasal cavity aiming towards the osteotomy created previously . ( d ) the proximal and distal part of medpor coating part was separated from the glass tube . ( e ) the 15-gauge needle was removed and the preselected medpor - coated tubes was then passed over the guide wire . ( f ) the endoscopic view confirmed the medpor - coated tubes was well positioned . the incision was closed using 6 - 0 suture , and skin wound was smeared with erythromycin ophthalmic ointment and bandaged . twenty - two eyes of 22 patients with surgery of medial canthoplasty combined with cdcr during june 2012 to june 2014 were enrolled in this retrospective comparative study . patients with < 3-month follow - up and without regular show - up in follow - up were excluded from the study . the study was conducted in accordance with the declaration of helsinki and was approved by the ethical committees of the department of ophthalmology , beijing tongren hospital , capital medical university . the direction and ideal position of the medial canthus were marked on the skin [ figure 1a ] . to acquire symmetric effect to the contralateral side , overreduction of 1 mm was adopted . along the medial canthus to the marked point , a reverse y - shaped incision was used . scar tissues around the canthus under the canthal skin ( a ) the normal position of the medial canthus was marked on the skin . ( b ) a microscrew was propelled into the anterior lacrimal crest on its posterior aspect . next , a self - tapping titanium microscrew was driven into the solid bone on the posterior aspect of the anterior lacrimal crest at attached position of the medial canthal ligament [ figure 1b ] . the 3 - 0 wire suture was surrounded neck of screw and passed through the stump of the medial canthal ligament by twice . after that , wire above on skin surface was cut and tucked into soft tissue . nasal decongestion was facilitated by packing neurosurgical cottonoids soaked in 50/50 mixture of 40% lidocaine and oxymetazoline solution into the middle meatus . further hemostasis was achieved by direct infiltration of lidocaine with epinephrine into the site of the initial osteotomy using a 22-gauge spinal needle . a 4 mm kerrison rongeur was used to create the initial osteotomy [ figure 2a ] . it should be cautious to avoid traumatizing the nasal septum or surrounding mucosa during all endonasal manipulations , as this might cause obstruction of medpor - coated ( porex surgical , inc . the desired position of the medpor - coated tube was marked on the conjunctiva [ figure 2b ] . it corresponded to a site 2.5 mm posterior to the medial commissure at the junction between the caruncle and plica semilunaris . an 18-gauge needle was then used to create a tract from the conjunctival side to the right nasal cavity . the angle of entry into the nasal cavity was approximately 45. using simultaneous endoscopic monitoring , the 18-gauge needle could be visualized through the osteotomy site . a 23-gauge stainless steel guidewire was then placed into the lumen of the 18-gauge needle that was previously used . after that , outside part of the 18-gauge needle was clamped by a hemostat to measure the medpor - coated tube . the length of the clamped hemostat was measured with a caliper and the appropriately sized medpor - coated tube was selected . the proximal and distal part of medpor - coating part was separated from the glass tube [ figure 2d ] . further , the conjunctival tract was enlarged with a 15-gauge though the guidewire to widen the conjunctival tract before placement of medpor - coated tube . after a few minutes , the 15-gauge needle was removed and medpor - coated tube selected early was passed over the guidewire [ figure 2e ] . the visualization with endoscopic confirmed the correct position of medpor - coated tube [ figure 2f ] . ( a ) a 4 mm kerrison rongeur was used to create the initial osteotomy . ( b ) the desired placement of the medpor - coated tubes was marked on the conjunctiva . ( c ) the 18-gauge needle was then used to create a tract from the conjunctival side to the right nasal cavity aiming towards the osteotomy created previously . ( d ) the proximal and distal part of medpor coating part was separated from the glass tube . ( e ) the 15-gauge needle was removed and the preselected medpor - coated tubes was then passed over the guide wire . ( f ) the endoscopic view confirmed the medpor - coated tubes was well positioned . the incision was closed using 6 - 0 suture , and skin wound was smeared with erythromycin ophthalmic ointment and bandaged . in the present study , a total of 22 patients ( 22 eyes ) were included . the mean age of the patients was 52.0 14.3 years ( range : 3376 years ) . fifteen patients were males ( 63.6% ) and eight patients were females ( 36.4% ) . thirteen patients had medial telecanthal deformities and lacrimal system obstruction in the right eye ; nine patients were in the left eye . all of the postoperative data reported here were documented at the last visit of patient 's follow - up . results of medial canthoplasty showed that , during follow - up , no common complications , such as infection , hematoma , or sensitive to temperature , were observed . the scars caused by the y - shaped medial canthal incision were masked and tolerated well in most patients . before surgery , the canthal distance between two eyes was corrected to 1 mm or less than in postoperative measurements of lateral displacement . patient satisfaction survey of appearance of eyelid and contour of the medial canthus revealed high grade [ figure 3a3d ] . representative photographs of the appearance of eyelid and contour of the medial canthus before and after surgery . ( c ) a 39-year - old woman with severe medial telecanthal deformity , underwent the surgery of medial canthal ligament reduction once . results of cdcr indicated that , in aspect of obstruction , proximal obstruction occurred in four cases due to conjunctival proliferation and distal obstruction and adhesion to septum occurred in two cases due to mucosal proliferation after the primary surgery . as for tube malposition , five patients had tube malposition , and tube extrusion was observed between 1 and 3 months after primary surgery , two tube extrusion developed in patients . moreover , the damage of the lacrimal drainage system also is a common concurrent injury at periorbital region . it is a great challenge to repair a medial canthus and restore the function of lacrimal drainage system . in this study , medial canthoplasty and cdcr were combined together to perform treatment on patients with medial telecanthal deformity and lacrimal drainage system obstruction . cdcr combined with jones tube placement is a classical technique to treat lacrimal drainage obstruction . jones tube is made by heat resistant glass material which has poor flexibility and is prone to prolapse and dislocate . chang et al . reported a 13-year follow - up results of cdcr with jones tube placement . the most common cause of failure was medial migration of the jones tube apart from inappropriate tube insertion in primary surgery and severe inflammation . in another report , a new tube , named metaireau tube ( m - tube ) , was used in cdcr . although the m - tube is simple to reposition when dislocated postoperatively , it does not show better than the jones tube including migration and extrusion in the early postoperative period . in this study , we adopted a medpor - coated tear drain which had shown lower rate of extrusion postoperatively as reported by others . some techniques are not applied currently , for instance , drilling two holes and inserting steel wire . in addition to the difficult procedures , they also cause damage to mucosal vessels and recurrent infection . as for the transnasal medial canthopexy , it is more applicable to bilateral than unilateral medial canthopexy . the procedure is required not only to expose larger surgical area to pass a wire through a bony fenestration , but also to dissect and protect the contralateral orbit . in this study , we chose the posterior aspect of the solid anterior lacrimal crest to attach the medial canthus , which can restore the naso - orbital valley . the improved technique not only prevents complications which are common in other approaches but also provides an excellent method to repair ipsilateral medial canthal without causing complex naso - orbital fractures . the y - shaped medial canthal incision described in this surgery is very small ; however , it provides enough exposure area for operation under direct vision . moreover , it is notable that the incision can minimize facial scarring and reduce operative time . it was reported that the coronal approach was complex and time - consuming for unilateral cases without craniomaxillofacial fractures . to treat the upper nasolacrimal duct obstruction or absence , cdcr with a tear drainage tube placement is an appropriate surgical method . nevertheless , it has several complications including tube malposition , extrusion , and proximal or distal obstruction , which are major problems that might influence surgical outcome . other minor problems such as conjunctival irritation , corneal abrasion , infection , foreign body sensation in the eye , and lumen obstruction might also affect patient comfort . during postoperative period , tube obstruction , caused by conjunctival or mucosal proliferation , is one of the most important reasons of cdcr surgery failure . in previous studies , pyrex drainage tube implantation in cdcr surgeries fan et al . used medpor - coated tear drainage tubes in their surgeries , the rate of obstruction was higher compared to that of previous studies , and nevertheless , they did not show a reasonable explanation . an obstruction rate of 27.3% ( 6/22 ) was observed in the study . in our view , the obstruction might be caused due to medpor coating . second , medpor might irritate the mucous membranes around the tube and cause pyogenic granulomas . tube malposition or migration is a very severe problem in cdcr , which lead to failure of surgery . malposition or shift of the tube outward could damage the ocular surface , whereas shifting inward may lead to pain , infection , obstruction , or mucosal damage . during sniffing or coughing , the tube could move toward the medial or lateral , which need to be revised by surgery . because medpor coating is prone to vascularization which contributes to the stability in early stage , the tube bed was made by osteotomy , which might enlarge overly the tube bed . the bone which the tube bed located was less grinded , and then the needle which is the same size with tube was pushed into the created tract from the conjunctival side to nasal cavity . in this case , debris or mucus accumulation could obstruct the lumen of the medpor - coated tube in cdcr surgery . the incidence of lumen obstruction is widely considered lower in pyrex tubes than in silicon and polyethylene tubes . tube extrusion is the most important complication after cdcr procedure , which leads to surgical failure and usually happened before a fistula formed during the first 6 months after surgery . multiple factors could influence the tube extrusion , for instance , the etiology of canalicular obstruction , the surgical method , or the shape and material of the tube . in previously reports , pyrex glass tube was used most commonly for its satisfactory and ideal drainage , but its extrusion rate was high as 1851% , so medpor - coated tear drainage seemed much more stable . fan et al . reported that there was no case of tube extrusion observed in medpor - coated tear drainage tube implanted cases . this study revealed two tube extrusion in patients with medpor - coated tubes and the reason might be same as tube malposition mentioned above , as the inappropriate osteotomy cause oversized tube bed . the results provide evidence that the porous - coating medpor tubes have good tissue compatibility , although efforts are still required to improve the ability of vascularization to prevent tube extrusion . lots of patients with medial telecanthal deformity are also suffered from lacrimal drainage system damage , especially after trauma . to achieve optimal anatomic outcomes and functional recovery at the same time , if medial canthoplasty was performed first , the titanium microscrew might be pull away from the anterior lacrimal crest during the procedure of cdcr , leading to medial telecanthal deformities again . on the other side , the tear drainage tube might be shifted distally or proximal or even broken , during the procedure of propelling the microscrew or fastening the wire if cdcr was taken first . therefore , the combination of medial canthoplasty and cdcr leads to a better appearance and function recovery in one time . second , this study was performed in a small group of patients . large cohort of patients is needed for the evaluation of efficacy and complications of the surgical procedure in prolonged study . in conclusion , according to the current study , the combination of medial canthoplasty and cdcr is shown to be a priority surgery method for treatment of medial telecanthal deformity and lacrimal drainage system obstruction .	background : rupture of the medial canthal ligament can be caused by many events . it remains a challenge to rebuild the drainage system and restore the function . the aim of this study was to evaluate the clinical efficacy of medial canthoplasty combined with conjunctivodacryocystorhinostomy ( cdcr ) in patients with medial telecanthal deformities and lacrimal drainage system damage.methods:twenty-two patients ( 22 eyes ) treated with medial canthoplasty and cdcr during june 2012 to june 2014 were included in this retrospective study . for all patients , a self - tapping , titanium , low - profile head microscrew was drilled into the solid bone on the posterior aspect of the anterior lacrimal crest at the attachment position of the medial canthal ligament . medpor - coated tear drainage tubes were applied . distance of patient 's lateral displacement before and after operation was recorded and compared . the complications of cdcr were described.results:before the surgery , distance of patient 's canthal displacement was 46 mm . the canthal distance between two eyes of patients with surgery was 1 mm or less . among patients with cdcr , four patients had proximal obstruction and two patients had distal obstruction . five patients had tube malposition , for example , tube extrusion 13 months after surgery.conclusions:medial canthoplasty combined with cdcr is an effective surgical method for treatment of patients with medial telecanthal deformity and lacrimal drainage system obstruction . the study indicates that medial canthoplasty combined with cdcr surgery rebuilds normal appearance of eyelid and contour of the medial canthus and successfully repairs the function of the lacrimal drainage system .
You are an expert at summarizing long articles. Proceed to summarize the following text: soccer players have better postural stability1 , 2 , rely less on vision3 , and develop different postural strategies3 compared with untrained subjects . soccer novices display an exceptional rate of postural control improvement4 . even at the highest level of soccer participation , nothing , however , is known about the changes in postural control in soccer players at the intermediate level of proficiency , i.e. , between early and late adolescence . this is an important and difficult period of motor control development in soccer players because of the significant increase of the training load , fatigue , and participation in competitions . while increased training and tournament experience are expected to enhance postural performance , the longer exposure to strenuous exercise and overload with residual effects of earlier contusions may negatively influence the player s career progress . however , well - tailored balance exercises or ankle taping may improve postural control5 provided that athletes with a balance deficit are correctly identified . the purpose of this study is to compare postural performance between two groups of young soccer players from one club , with significantly different age and sports experience but with a similar training regimen . according to existing knowledge on the role of balance in soccer performance , any departures from this hypothesis would shed light on problems that interfere with the optimal development of the older group , and require adequate action from therapists and athletic trainers . twenty - four young ( age , 13.1 0.6 years ; u14 ) and 23 older ( age , 18.8 0.9 years ; u20 ) players from a large top polish soccer club participated in this study . the younger soccer players trained for 2 h twice a week between 7 and 9 years of age and 2 h three times a week from the age of 10 years . the older group participated in training for 2 h , five times a week . all subjects were systematically engaged in trainings and have not experienced , for at least 6 months , any serious injury that resulted in missed participation time . the study was approved by the local bioethics committee , and all subjects provided informed consent signed by their parents and/or themselves . postural stability was assessed during four 20-s quiet stance trials , first in bipedal stance with eyes open ( eo ) followed with eyes closed ( ec ) , and after a 1-min break in unipedal stance with eo and ec on an amti ( accusway ) force plate . the subjects were instructed to stand barefoot , with the hands at their sides and their feet parallel and 10 cm apart . the sampling rate was 20 hz and the sampling time was 20 s , resulting in 400 sampling segments in each recorded center - of - pressure ( cop ) time series in both the anterior / posterior ( ap ) and medial / lateral ( ml ) planes . each recording started 10 s after the subject was ready for testing to eliminate possible transients in the cop data . the dependent variables were sway variability ( cop standard deviation [ sd ] ) and mean velocity ( mv = the total cop path length divided by the sampling time ) . all dependent variables were subjected to within ( two visual conditions two planes ) between ( two groups ) anova ( statistica 10.0 ) to evaluate the hypothesized main effects and possible interactions . comparison of postural performance and strategies between the two groups was performed by means of contrast analysis . although we did not find the main effect of group , intergroup differences were observed in the interactions that were found in specific trials ( table 1table 1.intergroup comparison ( ) of means ( sd ) of postural sway parameters between u20 and u14 soccer players and the effect of eyes closure ( * ) in two - legged ( bipedal ) and one - legged ( unipedal ) stanceseyes openeyes closedbipedal u20u14u20u14varml ( mm)2.0 ( 0.8)2.8 ( 1.1)2.7 ( 0.9)2.5 ( 0.9)mvelml ( mm / s)5.0 ( 2.5)5.7 ( 2.9)6.8 ( 2.8)5.6 ( 1.9)varap ( mm)2.8 ( 1.1)3.1 ( 1.1)3.2 ( 0.8)3.2 ( 1.1)mvelap ( mm / s)5.5 ( 2.5)6.4 ( 2.6)7.3 ( 3.2)7.4 ( 2.0)unipedalvarml ( mm)3.8 ( 0.9)4.6 ( 1.0)12.0 ( 5.1)9.7 ( 2.8)mvelml ( mm / s)20.9 ( 7.5)23.7 ( 6.6)55.4 ( 21.4)53.0 ( 14.1)varap ( mm)4.7 ( 1.4)5.7 ( 1.9)13.1 ( 5.5)10.5 ( 3.7)mvelap ( mm / s)18.9 ( 6.3)23.0 ( 6.2)63.2 ( 38.6)53.9 ( 23.6)ml : medial / lateral plane ; ap : anterior / posterior plane ; var : sway variability ; mvel : sway mean velocity ; * or p < 0.05 . ) . in the bipedal stance , the cop sd showed a vision group interaction ( f(1 , 45 ) = 4.71 , p = 0.035 ) , which accounted for different effects of vision on postural stability in both groups . ec significantly increased the sway amplitude in the older group without any effect in the younger group . there was also a three - way plane vision group interaction ( f(1 , 45 ) = 4.23 , p = 0.046 ) for the cop sd , which indicated that this difference in the reliance on vision between the two groups was larger in the ml than in the ap plane . moreover , it was in the ml plane only that postural performance with eo , as measured by using the cop sd , was better in the older than in the younger group ( p < 0.05 ) . there was a three - way plane vision group interaction ( f(1 , 45 ) = 4.47 , p = 0.04 ) that may be interpreted in the same way as the measures of cop amplitude . ml : medial / lateral plane ; ap : anterior / posterior plane ; var : sway variability ; mvel : sway mean velocity ; * or p < 0.05 . in the one - legged stance , there was a vision group interaction ( f(1 , 45 ) = 7.58 , p = 0.009 ) for the cop sd . this result confirmed a larger disadvantageous effect of ec on postural stability in the older than in the younger group , which was already shown in bipedal stance . post - hoc analysis revealed between - group differences in postural stability in both the ml and ap planes . with eo , the older soccer players had lower cop sd than the younger players . in contrast , with ec , the older soccer players had larger cop sd than their younger counterparts ( table 1 ) . the purpose of this study is to compare postural control between two groups of young soccer players with significant differences in age and training experience . we predicted better postural performance and decreased reliance on vision in the u20 group . the results supported the former prediction in both planes in the one - legged stance and in the ml plane in the bipedal stance . still , the reliance on vision , in contrast to the latter prediction , was lesser in u14 than in u20 soccer players . roughly speaking , adult athletes preserved their ability to improve their postural performance with eo ; however , they definitely lost this advantage with ec . although there are no precise data on the development of postural control between early adolescence and young adulthood , it is well established that balance performance is significantly better in young adults than in early adolescents6 . furthermore , diminished reliance on vision during balance activities is a widely recognized factor associated with the achievement of a proficient sports level . thus , the overreliance on vision found in this study in u20 players indicates that either the somatosensory7 , 8 and/or vestibular system9 of this group was affected by adverse factors associated with soccer training and game participation . the most common injuries in soccer that significantly contribute to postural control deterioration are ankle sprains and concussions10 . yet , such antecedents were not applicable in this study because of the medically confirmed good health status of our subjects , despite having some residual effects of much earlier strains and contusions , which are the most common injury types11 . also , it is possible that the new challenges of longer training and match exposure12 placed on the u20 players exceeded their tolerance threshold to overload and fatigue . however , our aim here was not to determine the actual reasons for the suboptimal postural control , but rather to demonstrate that balance assessment may be an important and effective way to detect concealed symptoms of postural control that may jeopardize athletic performance . on the basis of the high sensitivity of the contemporary postural control tests , we believe that regular balance assessment may be used as a means for the early detection of even slight deficits in postural control13 . finally , proper selection of stability measures and adequate design of an experimental setup may help identify possible causes for these deficits . this , however , warrants further investigations to determine the optimal structure of such tests to increase their specificity .	[ purpose ] to investigate how increased training participation time and intensity affect postural control in young soccer players . [ subjects and methods ] variability and mean velocity of sway were compared in u14 and u20 players during two - legged and one - legged quiet stances on a force plate with the player s eyes open or closed . [ results ] u20 players performed much better with vision , and eyes closure considerably deteriorated their performance . the increased reliance on vision in the older group most likely resulted from the longer exposure of the u20 players to strenuous exercise , overload , and cumulative residual effects of earlier contusions . [ conclusion ] these specific postural deficits in apparently healthy soccer players were found only because of objective and sensitive posturographic tests . the results of this study suggest that such tests should be regularly performed to increase the efficiency and precision of motor control evaluation in athletes . the corresponding results may help therapists mitigate the indiscernible yet detrimental changes in postural control that predispose soccer players to injury and negatively affect their performance .
You are an expert at summarizing long articles. Proceed to summarize the following text: inverted papilloma is a rare benign tumor of the nasal fossa , which usually originates from the lateral wall of the nasal cavity . only 5% of cases have exclusive sinus involvement . of the latter cases , the maxillary and ethmoid sinuses are most frequently affected.1 primary sphenoid sinus involvement is rare.2 3 4 5 6 7 although this tumor is considered a benign lesion , it has a potentially locally invasive nature , and it is correlated with bony erosion . it also has a tendency for local recurrence and an associated malignancy rate of 7 to 15% , with squamous cell carcinoma being the most common histopathologic type.1 8 we report a case of inverted nasal papilloma originating in a very unusual location : the sphenoid sinus . we describe how the patient was managed , including detailed description of how the lesion was diagnosed and treated . inverted papilloma is a rare benign sinonasal tumor , usually arising from the lateral aspect of nasal wall . it was first described in 1854 by ward.9 10 it accounts for 0.5 to 4% of nasal tumors , and it is most often seen in the fifth and sixth decades of life.11 this tumor presents a characteristic endophytic growth pattern : its schneiderian membrane inverts into the underlying stroma.8 it is also characterized by its potentially invasive nature ; 70% of cases have been found to show evidence of bony erosion on computed tomography ( ct ) scan at diagnosis . it has high rates of recurrence , varying from 20 to 47% according to the current literature.12 13 the characteristic radiographic appearance of inverted papillomas is a unilateral polypoid lesion occupying the lateral nasal wall and paranasal sinuses.8 only 5% of cases demonstrate exclusive sinus involvement , with the maxillary and ethmoid sinuses being the most commonly affected.8 isolated inverted papilloma of the sphenoid sinus is rare . in a recent review of the english literature , 50 cases were reported.14 the majority of patients with inverted papilloma present with nasal complaints such as unilateral nasal obstruction , rhinorrhea , epistaxis , and so on . however , the clinical presentation of inverted papillomas confined to the sphenoid sinus is often nonspecific and insidious , with headache being the most common presentation.14 for years , the recommended treatment of choice consisted of medial maxillectomy and en bloc tumor excision through lateral rhinotomy or a midfacial degloving approach . nevertheless , recently a more conservative management via a transnasal endoscopic approach has been advocated by some authors and has produced some good results . there has been a tendency to consider the exclusive endoscopic approach as the gold standard treatment for inverted papillomas , even in the more advanced stages of the disease and inclusive for the treatment of disease recurrences.15 this technique has remarkably improved throughout the years , presenting a decreased disease recurrence rate compared with the beginning of its use , and was the one chosen by us to perform in our patient.16 the endoscopic technique has shown at least the same effectiveness as the external traditional approach , avoiding the comorbidities related to the latter one.17 some advantages of this technique are better view of the surgical field , lesser resection of viable tissue , decreased nasal scabbing , and reduced amount of postoperative bleeding and pain . the patient , a 56-year - old woman , presented to our outpatient clinic with a 2-month history of frontal headache , occasional otalgia worsened when elevating the head , and recent forgetfulness . she was at first evaluated by a clinical neurologist and then submitted to a head magnetic resonance imaging ( mri ) scan . a lesion was found filling and expanding both sphenoid sinuses , extending to the posterior ethmoidal cells and right sphenoethmoidal recess ( figs . 1 and 2 ) . the radiologist described it as a lobulated mass homogenously enhanced by the contrast media , which was hyperintensive on t2-weighted images and with intermediate intensity on t1-weighted images . coronal view of head magnetic resonance image reveals a lobulated mass occupying both sphenoid sinuses enhanced by the contrast media with no unequivocal evidence of skull base involvement . sagittal view of head magnetic resonance image shows evidence that the lesion might extend beyond the sphenoid sinus lateral wall toward the skull base , possibly affecting the cavernous sinus . sinus computed tomography showing a soft tissue mass filling in the sphenoid sinus extending to the posterior sphenoid with apparent bony integrity . the patient underwent a sphenoidotomy through a transnasal endoscopic approach , by means of 0- and 30-degree rigid fibroscopes . biopsy was performed , and a fragment of tissue was sent for a frozen section analysis . the lesion was meticulously and completely resected through a bilateral sphenoid sinus endoscopic with de - epithelialization . the patient has been followed in the head and neck outpatient clinic for 60 days after surgery , with no signs of recurrence found upon flexible nasofibroscope examination , as shown in the picture ( fig . however , whether this single surgery will be sufficient therapy for our patient in the years to come remains to be seen . the literature describes most recurrences appearing between 1 and 11 months after the initial procedure.3 although endoscopic sphenoidotomy appeared to be effective in this case , longer follow - up is necessary to determine whether the disease will recur . therefore , regular and close follow - up is necessary in all cases following surgery to remove an inverted papilloma . nonspecific symptomatology and clinical presentation make this kind of tumor a diagnostic and therapeutic challenge for otolaryngologists . radiologic examinations , including mri and ct scan , are particularly important to identify its characteristics.14 endoscopic sphenoidotomy has been the treatment of choice ; its effectiveness is described as at least equal to the traditional external approach although it is associated with less comorbidities.18 close follow - up is required to detect possible recurrences and malignant transformation .	introduction inverted papilloma is a rare benign tumor of the nasal fossa , which usually originates from its lateral wall . only 5% of cases demonstrate exclusive sinus involvement . primary sphenoid sinus involvement is even rarer . although considered a benign lesion , the tumor has a potentially invasive nature and has also been found to have an associated malignancy rate of 7 to 15% . objectives to report a case of inverted nasal papilloma originating in a rare location : the sphenoid sinus . resumed report a 56-year - old woman , presented to our outpatient clinic complaining of frontal headache , occasional otalgia and recent forgetfulness . she was initially evaluated by a neurologist and then submitted to a head magnetic resonance imaging . a lesion was found to be filling both sphenoid sinuses . sinus computed tomography showed an opacified sphenoid sinus with apparent bony integrity . the patient underwent sphenoidotomy through a transnasal endoscopic approach . a bleeding papillomatous lesion was identified . a biopsy was performed and histopathologic study suggested inverted papilloma . the lesion was then completely resected . the patient has been followed for 60 days after surgery ; no signs of recurrence were found upon flexible nasofibroscope examination . conclusion inverted papilloma exclusively involving the sphenoid sinus is a rare entity . non specific symptomatology and clinical presentation make this kind of tumor a diagnostic and therapeutic challenge . the endoscopic sphenoidotomy has been the treatment of choice . close follow - up is required in order to detect possible recurrences and malignant transformation .
You are an expert at summarizing long articles. Proceed to summarize the following text: toxoplasmosis is one of the most widespread foodborne parasitic zoonoses caused by the obligate intracellular protozoan toxoplasma gondii . humans may become infected with t. gondii by direct contact with toxoplasmosis - positive ruminants or through the ingestion of the uncooked meat of such ruminants ( 1 ) . however , data on flocks and herds infection with t. gondii is limited in yunnan province , therefore , it is difficult to evaluate the risk of human t. gondii infection in relation to beef and mutton consumption in yunnan . this study aimed to evaluate the seroprevalence of t. gondii infection in buffaloes , sheep and goats , and to identify certain risk factors associated with the prevalence of t. gondii infection in yunnan province , southwestern china . a total of 973 blood samples were collected from the jugular veins of 427 buffaloes , 154 sheep and 392 goats reared in seven administrative regions of yunnan province , southwestern china , between may 2012 and december 2013 . all serum samples were obtained by centrifuging the blood samples at 3000 rpm for 5 min , after which they were stored at 20 c until antibody testing . t. gondii antibodies were evaluated by indirect hemagglutination ( iha ) test using a commercially available kit , according to the manufacturer s instructions ( 2 , 3 ) . in brief , sera were added to a 96-well v - bottomed polystyrene plate . then , iha dilution solution was added , and the samples were diluted twofold serially starting from 1:16 to 1:1024 . then , the t. gondii - sensitized erythrocyte antigen was added to each well , gently shaken for 2 min , and incubated at 37 c for 2 h. the assay result was considered positive for toxoplasmosis when a layer of hemocyte agglutination occurs in the wells with sample dilutions of 1:64 or higher . data of the investigated factors ( species , gender , age and geographical origin ) were analyzed using multinomial logistic regression in pasw statistics version 18.0 , where positive samples were coded as 1 and negative samples were coded as 0 . a probability ( p ) value of less than 0.05 was considered to show statistically significant association with t. gondii infection . odds ratios ( or ) and 95% confidence intervals ( 95% ci ) were recorded to quantify the relationship between different levels of t. gondii infection and the associated risk factors . out of 973 samples , 116 ( 11.9% ) were seropositive with the following distributions : 69/392 ( 17.6% ) for goats , 15/154 ( 9.7% ) for sheep and 32/427(7.5% ) for buffaloes . the antibody titers were 1:64 in 35 samples , 1:128 in 38 samples , 1:256 in 18 samples , 1:512 in 7 samples and 1:1024 in 19 samples . the seropositivity of females ( 12.3% , 84/683 ) was slightly higher than that of males ( 11.0% , 32/290 ) . the seropositivities of young animals ( age , 2 yr ) and adults were 14% and 10.2% , respectively . the t. gondii seroprevalence with respect to geographical origin varied among the different administrative districts of yunnan province , ranging from 5.9% in dehong to 47.7% in zhaotong ( table 1 ) . gender and age were not significant in the conditional stepwise logistic regression analysis ( p > 0.05 ) and were excluded from the final model . the other two factors , namely , species and region , were considered risk factors that significantly influence seroprevalence . statistically , buffaloes had lower frequency to show significant seropositivity compared to that for goats ( or = 0.153 , 95% ci = 0.0250.958 , p = 0.045 ) , while no statistically significant differences in the seroprevalence were observed for sheep and goats . qujing ( or = 0.087 , 95% ci = 0.0100.730 , p = 0.024 ) , yuxi ( or = 0.067 , 95% ci = 0.0080.597 , p = 0.015 ) and zhaotong ( or = 0.019 , 95% ci = 0.0020.161 , p=0.000 ) showed significantly lower seropositive samples compared to those from xishuangbanna ( p<0.05 ) . however , no statistically significant regional differences in seroprevalence were found among the other three administrative regions compared to that in xishuangbanna ( table 2 ) . this value was slightly higher than that of recent studies of t. gondii infection in flocks and herds in jiangsu province ( 7.8% , n = 51 ) ( 4 ) , qinghai province ( 3.4% , n = 206 ) ( 5 ) , xinjiang province ( 5.1% , n = 495 ) ( 6 ) and shanghai city ( 2.5% , n = 477 ) ( 7 ) . several factors may be responsible for the differences in prevalence , including geographical , ecological , feeding conditions and animal welfare , in addition to the number of tested samples . for instance , in this study the seroprevalence in buffaloes was lower than that of sheep and goats ( p < 0.05 ) . thus , buffaloes have lower susceptibility as hosts to t. gondii than that by sheep and goats , as evidenced by previous studies from various countries . for instance , the seroprevalences of goats and sheep were 24.9% in ethiopia ( 8) , 24.5% in greece ( 9 ) , 30.5% in ghana ( 10 ) and 11.8% in spain ( 11 ) . in contrast , seroprevalences in buffaloes were 8.8% in iran ( 12 ) , 3.9% in brazil ( 13 ) . the samples collected from qujing , yuxi and zhaotong were less likely to show seropositivity compared to those collected from xishuangbanna , kunming , baoshan and dehong ( p < 0.05 ) . for instance , nearly 80,000 cats are present in xishuangbanna , kunming , baoshan and dehong , whereas only about 50,000 cats are present in qujing , yuxi and zhaotong . to our knowledge , this is the first systematic study of t. gondii infection in ruminants , with the results showing that the seroprevalence of t. gondii is high in yunnan province . host species and geographical origin are the main risk factors for t. gondii seroprevalence , suggesting important implications for public health . integrated and efficient measures are required to prevent and control t. gondii infection in buffaloes , sheep and goats in yunnan province .	background : the seroprevalence of toxoplasma gondii infection in buffaloes , sheep and goats in yunnan province , southwestern china was conducted between may 2012 and december 2013.methods:a total of 973 ( 427 buffaloes , 154 sheep and 392 goats ) serum samples were collected from seven administrative regions of yunnan province , and examined for t. gondii antibodies by indirect hemagglutination ( iha ) test . some risk factors related to species , age , gender and geographical origin were determined using a multinomial logistic regression.results:the overall seroprevalence of t. gondii in ruminant species was estimated at 11.9% . the final logistic regression model demonstrated that host species and geographical origin were the main risk factors associated with t. gondii infection ( p<0.05).conclusion : taken together , the results of the present study revealed a high exposure to t. gondii in ruminant species in yunnan province , which has an important implication for public health .
You are an expert at summarizing long articles. Proceed to summarize the following text: the ophthalmic segment of the internal carotid artery ( ica ) , running from the distal dural ring to the posterior communicating artery ( pcom ) , can give rise to aneurysms.1 the three subtypes are the superiorly pointing aneurysms originating at the ophthalmic artery ( i.e. , ophthalmic artery [ oa ] aneurysms ) , the medially pointing aneurysms originating from the superior hypophyseal trunk , and aneurysms originating from a perforator - free part of the ica , the so - called atypical or blister ica aneurysms.2 the incidence of oa aneurysms is somewhere between 0.5% and 11% of all intracranial aneurysms.3 4 unruptured large oa aneurysms frequently present with gradual loss of vision . the goal of their treatment is then twofold : to exclude the aneurysm from the circulation and to preserve or restore visual function . treatment of oa aneurysms can be surgical or endovascular , depending on the mode of presentation , aneurysm geometrics and size , as well as the patients medical condition.5 in the past , intracranial aneurysm repair was exclusively surgical,4 and in large unruptured oa aneurysms , clipping is still often the preferred method because surgical decompression of the aneurysm sac may lend the optic nerve a better prognosis.6 7 however , surgery of oa aneurysms carry inherent risks such as stroke,8 hemorrhage,9 or visual loss.10 11 12 since its introduction in 1991,13 endovascular aneurysm repair has grown in popularity and versatility.8 14 15 with the introduction of stents,16 17 endovascular treatment of oa aneurysms has made important progress . although this development is welcomed , it also makes the choice of treatment strategy less straightforward than in the past . in this report , we present a patient with a troublesome unruptured oa aneurysm and some lessons learned . a 56-year - old right - handed woman presented with a 4-month history of retro - orbital headache and progressive decline in visual acuity oculus sinister ( os ) . her ophthalmologist ( p.l . ) found only perception of light os and normal visual acuity oculus dexter ( od ) . magnetic resonance imaging ( mri ) detected a left - sided oa aneurysm 20 12 13 mm in diameter ( fig . 1 ) . magnetic resonance imaging ( mri ) of a 56-year - old right - handed woman who presented with a 4-month history of retro - orbital headache and progressive visual loss demonstrating a left - sided ophthalmic artery aneurysm 20 12 13 mm in diameter . because of her long history of very poor visual acuity , we considered her left eye to be irredeemable . because the aneurysm had a wide neck and was of moderate size the treatment plan was first to place a regular stent within the ica , running from proximal to the oa to distal to the pcom artery , with a second semipermeable stent inside the first stent in the aneurysm orifice area to enhance aneurysm thrombosis . following 1 week of treatment with plavix and aspirin preceding the endovascular procedure , a leo ( balt extrusion , montmorency , france ) 4.5 mm 40 mm stent was placed in the ica ( s. j. b. and e. a. j. ) . attempts to place additional stents , however , were unsuccessful . to promote aneurysm thrombosis , three matrix coils ( boston scientific , fremont , california , united states ) , of 24 mm 40 cm , 30 mm 16 cm , and 14 mm 30 cm , respectively , were put into the aneurysm sac ( fig . this led to stagnation of the contrast media in the aneurysm sac , but because of the optic nerve compression , the aneurysm was filled loosely so as not to cause further optic chiasm compression . digital subtraction angiography after a stent was placed in the interior carotid artery and the aneurysm sac coiled using three matrix coils . after the procedure , the patient woke up with an expressive dysphasia and a right - sided hemiparesis . mri demonstrated several punctate lesions in the left parieto - occipital region secondary to emboli and perfusion mri showed a small hypoperfusion in the left lentiform nucleus region . her visual acuity improved to perception of hand movement ad ocolum os and acuity od remained at 1.0 . over the following months , the aneurysm continued to grow , measuring 22 13 14 mm ( fig . it now caused significant compression of both optic nerves , and her ophthalmologist recorded a reduction of visual acuity to 0.8 od and an upper quadrant anopia . a course of prednisolone 20 mg twice daily was tried for 5 days without effect . the aneurysm continued to grow , measuring 22 13 14 mm 2 months post - coiling . six months after her presentation , her visual acuity remained at light perception os and 0.8 od with an upper quadrant anopia . a digital subtraction angiography ( dsa ) demonstrated coil compaction and further aneurysm growth . the patient failed an ica balloon test occlusion ( w.s.o . ) and was therefore referred to high - flow extracranial - intracranial ( ec - ic ) artery bypass grafting in berlin , germany . preoperatively , her visual acuity od was down to 0.7 with an upper quadrant anopia , whereas os remained at light perception . she underwent a high - flow venous graft bypass between the left external carotid artery and the left middle cerebral artery ( p.v . and t.r.m . ) 4 ) . because of the combined effects of stent within the ica and the large coil mass in the aneurysm , it was difficult to put an occluding clip on the ica just distal to the oa take - off , and the ica was therefore occluded proximally in the neck . the patient underwent a high - flow venous graft bypass between the left external carotid artery and the middle cerebral artery ( mca ) . ( a ) axial computed tomography angiography demonstrating the patent graft to mca and coil artifacts . ( b ) digital subtraction angiography anteroposterior view demonstrating filling of the extracranial - intracranial bypass . postoperatively , she had expressive dysphasia , right - sided hemiparesis , and short - term memory loss . postoperative t1-weighted mri demonstrated some encephalomalacia with peri - sylvian cortical laminar necrosis in the temporal and frontal lobes ( fig . 5 ) . over the next months she recovered well from these neurologic deficits , with the exception of blindness os . postoperative fluid attenuated inversion recovery magnetic resonance imaging demonstrates some encephalomalacia with peri - sylvian cortical laminar necrosis . contrary to what we anticipated , the aneurysm continued to expand ( 27 19 20 mm ) ; her right eye visual acuity decreased dramatically to 0.3 a month after the surgery . a dsa demonstrated good flow through the bypass , retrograde filling of the distal ica , antegrade filling of the oa , some filling in the cavernous portion of the ica , and some filling in the bottom of the aneurysm ( fig . digital subtraction angiography demonstrates good bypass flow , with retrograde filling of the distal internal carotid artery ( ica ) , antegrade filling of the ophthalmic artery , and some filling in the cavernous portion of the ica . there is also some filling of the caudal part of the aneurysm ( arrow ) , the latter finding explaining the continued aneurysm growth . because of progressive visual field defect and acuity loss od , the patient was operated again a year after her initial presentation via a 30 25 mm supraorbital craniotomy ( t.r.m . ) . the stented ica was crushed using a debakey forceps to fit a clip across the ica proximal to the pcom . 7 ) , and the optic chiasm and both optic nerves were decompressed . the patient made an uneventful recovery , and the surgery led to a significant improvement in visual acuity od to 0.7 . the patient was reoperated via a 30 25 mm supraorbital craniotomy , so as not to compromise the bypass . the stented internal carotid artery ( ica ) was crushed using a debakey forceps to fit a clip across the ica proximal to the posterior communicating artery , and the coiled giant aneurysm was excised , thereby decompressing the optic chiasm and optic nerves . surgery led to a significant improvement in visual acuity on the right side ; the left remained amaurotic . a 56-year - old right - handed woman presented with a 4-month history of retro - orbital headache and progressive decline in visual acuity oculus sinister ( os ) . her ophthalmologist ( p.l . ) found only perception of light os and normal visual acuity oculus dexter ( od ) . magnetic resonance imaging ( mri ) detected a left - sided oa aneurysm 20 12 13 mm in diameter ( fig . 1 ) . magnetic resonance imaging ( mri ) of a 56-year - old right - handed woman who presented with a 4-month history of retro - orbital headache and progressive visual loss demonstrating a left - sided ophthalmic artery aneurysm 20 12 13 mm in diameter . because of her long history of very poor visual acuity , we considered her left eye to be irredeemable . because the aneurysm had a wide neck and was of moderate size the treatment plan was first to place a regular stent within the ica , running from proximal to the oa to distal to the pcom artery , with a second semipermeable stent inside the first stent in the aneurysm orifice area to enhance aneurysm thrombosis . following 1 week of treatment with plavix and aspirin preceding the endovascular procedure , a leo ( balt extrusion , montmorency , france ) 4.5 mm 40 mm stent was placed in the ica ( s. j. b. and e. a. j. ) . attempts to place additional stents , however , were unsuccessful . to promote aneurysm thrombosis , three matrix coils ( boston scientific , fremont , california , united states ) , of 24 mm 40 cm , 30 mm 16 cm , and 14 mm 30 cm , respectively , were put into the aneurysm sac ( fig . this led to stagnation of the contrast media in the aneurysm sac , but because of the optic nerve compression , the aneurysm was filled loosely so as not to cause further optic chiasm compression . digital subtraction angiography after a stent was placed in the interior carotid artery and the aneurysm sac coiled using three matrix coils . after the procedure , the patient woke up with an expressive dysphasia and a right - sided hemiparesis . mri demonstrated several punctate lesions in the left parieto - occipital region secondary to emboli and perfusion mri showed a small hypoperfusion in the left lentiform nucleus region . her visual acuity improved to perception of hand movement ad ocolum os and acuity od remained at 1.0 . over the following months , the aneurysm continued to grow , measuring 22 13 14 mm ( fig . it now caused significant compression of both optic nerves , and her ophthalmologist recorded a reduction of visual acuity to 0.8 od and an upper quadrant anopia . a course of prednisolone 20 mg twice daily was tried for 5 days without effect . the aneurysm continued to grow , measuring 22 13 14 mm 2 months post - coiling . six months after her presentation , her visual acuity remained at light perception os and 0.8 od with an upper quadrant anopia . a digital subtraction angiography ( dsa ) demonstrated coil compaction and further aneurysm growth . the patient failed an ica balloon test occlusion ( w.s.o . ) and was therefore referred to high - flow extracranial - intracranial ( ec - ic ) artery bypass grafting in berlin , germany . preoperatively , her visual acuity od was down to 0.7 with an upper quadrant anopia , whereas os remained at light perception . she underwent a high - flow venous graft bypass between the left external carotid artery and the left middle cerebral artery ( p.v . and t.r.m . ) 4 ) . because of the combined effects of stent within the ica and the large coil mass in the aneurysm , it was difficult to put an occluding clip on the ica just distal to the oa take - off , and the ica was therefore occluded proximally in the neck . the patient underwent a high - flow venous graft bypass between the left external carotid artery and the middle cerebral artery ( mca ) . ( a ) axial computed tomography angiography demonstrating the patent graft to mca and coil artifacts . ( b ) digital subtraction angiography anteroposterior view demonstrating filling of the extracranial - intracranial bypass . postoperatively , she had expressive dysphasia , right - sided hemiparesis , and short - term memory loss . postoperative t1-weighted mri demonstrated some encephalomalacia with peri - sylvian cortical laminar necrosis in the temporal and frontal lobes ( fig . 5 ) . over the next months she recovered well from these neurologic deficits , with the exception of blindness os . postoperative fluid attenuated inversion recovery magnetic resonance imaging demonstrates some encephalomalacia with peri - sylvian cortical laminar necrosis . contrary to what we anticipated , the aneurysm continued to expand ( 27 19 20 mm ) ; her right eye visual acuity decreased dramatically to 0.3 a month after the surgery . a dsa demonstrated good flow through the bypass , retrograde filling of the distal ica , antegrade filling of the oa , some filling in the cavernous portion of the ica , and some filling in the bottom of the aneurysm ( fig . digital subtraction angiography demonstrates good bypass flow , with retrograde filling of the distal internal carotid artery ( ica ) , antegrade filling of the ophthalmic artery , and some filling in the cavernous portion of the ica . there is also some filling of the caudal part of the aneurysm ( arrow ) , the latter finding explaining the continued aneurysm growth . because of progressive visual field defect and acuity loss od , the patient was operated again a year after her initial presentation via a 30 25 mm supraorbital craniotomy ( t.r.m . ) . the stented ica was crushed using a debakey forceps to fit a clip across the ica proximal to the pcom . 7 ) , and the optic chiasm and both optic nerves were decompressed . the patient made an uneventful recovery , and the surgery led to a significant improvement in visual acuity od to 0.7 . the patient was reoperated via a 30 25 mm supraorbital craniotomy , so as not to compromise the bypass . the stented internal carotid artery ( ica ) was crushed using a debakey forceps to fit a clip across the ica proximal to the posterior communicating artery , and the coiled giant aneurysm was excised , thereby decompressing the optic chiasm and optic nerves . surgery led to a significant improvement in visual acuity on the right side ; the left remained amaurotic . major neurologic deficits after treatment of giant intracranial aneurysms occur in 10% of patients.18 19 20 21 22 with paraclinoid giant aneurysms , visual deterioration after treatment is observed in up to 17% of patients.19 20 although surgical clipping is often the preferred treatment for aneurysms causing cranial nerve deficits,6 7 in cases of giant paraclinoid ica aneurysms , it may not be feasible in > 60% of cases.18 20 21 22 surgery on oa aneurysms is technically demanding because these aneurysms are often large and may extend into the cavernous sinus.21 22 23 24 25 26 thus they are challenging even for the most experienced of neurosurgeons . over the years , these aneurysms have therefore been treated by common carotid artery ligation,20 21 22 27 28 ica occlusion,18 19 20 22 29 30 proximal vessel ligation with ec - ic bypass,18 19 20 22 trapping,18 19 31 intra - aneurysmal balloon occlusion,32 33 coiling,34 35 36 or by stenting.37 however , because visual deterioration after coil embolization of oa aneurysms has been reported in as many as a third of the patients,14 the decision whether to clip or coil is often difficult . in the present case , the endovascular treatment plan was to first place a regular stent in the ica from the oa to the pcom , with a second semipermeable stent inside the first stent in the aneurysm orifice area . retrospectively , upon failing to place the semipermeable stent , we should have discontinued the endovascular procedure because the subsequent aneurysm coiling would not make the aneurysm shrink and would make aneurysm surgery at a later stage considerably more difficult . given a situation with a large and growing coiled aneurysm and with a failed balloon test occlusion ( bto ) , we opted for a high - flow ec - ic bypass followed by therapeutic ica closure because ica occlusion , with or without ec - ic bypass , is a good therapeutic option when treating giant ica aneurysms.29 38 39 40 41 42 43 44 however , it proved difficult to put an occluding clip on the ica just distal to the oa take - off due to the combined effects of the stent within the ica and the large coil mass within the aneurysm . furthermore , the pcom was also not in sight due to the previously mentioned limiting structures , but also because of the high - flow vein graft in the surgical field . consequently , the ica was occluded proximally in the neck . retrospectively , after finishing the bypass and realizing that the intracranial ica closure was impossible , we should have left the ica open and closed this vessel off endovascularly by placing coils at the origin of the oa / aneurysm because it is known that proximal ica occlusion does not fully prevent subsequent hemorrhage or necessarily prevent aneurysm enlargement.10 20 21 38 41 45 46 a more distal ica closure would have eliminated blood flow in the ica below the pcom and triggered thrombosis and shrinkage of the noncoiled portion of the aneurysm . it is difficult to tidy up the mess , as it were , if you start out wrong . given the chance again , we would have followed our usual game plan when treating patients with large unruptured oa aneurysms : if there is reduced visual acuity and no or moderate thrombus material in the aneurysm , we opt for surgical clipping via a lateral supraorbital craniotomy with extradural clinoidectomy for proximal control of the ophthalmic ica segment,47 aneurysm dissection , suction / decompression of the aneurysm ( either direct after temporary trapping or ad modum hunt batjer with exposure of the ica in the neck48 ) , and aneurysm clipping . if there is a large thrombotic mass in the aneurysm , with or without reduced visual acuity , we generally manage our patients with semipermeable ( flow diversion ) stents or therapeutic ica closure with or without a high - flow excimer laser - assisted nonocclusive anastomosis ( elana ) bypass for flow replacement,43 depending on the bto tolerance.44	objective and importance when treating large unruptured ophthalmic artery ( oa ) aneurysms causing progressive blindness , surgical clipping is still the preferred method because aneurysm sac decompression may relieve optic nerve compression . however , endovascular treatment of oa aneurysms has made important progress with the introduction of stents . although this development is welcomed , it also makes the choice of treatment strategy less straightforward than in the past , with the potential of missteps . clinical presentation a 56-year - old woman presented with a long history of progressive unilateral visual loss and magnetic resonance imaging showing a 20-mm left - sided oa aneurysm . intervention because of her long history of very poor visual acuity , we considered her left eye to be irredeemable and opted for endovascular therapy . the oa aneurysms was treated with stent and coils but continued to grow , threatening the contralateral eye . because she failed internal carotid artery ( ica ) balloon test occlusion , we performed a high - flow extracranial - intracranial bypass with proximal ica occlusion in the neck . however , aneurysm growth continued due to persistent circulation through reversed blood flow in distal ica down to the oa and the cavernous portion of the ica . due to progressive loss of her right eye vision , we surgically occluded the ica proximal to the posterior communicating artery and excised the coiled , now giant , oa aneurysm . this improved her right eye vision , but her left eye was permanently blind . conclusion this case report illustrates complications of the endovascular and surgical treatment of a large unruptured oa aneurysm .
You are an expert at summarizing long articles. Proceed to summarize the following text: mirizzi syndrome ( ms ) , an unusual complication of gallstone disease , was first described by the argentinean surgeon pablo mirizzi based on cholangiography in 1948.1 it is rare and occurs in only 0.7%1.4% of gallstone patients ; the typical signs are intermittent or constant jaundice , fever , and right upper quadrant abdominal pain . although these symptoms are found in approximately 80% of cases , there is no specific clinical picture of ms . as a result , it is difficult to identify it preoperatively.2 ms can be confirmed only when the typical cholangiography revealed a smooth structure of common bile duct ( cbd ) . although some advanced technologies , such as magnetic resonance cholangiopancreatography ( mrcp ) , multidetector computed tomography ( mdct ) , and ultrasound ( us ) can assist in preoperative diagnosis , ms with fistula is mainly diagnosed during operation . the cbd or hepatic duct may be involuntarily injured during duct operation , and the former is easily injured by technical failures , causing an aberrant duct . therefore , more appropriate surgical procedures need to be adopted for ms with an aberrant duct fistula . we herein reported a case of ms with an unusual type fistula that was successfully treated with the combined approach of partial hepatectomy , cholecystectomy , and t - tube drainage . the patient , a 76-year - old asian female , was detected with liver gallstones ( lithiasis ) by ultrasonic diagnosis during a health examination and was admitted to our department . at that time , she did not show fatigue , jaundice , intermittent high fever , and right upper quadrant abdominal pain . moreover , according to the abdominal findings via physical examination , no icteric scleras and right upper quadrant abdominal tenderness in deep palpation were found , nor were the rebound tenderness or abdominal muscle rigidity and palpable masses found . the following were the testing indexes : blood tests showed alt : 313 u / l ( normal : 040 u / l ) , alp : 67 u / l ( normal : < 106 u / l ) , and -ggt : 93 u / l ( normal : < 50 u / l ) with normal bilirubin levels : 20 mol / l ( normal values for total bilirubin : 025 mol / l).serologic tests for hepatitis b and c were all negative . tumor markers including -fetoprotein , carcinoembryonic antigen , and carbohydrate antigen 19 - 9 were within normal limits.us examination showed cholelithiasis with a distended gallbladder , multiple calculi within its lumen , and moderate intrahepatic biliary dilatation.abdominal enhanced multidetector computed tomography scan revealed an atrophic right posterior liver and a dilated hepatic duct and right posterior sectional duct with multiple stones inside.mrcp indicated the presence of a sinus tract between the gallbladder fossa and right posterior hepatic duct . cholecystobiliary and aberrant right posterior hepatic duct fistula were also observed ( figure 1 ) . computed tomographic ( ct ) scans showed multiple dilated bile ducts in the right posterior segment with stones ( figure 2 ) . u / l ) , alp : 67 u / l ( normal : < 106 u / l ) , and -ggt : 93 u / l ( normal : < 50 u / l ) with normal bilirubin levels : 20 mol / l ( normal values for total bilirubin : 025 mol / l ) . tumor markers including -fetoprotein , carcinoembryonic antigen , and carbohydrate antigen 19 - 9 were within normal limits . us examination showed cholelithiasis with a distended gallbladder , multiple calculi within its lumen , and moderate intrahepatic biliary dilatation . abdominal enhanced multidetector computed tomography scan revealed an atrophic right posterior liver and a dilated hepatic duct and right posterior sectional duct with multiple stones inside . mrcp indicated the presence of a sinus tract between the gallbladder fossa and right posterior hepatic duct . cholecystobiliary and aberrant right posterior hepatic duct fistula were also observed ( figure 1 ) . computed tomographic ( ct ) scans showed multiple dilated bile ducts in the right posterior segment with stones ( figure 2 ) . although the patient was suffering from severe lithiasis , she did not show any symptoms . on the basis of the aforementioned data , the initial diagnosis before operation was ms complicated with intrahepatic lithiasis associated with aberrant right posterior hepatic duct fistula . surgery remained the exclusive choice of curative therapy , and the definitive diagnosis was confirmed intraoperatively . an exploratory laparotomy through a right subcostal incision was performed . during cholecystectomy , two severe anatomic alterations were observed . the first was an impact stone found in the cystic duct , which firmly adhered to the aberrant right posterior hepatic duct and the cholecystobiliary fistula , and involved less than one - third of the circumference of the duct . the other was a wide range of tissue adhesion , which was associated with elongated cystic duct , parallel to the cbd . multiple cystic dilations of the intrahepatic biliary tree and black pigment stones adherent to the bile duct wall were observed in the resected specimen ( figure 3 ) . the cbd was lavaged , and the defect of the cbd was sutured in a one - layer manner . the postoperative course was uneventful and the patient was discharged a week after the operation . ms , a rare complication ( ~1% ) of chronic cholecystitis and cholelithiasis , was first described in 1923 by hans kehr and was characterized by impaction of stones in the cystic duct or neck of the gallbladder , resulting in mechanical compression or erosion of the cbd.1 as there is no specific clinical or laboratory finding for the syndrome , ms was always characterized with jaundice , abdominal pain , and alterations during the serum tests of hepatic function . however , these symptoms of ms are seen in ~80% of cases.2 the patient we reported here had no significant clinical picture . even with the availability of modern imaging techniques , majority of cases are not identified preoperatively . mcsherry et al3 classified ms into two types based on endoscopic retrograde cholangiopancreatography ( ercp ) findings : type i ms when there is extrinsic compression of the common hepatic duct and type ii ms when the gallstones erode the common hepatic duct wall , resulting in a cholecystocholedochal fistula . the most recent and important classification was made by nagakawa et al,4 while probably the best one was done by csendes et al.5 according to the classification of csendes et al5 , ms is divided in four types depending on the size of the destruction of the cbd.6 we consider this case as a special kind of ms where intrahepatic stones complicated patient s condition . in general , a preoperative diagnosis is crucial for us to choose the appropriate surgical approach . us was always utilized as a primary investigation in the treatment of patients with abdominal pain and jaundice . ms was confirmed via the evidence of dilated intrahepatic ducts and common hepatic duct by observing the narrowness of the compressed external bile duct that caused by the calculus.7 it was regarded as a criterion used to diagnose ms that cholangiographic evidence of stone affected compression of the bile duct in the gallbladder neck or cystic duct , or the presence of a cholecystcholedochal fistulam , which were detected by ct , mrcp , and ercp . in addition , direct cholangiography is the gold standard for locating subtle abnormalities within the bile ducts and detecting small calculi.8,9 nevertheless , the patient refused ercp , even though it remains the gold standard for preoperative diagnoses of ms . a recent study demonstrated that mrcp , a noninvasive alternation to ercp , is a useful preoperative diagnostic modality for ms with a higher accuracy and better interobserver agreement when combined with ct.10 in this case , mrcp demonstrated a possibility of an already existing abnormal fistula between the gallbladder and the common hepatic duct . noninvasive imaging modalities such as ultrasonography , ct , and magnetic resonance imaging can also accurately depict the presence of intrahepatic stones . the patient was diagnosed with intrahepatic lithiasis that caused liver fibrosis , atrophy , and fibrotic stricture of right posterior hepatic duct and her second / third branches . the incidence of hepatolithiasis has been reported to be 20%31% in the patients with gallstone disease , and it is a prevalent disease in east asia . compared to nonoperative treatment , hepatic resection is a preferable choice for unilateral stones treatment.11 it was reported that surgical therapy is a safe and effective management for hepatolithiasis . however , ms hinders the complex operative procedure further , by making it much more difficult on the condition of dangerous anatomical alteration in the area of calot s triangle . as the principle of which is to remove the stones as well as the biliary stricture and to reduce the risk of recurrent stones , hepatectomy seems to be the optimal treatment for hepatolithiasis among selected patients.1214 tabrizian et als15 investigation showed that hepatic resection is a safe and definitive treatment option in the control of primary hepatolithiasis , and it could achieve excellent short- and long - term effect . furthermore , according to jiang et als11 study , anatomical hepatectomy can produce better clinical outcome than limited hepatectomy about regional hepatolithiasis . in our study , hepatolithiasis was limited to a right posterior lobe ( segment ) irrespective of lobular atrophy or fibrosis . by receiving anatomical hepatectomy , she may get a radical cure so as to minimize the action on hepatic function . during operation , ms was confirmed only after the extraction of large gallstone that compacted on gallbladder neck and right posterior hepatic duct , and under this circumstance , the cystic duct usually ran parallel to the cbd ( 10% of cholangiograms).16 ms exhibited a dangerous and unexpected variation in calots triangle . thus , preoperative recognition of this variation is significantly important to avoid inadvertent ligation or severance of the bile duct . the fistula s excision and repair of the hepatic flexure with primary closure was finally performed without any further postoperative complications . a t - tube was routinely inserted after hepatectomy for postoperative cholangiography and choledochoscopy via the t - tube route . this protocol was approved by the institutional review board of the first people s hospital of wujiang . written informed consent was obtained from the patient for the publication of this case report and any accompanying images . preoperative evaluation of patient s condition , adequate recognition of variation , right approach , and minimal surgical maneuvers at the time of the operation were important key points for successful treatment of these clinical entities .	mirizzi syndrome ( ms ) is a rare complication of chronic cholelithiasis , which is always caused by a calculus in the cystic duct or neck of the gallbladder , resulting in mechanical compression of common bile duct and the gallbladder . it is clinically characterized by abdominal pain , fever , as well as obstructive jaundice . during cholecystectomy , ms is seen as a dangerous adherent and inflammatory tissue in the area of calot s triangle . in the general population , aberrant right posterior hepatic duct , one of the causes of bile duct injury during duct surgery , is present in 4.8%8.4% of people . herein we report a rare case of a 76-year - old female patient , with hepatolithiasis of right posterior lobe and cholecysto - aberrant right posterior hepatic duct fistula . this is a special type of ms ; however , interestingly , she did not have any symptoms , and the disease was found by physical examination incidentally . this case highlights another situation , namely , there may be difficulty in diagnosing ms and dissecting for operation . therefore , to avoid the complication associated with this special situation , the surgeons need to diagnose carefully and adopt an optimal treatment strategy .
You are an expert at summarizing long articles. Proceed to summarize the following text: although the disease is limited to the peritoneal surface , this condition is still worrisome for the surgeon and the oncologist as complete surgical removal is impossible and systemic chemotherapy is ineffective . peritoneal implants are most commonly encountered in ovarian carcinoma ( 35% ) , followed by colonic ( 30% ) and gastric carcinoma ( 10% ) . less than 5% of cases include pancreatic , uterine , fallopian tube , hepatocellular , cholangiocarcinoma , cervical , and bladder carcinomas , mesothelioma ; hodgkin disease , and carcinoma ( primary site unknown ) . to the best our knowledge , hemangiopericytoma as a cause of abdominal carcinomatosis at the time of its presentation , has been not reported before . although there are reports of recurrent peritoneal carcinomatosis in cases of hemangiopericytoma , we present a rare case of pelvic hemangiopericytoma presenting as peritoneal carcinomatosis . a 45-year - old female presented with lower abdominal pain and dysuria of 2 months duration , along with loss of appetite and loss of weight . no history of alteration of bowel habits , bleeding per vaginum or per rectum was given . histopathological examination of the operated specimen showed extensive adenomyosis in the myometrium . on general physical examination the patient appeared emaciated , a huge firm mass 12 12 cm in size was palpated in the right iliac fossa , crossing the midline . ultrasound abdomen showed a large abdominopelvic solid heterogeneous mass with a few anechoic areas of necrosis within it . increased colour flow was present on colour doppler examination , suggesting the vascular nature of the mass . multidetector contrast enhanced computed tomography was subsequently performed which revealed a heterogeneously enhancing , lobulated abdominopelvic mass , 21 16 13 cm in size , in relation to the greater omentum which showed subtle , small hypodense areas of necrosis . ill - defined margins with invasion of the small bowel loops and mesentery , sigmoid mesocolon and vaginal vault were seen with indentation over the anterior wall of the rectum and the posterior wall of the urinary bladder ( fig . 1 ) . multiple well - defined heterogeneous masses suggestive of peritoneal implants were present in the small bowel mesentery , greater omentum and peritoneum , indenting the posterior surface of the liver adjacent to segment vi ( fig . as the tumour was very large at the time of imaging , its site of origin could not be ascertained , hence a diagnosis of a sarcomatous tumour arising from the pelvis or solid primary omental tumour , with peritoneal carcinomatosis and hepatic metastasis was given . large heterogeneously enhancing abdominopelvic mass with a few areas of necrosis , proven on cytology to be hemangiopericytoma . large heterogeneously enhancing abdominopelvic mass with a few areas of necrosis , proven on cytology to be hemangiopericytoma . the tumour cells were round to oval with a high nuclear cytoplasmic ratio , clumped chromatin and scanty cytoplasm . scattered spindle - shaped cells with bare nuclei in a necrotic and hemorrhagic background were seen . the patient received 6 cycles of a ifosphamide , epirubicine , cisplatin chemotherapy regime as there was dissemination of the disease at the time of presentation . repeat contrast - enhanced computed tomography 6 months later showed significant reduction in the mass and omental deposits ( fig . 3 ) , with resolution of ascites . figure 3post - chemotherapy repeat contrast - enhanced computed tomography shows significant resolution of the peritoneal implants . post - chemotherapy repeat contrast - enhanced computed tomography shows significant resolution of the peritoneal implants . this rare vascular tumour was first described by schmidt in 1937 and named by stout and murray in 1942 . it is most common in the lower extremities , head , neck , and retroperitoneum ; less frequent sites are the abdomen and pelvis . hemangiopericytoma arises from the pericytes of zimmerman which are rudimentary pericapillary cells , not connected to the arterial or venule epithelium . since all capillaries are surrounded by pericytes , hemangiopericytomas are ubiquitous in distribution . according to schwartz et al . only 13 cases of omental hemangiopericytoma are reported in the english literature ; 4 out of these 13 cases had recurrent peritoneal carcinomatosis ; however no case of omental or pelvic hemangiopericytoma documents peritoneal implants at the time of presentation . imaging plays a pivotal role in the appropriate treatment planning by demonstrating the vascular nature of the tumour , revealing the exact source of its blood supply , and , finally , demonstrating its size and relationship with the adjacent organs . ultrasonography of a hemangiopericytoma shows a solid mass with heterogeneous echo pattern , well - defined margins and marked vascularity with low impedance flow ( mean resistive index 0.42 ) on colour flow imaging . contrast - enhanced computed tomography demonstrates strong but brief peripheral enhancement and a central hypodense scar / necrosis in a well - defined solid mass can be seen . homogenous enhancement , absence of calcification , necrosis and haemorrhage are commonly seen in benign hemangiopericytoma . catheter angiography shows a feeder vascular pedicle with radial branching pattern wrapping a well - demarcated tumour stain . magnetic resonance imaging ( mri ) detects haemorrhage and necrosis within the tumour and delineates the relationship of the mass with the adjacent structures . recurrences , particularly developing at distant sites , after an extended disease - free interval are well known ; they involve the liver , lung , bone , and peritoneum . systemic chemotherapy may be employed for hemangiopericytoma metastasis and recurrence . however , standard and effective chemotherapeutic regimens have yet to be established . therefore , the early detection of locoregional disease , assessment of its extent and distant recurrence plays a key role in the prognosis of these patients . a careful long - term follow - up is mandatory for such patients .	abstracthemangiopericytoma , a rare mesenchymal tumour , is believed to originate from the pericyte of zimmermann . it may affect every organ in the body . recurrences after treatment and metastasis are well known . however , presentation of hemangiopericytoma with peritoneal carcinomatosis is not documented in literature . to the best our knowledge , we report the imaging findings of the first histologically proven case of hemangiopericytoma with peritoneal carcinomatosis .
You are an expert at summarizing long articles. Proceed to summarize the following text: research on marijuana ( mj ) use continues to be a major area of investigation , since mj remains the most widely used illicit drug in several countries , including the united states . daily , long - term , and frequent mj use can have serious adverse effects on mental and physical health and can affect work performance , family , and school functioning . in 2009 , epidemiological data ( treatment episode data set ) indicated that mj was associated with 740,800 substance abuse treatment admissions , with daily use being reported in 23% of treatment entries . nearly half ( 46.3% ) of daily mj admissions occurred in individuals between ages 26 and 40 years old and 34.2% between ages 18 and 25 years old . in addition , there has been a rise in the prevalence of mj use among youth , with 36.4% and 22.6% of high school seniors reporting past year and past 30 days use , respectively . given that rapid brain maturation occurs from adolescence into the early twenties [ 3 , 4 ] , a time when mj use is often initiated and tends to increase , identifying neurobiological vulnerabilities associated with mj use is critical . short - term effects of mj have been reported across a number cognitive domains ( for review [ 5 , 6 ] ) , including deficits in memory , attention and mental flexibility , response inhibition , decision making [ 10 , 11 ] , emotional processing , and impulsivity . however , to date there have been limited studies examining the effects of mj on spatial memory processing . while chronic mj users have been shown to exhibit deficits on tests of visual recognition , delayed visual recall , and prospective memory , a meta - analytic study failed to find substantial long - term neurocognitive deficits , except in the domains of learning and forgetting . to this end , significant structural and functional changes have been reported in young mj users in brain regions implicated in learning and memory [ 1619 ] . the hippocampus may be notably vulnerable to the effects of mj , given the high density of cannabinoid receptors in this area . findings from animal studies have provided evidence supporting cannabinoid - induced impairments on hippocampal - mediated memory tasks [ 2127 ] . for instance , activation of cannaninoid-1 ( cb1 ) receptors in mice in the hippocampal region inhibited long - term potentiation ( ltp ) , which is a neurobiological model for learning and memory . administration of delta-9-tetrahydrocannabinol ( -thc ) impaired spatial memory in mice tested on the morris water maze task ( wmt ) , while the cb1 receptor antagonist sr141716a reversed the impairment . similar morris water maze impairments were reported in mice after injection of -thc or inhalation of marijuana smoke . these findings provide evidence of cannabinoid - induced impairments on hippocampus - dependent spatial learning tasks , likely due to interference in learning acquisition and retrieval processing . the hippocampus is necessary for processing spatial layout and configural representation of an environment [ 2935 ] , as rodents with hippocampal lesions demonstrate spatial memory deficits , evidenced as an inability to find a hidden platform in the morris wmt [ 30 , 36 , 37 ] . in addition to compelling animal literature indicating that mj exposure impacts hippocampal function [ 23 , 25 , 38 ] , humans with medial temporal lobe damage , including the hippocampus and associated areas , exhibit impaired declarative memory , such that patients have an inability to describe time , place , and meaning of events . patients with unilateral hippocampal resections demonstrate impaired spatial navigation during performance of a virtual morris wmt . studies employing functional magnetic resonance imaging ( fmri ) techniques provide evidence for altered brain activation patterns in memory - related processing regions associated with heavy mj use . long - term , heavy mj users exhibit greater widespread blood oxygen level - dependent ( bold ) activation compared to nu during a spatial working memory task after short - term drug withdrawal . in a study using a visuospatial 2-back working memory fmri task , mj users and nu exhibited similar task performance ; however , mj users demonstrated greater activation in the inferior and middle frontal gyri , areas associated with visuospatial working memory , and increased activation in the right superior temporal gyrus , an area not typically recruited for visuospatial working memory . the parahippocampal area also plays an important role in spatial memory , namely , allocentric memory processing , especially during viewing of complex scenes with objects and landmarks ( e.g. , [ 4345 ] ) . an increased response in the parahippocampal gyrus has been reported for objects at relevant locations ( i.e. , at decision making points ) during an object - location memory task , suggesting that neural activation in the parahippocampus is associated with the navigational relevance of an object 's location . the frontal cortex , specifically , the dorsolateral prefrontal cortex , has been implicated in spatial working memory tasks [ 47 , 48 ] . while mj effects on spatial working memory have been the subject of several investigations , the objective of the present study was to investigate mj - related effects on spatial memory ( learning and retrieval ) to examine differences in neural activation during the performance of a virtual analogue of the morris water maze task . based on the work by jager and colleagues , it was hypothesized that mj users would demonstrate hypoactivity in the hippocampal / parahippocampal region relative to nu participants . further , exploratory analysis of the cingulate gyrus was performed , given that this region is activated during wmt performance , but also frontal - related alterations associated with mj use have been previously reported [ 42 , 51 , 52 ] . the study sample consisted of ten chronic marijuana ( mj ) users ( 8 males ) and eighteen nonusing ( nu ) comparison subjects ( 11 males ) . participants were recruited through local advertisement and screened by telephone interview to ensure they met criteria for inclusion in the study . all aspects of the clinical research protocol were reviewed and approved by the institutional review board of mclean hospital ( belmont , ma , usa ) . mj smokers had to have smoked mj a minimum of 2500 times , used mj at least five of the last seven days prior to the study visit , test positive for urinary cannabinoids , and meet dsm - iv criteria for mj abuse on the day of scanning . mj users were asked to refrain from smoking for 12 hours immediately preceding the study visit and were told a urine sample would be collected at the initiation of the study visit , in order to improve compliance . the nu participants reported fewer than 5 lifetime episodes of mj use and did not use any other illicit substances . exclusion criteria for all subjects included history of head injury , loss of consciousness , history of organic mental disorder , seizure disorder or central nervous system disease , and contraindications to mr scanning ( e.g. , pacemaker , aneurysm clips , metallic implants , pregnancy , or claustrophobia ) . mj users reported consuming 4.4 4.3 alcoholic beverages per week , while nu participants reported consuming 1.8 2.5 alcoholic beverages per week ( f(1,26 ) = 4.2 , p = .05 ) . four mj users reported recent nicotine use ( ranging from 1 pack per day ; 1 pack every 2 weeks ; 1 pack per month ; occasional / social use ) . the barratt simplified measure of social status ( bsmss ) was used to measure socioeconomic status ( ses ) . clinical interviews were conducted using the structured clinical interview for dsm - iv ( scid ; ) . all participants were free of axis i diagnosis , except the mj group , who were required to meet criteria for mj abuse . participants completed the positive and negative affect scale ( panas ; ) , a 20-item scale measuring positive and negative affects , and the hamilton anxiety scale ( ham - a ; ) , a 14-item scale measuring anxiety level . the addiction severity index ( asi ) was used to evaluate substance abuse using a 5-point scale ( 0 = not at all ; 4 = extremely ) for questions regarding seven areas in their life that include medical condition , employment , drug use , alcohol use , illegal activity , family / social relations , and psychiatric function . the marijuana withdrawal checklist ( mwc ) , a 12-item scale , was used to assess withdrawal symptom during the early stages of abstinence is a 12-item scale used . all participants provided a urine sample to be tested for amphetamines , barbiturates , benzodiazepines , cocaine , opiates , phencyclidine , and tetrahydrocannabinol ( thc ) ( triage drugs of abuse panel : immediate response diagnostics , biosite , san diego , ca , usa ) . a positive result for thc confirmed recent mj use in the mj group , while a negative result was required for the nu group . standard laboratory urinalysis assessed an aliquot of the urine sample , which included gas chromatography - mass spectroscopy in order to quantify the level of 11-nor-9-carboxy - delta 9-tetrahydrocannabinol ( thc - cooh ) and creatinine ( quest diagnostics , cambridge , ma , usa ) . to allow for differences in urinary concentration among the participants , levels of thc - cooh were normalized to urinary creatinine levels . a measure of general intellectual ability ( iq ) was derived using two of the four subtests ( vocabulary and matrix reasoning ) from the wechsler abbreviated scale of intelligence ( wasi , ) . visuospatial ability and spatial perception were assessed using the mental rotation task and the santa barbara sense - of - direction scale ( sbsod ) . the mental rotation task is a four - minute paper - pencil test in which participants match a target item to two of four rotated versions . one point is given for a correct response , with a maximum score of 24 . the questionnaire consists of several statements about spatial and navigational abilities , preferences , and experiences . subjects circle a number to indicate their level of agreement with each statement using a seven - point scale ranging from 1 : strongly agree to 7 : strongly disagree . a pc - compatible laptop was used for testing and operating the virtual water maze program ( neuroinvestigations , inc . , the virtual environment was comprised of a circular pool located in the center of a square room , with four large abstract pictures positioned on the walls , which served as landmarks ( figure 1(a ) ) . subjects viewed the virtual environment from a first - person perspective and navigated through the environment using an mr - compatible joystick that allowed right , left , and forward , but not backward , movements . participants began each trial facing the wall of the pool , from each of four starting positions : north , south , east , and west . the platform was always located in the northeast ( ne ) quadrant for all trials for all participants . prior to the start of the experiment ( nonscanning and scanning conditions ) , participants completed a training phase outside of the mr suite , which consisted of two trials with the platform visible in the ne quadrant , in order to familiarize them with the task and the use of the joystick . the virtual environment used for training had landmarks that were unique from those in the virtual environment presented during nonscanning and during fmri . the experimental phase consisted of three conditions : learning ( hidden trials conducted outside the magnet / nonscanning ) ; retrieval ( hidden trials conducted in the magnet ) ; motor control ( visible trials conducted in the magnet ) . during the learning condition , each participant completed 4 blocks of hidden platform trials ( 4 trials per block , each trial beginning from a different location ) , in which the platform was hidden under the surface of the water and the participants were instructed to navigate to the platform as quickly as possible . once the participant successfully navigated to the area where the platform was located , a message on the computer displayed platform found . if the platform was not located within 60 sec , the platform became visible and the following message was displayed on the screen : the platform is visible , swim to it . the next trial began 1 sec after the previous trial ended ( 1 sec intertrial interval ( iti ) ) . after completion of the learning trials , the probe trial began , in which the platform was removed from the virtual environment unbeknownst to participants . the retrieval condition was similar to the learning condition and participants were instructed to navigate to the hidden platform as quickly as they could . the platform was always located in the same location as during the learning condition . during the motor control condition , each participant completed 2 blocks of visible platform trials ( 4 trials per block , each trial beginning from a different location ) . the platform was visibly above the surface of the water and participants were instructed to navigate to the platform as quickly as possible , without paying attention to environmental landmarks . the location of the platform was the same as in the hidden condition , thereby minimizing the potential for encoding novel information during navigation in the environment . the scanning sequence lasted for 360 sec and consisted of alternating on ( 4 active on periods ) and off periods ( 5 rest off periods ) . during the on periods participants navigated through the virtual environment and completed as many trials as possible within each of the four 60 sec on periods . periods , participants viewed a black screen that displayed the message please wait for instructions ( figure 1(b ) ) . dependent measures for learning , retrieval , and motor control conditions on the wmt included path length , navigation latency , and first movement latency . path length ( relative to pool diameter ) was measured as the distance to reach the platform . navigation latency was measured as the total time ( sec ) to complete the task minus the total elapsed time ( sec ) prior to the first movement . latency to first movement was measured as the time ( sec ) before the participant initiated navigation in the pool . path length ( distance to the platform ) , navigation latency , and latency to first movement measures were averaged across trials per block for the learning , retrieval , and motor control conditions . for the probe trial , dependent measures included percent of total distance traversed within the correct platform quadrant ( ne ) , reflecting as an index of spatial learning , and heading error towards the platform , calculated as the angular deviation from a straight path to the center of the platform from the starting position . heading error was measured at the first occurrence that participant distance was greater than 25% of the pool diameter from the starting position . the number of trials completed during the retrieval and motor control conditions was also recorded . two independent raters blind to participant diagnosis rated navigation strategies used by participants during the probe trial . the strategy chosen to solve the water maze could affect behavioral performance . participant navigation strategies were rated as a direct strategy , where participants navigated directly to the platform location , or a nondirect strategy , where participants navigated in a circuitous or random route that was not in the direction of the platform quadrant ( ne ) ( figure 2 ) . interrater reliability for strategy coding was r = .53 , p = .004 ( pearson 's r correlation coefficient , two - tailed ) . functional mri scanning was performed on a 3 t siemens trio whole - body mr scanner ( siemens healthcare , erlangen , germany ) , using a birdcage quadrature rf head coil for acquisition of echo planar imaging ( epi ) blood oxygen level - dependent ( bold ) fmri . sagittal scout images were first acquired for alignment and localization using a fast spin echo sequence ( fse ) with the following parameters : repetition time ( tr ) = 3 msec , echo time ( te ) = 40 msec , field of view ( fov ) = 20 cm , matrix size = 64 64 , slice thickness = 7 mm ( 1 mm gap ) , and flip angle = 90. images were acquired from the whole brain using the following parameters : 100 images per slice using a single - shot , gradient pulse - echo sequence , slice thickness = 5 mm , 0 mm skip , flip angle = 90 , te = 30 msec , and tr = 3000 msec . for each participant , matched t1 and t2 epi image sets were also obtained : t1-matrix size = 256 256 , tr = 5760 msec ; te = 80 msec , number of shots = 4 , flip = 90 ; t2-matrix size = 256 256 , tr = 6680 msec , te = 75 msec , number of shots = 4 , flip = 90 ; 64 64 image matrix , 3 mm 3 mm in plane resolution . in order to maximize the amplitude of the task - induced signal intensity changes , a gradient echo pulse sequence was utilized.the virtual water maze environment northridge , ca , usa ) onto a translucent screen located at the rear of the bore , visible to subjects using a mirror mounted on the head coil . spm5 ( wellcome department of imaging neuroscience , university college , london , uk ) was run in matlab ( mathworks , natick , ma , usa ) for analysis of functional mri data . to correct for motion in bold fmri data , an intrarun realignment algorithm was utilized , which uses the first image as a reference . an exclusionary criterion of 2 mm of head motion in any direction was used . an epi template in montreal neurological institute ( mni ) stereotactic space was employed to normalize the realigned images , which were resampled into 2 mm cubic voxels . to spatially smooth the normalized images , an isotropic gaussian filter ( full width half maximum [ fwhm ] = 10 mm ) in spm5 , high - pass temporal filtering , with a cut - off of 128 sec was applied , and serial autocorrelations were modeled using an ar(1 ) model . global scaling was not utilized . using the framework of the general linear model , statistical analysis for individual subjects was performed [ 64 , 65 ] using a box - car reference function convolved with the hemodynamic response function . the motor control condition of the water maze paradigm was used as a control condition since there was no learning or memory component ( i.e. , subjects simply navigate to the visible platform ) . age was entered as a covariate into the analysis . to identify brain areas activated during hidden conditions , predetermined condition effects were calculated at each voxel by the fixed model and a single image of mean activation for retrieval - motor control was created for each subject . the group data were then analyzed using a random - effects model on a second level to account for interindividual variance . comparisons between groups ( nu > mj ; mj > nu ) were performed using a two - sample t - test with a priori threshold of p < .005 , uncorrected , with a minimum extent threshold ( k ) set at 20 contiguous voxels . anatomic regions ( hippocampus , parahippocampal gyrus , and cingulate gyrus ) for the region of interest analyses were automatically defined using the automated anatomical labeling atlas in spm5 using a threshold of p < .05 and k = 20 . thresholds were based on previously published methods used in bold fmri studies of mj users [ 12 , 41 , 50 , 67 ] . one - way analyses of variance ( anovas ) were used to compare mj users and nu on demographic , clinical measures , cognitive measures , and behavioral measures . spss 18.0 ( spss , chicago , il ) was used for all statistical analyses ( = .05 ) . two - way ( group block ) repeated measures analyses of variance ( anovas ) were conducted for path length , navigation latency , first movement latency on wmt learning trials . chi - square nonparametric analyses were conducted to compare navigation strategies , that is , direct strategy versus the nondirect strategy , between groups . significant group differences were observed for age ( f(1,27 ) = 5.0 , p = .03 ) and education ( f(1,27 ) = 5.10 , p = .03 ) , and , therefore , fmri analyses included age as a covariate . as illustrated in table 1 , data for the mj group confirm near daily mj use , as indicated by asi scores of mj use in the last 30 days , smoking episodes per week , total grams of mj used per week and average urinary cannabinoid levels ( ng / mg ) . mj users also reported very low scores ( out of a total 36 ) on the mwc , suggesting no significant withdrawal symptoms were present on study day . no significant differences were observed between the groups for iq , as measured by wasi , or for mood , as measured by the ham - a , or on panas ( positive or negative affect subscales ) ( table 2 ) . further , no significant performance differences were detected between the mj and nu groups on the mental rotation test total score , or on the sbsod total score ( table 2 ) . there was a significant effect of block ( f(3 , 78 ) = 5.1 , p < .005 ) , with both groups displaying shorter path lengths to reach the hidden platform by the fourth block ( figure 3 ) . for navigation latency , there also was a significant main effect of block ( f(3,78 ) = 3.8 , p < .05 ) , again with both groups displaying shorter navigation latencies to successfully complete the trial with increasing number of completed trials ( block 1 : 16.0 9.2 ; block 2 : 11.0 6.9 ; block 3 : 12.9 13.2 ; block 4 : 9.8 6.4 ) . there was a significant main effect of block ( f(3 , 78 ) = 17.1 , p < .001 ) for latency to first movement , with both groups displaying shorter latencies to initiate movement by the fourth block ( block 1 : 5.6.0 1.8 ; block 2 : 4.1 1.8 ; block 3 : 4.1 1.7 ; block 4 : 3.8 1.9 ) . the group effect for retention trended towards significance , with mj users displaying a lower percentage of total navigation distance within the ne ( correct ) platform quadrant on the probe trial relative to nu ( 41.6% 15.6 versus 50.7% 10.6 , resp . ; include f value , p = .08 ) . heading error did not differ significantly between mj and nu groups ( 27.9 degrees 28.6 and 20.6 21.5 , resp . ) . the number of hidden platform trials completed during fmri did not differ between groups , with mj users completing 10.3 3.6 and nu completing 11.4 2.7 hidden platform trials during fmri bold acquisition . despite a lack of difference in the number of trials completed mj users demonstrated shorter latencies to first movement ( 3.2 sec 1.2 ) relative to nu ( 4.6 1.6 ) ( f(1 , 26 ) = 5.9 , p < .05 ) and longer path lengths to reach the hidden platform ( mj : 1.7 1.5 versus nu : 0.8 0.4 ; f(1 , 26 ) = 4.8 , p < .05 ) . there were no significant group differences for navigation latency ( mj users : 15.1 12.9 ; nu : 9.9 5.5 ) . the number of visible platform trials completed also did not differ between groups , with mj users completing 15.7 1.3 and nu completing 15.0 1.4 visible platform trials during fmri bold acquisition . there were no significant group differences observed for path length ( mj users : 0.5 0.1 ; nu : 0.4 0.01 ) , navigation latency ( mj users : 3.9 0.5 ; nu : 3.9 0.7 ) , or latency to first movement ( mj users : 3.3 1.4 ; nu : 4.4 1.7 ) . there was a significant preference observed for the use of a direct versus a nondirect strategy during the probe trial in the nu group , with 78% ( n = 14 ) employing a direct search strategy and 22% ( n = 4 ) employing a nondirect strategy ( (1,18 ) = 5.6 , p < .05 ) . a strategy preference was not observed in the mj group , 50% ( n = 5 ) utilized a direct strategy and 50% ( n = 5 ) utilized a nondirect strategy . nu , relative to mj group , demonstrated greater bold activation in the bilateral inferior frontal pars triangularis and bilateral inferior frontal pars opercularis , left superior frontal gyrus , left superior frontal pars orbitalis , bilateral middle frontal gyrus , right pallidum , and right putamen for the retrieval - motor control contrast ( table 3 ) . however , the mj group relative to nu did not show greater bold activation in any region ( table 3 ) . nu , relative to mj group , displayed significantly greater bold activation in the right parahippocampal gyrus ( cluster size ( k ) = 26 , x = 24 , y = 4 , z = 28 , p uncorrected = 0.018 ) for the retrieval - motor control contrast ( figure 4(a ) ) . in addition , mj users demonstrated no regions of greater bold activation relative to the nu group in either the parahippocampal gyrus or hippocampus . for the exploratory analysis of the cingulate gyrus , the nu group relative to the mj group also demonstrated greater bilateral anterior cingulate gyrus and bilateral midcingulate gyrus activation ( figure 4(b ) ) , however , mj users showed no greater activation in this area relative to the nu group ( table 4 ) . this pilot study compared current , chronic mj users and nu during performance of a virtual water maze task of spatial learning and memory . while task performance on learning trials was similar between groups , there was a trend for mj users to display a lower percentage of total navigation distance within the correct quadrant during the probe trial relative to nu , suggesting a subtle difference in memory retention . during performance on hidden trials during fmri , although the number of completed trials did not differ between groups , mj users exhibited significantly longer path lengths and shorter latencies to first movement , which also indicates a deficit in memory retrieval . performance on visible trials did not differ between groups , however , suggesting that groups had comparable motor abilities . visuospatial perception ( i.e. , mental rotation ) and environmental spatial ability ( i.e. , santa barbara sense of direction scale ) also did not differ between groups , which is consistent with a previous investigation that failed to find differences in orientation skills in mj users . importantly , this first pilot fmri investigation of water maze performance in current mj users revealed that in addition to some behavioral performance differences during memory retrieval , brain activation patterns differed significantly during task performance , with mj users demonstrating less bold activation in the right parahippocampus and the cingulate gyrus relative to nu . the parahippocampal area is necessary for the processing associations between landmark objects and the environment ( landmark - based memory ) , or contextual memory . in the current study , the nu group demonstrated greater recruitment of the parahippocampus during the retrieval of the hidden platform location , which was located between two relevant landmarks ( e.g. , abstract paintings ) within the environment , which provides consistent support for this brain region being involved in spatial navigation in healthy adults . although there are no existing data on mj effects on bold activation during a spatial memory task , alterations in hippocampal activation in mj users relative to nonusers have been reported for nonspatial , associative memory tasks . jager and colleagues reported that despite normal memory performance , abstinent mj users displayed hypoactivity in the hippocampal / parahippocampal area compared to nu during the learning phase of a pictorial memory pairing task . in contrast , hyperactivation of the hippocampal / parahippocampal area was reported during the learning phase in a face - name matching task in mj users compared to nonusers . similarly , hyperactivation in the left parahippocampal gyrus was observed during the encoding of face - profession pairs in high - frequency versus low - frequency mj users . overall , these data suggest evidence for hippocampal / parahippocampal activation differences associated with mj use during the performance of memory tasks , although memory for objects versus memory for faces may underlie the mj - related differences in the direction of bold activation effects ( hypoactivation versus hyperactivation ) across these previously published studies . in the present study , exploratory analysis of the cingulate gyrus revealed greater activation of the anterior cingulate and the midcingulate gyrus during memory retrieval in the nu group the anterior cingulate cortex is an executive region that plays a critical role in modulation of attention , with reciprocal connections with the amygdala , providing support for its role in arousal and motivation . these preliminary data suggest that nu may differentially activate this frontal region to meet the attentional demands posed by this task , which subsequently leads to a greater utilization of attentional resources during memory retrieval as compared to mj users . these findings are consistent with previous studies , in which frontal hypoactivation was observed in mj users relative to nonusers . nestor and colleagues demonstrated hypoactivation in the frontal gyrus in mj users relative to nonusers during the learning phase in a face - name association task . the majority of remaining available data on brain activation differences associated with mj use are based on investigations of spatial working memory , which employs a different neural circuitry that is more frontally mediated , compared to more traditional memory tasks that involve the medial temporal lobe . nonetheless , adolescents with recent mj use exhibit greater activation of the medial and left superior prefrontal cortex and bilateral anterior insula , despite similar task performance , and as compared to an abstinent group and nonusers during the performance of a 2-back spatial working memory task . in addition , young adult mj users were reported to demonstrate greater activation in the inferior and middle frontal gyri , as well as the right superior temporal gyrus , an area not typically recruited for visual spatial working memory during the performance of a visuospatial 2-back working memory task . long - term heavy mj users also exhibit increased activation in the prefrontal cortex and anterior cingulate , as well as the basal ganglia , compared to non - users , during performance of a spatial working memory task . taken together , these data suggest that mj users exhibit altered neural functioning during spatially - related cognitive challenges , with deficits being observed in both frontal and temporal cortices and suggesting evidence for compensatory and adaptive functioning to overcome inefficient activation of the neural network associated . brain activation changes associated with mj use appear to be task specific , with some studies demonstrating hyperactivation , suggestive of increased recruitment , and other studies demonstrating hypoactivation , suggestive of inefficient neural networking [ 42 , 51 , 52 ] . overall , studies that have reported hyperactivation of brain areas suggest functional compensation and possible neural recruitment of additional brain areas . alterations in brain activation ( e.g. , hypoactivation ) can also be affected by differences in cerebral blood volume ( cbv ) and cerebral blood flow ( cbf ) . studies using dynamic susceptibility contrast magnetic resonance imaging ( dsc mri ) have provided important insight into the effects of marijuana on cerebral hemodynamics , demonstrating that while cbv levels begin to normalize with continued abstinence from marijuana in frontal areas , temporal and cerebellar brain regions show slower cbv decreases [ 73 , 74 ] . these findings have important implications for understanding the effects of changes in the microvasculature blood volume and/or blood flow that can affect fmri bold signal in chronic marijuana users and nonusers [ 73 , 74 ] . at least in the current study , the strategy chosen to solve the water maze could have affected behavioral performance . a significantly greater percentage of nu than mj users employed a direct navigation strategy , which relies on spatial cues and is the most efficient means to reach the platform quadrant . indeed , only half of the mj users used a direct approach to complete the task , which may have contributed to the trend for worse performance on the probe trial and greater path lengths during retrieval . it is plausible that choosing a less efficient strategy to solve the water maze could have likewise contributed to differences in bold activation during spatial navigation . these preliminary findings should therefore be replicated in a larger sample of mj and nu subjects , which would permit the ability to examine strategy choice in relationship to bold activation during spatial memory task performance . a strength of this study is that it is the first investigation of hippocampal brain activation during the performance of a virtual analogue of the well - established morris water maze task in mj users , who were well characterized , clinically diagnosed with marijuana abuse , and who did not meet criteria for any other substance abuse disorders . furthermore , self - report of marijuana use was confirmed by urine drug toxicology screen and results from the scid and the mwc suggest that in this sample of chronic , heavy mj smokers , they were not experiencing significant withdrawal symptoms at the time of assessment . in terms of limitations , only a modest number of subjects were examined in this pilot study , which limits generalizability and precludes the ability to examine sex differences within the groups . performance measures of spatial ability typically have large variability and , therefore , the current investigation should be replicated using a larger sample of subjects . however , despite the modest sample size , significant bold activation differences in the parahippocampal and cingulate region were detected . although differences in age may have been a potential confound , fmri analyses were corrected for age and differences remained significant between groups . the mj group also endorsed more alcohol and tobacco use than the nu comparison group , albeit at modest , nonclinical levels . nonetheless , effects on bold activation can not be ruled out , particularly since nicotinic alpha-7 acetylcholine receptors are highly distributed in the hippocampus and alcohol use has been reported to block the induction of long - term potentiation in hippocampal rat slices . although subjects from the current study were well characterized with regard to their clinical , demographic and mj - use status , formal personality testing was not completed with instruments designed to specifically assess axis ii pathology , which may impact neurocognitive performance . it is of note , however , that the majority of these subjects ( 80% ) were enrolled in a separate , multiweek study , which repeatedly assessed clinical state through clinical scales and interviews , and none appeared to meet criteria or demonstrate any symptoms of a personality disorder [ 67 , 77 ] . in terms of fmri data processing , the automated anatomical labeling ( aal ) atlas was used to define region of interest ( rois ) . it is difficult to localize activation in small areas such as the hippocampus , since areas such as the parahippocampal cortex , fusiform gyrus , and lingual gyrus surround this area . thus , the atlas map chosen for analysis could have contributed to varied results across studies . the length of the period of abstinence from marijuana use has been shown to impact performance on memory tasks and brain function . even though , the mwc suggests that the mj users are not experiencing significant withdrawal symptoms , it can not be discounted that the observed group differences could still reflect residual effects of mj use and may account for the disparate findings amongst studies . study were abstinent for at least 7 days prior to testing , participants in the current pilot study abstained for only a minimum of 12 hours . regardless , both studies demonstrated hypoactivation of the hippocampus and parahippocampal gyrus in mj users relative to nonusers during a learning and memory task . in order to examine the potential adverse effects of mj use on neural activity beyond a week of abstinence , a logical next step to this work would be to examine subjects who have undergone a longer period of abstinence to explore whether functional changes in bold signal between mj users and nu result from potential washout effects associated with drug abstinence . in summary , data from this pilot study demonstrate significant differences in bold activation in mj users compared to a nu comparison group during memory retrieval on a spatial navigation task . these data suggest that mj users utilize neuronal resources in a manner that differs from nu , as suggested by the observed hypoactivation of the / parahippocampal area during navigation , but perhaps also from frontal hypoactivation due to the attentional demands of the task . further research is warranted to determine the potential mechanism of action by which mj use may affect brain activation during memory retrieval . nevertheless , the current findings demonstrate that mj use exerts a significant effect on neural activity , which is relevant to public health concerns associated with understanding the long - term consequences of chronic marijuana use on brain function in young adults . indeed , altered brain function in the absence of gross behavioral performance differences may be an early indicator of future long - term consequences associated with continued use , particularly given that relatively short history of mj use in the current study sample . early alterations in neuronal function may potentially be related to the later manifestation of mj - related cognitive impairments , as well as an increased risk for psychiatric conditions , which underscores the need for additional investigations focusing on the neurobiological consequences of mj use .	numerous studies have reported neurocognitive impairments associated with chronic marijuana use . given that the hippocampus contains a high density of cannabinoid receptors , hippocampal - mediated cognitive functions , including visuospatial memory , may have increased vulnerability to chronic marijuana use . thus , the current study examined brain activation during the performance of a virtual analogue of the classic morris water maze task in 10 chronic marijuana ( mj ) users compared to 18 nonusing ( nu ) comparison subjects . imaging data were acquired using blood oxygen level - dependent ( bold ) functional mri at 3.0 tesla during retrieval ( hidden platform ) and motor control ( visible platform ) conditions . while task performance on learning trials was similar between groups , mj users demonstrated a deficit in memory retrieval . for bold fmri data , nu subjects exhibited greater activation in the right parahippocampal gyrus and cingulate gyrus compared to the mj group for the retrieval - motor control contrast ( nu > mj ) . these findings suggest that hypoactivation in mj users may be due to differences in the efficient utilization of neuronal resources during the retrieval of memory . given the paucity of data on visuospatial memory function in mj users , these findings may help elucidate the neurobiological effects of marijuana on brain activation during memory retrieval .
You are an expert at summarizing long articles. Proceed to summarize the following text: langerhans cell histiocytosis ( lch ) is a clonal proliferation of langerhans cells occurring as an isolated lesion or as part of a systemic ( multifocal ) proliferation . the designation of lch has replaced the previous nomenclature of the group of diseases termed histiocytosis x , which included eosinophilic granuloma ( eg ) , letterer - siwe syndrome and hand - schuller - christian disease . the incidence of spinal involvement in this disease varies from 6.5 to 25% of cases with lch of the skeleton . eighty percent of cases occur in children younger than 10 years of age . in nearly 95% of cases of spinal lch isolated involvement of posterior elements of spine in a child has been described by garg et al . our 's is the first to describe such a case in an adult who presented with progressive lower limb weakness . the etiology , pathophysiology , differential diagnosis and treatment of this disease are discussed with reference to our case . a 35-year - old housewife presented to us with complaints of progressive loss of power in both lower limbs since two months , tingling and numbness in both lower limbs , inability to pass urine and constipation of 2-week duration . she was symptom - free 2 months ago when she initially noticed mild weakness in left lower limb which spread to the right side in the next week . the weakness progressively worsened to the present state of no movement in the limbs 1 week preceding her presentation to us . on examination the power in both lower limbs was 0/5 with associated hypertonia ( spastic paraplegia ) . study of dorsal spine revealed a well - defined extradural contrast enhancing mass lesion at d2-d4 vertebral level on right side of spinal canal , extending into the d2-d3 and d3-d4 neural foramina causing compression on the cord with displacement of the spinal cord to the left . [ figures 1and 2 ] t2w images showed subtle cord edema in the spinal cord at d2-d4 level . [ figure 3 ] a preoperative diagnosis of tuberculoma , organized hematoma , meningioma , schwannoma or metastasis was made based on radiological investigations . in view of neurological deficits and radiological evidence of spinal cord compression , a decision to operate the patient was taken . postcontrast sagittal image of spine showing a contrast enhancing extradural lesion at d2 - 4 level with cord compression postcontrast axial image of spine at d2 - 3 level showing the lesion occupying almost all of the spinal canal with displacement of the cord to left t2w sagittal image showing tumor compression of the cord with subtle changes in the cord signal intensity in prone position , d2-d5 decompressive laminectomy was performed . it was easily separable from the dura and seemed to be arising from the lamina of the d3 vertebra . [ figure 4a ] the tumor was removed in toto and the cord was lax at the end of procedure . [ figure 4b ] patient was extubated on table with no added neurological deficits . ( a ) intraoperative picture after laminectomy showing the extradural tumor in situ and ( b ) specimen following excision frozen section was suggestive of hemolymphoid malignancy . histopathology showed fibrocollagenous tissue infiltrated by dense collection of lymphocytes , plasma cells and larger cells with vesicular nuclei resembling histiocytes , few eosinophils and occasional mitotic figures were also seen within the lesion suggestive of lch . her power in the lower limbs improved progressively and by postoperative day 9 , she was ambulatory with support . she had to strain at micturition and needed laxatives for almost a month after surgery . [ figure 5 ] on follow - up of 1 year she was ambulatory with walker stick and her bowel bladder symptoms had improved . examination revealed power of grade 4+/5 , reflexes were brisk but there was no clonus . fifteen months after the spinal surgery she developed another lesion in the uterus for which hysterectomy was done . postoperative postcontrast sagittal image of the cord showing complete excision of the lesion with postoperative changes siwe disease , three different syndromes with the same histology , under the term histiocytosis x . lch is a rare disease that is found mostly in children , with an estimated incidence between 0.2 and 2.0 cases per 100,000 children under 15 years of age and a peak incidence of age between 24 years . lch has a higher incidence in patients with a persistent or transient systemic immunodeficiency , such as viral infections , leukemia , lymphoma , or genetic defect . even among the adults , this disease has preponderance in males , sometimes as high as 6070% , and is more common in whites of northern european descent . our patient was a middle - aged adult female of south asian origin and there was no history of previous medical illness . there are three key subtypes of lch : unifocal , multifocal , and systemic lch . the most common presentation is unifocal ( about 65% ) and the bone is the most frequently affected tissue making up 90% of such cases . the most common site involved is the skull and it accounts for more than 50% of cases . in the spine it usually presents with local pain and stiffness only . neurological symptoms are extremely rare and are usually limited to mild paresthesias or radicular pain . in our case the patient had severe neurological deficits in the form of paraplegia and bowel / bladder symptoms . there are different ways to treat the unifocal lch and there have been four approaches described in the literature . first option is not to offer any treatment at all , because in some eosinophilic granulomas self - limited growth has been reported , as was spontaneous regression . second option is to attempt at least a partial resection or to perform a complete excisional biopsy of the lesion . third option is a biopsy , followed by low - dose radiation to the lesion usually with 610 gy with a local control rate of approximately 80% . fourth option , is with intralesional corticosteroids , usually methylprednisolone 30125 mg to limit immunoresponse , followed by sequential imaging . finally , systemic chemotherapy may be indicated when lch progresses systemically or is recurrent . in 95% of cases , lch of the spine presents as a focal osteolytic vertebral lesion , with or without collapse of the vertebral body . the level of spinal involvement varies at different ages . while in children , the thoracic spine ( 54% ) is commoner , in adults , 47% of reported cases involve the cervical spine , 33% the thoracic spine , and 20% the lumbar spine . our patient had exclusive involvement of the posterior elements of dorsal spine and there was no osteolytic component . eosinophilic granuloma should be considered as a differential diagnosis in all cases of spinal space occupying lesions even in the absence of typical features of lch and the patient should be investigated for associated lesions in the body .	langerhans cell histiocytosis ( lch ) is a clonal proliferation of langerhans cells occurring as an isolated lesion or as part of a systemic proliferation . it is commoner in children younger than 10 years of age with sparing of the posterior elements in more than 95% of cases . we describe a case of lch in an adult female presenting with paraplegia . mri revealed a well - defined extradural contrast enhancing mass at d2-d4 vertebral level involving the posterior elements of spine . d2 - 5 laminectomy with excision of lesion was performed which lead to marked improvement of patients neurological status . histopathology was suggestive of eosinophilic granuloma . we describe the case , discuss its uniqueness and review the literature on this rare tumor presentation .
You are an expert at summarizing long articles. Proceed to summarize the following text: bronchogenic cysts are congenital lesions thought to result from abnormal budding of the ventral foregut that occurs between the 26 and 40 days of gestation . this abnormal bud subsequently differentiates into a fluid - filled , blind - ending pouch . otherwise , chest pain , cough , dyspnea , fever , and expectoration if the cysts are infected comprise their symptomatology . diagnosis of bronchogenic cysts is possible with computed tomography ( ct ) that usually shows well - circumscribed lesions of water density . however , half of the cysts have attenuation values of soft - tissue because of viscid mucoid content , making them indistinguishable from neoplasms . in this article , we describe the imaging characteristics and pathological findings in a case of bronchogenic cyst presenting as soft - tissue mass , which was evaluated and diagnosed by endobronchial ultrasound ( ebus ) . an 18-year - old male presented with 2-months history of progressive dyspnea on exertion and persistent non - productive cough . chest x - ray showed a left perihilar mass and the ct scan revealed a well - circumscribed , round homogeneous low - density ( 50 hounsfield units ) mass in the middle mediastinum adjacent to the left main bronchus measuring 5.1 cm 5.8 cm at its maximum , causing over 80% luminal narrowing of both left pulmonary veins [ figure 1 ] . rigid bronchoscopy was performed under general anesthesia followed by the insertion of the fiber - optic bronchoscope , which demonstrated a moderate extrinsic compression of the left main stem bronchus . radial probe of 20 mhz frequency ebus with a balloon ( olympus , um - bs20 - 26r ) was then placed through the working channel of the fiber - optic bronchoscope and this showed a hypoechoic homogeneous lesion compressing the left main stem bronchus suspicious of a cystic mass . fine internal echoes within the lesion suggested it was mainly a viscous fluid - filled cyst . 18-year - old male with progressive dyspnea on exertion and dry cough diagnosed with bronchogenic cyst . contrast - enhanced computed tomography of the chest ( lung window ) shows a well - defined round homogeneous low - density mass in the mediastinum adjacent to the left main bronchus measuring 5.1 cm 5.8 cm at its maximum , causing over 80% luminal narrowing of both left pulmonary veins ( yellow arrow ) . 18-year - old male with progressive dyspnea on exertion and dry cough diagnosed with bronchogenic cyst . endobronchial ultrasound demonstrates a hypoechoic homogeneous lesion compressing the left main stem bronchus suspicious of a cystic mass with surrounding anatomical structures . dlmb : distal left main bronchus , dao : descending aorta , lpa : left pulmonary artery , atr : atrium , mv : mitral valve . patient underwent complete surgical excision of the mediastinal cyst through a left posterolateral thoracotomy and exhibited an uneventful recovery . grossly , the cyst was smooth , thin - walled , and unilocular measuring a maximum of 4.5 cm 3.5 cm 2.5 cm and containing mostly mucous brownish fluid [ figure 3 ] . aspiration of the cyst contents was initially performed to make the cyst technically easier to remove . then , the cyst was carefully dissected free of its mediastinal and pleural attachments , taking care not to leave any residual cyst wall behind . histopathologically , the cyst was lined by respiratory epithelium with areas of sub - epithelial fibrosis [ figure 4 ] . a slight chronic inflammation of the epithelial lining was also noted . microbiologic and cytologic examinations of cyst fluid were negative for any pathogen development or malignancy , respectively . the afore - mentioned findings were consistent with the presence of a bronchogenic cyst . at last follow - up , 2 months post - operatively 18-year - old male with progressive dyspnea on exertion and dry cough diagnosed with bronchogenic cyst . photography the surgically removed mass shows the resected thin - walled and unilocular cyst measuring a maximum of 4.5 cm 3.5 cm 2.5 cm and containing mostly mucous brownish fluid . 18-year - old male with progressive dyspnea on exertion and dry cough diagnosed with bronchogenic cyst . microscopic examination of the mass ( hematoxylin and eosin , 50 ) shows a portion of the cyst wall with respiratory epithelium ( black arrow ) that overlies fibrous tissue and cartilage . bronchogenic cysts are congenital bronchopulmonary lesions derived from an abnormal budding of the tracheobronchial tree during embryonic development . their incidence is estimated between 1:42,000 and 1:68,000 . however , it is difficult to appreciate the incidence of the cysts exactly since some aged patients have lesions that remain forever silent . bronchogenic cysts are the predominant sub - group of mediastinal cysts accounting for approximately 40% according to one series followed by pericardial cysts ( 35% ) , enteric cysts ( 10% ) , and non - specific cysts ( 14% ) . they are typically located near the large airways just posterior to the carina and lined with cartilage and pseudostratified columnar epithelium . though usually found as an incidental finding on a chest radiograph performed for other unrelated conditions , they may cause compression symptoms such as chronic cough , chest pain , and dyspnea or may become infected . the symptoms occur frequently in children since their smaller thoracic volume and malleable airways predispose them to compressive symptoms earlier when the cyst enlarges . as for imaging modalities , mediastinal bronchogenic cyst appears on plain chest radiograph as smooth rounded opacity in the mediastinum . some cysts that lie beneath the carina can not be visualized by chest x - ray . moreover , ct scan and magnetic resonance imaging ( mri ) may both provide accurate diagnosis of bronchogenic cysts using typical characteristics of a round , well - circumscribed , unilocular mass with density of water . more specifically , uniform low t1 and high t2 intensities , indicative of water density , are demonstrated on mri . roughly , half of the cysts have attenuation values of soft - tissue because of viscous mucoid contents making them indistinguishable from neoplasms . although magnetic resonance may help to further differentiate these lesions , they can still be confounded with malignancies presenting with central necrosis . nevertheless , ebus is a new promising modality , which has broadened the diagnostic possibilities for airway and mediastinal pathology . both ultrasound probes ( radial with a balloon-20 mhz and the convex one-7.5 mhz ) in the present case , ebus detected easily the cystic lesion determining further its extent and relation to the airway wall and key anatomic structures and characterizing the intrinsic composition of its content . more specifically , ultrasound image showed a hypoechoic lesion with fine internal echoes within it thus suggesting mainly a viscous fluid - filled cyst . echogenicity of cystic lesions is related to their cellular content and echogenicity is by convention described with reference to soft - tissue such as lymph nodes or tumors . darker ( hypoechoic ) or black ( anechoic ) images denote either cysts with serous fluid or blood vessels . echogenic images within cysts identify complicated fluid collections that may contain either frank pus or blood clots . the presence of septations , thickened walls or floating debris within the cyst may give further radiological clues to an infected cyst . therefore , ebus can be used to diagnose bronchogenic cysts that present as soft - tissue densities on ct imaging . if there is any doubt in the diagnosis , then ebus transbronchial aspiration can be considered and aspirate sent for bacterial cultures and cytological analysis . despite extensive investigations , the nature of a cystic lesion in the thorax can not be ascertained in a significant percentage of individuals preoperatively . differential diagnosis of bronchogenic cyst includes many other entities such as , congenital cysts and malformations ( pericardial cysts , cystic hygroma / lymphangioma , neurenteric cyst , esophageal duplication cyst , thyroid colloid cyst , thymic cyst ) , hydatid cysts , lymphoma , lung abscess , fungal disease , tuberculosis , infected bullas , vascular malformations , mediastinal tumors , hematoma , sarcoidosis , pancreatic pseudocyst ( for retroperitoneal bronchogenic cysts or for pancreatic pseudocysts that extend intrathoracically through the aortic hiatus or esophageal hiatus ) and pulmonary masses ( congenital cystic adenomatoid malformation , pulmonary sequestration , lung cancer , metastases ) . surgical resection remains the mainstay and the only curative treatment for bronchogenic cysts , even though they are asymptomatic and vary in their clinical behavior . the crucial point for avoiding cyst recurrences is the complete excision of the mucosal lining . in addition , convex - probe ebus has an important implication in the management of the bronchogenic cyst as shown by recently published case studies , where it was successfully used to puncture and aspirate the cyst contents in patients who were unfit for surgery . furthermore , real - time ultrasound allows complete aspiration of the cyst that is not always possible when blind techniques are employed . this results in cyst collapse and adhesion of the mucosal lining thus diminishing recurrence rates . this is more likely a temporary procedure when emergency decompression of the cyst is needed to relieve a significant airway narrowing or in patients not fit for thoracotomy or other invasive procedure . the disadvantage of the option is the possible increase in the cyst size later and the minimal risk of malignant transformation . ebus has a potential role in diagnosis , when a confident diagnosis of bronchogenic cyst can not be made by ct . in particular , it can easily identify the cystic lesion and clearly clarify its nature as well as provide imaging guidance for therapeutic procedures .	diagnosis of bronchogenic cysts is possible with computed tomography , where the cysts are seen usually as well - circumscribed lesions of water density . however , many of the cysts have a soft - tissue density thus rendering them indistinguishable from neoplasms . in this article , we describe a case of bronchogenic cyst presenting as soft - tissue mass that was evaluated and diagnosed by endobronchial ultrasound ( ebus ) . we discuss the ultrasound image characteristics of the cyst and its histopathology findings . ebus seems to be a valuable tool in the diagnosis of bronchogenic cysts and also enables their complete aspiration .
You are an expert at summarizing long articles. Proceed to summarize the following text: kitaibelii ( winter savory ) were collected in the period may - june , 2005 , in the region of mountain zlatibor , serbia , as labelled . the voucher specimen of the collected plant material was confirmed by biljana boin and deposited at the herbarium of the department of pharmacognosy , faculty of medicine , university of novi sad . all chemicals and reagents were of analytical reagent grade and were purchased from sigma chemical co. ( st louis , mq , usa ) , aldrich chemical co. ( steineheim , germany ) and " zorka " ( abac , serbia ) . . " vital " , oil and vegetable fat factory ( vrbas , serbia ) . commercial preparation of liposomes ( pro - lipo s , with 30% soybean phosphatidylcholine ) was obtained from lucas - meyer , hamburg , germany . the dried aerial parts ( moisture content 3.72% ) of winter savory were ground in a grinder ( dlfu bhler miag laboratory disc mill , germany ) with a 2 mm in diameter mesh . this material ( 100 g ) was macerated with 70 % methanol in water ( 2 2500 ml ) at room temperature for 2 24 h. the obtained extract was concentrated under reduced pressure to remove methanol , and then extracted sequentially with petroleum ether ( 2 200 ml ) , chloroform ( 2 200 ml ) , ethyl acetate ( 2 200 ml ) and n - butanol ( 2 200 ml ) . the petroleum ether , chloroform , ethyl acetate , n - butanol and remaining water extract were evaporated to dryness under reduced pressure at 40c with a water bath . the yields , average of triplicate analysis , of the extracts were : petroleum ether , m = 0.580.029 g ; chloroform , m=0.490.024 g ; ethyl acetate , m=0.550.028 g ; n - butanol , m=2.130.106 g and water , m=6.030.30 g. hydroxyl radicals were obtained during a fenton reaction by mixing 200 l 0.3 m 5,5-dimethyl-1- pyroline - n - oxide ( dmpo ) , 200 l 10 mm h2o2 , 200 l 10 mm fe and 10 l of methanol ( blank ) . the influence of different types of extract on the formation and transformation of hydroxyl radicals was investigated by adding the petroleum ether , chloroform , ethyl acetate , n - butanol and water extracts in the fenton reaction system at the range of concentrations 0.10.5 mg / ml ( probe ) . the esr spectra were recorded on a bruker 300e , after 5 min , with the following spectrometer settings : field modulation 100 khz , modulation amplitude 0.512 g , receiver gain 210 , time constant 81.92 ms , conversion time 163.84 ms , centre field 3440.00 g , sweep width 100.00 g , x - band frequency 9.64 ghz , power 20 mw , temperature 23c . the antioxidant activity ( aaoh ) of the extracts was defined as : aaoh = 100 ( ho - hx)/ho [ % ] where ho and hx are the height of the second peak in the esr spectrum of the dmpo - oh spin adduct of the blank and probe , respectively . oxidation was investigated in a solution containing 1 ml of sunflower oil , 0.0018 g acva , 0.0274 g of -phenyl - n - tert - butylnitrone ( pbn ) and 380 l of various concentrations of methanolic solutions of the investigated extracts ( final concentrations were in range 15 mg / ml ) . liposome suspension was prepared by adding 1 g of commercial liposomes to 10 ml water and incubated with stirring at 37c for 1h . oxidation was investigated in the solution containing 1 ml of liposome suspension , 0.0019 g aaph , 0.0274 g of pbn and 380 l of various concentrations of methanolic solutions of the investigated extracts ( final concentrations were in the range 15 mg / ml ) . lipid oxidation in both systems was measured by following the formation of peroxyl radicals with esr spin trapping method . the esr spectra of the formed pbn - peroxyl radical spin adducts were recorded with the following spectrometer settings : field modulation 100 khz , modulation amplitude 1.021 g , receiver gain 510 , time constant 20.48 ms , conversion time 327.68 ms , centre field 3440.00 g , sweep width 100.00 g , x - band frequency 9.64 ghz , power 20 mw , temperature 23c . the antioxidant activity value ( aaloo ) of the extract was defined as : aaloo=100(ho - hx)/ho [ % ] , where ho and hx are the height of the second peak in the esr spectrum of the pbn - ool spin adduct obtained in the absence and in presence of the investigated extracts , respectively . splitting constants were calculated from computer - generated second derivatives of the spectra , after optimizing signal - to - noise ratios , and were verified by computer simulations . for these investigations the disc diffusion method and microbroth dilution methods were applied . from the primary isolation medium 23 colonies of investigated bacteria were taken by flamed loop , suspended in mueller - hinton or sabouraud broth , and they were incubated at 37c . the suspension for inoculation the number of cells in 1 ml of suspension for inoculation measured by the mcfarland nephelometer was 110 cfu / ml . a volume of 1 ml of this suspension was homogenized with 9 ml of melted ( 45c ) mueller - hinton or sabouraud dextrose agar and poured into petri dishes . for screening , sterile 6 mm discs ( himedia , mumbai , india ) were impregnated with 10 l of 100 mg / ml of satureja montana l. subsp . after incubation for 2448 hours in the thermostat , inhibition zone diameters , zi , ( including disc ) were measured and expressed in mm . the presence of the inhibition zone indicates the activity of tested extracts against bacteria or yeasts . the minimum inhibitory concentration ( mic ) was reported as the lowest concentration of the extracts capable of inhibiting the growth of the bacterium tested . the mic was determined by the broth macrodilution test using an inoculum of 110 cfu / ml . final concentrations of the investigated extracts were 6.25 , 12.5 , 25 , 50 , 75 and 100 mg / ml . both tests were done in three replications . pseudomonas aeruginosa ( atcc 27853 , gram negative ) , escherichia coli ( atcc 25922 , gram negative ) , staphylococcus aureus ( atcc 25923 , gram positive ) , sarcina lutea ( atcc 9341 , gram positive ) , bacillus cereus ( atcc 10707 , gram positive ) , saccharomyces cerevisiae ( 112 , hefebank weihenstephan ) and candida pseudotropicalis ( clinical isolate ) microorganism strains were employed for the determination of antimicrobial activity . penicillin ( 10 iu / disc ) and amoxicillin ( 25 g / disc ) were used as reference standards as obtained from bioanalyse co. , ltd . , ankara , turkey . in parallel with the antibacterial investigation of satureja montana l. subsp . kitaibelii extracts , pure solvent was tested too , and it did not exhibit any antibacterial activity ( data are not shown ) . bacteria were obtained from the stock cultures of the microbiology laboratory , faculty of technology , university of novi sad . all measurements were carried out in triplicate , and presented as mean sme or sd . regression analyses and significance of differences were carried out using a spss statistical software package ( spss for windows , 8.0 , 1997 , spss inc . , chicago , il , usa ) . kitaibelii ( winter savory ) were collected in the period may - june , 2005 , in the region of mountain zlatibor , serbia , as labelled . the voucher specimen of the collected plant material was confirmed by biljana boin and deposited at the herbarium of the department of pharmacognosy , faculty of medicine , university of novi sad . all chemicals and reagents were of analytical reagent grade and were purchased from sigma chemical co. ( st louis , mq , usa ) , aldrich chemical co. ( steineheim , germany ) and " zorka " ( abac , serbia ) . . " vital " , oil and vegetable fat factory ( vrbas , serbia ) . commercial preparation of liposomes ( pro - lipo s , with 30% soybean phosphatidylcholine ) was obtained from lucas - meyer , hamburg , germany . the dried aerial parts ( moisture content 3.72% ) of winter savory were ground in a grinder ( dlfu bhler miag laboratory disc mill , germany ) with a 2 mm in diameter mesh . this material ( 100 g ) was macerated with 70 % methanol in water ( 2 2500 ml ) at room temperature for 2 24 h. the obtained extract was concentrated under reduced pressure to remove methanol , and then extracted sequentially with petroleum ether ( 2 200 ml ) , chloroform ( 2 200 ml ) , ethyl acetate ( 2 200 ml ) and n - butanol ( 2 200 ml ) . the solvent extractions were performed in separation funnels , shaking for 10 min . the petroleum ether , chloroform , ethyl acetate , n - butanol and remaining water extract were evaporated to dryness under reduced pressure at 40c with a water bath . the yields , average of triplicate analysis , of the extracts were : petroleum ether , m = 0.580.029 g ; chloroform , m=0.490.024 g ; ethyl acetate , m=0.550.028 g ; n - butanol , m=2.130.106 g and water , m=6.030.30 g. hydroxyl radicals were obtained during a fenton reaction by mixing 200 l 0.3 m 5,5-dimethyl-1- pyroline - n - oxide ( dmpo ) , 200 l 10 mm h2o2 , 200 l 10 mm fe and 10 l of methanol ( blank ) . the influence of different types of extract on the formation and transformation of hydroxyl radicals was investigated by adding the petroleum ether , chloroform , ethyl acetate , n - butanol and water extracts in the fenton reaction system at the range of concentrations 0.10.5 mg / ml ( probe ) . the esr spectra were recorded on a bruker 300e , after 5 min , with the following spectrometer settings : field modulation 100 khz , modulation amplitude 0.512 g , receiver gain 210 , time constant 81.92 ms , conversion time 163.84 ms , centre field 3440.00 g , sweep width 100.00 g , x - band frequency 9.64 ghz , power 20 mw , temperature 23c . the antioxidant activity ( aaoh ) of the extracts was defined as : aaoh = 100 ( ho - hx)/ho [ % ] where ho and hx are the height of the second peak in the esr spectrum of the dmpo - oh spin adduct of the blank and probe , respectively . oxidation was investigated in a solution containing 1 ml of sunflower oil , 0.0018 g acva , 0.0274 g of -phenyl - n - tert - butylnitrone ( pbn ) and 380 l of various concentrations of methanolic solutions of the investigated extracts ( final concentrations were in range 15 mg / ml ) . liposome suspension was prepared by adding 1 g of commercial liposomes to 10 ml water and incubated with stirring at 37c for 1h . oxidation was investigated in the solution containing 1 ml of liposome suspension , 0.0019 g aaph , 0.0274 g of pbn and 380 l of various concentrations of methanolic solutions of the investigated extracts ( final concentrations were in the range 15 mg / ml ) . lipid oxidation in both systems was measured by following the formation of peroxyl radicals with esr spin trapping method . the esr spectra of the formed pbn - peroxyl radical spin adducts were recorded with the following spectrometer settings : field modulation 100 khz , modulation amplitude 1.021 g , receiver gain 510 , time constant 20.48 ms , conversion time 327.68 ms , centre field 3440.00 g , sweep width 100.00 g , x - band frequency 9.64 ghz , power 20 mw , temperature 23c . the antioxidant activity value ( aaloo ) of the extract was defined as : aaloo=100(ho - hx)/ho [ % ] , where ho and hx are the height of the second peak in the esr spectrum of the pbn - ool spin adduct obtained in the absence and in presence of the investigated extracts , respectively . splitting constants were calculated from computer - generated second derivatives of the spectra , after optimizing signal - to - noise ratios , and were verified by computer simulations . for these investigations the disc diffusion method and microbroth dilution methods were applied . from the primary isolation medium 23 colonies of investigated bacteria were taken by flamed loop , suspended in mueller - hinton or sabouraud broth , and they were incubated at 37c . the suspension for inoculation the number of cells in 1 ml of suspension for inoculation measured by the mcfarland nephelometer was 110 cfu / ml . a volume of 1 ml of this suspension was homogenized with 9 ml of melted ( 45c ) mueller - hinton or sabouraud dextrose agar and poured into petri dishes . for screening , sterile 6 mm discs ( himedia , mumbai , india ) were impregnated with 10 l of 100 mg / ml of satureja montana l. subsp . after incubation for 2448 hours in the thermostat , inhibition zone diameters , zi , ( including disc ) were measured and expressed in mm . the presence of the inhibition zone indicates the activity of tested extracts against bacteria or yeasts . the minimum inhibitory concentration ( mic ) was reported as the lowest concentration of the extracts capable of inhibiting the growth of the bacterium tested . the mic was determined by the broth macrodilution test using an inoculum of 110 cfu / ml . final concentrations of the investigated extracts were 6.25 , 12.5 , 25 , 50 , 75 and 100 mg / ml . pseudomonas aeruginosa ( atcc 27853 , gram negative ) , escherichia coli ( atcc 25922 , gram negative ) , staphylococcus aureus ( atcc 25923 , gram positive ) , sarcina lutea ( atcc 9341 , gram positive ) , bacillus cereus ( atcc 10707 , gram positive ) , saccharomyces cerevisiae ( 112 , hefebank weihenstephan ) and candida pseudotropicalis ( clinical isolate ) microorganism strains were employed for the determination of antimicrobial activity . penicillin ( 10 iu / disc ) and amoxicillin ( 25 g / disc ) were used as reference standards as obtained from bioanalyse co. , ltd . , ankara , turkey . in parallel with the antibacterial investigation of satureja montana l. subsp . kitaibelii extracts , pure solvent was tested too , and it did not exhibit any antibacterial activity ( data are not shown ) . bacteria were obtained from the stock cultures of the microbiology laboratory , faculty of technology , university of novi sad . all measurements were carried out in triplicate , and presented as mean sme or sd . regression analyses and significance of differences were carried out using a spss statistical software package ( spss for windows , 8.0 , 1997 , spss inc . ,	the antioxidant activity of different satureja montana l. subsp . kitaibelii extracts was tested by measuring their ability to scavenge reactive hydroxyl radical during the fenton reaction , using esr spectroscopy . also , the influence of these extracts on lipid peroxyl radicals obtained during lipid peroxidation of : ( i ) sunflower oil ( 37 c , 3h ) induced by 4,4-azobis(4-cyanovaleric acid ) ( acva ) and ( ii ) liposomes induced by 2,2-azobis(2- amidino - propane)dihydrochloride ( aaph ) was studied . n - butanol extract had the best antioxidant activity ( 100% at 0.5 mg / ml in fenton reaction system ; 89.21% at 5 mg / ml in system i ; 83.38% at 5 mg / ml in system ii ) . the antioxidant activities of the extracts significantly correlated with total phenolic content . the antimicrobial activity of satureja montana l. subsp . kitaibelii extracts was investigated . petroleum ether , chloroform and ethyl acetate extracts expressed a wide range of inhibiting activity against both grampositive and gram - negative bacteria .
You are an expert at summarizing long articles. Proceed to summarize the following text: glaucoma - related blindness affects about 8.5 million people worldwide ; however , it can be significantly reduced by early detection of glaucoma and prompt introduction of treatment , which may slow progression of the disease , especially the open - angle type [ 2 , 3 ] . glaucoma detectability and treatment results are still highly unsatisfactory not only in developing regions of the world but also in developed countries where glaucoma detection rate does not exceed 50% [ 47 ] . population screening programs aimed at glaucoma risk groups may enable early detection of the disease and substantially reduce its negative personal and socioeconomic impact [ 811 ] . a key issue for screening is effective recruitment , which requires a wide range of strategies tailored to various characteristics of potential screening participants . although there is substantial data on the effectiveness of recruitment strategies for many screening programs worldwide , according to the authors ' knowledge there is an absence of this kind of data concerning glaucoma screening . primary care ( pc ) , the most common form of health service in numerous countries , where treatments stay close to prevention , constitutes a natural environment for promoting prophylactic programs . our study was to assess the effectiveness of one - on - one counseling carried out by pc doctors and nurses to increase glaucoma screening rates measured three months after the intervention . counseling was performed to encourage eligible patients to undergo free screening visit in specialist ophthalmology outpatient clinics independent from pc unit . in poland , a state - funded glaucoma screening program has been in place since 2006 . this program , which was developed for participants aged 35 years and older who were neither diagnosed with glaucoma nor examined for glaucoma within the last 24 months , consists of a mandatory protocol performed by ophthalmologists . it includes an ophthalmological examination consisting of optic disc stereophotography of anterior and posterior segment structures , intraocular pressure assessment , and anterior chamber angle measurements . presented research belongs to the health and social survey group of studies related to human behaviours . during the conceptualization phase we assumed that the study plan comprising routine counseling procedures with no identified risk for patients performed by primary care doctors and nurses as a part of their everyday practice does not qualify it for formal ethical committee approval . ethical issues , including respect to patients rights , were ensured by taking informed consent from every participant of the study and by adherence to routine primary care procedures to ensure privacy and other ethical aspects of patient management . the study was conducted from march 2010 to may 2011 by primary care doctors and nurses according to a written protocol with detailed description of study procedures , including recruitment , aims of glaucoma screening encouragement , estimated duration of counseling sessions to encourage glaucoma screening , scope and form of information provided to patients , and procedures to assess the number of patients who underwent screening in specialist ophthalmology clinics after the counseling . a short training concerning the study protocol was given to the mentioned primary care staff . every member of the study team was equipped with a written version of the protocol for referral . first time during the recruitment phase which was followed by procedures assigned to intervention and control groups . second approach occurred three months after initial participant 's visit in the form of telephone interview to acquire information if the person was screened for glaucoma within the time from the visit . participants were recruited by primary care nurses from patients visiting a primary healthcare center within its standard everyday practice . eligibility for glaucoma screening was based on the above mentioned criteria for a state - founded glaucoma screening program . to avoid randomization bias the study was not publicized , so the patients were generally unaware of it before their arrival to the center . patients who consented to the study and met the criteria for inclusion to at least one of four state - funded prophylactic programs ( i.e. , glaucoma , breast cancer , cervical cancer , or cardiovascular disease ) were consecutively assigned to one of three groups ( i.e. , doctor 's , nurse 's , or control ) according to their order of appearance at the health center . for a small portion of participants , due to organizational reasons considering patients who met inclusion criteria for at least one of the above mentioned prophylactic programs we established three databases for persons consecutively assigned to doctors , nurses , and control groups . for the purpose of this study , we chose from these groups only those patients , who qualified for glaucoma screening ; therefore , in this paper , only the data related to participants eligible for glaucoma screening is presented and analyzed . study interventions were focused on providing patients with high quality information concerning medical and practical aspects of glaucoma screening . duration of the counseling procedures performed by doctors and nurses was kept in accordance with instructions from the study protocol . exact duration of every procedure was not measured , and adherence to the study protocol ( including average duration of counseling procedures ) was estimated on the base of interviews with doctors and nurses who participated in the study . questions as well as scope and form of information provided to patients were based on instructions contained in the study protocol . consultations performed by doctors required on average an additional 5 minutes after routine consultation and included taking a history of previous prophylactic programs , discussing the medical aspects of glaucoma screening along with its health benefits , informing on glaucoma screening providers , and answering questions . the nurse consultations were also carried out in private rooms and were similar to the doctor 's consultations , but they lasted on average 10 minutes and were not connected with consultation for other reasons . patients from both intervention groups were equipped with identical leaflets on glaucoma screening and with the list of contact details concerning local specialist ophthalmology outpatient clinics which were free glaucoma screening providers . patients assigned to the control group were asked by a nurse about their history of participation in prophylactic programs , though they were not advised on glaucoma screening . in the doctor 's group , one of the doctors interviewed the majority of patients , while the remaining two interviewed a dozen or so patients each . in the nurse 's group , two nurse practitioners carried out the consultations , one of whom counseled twice as many patients as the other . during operationalization phase we established that the efficacy of doctors and nurses interventions will be measured by means of patients declarations obtained by telephone interview . the interviews with all study participants were carried out three months after their first visit in the primary care center by the same primary care nurses who performed counseling procedures and included a standard question as follows : have you attended glaucoma screening examination during the last 3 months which constitute the period of time that passed from your visit 3 months ago in our primary care center ? designatum of the efficacy of the interventions was the number of yes answers . interview question was dichotomous and the question considered behaviours ; therefore we assumed that the measurement is accurate . all study participants were successfully contacted and interviewed . to assess the significance of differences between quantitative values , we used anova for variables with normal distribution and for other variables we used mann - whitney u test ( to compare two groups ) and kruskal - wallis test ( to compare three groups ) . medcalc statistical software ( version 12.7.7 , medcalc software bvba , ostend , belgium ) was used for statistical analyses . we enrolled 308 persons eligible for glaucoma screening who were mostly urban dwellers aged 3587 years with average age of about 48 , mostly with higher education and married . there were no statistically significant differences in demographic characteristics between the compared study groups ( table 1 ) . the percentage of persons in the nurse 's group who declared entering a glaucoma screening program within three months from intervention was more than four times higher than in the control group ( table 2 ) and in this intervention group it reached about one - fifth of persons who were eligible for glaucoma screening . doctor 's consultations resulted in an almost tripled increase in screening rate as compared to controls , but the difference did not reach statistical significance . secondary analyses concerning relationship of socioeconomic factors with screening adherence did not reveal any statistically significant differences between persons who declared being up to date with screening and those who did not ( table 3 ) . presented data demonstrated the effectiveness of encouragement from pc nurses ; however , we can not unequivocally conclude on the effectiveness of doctor 's consultation , although it was related to an almost three times higher declared screening rate than in controls . lack of statistical significance of this apparent difference could have resulted from insufficient statistical power calculated on the assumption that the screening rate in the control group would be comparable to the very low screening rate observed in the general polish population ( oscillating around 3% ) , which was assessed using popular press data and personal observations in the inability to obtain information from other sources . also , by taking the history of screening status in the control group , as well as by applying the procedure of an informed consent , we might have played some educational role that might have raised the screening rate above the expected level and contributed to the slightly underpowered constitution of the study . we must also remark that the effects of our interventions were measured as declared screening status , and this subjective type of measurement is a potential source of bias most probably producing somewhat exaggerated screening rates . as a potential source of bias , randomization procedure used in our study had some shortcomings due to organizational reasons described earlier ; nevertheless it produced fairly equivalent study groups . other potentially significant sources of bias within our study method were overall precision of the used measurement tools ( questionnaires ) ; problems with the assessment of reliability and validity of our results related to the lack of identified studies concerning the effectiveness of encouragement to participate in glaucoma screening in primary care setting , especially the assessment of external validity strongly associated with restrictions of sampling ; the choice of professionals who performed interventions and conducted the study along with their communicativeness and engagement ( the influence of professionals and investigators ) . in our study , the percentage of individuals who declared positive screening status in intervention groups was substantially lower than that reported in another glaucoma epidemiology study in one of the largest polish cities . authors reported that 6,000 invitations addressed to the target population resulted in 4,353 persons who entered the screening ( 80.8% ) ; however , detailed description of recruitment procedures was not provided . this is the only paper with data on glaucoma screening recruitment in poland that we have identified . the one - on - one education strategy used in our study has also been demonstrated to be effective in numerous studies on recruitment for other screening schemes . the magnitude of increases in screening rates was comparable with our trial when controls were characterized with screening rates oscillating around 5% . intervention procedures in the study were designed with respect to conditions and limitations of pc environment so that interventions passing effectiveness test could be used in routine practice . to discuss cost - effectiveness of nurses and doctors interventions we needed to consider labor costs and interventions efficacy measured as the number of patients who decided to undergo screening in specialist centers in comparison to controls . according to the data from the study setting , the cost of a 5-minute doctor counseling is comparable to the cost of a 10-minute counseling provided by a nurse . consistent with our knowledge , this proportion may be common in other primary care centers in poland . assuming superior efficacy of nurses intervention versus doctors intervention as compared to controls and their comparable cost , one may put hypothesis that the cost - effectiveness of the first kind of intervention is higher ; however , there is insufficient data from the study to reach a conclusion and further research is required in this field . to provide discussion in a wider context of cost - effectiveness of glaucoma management , including quality - adjusted life year cost analysis , more data would be required , especially concerning the effectiveness and cost of glaucoma screening procedures , as well as glaucoma treatment in specific settings ; nevertheless , this study may provide useful input for further analyses . in the studied population of urban primary care patients , one - on - one counseling provided by primary care nurses proved to be an efficacious method of encouragement to glaucoma screening . it seems to be also more cost - effective than that provided by doctors when the observed efficacy , time consumption , and labor costs of both types of interventions are considered .	introduction . an effective screening that can prevent glaucoma - related blindness largely depends on successful recruitment . this study was to assess the effectiveness of one - on - one counseling carried out by primary care doctors and nurses to increase glaucoma screening rates . material and methods . the study , carried out in an urban primary care center , involved 308 persons aged 3587 years who were assigned to a doctor 's , nurse 's , or control group ( n = 109 , 110 , and 89 , resp . ) . interventions by doctors and nurses included a brief one - on - one counseling session , while only a screening history was taken from controls . the number of people in each group with a positive screening status was assessed by telephone interview three months after the visit . results . the percentage of persons in the nurse 's counseling group who claimed being subjected to screening was more than four times higher than in the control group ( 20.9% versus 4.5% , p = 0.002 ) . the doctor 's interventions resulted in almost a tripled screening rate as compared to the control group ( 12.8% versus 4.5% , p = 0.052 ) . there was no significant difference between screening rates in doctor 's and nurse 's groups ( p = 0.212 ) . conclusions . in the studied population , counseling provided by nurses proved to be an efficacious method to encourage patients to undergo glaucoma screening .
You are an expert at summarizing long articles. Proceed to summarize the following text: a number of surgical options are available for treating medial unicompartmental osteoarthritis ( oa ) of the knee , such as high tibial osteotomy ( hto ) , unicompartmental knee arthroplasty , and total knee arthroplasty . however , the activities of patients after arthroplasty may be limited and revision surgery is invariably required after 10 or 20 years . accordingly , valgus hto is becoming more popular for relatively active young patients with medial unicompartmental oa and varus deformity1234567 ) . opening wedge technique is becoming more popular because it has some advantages over closing wedge osteotomy . it has been shown that adequate stable fixation is mandatory for safe healing of the osteotomy to minimize the risk of nonunion and loss of correction after medial opening wedge hto8 ) . some special implants have been developed in an attempt to make medial opening wedge hto procedure stable . , naples , fl , usa ) is the most widely used fixation device for the medial opening hto . however , several studies have reported higher complication rates of nonunion , fixation failure , and correction loss , due to unstable fixation in medial opening hto using the puddu plate910 ) . hence , internal fixators such as tomofix plate ( synthes , oberdorf , switzerland ) and aescular plate ( b. braun korea , seoul , korea ) were developed to achieve optimal stability and maintain the attained correction . stoffel et al.11 ) suggested that the tomofix plate would provide superior stability under both compression and torsion compared to the puddu plate in a situation where the lateral cortex is damaged . jung et al.8 ) insisted that loss of correction after opening - wedge hto using the aescular plate was significant compared with the tomofix plate . this study was undertaken to compare the mechanical stability of the three fixation plate systems for opening wedge hto based on the mechanical test results obtained using a porcine tibia model . our hypothesis was that the aescular plate would show no difference compared to other fixation plate systems with respect to mechanical stability . fifty - four tibias from 1-year - old domestic pigs weighting 90 - 100 kg were used . specimens were stored at -70 until required and thawed at room temperature for 24 hrs before experiments . the soft tissues were completely removed , but fibular and tibiofibular joints ( anterior , posterior tibiofibular ligament and interosseous membrane ) were spared . a medial opening wedge osteotomy was performed at 20 mm below the tibial plateau targeting the tibiofibular joint using an oscillating saw . the osteotomy was opened carefully using a small osteotome and an osteotomy wedge was formed gradually so as not to break the lateral cortex of the tibia . after 10 mm opening of the osteotomy site , fixation was carried out on the osteotomy site using either aescular plate ( b. braun korea ) , a puddu plate ( arthrex inc . ) , or a tomofix plate ( synthes ) without a bone graft . in the aescular group , two plate sizes were used , that is , the anterior plate was smaller than the posterior plate to prevent subsequent increases in posterior slope . two 6.5 mm cancellous screws were used for each plate fixation . in the puddu group , two 6.5 mm cannulated screws were used for proximal fixation and two 4.5 mm cortical screws for distal fixation . in the tomofix group , three 4.5 mm locking screws were used for proximal fixation and four 4.5 mm locking screws for distal fixation . the ends of both plates were then molded with bone cement for mechanical testing ( fig . this process was performed using a jig that aligned the long axis of the tibia with the axis of the instron 5569 series unit ( instron , norwood , ma , usa ) ( fig . six of the original 54 specimens were excluded due to lateral cortical breakage during osteotomy or the opening procedure . thus , 48 fresh - frozen specimens were assigned to the three study groups , that is , aescualr group ( 16 specimens ) fixed with aescular plates ; puddu group ( 16 specimens ) with a puddu plate , and tomofix group ( 16 specimens ) with a tomofix plate . axial compression load testing and compression - extension cyclic load testing were both conducted on 8 tibias per group . initially , a preload of 50 n was applied for 3 minutes before axial compression . the width of the ventral and dorsal parts of the osteotomy space was measured by micrometer ( tolerance 0.1 mm ) during this time interval . the point for measurement was marked with a water proof fine liner on the ventral and dorsal tibial edges . axial compression load testing involved a gradual axial compression load test and a maximal compression axial load test . axial displacement was measured by increasing the axial compression force in steps from 200 to 2,000 n ( 200 , 500 , 1,000 , and 2,000 n)12 ) . specimens were then loaded to failure to determine maximal failure loads ; testing was stopped when loads fell by 30% of maximum loads ( fig . the testing machine was operated at a constant speed of 20 mm / min for all tests . compression - extension cyclic load testing involved the cyclic application of compressive force and an extension force from 0 to 2,000 n. extension means distraction of proximal tibia . loading was applied to the tibial shaft for 100 cycles at 1 hz , and the loading condition was from 0 to 2,000 n13 ) . extension length ( mm ) and strain ( % ) were recorded during the last complete test cycle . extension length was recorded as the difference of length between the initial cycle and the last cycle . so , strain was calculated as the extension length divided by the initial length . a compressive load of 2,000 n corresponds to the load exerted on the knee by a person weighing 70 kg during normal walking . analysis of variance was used to compare the three groups with respect to displacement and loads under compression and cyclic loads . spss ver . 17.0 ( spss inc . , chicago , il , usa ) was used to compare results , and statistical significance was accepted for p - values of < 0.05 . fifty - four tibias from 1-year - old domestic pigs weighting 90 - 100 kg were used . specimens were stored at -70 until required and thawed at room temperature for 24 hrs before experiments . the soft tissues were completely removed , but fibular and tibiofibular joints ( anterior , posterior tibiofibular ligament and interosseous membrane ) were spared . a medial opening wedge osteotomy was performed at 20 mm below the tibial plateau targeting the tibiofibular joint using an oscillating saw . the osteotomy was opened carefully using a small osteotome and an osteotomy wedge was formed gradually so as not to break the lateral cortex of the tibia . after 10 mm opening of the osteotomy site , fixation was carried out on the osteotomy site using either aescular plate ( b. braun korea ) , a puddu plate ( arthrex inc . ) , or a tomofix plate ( synthes ) without a bone graft . in the aescular group , two plate sizes were used , that is , the anterior plate was smaller than the posterior plate to prevent subsequent increases in posterior slope . two 6.5 mm cancellous screws were used for each plate fixation . in the puddu group , two 6.5 mm cannulated screws were used for proximal fixation and two 4.5 mm cortical screws for distal fixation . in the tomofix group , three 4.5 mm locking screws were used for proximal fixation and four 4.5 mm locking screws for distal fixation . the ends of both plates were then molded with bone cement for mechanical testing ( fig . this process was performed using a jig that aligned the long axis of the tibia with the axis of the instron 5569 series unit ( instron , norwood , ma , usa ) ( fig . six of the original 54 specimens were excluded due to lateral cortical breakage during osteotomy or the opening procedure . thus , 48 fresh - frozen specimens were assigned to the three study groups , that is , aescualr group ( 16 specimens ) fixed with aescular plates ; puddu group ( 16 specimens ) with a puddu plate , and tomofix group ( 16 specimens ) with a tomofix plate . axial compression load testing and compression - extension cyclic load testing were both conducted on 8 tibias per group . initially , a preload of 50 n was applied for 3 minutes before axial compression . the width of the ventral and dorsal parts of the osteotomy space was measured by micrometer ( tolerance 0.1 mm ) during this time interval . the point for measurement was marked with a water proof fine liner on the ventral and dorsal tibial edges . axial compression load testing involved a gradual axial compression load test and a maximal compression axial load test . axial displacement was measured by increasing the axial compression force in steps from 200 to 2,000 n ( 200 , 500 , 1,000 , and 2,000 n)12 ) . specimens were then loaded to failure to determine maximal failure loads ; testing was stopped when loads fell by 30% of maximum loads ( fig . the testing machine was operated at a constant speed of 20 mm / min for all tests . compression - extension cyclic load testing involved the cyclic application of compressive force and an extension force from 0 to 2,000 n. extension means distraction of proximal tibia . loading was applied to the tibial shaft for 100 cycles at 1 hz , and the loading condition was from 0 to 2,000 n13 ) . extension length ( mm ) and strain ( % ) were recorded during the last complete test cycle . extension length was recorded as the difference of length between the initial cycle and the last cycle . so , strain was calculated as the extension length divided by the initial length . a compressive load of 2,000 n corresponds to the load exerted on the knee by a person weighing 70 kg during normal walking . analysis of variance was used to compare the three groups with respect to displacement and loads under compression and cyclic loads . spss ver . 17.0 ( spss inc . , chicago , il , usa ) was used to compare results , and statistical significance was accepted for p - values of < 0.05 . as axial compressive load was gradually applied , plate displacements increased in all three groups . in the aescular group , the osteotomy model showed a mean displacement of 0.270.16 mm at 200 n , but this increased to 2.701.38 mm at 2,000 n. in the puddu group , the osteotomy model showed a mean displacement of 0.170.14 mm at 200 n , which increased to 2.081.16 mm at 2,000 n. the tomofix group showed a displacement of 0.150.09 mm at 200 n and 1.811.06 mm at 2,000 n. all three groups showed similar increases in displacement with the increase of axial compressive loads ( table 1 ) , but no significant intergroup difference in mean values was observed under different amount of loading conditions ( p>0.05 ) . the maximum load at the time of failure was 6,055.11,184.7 n in the aescular group , 6,798.2998.7 n in the puddu group , and 6,973.8499.7 n in the tomofix group . at the time of failure , the aescular , pudda , and tomofix groups showed a displacement of 7.542.32 mm , 7.312.05 mm , and 6.413.31 mm , respectively ( fig . however , no significant difference was found in the mean maximal loads or displacements at the time of failure among three groups ( p=0.41 , p=0.41 ) . in the aescular , puddu , and tomofix groups , the mean extension under cyclic loading test was 2.910.39 mm , 2.560.38 mm , and 2.020.27 mm , respectively , and corresponding mean strain ( % ) was 9.201.23 , 8.081.20 , and 6.380.86 , respectively ( table 2 ) . the mean extension and strain were slightly smaller in the tomofix group than the other two groups . however , no significant differences were observed among groups in terms of extension ( p=0.21 ) and strain ( p=0.43 ) as axial compressive load was gradually applied , plate displacements increased in all three groups . in the aescular group , the osteotomy model showed a mean displacement of 0.270.16 mm at 200 n , but this increased to 2.701.38 mm at 2,000 n. in the puddu group , the osteotomy model showed a mean displacement of 0.170.14 mm at 200 n , which increased to 2.081.16 mm at 2,000 n. the tomofix group showed a displacement of 0.150.09 mm at 200 n and 1.811.06 mm at 2,000 n. all three groups showed similar increases in displacement with the increase of axial compressive loads ( table 1 ) , but no significant intergroup difference in mean values was observed under different amount of loading conditions ( p>0.05 ) . the maximum load at the time of failure was 6,055.11,184.7 n in the aescular group , 6,798.2998.7 n in the puddu group , and 6,973.8499.7 n in the tomofix group . at the time of failure , the aescular , pudda , and tomofix groups showed a displacement of 7.542.32 mm , 7.312.05 mm , and 6.413.31 mm , respectively ( fig . however , no significant difference was found in the mean maximal loads or displacements at the time of failure among three groups ( p=0.41 , p=0.41 ) . in the aescular , puddu , and tomofix groups , the mean extension under cyclic loading test was 2.910.39 mm , 2.560.38 mm , and 2.020.27 mm , respectively , and corresponding mean strain ( % ) was 9.201.23 , 8.081.20 , and 6.380.86 , respectively ( table 2 ) . the mean extension and strain were slightly smaller in the tomofix group than the other two groups . however , no significant differences were observed among groups in terms of extension ( p=0.21 ) and strain ( p=0.43 ) opening wedge osteotomy has higher complication rates than closing wedge osteotomy with respect to fixation failure , loss of correction , nonunion , and delayed union1014 ) . in particular , the rate of nonunion has been reported to be higher for opening wedge hto than closing wedge hto , ranging between 10% and 35% . furthermore , after medial opening wedge osteotomy , the gap created in the proximal tibia facilitates instability and loss of correction , the latter of which is mainly caused by a lack of primary stability15 ) . al.16 ) reported a 5.4% nonunion rate ( 10 of 182 patients ) for medial opening wedge hto , and concluded that lateral cortex preservation and secure fixation were most important in terms of preventing complications after opening wedge hto . in another study , inadequate fixation stability of opening wedge plates was found to be a reason for opening wedge hto failure17 ) . of the implants specifically designed for medial opening wedge hto this plate is fixed to the medial side of the tibial plateau , and a spacer is inserted into the osteotomy gap , thus preventing gap closure . however , some authors have reported high failure rates of this implant and technique in hto due to unstable fixation1118 ) . for these reasons , a new implant with a long , rigid titanium plate ( tomofix ) with the curvature of the medial tibial metaphysis was designed for opening wedge hto . stoffel et al.11 ) examined the construct stiffness and fixation strengths of the puddu and tomofix plates , and found that both were able to maintain correction at a load of more than 2,500 n , which concurs with our results . this finding suggests that both plates can provide sufficient stability to maintain an axial compressive load in the knee of an adult in a single limb stance or during walking19 ) . however , tomofix plates were found to provide better stability in both compression and torsion than puddu plates when the lateral cortex was fractured . in the present study , mean displacements of 2.08 and 2.13 mm were observed for puddu and tomofix plates , respectively , at a compressive load of 2,000 n , indicating no significant difference between the plates . however , tomofix plates showed better stability during cyclic load testing ( 2.5 mm vs. 2.0 mm displacement for puddu and tomofix plates , respectively ) . although tomofix plates provide sufficient initial stability after opening wedge osteotomy , they are too large if a small incision is required and the posterior tibial slope is not easily controlled . to resolve these problems , an opening wedge plate system consisting of two plates ( aescular plate ; b. braun korea ) was developed . this system consists of anterior and posterior plates ; the posterior plate is placed as posteriorly as possible at the corner of the proximal tibia , and the anterior plate is placed behind the tibial tuberosity . thus , surgeons can control the tibial slope and prevent an unintended increase in posterior tibial slope . however , the fixation stability of this fixation device has not been fully established . in this study , primary fixation stability of this plate the amount of displacement of the aescular plate during axial compression load testing was not significantly different from the other two plates . 6,973.8499.8 n for the aescular , puddu , and tomofix plates , respectively , which were also not significantly different . all three plates were able to maintain correction at loads of greater than 2,500 n , which approximates to the axial compression load in the knee of an adult during walking19 ) . during cyclic load testing using 100 cycles of a 2,000 n compressive force , the mean displacement of the aescular system was comparable to that of the puddu system ( 2.91 mm vs. 2.56 mm ) . however , the tomofix system exhibited greater stability ( 2.02 mm ) than the aescular and puddu systems , although the intergroup differences in the mean displacement were not significant and less than 1 mm during the cyclic load test . these results showed that the primary stability of three systems were similar each other under cyclic loading . first of all , we fully acknowledge that the porcine bone could have different mechanical properties to a human bone even though we performed a bone quality test using quantitative computed tomography . second , the osteotomy site of hto is broad ; therefore , there can be a little difference of displacement in the medial and lateral osteotomy sites . we are aware that we did not consider the difference of displacement in the medial and lateral osteotomy sites so that the result of difference in medial and lateral side displacement was not taken into consideration . third , the study was aimed at evaluating the stability of the plates during walking ; however , we used instron instead of the femur for the upper loading , and were unable to accurately simulate the walking condition . forth , this study only dealt with an axial load without any other load components . based on the comparison of stability of three types of fixation plate systems , the aescular , puddu , and tomofix plate systems were found to provide fixation sufficient stability to bear axial compression and cyclic loads during walking .	purposethe purpose of this study was to compare the mechanical stability of three types of plate systems for opening wedge high tibial osteotomy.materials and methodsforty - eight fresh frozen porcine tibia specimens were assigned to three different fixation device groups : aescular group ( 16 specimens ) was fixed with aescular plates ; puddu group ( 16 specimens ) with a puddu plate , and tomofix group ( 16 specimens ) with a tomofix plate . we compared axial displacements under compression loads from 200 to 2,000 n and maximal loads at failure among 8 specimens per group . we also compared displacements under cyclic load after 100 cycles at a compressive load of 2,000 n among 8 specimens per group.resultsin all three groups , displacement under compression load increased with the increase in the axial compressive load ; however , no significant intergroup differences were observed in the mean values under tested loading conditions . the mean maximal loads at failure were not significantly different ( 6,055 , 6,798 , and 6,973 n in the aescular , puddu , and tomofix groups , respectively ; p=0.41 ) . while the tomofix group showed less extension and strain during the cyclic load test , the mean values showed no significant differences among groups.conclusionsall three plate systems were found to provide fixation stability suitable for bearing axial compression and cyclic loads while walking .
You are an expert at summarizing long articles. Proceed to summarize the following text: the open surgical placement of a gastrostomy tube in children may cause significant complications , such as wound infection , leakage , and excessive granulation tissue . the use of a percutaneous gastrostomy tube ( peg ) obviates the need for a laparotomy [ 1 , 2 ] . the technique is associated with the same complications , along with the risk of inadvertent bowel injury due to a blind puncture through the abdominal cavity [ 35 ] . to avoid the complications associated with the peg technique , laparoscopic - assisted gastrostomy has been used at our centre since 1994 , avoiding the risk of bowel injuries [ 612 ] . this study aims to use a literature review to compare the frequency of serious gastrointestinal complications after laparoscopic versus percutaneous endoscopic gastrostomy ( peg ) in a pediatric population . the specific question that our study intends to answer is : does the laparoscopic procedure significantly reduce the rate of gastrointestinal complications of fistula that necessitated operation compared with peg ? we are not aware that any literature review of gastrostomy complications in a pediatric population has been performed previously to answer that question . a systematic review of articles published in the english and swedish languages between 1995 through november 2009 was performed by searching the following electronic databases : pub med , web of science and cochrane library . randomized controlled trials , case series reports , clinical trials , practice guidelines , meta - analysis , reviews and editorials were searched for . the detailed search strategy included the terms : gastrostomy , percutaneous endoscopic gastrostomy , laparoscopic gastrostomy , video - assisted gastrostomy , gastrointestinal complications , gastrocolic fistula , gastroenteric fistula , ages : all child : 018 years . data for the following outcomes were extracted and included in the literature review of the study . surgery - related mortality and morbidity including : intra - abdominal bleeding , bowel injury , wound infection causing sepsis , and intra - abdominal infection . surgery - related morbidity noted after discharge from the hospital correlated to the fact that the child had been operated on and correlated to the child 's general condition , including prolonged hospital stay and readmission reviewed by a doctor ; complications and morbidity correlated to the fact that the child had got a foreign body through their abdominal wall into the stomach , not depending on the type of gastric tube or the method used for the operation , including pain , nausea , vomiting , granuloma , leakage , infection demanding the use of antibiotics . for statistical calculation 822 case series reports publications on gastrostomy in children were identified ; 54 filled the criteria of the study and were included . the results are summarized in table 1 disclosing that unintentional damage to the colon or small bowel is reported after 1.27% of the peg operations only , and this is caused by the blind puncture through the abdominal cavity . this study has investigated the possible benefits of vag over peg in a pediatric population , where reduced postoperative complications are particularly desirable . the results of this literature review of 54 studies , retrospective and prospective , suggest that postoperative gastrointestinal complications are statistically significantly reduced or nonexistent in children undergoing vag compared with peg . this is in accordance with the previous studies reporting a 2%-3% frequency of gastrointestinal fistulas when using the peg method in children [ 2 , 13 ] . the results suggest that gastrointestinal postoperative complications are more likely to be fewer with the use of vag than with peg . we have no reason to believe that the frequency of a postoperative wound infections or postoperative intestinal obstruction due to adhesions differs between these two groups . reviewing the literature we found a total of 4331 subjects , of which 3304 ( 76% ) underwent peg and 1027 ( 24% ) underwent vag . a sample group this size would otherwise be impossible to accumulate in a reasonable length of time in a randomized control trial . these findings should , however , be treated with caution because of the lack of randomized comparative trials of peg versus vag in the pediatric population available for use in the meta - analysis . a literature review can be used to evaluate the literature in both qualitative and quantitative ways by comparing and integrating the results of different studies , accounting for variations in characteristics that can influence the overall estimate of outcomes of interest . it is important , however , to address the limitations of the literature review , which were as follows : first : different studies may have had slightly different defining criteria for the outcome measures we were interested in . this would not apply to the complications in need of operative interventions which were relatively homogeneously reported throughout the studies . in this paper , every attempt is made to select outcome measures that are as absolute as possible , such as the gastrointestinal complications registered here , in order to reduce heterogeneity . second : neither the allocation of treatment , that is , type of operation , nor the assessment of outcome was blinded . this paper is based on clinical reports from centers using only one of the methods studied . a meta - analysis of randomized controlled trials would have been preferred for answering the question posed here , but these are still missing . third : it is important to bear in mind nonpublication bias , particularly in a review based on published studies . the studied material is , moreover , biased by the fact that some of the authors do not report their results . thus we have probably missed a considerable number of operated on children as well as several complications that have not been reported . fourth : there was variation in inclusion criteria , study type , type of randomization , treatment protocols , and outcome assessment between studies . finally : although the studies included in this paper reported results on a paediatric population , there were patient groups who represented a population that was in the wide paediatric age range from newborns to 18 years old . apart from these limitations , we think that an important link has been identified between vag and a reduction in gastrointestinal complications compared with peg in a pediatric population . in addition to helping to answer the question of whether vag reduces gastrointestinal complications compared with the peg procedure , this study raises several important issues regarding the factors that need to be taken into account when comparing the two surgical techniques . this could become evident in a sensitivity analysis , which may show the level of heterogeneity to be the lowest with studies that are of randomized design , followed by prospective studies . to further reduce heterogeneity , studies must be of an adequate size , and older publications may increase heterogeneity because surgical technique , degree of proficiency , and types of instrumentation can all change significantly over a period of 15 years . it is important to note that there are more factors that should be matched when comparing peg and vag groups . we did not register concomitant diseases , whether the children are operated on at a pediatric surgical centre or in a general surgical unit , with or without university affiliation . some of the major advantages of vag are the siting of the gastrostomy to allow for later fundoplication , which is necessary in up to 20% of patients , without takedown of the previously placed gastrostomy . furthermore , primary placement of a balloon button , instead of the hard peg disc , is preferred since the removal of the peg disc usually requires an anesthetic in small children whereas changing a balloon button is simple and can be done in an office setting without analgesics or sedation . another advantage is that one does not have to bring more equipment into the room for the peg gastrostomy after laparoscopic fundoplication . although this study adds weight to the argument that video - assisted or laparoscopic gastrostomy results in fewer preoperative gastrointestinal complications when compared with the percutaneous endoscopic gastrostomy , it is important to appreciate that it does not attempt to evaluate the different minimally invasive surgical techniques . the analysis further highlights the need for high - quality randomized trials , comparing peg to vag in pediatric patient groups matched not only for age and sex , but also for weight and concomitant diseases . finally , results such as those produced by our study may lead to more accurate informed parental consent when explaining the risks of peg versus vag in children . this paper presents a subject that is very relevant to pediatric surgeons because it addresses one of the most commonly done procedures in daily practice . however , this is a raw data analysis of a very heterogeneous group of papers with a very uneven numbers of patients in each group . the analyzed papers were not stratified as to their purpose , as to who did the procedures ( surgeons , gastroenterologists , radiologists , others ) and their level of experience , what special anatomical problems the different patients had ( previous operations , scoliosis , or very young age ) , for indications for the gastrostomy as well as other factors . it is quite logical that , during a laparoscopic procedure , where the surgeon is looking at the stomach , injury to the bowel is unlikely . not included in the discussion are the complications associated with the laparoscopic interventions , as well as their cost . in future work emphasis should be on the problems encountered with each one of the techniques and how to best avoid them .	objective . this study compares laparoscopic and percutaneous endoscopic gastrostomy ( peg ) in a paediatric population to test the hypothesis that there is a difference in the frequency of serious gastrointestinal complications between the two methods . methods . all reports published between 1995 and 2009 on laparoscopic gastrostomy and peg in children was included . prospective and retrospective trials , comparing the two methods or dealing with one of them only were included . endpoints were accidentally performed gastrointestinal fistula causing an emergency re - operation . the frequency of inadvertent gastroenteric fistulas using the two different techniques was calculated . results . 822 publications were found when using the search terms : gastrostomy , gastrointestinal complications , and all child : 018 years . from these , 54 studies were extracted for this investigation . these studies reported a total of 4331 children undergoing gastrostomy operation , 1027 by using the laparoscopic technique and 3304 using the peg technique . the number of serious gastrointestinal fistulas to colon or small bowel was 0% and .27% , respectively , p < .05 . conclusions . the results suggest that by performing laparoscopic gastrostomy in children it is possible to avoid the serious intestinal fistula complications caused by a blind puncture through the abdominal cavity when performing the peg .
You are an expert at summarizing long articles. Proceed to summarize the following text: subjects aged 3075 years previously participating in the sixth troms study were invited to participate . the troms study is an ongoing longitudinal population - based study first performed in 1974 ( 23 ) . the sixth survey was performed in 2008 and the following groups were invited : those who participated in the second phase of the fourth survey ( 19941995 ) , a random 10% sample of subjects aged 3039 years , all subjects aged 4042 and 6087 years , and a 40% random sample of subjects aged 4359 years . in total , 19,762 subjects were invited and 12,984 subjects ( 65.7% ) attended ( 23 ) . serum 25(oh)d measurements were performed in all the participants , and people with serum 25(oh)d between the 5th and 10th percentiles ( low serum 25[oh]d ; case subjects ) or between the 80th and 95th percentiles ( high serum 25[oh]d ; control subjects ) were invited to the current study by mail . those who reported to be current smokers were not invited owing to a newly discovered interference between smoking and the assay used for serum 25(oh)d analyses in the sixth troms study ( 24 ) . a person not involved in the examinations administered the invitations to achieve a fairly equal distribution among case and control subjects regarding sex , age , and bmi . exclusion criteria were diabetes , acute myocardial infarction or stroke during the past 12 months , cancer during the past 5 years , steroid use , serum creatinine 130 mol / l ( males ) or 110 mol / l ( females ) , possible primary hyperparathyroidism ( plasma parathyroid hormone [ pth ] > 5.0 pmol / l combined with serum calcium > 2.50 mmol / l ) , sarcoidosis , systolic blood pressure > 175 mmhg or diastolic blood pressure > 105 mmhg , and specifically for women , pregnancy , lactation , or fertile age and no contraception use . participants were recruited between november 2008 and april 2010 . because there was a considerable time span between the first serum 25(oh)d measurement in the troms study and inclusion in the current study , a low or high serum 25(oh)d in the troms study had to be confirmed in a new serum sample before inclusion . the study consisted of a nested case - control study , comparing participants with low and high serum 25(oh)d levels , and a randomized controlled trial ( rct ) , comparing 6 months of supplementation with high dose vitamin d3 versus placebo in the participants with low serum 25(oh)d levels . those who had accepted the study invitation attended a screening examination where medical history , blood pressure , and blood samples for pth , calcium , creatinine , hba1c , and 25(oh)d were obtained . subjects with serum hba1c > 6.1% underwent an oral glucose tolerance test and were not included if this test showed impaired fasting glucose or reduced glucose tolerance ( fasting plasma glucose > 6.0 subsequent eligible participants came fasting to a baseline visit at the research unit , university hospital of north norway , where fasting blood samples for serum lipids were drawn and a standard hyperglycemic clamp performed to study insulin secretion and sensitivity ( 15,25 ) . after the baseline clamp was finished , a sealed envelope ( prepared for each participant by people not performing the examinations ) was opened , revealing whether the participant was a case subject ( low serum 25[oh]d ) or a control subject ( high serum 25[oh]d ) . thus , neither the participants nor the staff knew the vitamin d status when the clamp was performed . if the participant was a control subject , involvement in the study the case subjects were immediately randomized to either one capsule of vitamin d3 20,000 iu ( dekristol ; mibe , brehna , germany ) or identical - looking placebo capsules to be taken twice per week . the randomization was performed by the central randomization unit at the university hospital of north norway , using block randomization with various block sizes . the randomization numbers with treatment allocations were given directly to the hospital pharmacy who prepared the medication boxes , which were delivered to the study nurse at baseline for each participant . thus , the study was a randomized , double - blind , controlled trial where neither the participants , the staff performing the examinations , nor the researchers knew the randomization status of the participants during the study . a study nurse contacted the participants by phone after 1 and 3 months to ensure that the study medication was taken correctly and to register adverse events . after 6 months , participants came to the final examination where a new hyperglycemic clamp was performed . the participants received a gift card valued at $ 90 for the baseline as well as the 6-month visits . physical activity was self - reported in the troms study by indicating usual level of leisure activity in the past year using one of four response categories : level 1 , reading , watching television , or engaging in sedentary activities ; level 2 , at least 4 h a week walking , bicycling , or engaging in other types of physical activity ; level 3 , at least 4 h a week exercising to keep fit and participating in recreational athletics ; and level 4 , regular , vigorous training or participating in competitive sports several times a week . this physical activity assessment method has been observed to reflect heart rate , fitness , and metabolic profile , as well as objectively measured activity by accelerometer ( 26 ) . fat fish intake was self - reported in the troms study using the following alternatives : 1 ) 01 times per month ; 2 ) 23 times per month ; 3 ) 13 times per week ; 4 ) 46 times per week ; and 5 ) 12 times per day . because of the small number of participants in the two highest frequency groups ( three case subjects and four control subjects ) , groups 35 were assessed together in the analyses . at screening , the participants reported intake of cod liver oil or other vitamin d supplements , any sun bed use during the past year , and sunny holiday during the past 3 months . troms study participants also reported number of glasses of milk ( any kind ) per day , sandwiches with cheese ( any kind ) per day , and servings of yogurt ( 125 ml ) per week . thus , we calculated the number of dairy product servings per week as a crude measure of calcium intake . the participants voided before and after the clamp for measurement of urinary glucose loss . after a stabilization period of 30 min , a bolus dose of dextrose 200 mg blood was drawn from a cannulated dorsal vein on the opposite hand , where the blood was kept arterialized by keeping the hand in a heating device . every 5th min , venous plasma glucose was analyzed on a ysi life sciences glucose analyzer ( 2300 stat plus ; yellow springs , oh ) , and the infusion was accordingly adjusted to achieve a stable glucose level of 10 mmol / l . serum samples for insulin were drawn at 0 , 2.5 , 5 , 7.5 , 10 , 15 , 30 , 60 , 90 , 120 , 140 , 160 , and 180 min . first phase insulin release , reflecting the early insulin peak secreted from the pancreatic -cell in response to glucose stimulation , was calculated as the area under the curve ( auc ) during the first 10 min of the clamp by using the trapezium rule . second phase insulin release , reflecting -cell function under sustained elevated glucose levels , was calculated as auc during the last hour ( 120180 min ) . as a measure of glucose tolerance , glucose metabolized ( m ) the last hour of the clamp was calculated as m = inf uc sc , where inf is the glucose infusion rate , uc is the correction for urinary loss of glucose , and sc is the space correction ( mol min kg ) ( 28 ) . insulin sensitivity index ( isi ) was calculated by dividing the mean inf ( mol kg min ) during the last hour by the average serum insulin level during the same period ( pmol / l ) . to compare with other trials ( 29 ) , insulin resistance from homeostasis model assessment ( homa - ir ) was calculated as fasting serum insulin ( u / ml ) fasting plasma glucose ( mmol / l)/22.5 ( 30 ) . serum 25(oh)d was measured in the troms study and at screening using an electrochemiluminescence immunoassay ( modular e170 ; roche diagnostics , mannheim , germany ) ( 24 ) . this method was later withdrawn , and sera from the baseline and final visits , stored at 70c , were analyzed for serum 25(oh)d at the hormone laboratory , haukeland university hospital , using an in - house the intra - assay coefficient of variation ( cv ) was 1.72.6% for low , medium , and high levels of 25(oh)d . the other analyses were performed successively at the department of medical biochemistry , university hospital of north norway . serum calcium was analyzed by colorimetry using an automated clinical chemistry analyzer , serum creatinine was analyzed by an enzymatic colorimetric method ( crea plus , roche diagnostics ) , and serum phosphate was analyzed by photometric end point measurement . reference ranges were as follows : serum calcium 2.152.55 mmol / l , serum creatinine 5090 mol / l , and serum phosphate 0.761.41 mmol / l . serum ionized calcium was analyzed by ion selectivity ( abl 800 flex ; radiometer america inc . , serum insulin was measured by electrochemiluminescence immunoassay ( modular e170 , roche diagnostics ) , reference ranges of 18173 pmol / l , whereas high - sensitivity c - reactive protein ( hs - crp ) was measured by immunoturbidimetry ( modular p , roche diagnostics ) . plasma pth , serum glycated hemoglobin ( hba1c ) , total cholesterol , triglycerides ( tgs ) , ldl cholesterol , and hdl cholesterol were analyzed as previously described ( 22,24,27 ) . before each clamp , a quality control of the ysi glucose measurement was performed using two industrial made and two human standards . the producer recommended using a cv of 5% ; however , 89% of the controls were within a limit of cv 2% . the data were checked for normal distribution using visual inspection of histograms , and skewed variables were log transformed before statistical analyses when appropriate . for between - group comparisons of case and control subjects in the nested case - control study and for baseline values and -values ( 6 months minus baseline ) of the two treatment groups in the intervention study , student t test or tests were used . paired t tests were used to analyze changes from baseline to 6 months within each treatment group . to control for possible confounders , general linear models were used to compare case and control subjects at baseline . because use of statins affects serum lipid and crp levels , the analyses were also performed with the statin users excluded . to compare the effect of vitamin d and placebo on the outcome variables , we also used ancova models adjusting for the baseline value ( 31 ) , presenting the relative effect of vitamin d to the effect of placebo ( set to 1 as reference ) . the results from the intervention study were analyzed both as intention - to - treat analyses ( with last observation carried forward ) and per - protocol analyses . tests for interactions between treatment group and sex , above or below median of homa - ir , bmi , or dairy servings per week , were performed for the primary outcome variable isi . data are presented as mean sd for normally distributed variables and as median ( 5th to 95th percentiles ) for nonnormally distributed variables , unless otherwise indicated . all statistical analyses were performed using the statistical software package spss 16.0 ( spss inc . , chicago , il ) , and p < 0.05 was considered a significant finding . power calculation prior to the study was based upon a previous work , where isis in healthy control subjects were 0.19 0.10 mg kg min/u ml ( 0.15 0.08 mol kg min / pmol l ) ( 15 ) . the difference in isi between the upper and lower half of serum 25(oh)d was 0.12 mg kg min/u ml ( 0.10 mol kg min / pmol l ) . defining a difference of 0.10 mg kg min/u ml ( 0.08 mol kg min / pmol l ) as being of clinical relevance , 40 people in each group would be needed to have a power of 90% to detect such a difference with a significance level of 0.05 . to account for dropouts and nonsuccessful clamps , the inclusion of 100 case subjects and 50 control subjects was planned . the study was approved by the regional committee for medical research ethics and the norwegian medicines agency . the study consisted of a nested case - control study , comparing participants with low and high serum 25(oh)d levels , and a randomized controlled trial ( rct ) , comparing 6 months of supplementation with high dose vitamin d3 versus placebo in the participants with low serum 25(oh)d levels . those who had accepted the study invitation attended a screening examination where medical history , blood pressure , and blood samples for pth , calcium , creatinine , hba1c , and 25(oh)d were obtained . subjects with serum hba1c > 6.1% underwent an oral glucose tolerance test and were not included if this test showed impaired fasting glucose or reduced glucose tolerance ( fasting plasma glucose > 6.0 mmol / l and/or 2-h value > subsequent eligible participants came fasting to a baseline visit at the research unit , university hospital of north norway , where fasting blood samples for serum lipids were drawn and a standard hyperglycemic clamp performed to study insulin secretion and sensitivity ( 15,25 ) . after the baseline clamp was finished , a sealed envelope ( prepared for each participant by people not performing the examinations ) was opened , revealing whether the participant was a case subject ( low serum 25[oh]d ) or a control subject ( high serum 25[oh]d ) . thus , neither the participants nor the staff knew the vitamin d status when the clamp was performed . if the participant was a control subject , involvement in the study was now completed . the case subjects were immediately randomized to either one capsule of vitamin d3 20,000 iu ( dekristol ; mibe , brehna , germany ) or identical - looking placebo capsules to be taken twice per week . the randomization was performed by the central randomization unit at the university hospital of north norway , using block randomization with various block sizes . the randomization numbers with treatment allocations were given directly to the hospital pharmacy who prepared the medication boxes , which were delivered to the study nurse at baseline for each participant . thus , the study was a randomized , double - blind , controlled trial where neither the participants , the staff performing the examinations , nor the researchers knew the randomization status of the participants during the study . a study nurse contacted the participants by phone after 1 and 3 months to ensure that the study medication was taken correctly and to register adverse events . after 6 months , participants came to the final examination where a new hyperglycemic clamp was performed . the participants received a gift card valued at $ 90 for the baseline as well as the 6-month visits . physical activity was self - reported in the troms study by indicating usual level of leisure activity in the past year using one of four response categories : level 1 , reading , watching television , or engaging in sedentary activities ; level 2 , at least 4 h a week walking , bicycling , or engaging in other types of physical activity ; level 3 , at least 4 h a week exercising to keep fit and participating in recreational athletics ; and level 4 , regular , vigorous training or participating in competitive sports several times a week . this physical activity assessment method has been observed to reflect heart rate , fitness , and metabolic profile , as well as objectively measured activity by accelerometer ( 26 ) . fat fish intake was self - reported in the troms study using the following alternatives : 1 ) 01 times per month ; 2 ) 23 times per month ; 3 ) 13 times per week ; 4 ) 46 times per week ; and 5 ) 12 times per day . because of the small number of participants in the two highest frequency groups ( three case subjects and four control subjects ) , groups 35 were assessed together in the analyses . at screening , the participants reported intake of cod liver oil or other vitamin d supplements , any sun bed use during the past year , and sunny holiday during the past 3 months . troms study participants also reported number of glasses of milk ( any kind ) per day , sandwiches with cheese ( any kind ) per day , and servings of yogurt ( 125 ml ) per week . thus , we calculated the number of dairy product servings per week as a crude measure of calcium intake . the participants voided before and after the clamp for measurement of urinary glucose loss . after a stabilization period of 30 min , a bolus dose of dextrose 200 mg blood was drawn from a cannulated dorsal vein on the opposite hand , where the blood was kept arterialized by keeping the hand in a heating device . every 5th min , venous plasma glucose was analyzed on a ysi life sciences glucose analyzer ( 2300 stat plus ; yellow springs , oh ) , and the infusion was accordingly adjusted to achieve a stable glucose level of 10 serum samples for insulin were drawn at 0 , 2.5 , 5 , 7.5 , 10 , 15 , 30 , 60 , 90 , 120 , 140 , 160 , and 180 min . first phase insulin release , reflecting the early insulin peak secreted from the pancreatic -cell in response to glucose stimulation , was calculated as the area under the curve ( auc ) during the first 10 min of the clamp by using the trapezium rule . second phase insulin release , reflecting -cell function under sustained elevated glucose levels , was calculated as auc during the last hour ( 120180 min ) . as a measure of glucose tolerance , glucose metabolized ( m ) the last hour of the clamp was calculated as m = inf uc sc , where inf is the glucose infusion rate , uc is the correction for urinary loss of glucose , and sc is the space correction ( mol min kg ) ( 28 ) . insulin sensitivity index ( isi ) was calculated by dividing the mean inf ( mol kg min ) during the last hour by the average serum insulin level during the same period ( pmol / l ) . to compare with other trials ( 29 ) , insulin resistance from homeostasis model assessment ( homa - ir ) was calculated as fasting serum insulin ( u / ml ) fasting plasma glucose ( mmol / l)/22.5 ( 30 ) . serum 25(oh)d was measured in the troms study and at screening using an electrochemiluminescence immunoassay ( modular e170 ; roche diagnostics , mannheim , germany ) ( 24 ) . this method was later withdrawn , and sera from the baseline and final visits , stored at 70c , were analyzed for serum 25(oh)d at the hormone laboratory , haukeland university hospital , using an in - house developed liquid chromatography double mass spectrometry method ( 24 ) . the intra - assay coefficient of variation ( cv ) was 1.72.6% for low , medium , and high levels of 25(oh)d . the other analyses were performed successively at the department of medical biochemistry , university hospital of north norway . serum calcium was analyzed by colorimetry using an automated clinical chemistry analyzer , serum creatinine was analyzed by an enzymatic colorimetric method ( crea plus , roche diagnostics ) , and serum phosphate was analyzed by photometric end point measurement . serum calcium 2.152.55 mmol / l , serum creatinine 5090 mol / l , and serum phosphate 0.761.41 mmol / l . serum ionized calcium was analyzed by ion selectivity ( abl 800 flex ; radiometer america inc . , serum insulin was measured by electrochemiluminescence immunoassay ( modular e170 , roche diagnostics ) , reference ranges of 18173 pmol / l , whereas high - sensitivity c - reactive protein ( hs - crp ) was measured by immunoturbidimetry ( modular p , roche diagnostics ) . plasma pth , serum glycated hemoglobin ( hba1c ) , total cholesterol , triglycerides ( tgs ) , ldl cholesterol , and hdl cholesterol were analyzed as previously described ( 22,24,27 ) . before each clamp , a quality control of the ysi glucose measurement was performed using two industrial made and two human standards . the producer recommended using a cv of 5% ; however , 89% of the controls were within a limit of cv 2% . the data were checked for normal distribution using visual inspection of histograms , and skewed variables were log transformed before statistical analyses when appropriate . for between - group comparisons of case and control subjects in the nested case - control study and for baseline values and -values ( 6 months minus baseline ) of the two treatment groups in the intervention study , student t test or tests were used . paired t tests were used to analyze changes from baseline to 6 months within each treatment group . to control for possible confounders , general linear models were used to compare case and control subjects at baseline . because use of statins affects serum lipid and crp levels , the analyses were also performed with the statin users excluded . to compare the effect of vitamin d and placebo on the outcome variables , we also used ancova models adjusting for the baseline value ( 31 ) , presenting the relative effect of vitamin d to the effect of placebo ( set to 1 as reference ) . the results from the intervention study were analyzed both as intention - to - treat analyses ( with last observation carried forward ) and per - protocol analyses . tests for interactions between treatment group and sex , above or below median of homa - ir , bmi , or dairy servings per week , were performed for the primary outcome variable isi . data are presented as mean sd for normally distributed variables and as median ( 5th to 95th percentiles ) for nonnormally distributed variables , unless otherwise indicated . all statistical analyses were performed using the statistical software package spss 16.0 ( spss inc . , chicago , il ) , and p < 0.05 was considered a significant finding . power calculation prior to the study was based upon a previous work , where isis in healthy control subjects were 0.19 0.10 mg kg min/u ml ( 0.15 0.08 mol kg min / pmol l ) ( 15 ) . the difference in isi between the upper and lower half of serum 25(oh)d was 0.12 mg kg min/u ml ( 0.10 mol kg min / pmol l ) . defining a difference of 0.10 mg kg min/u ml ( 0.08 mol kg min / pmol l ) as being of clinical relevance , 40 people in each group would be needed to have a power of 90% to detect such a difference with a significance level of 0.05 . to account for dropouts and nonsuccessful clamps , the inclusion of 100 case subjects and 50 control subjects the study was approved by the regional committee for medical research ethics and the norwegian medicines agency . a total of 108 case subjects and 52 control subjects attended the baseline examination and a successful hyperglycemic clamp was performed in 104 and 50 participants , respectively ( fig . 1 ) . mean plasma glucose level the last hour of the clamp was 9.9 0.3 mmol / l , with no difference between case and control subjects ( p = 0.85 ) . figure 2 shows plasma glucose levels , infused glucose ( mg / kg / min ) , and serum insulin levels in the case and control subjects . results from a 3-h hyperglycemic clamp in 104 subjects with low serum 25(oh)d ( ) and 50 subjects with high serum 25(oh)d ( ) . a : mean ( 95% ci ) ln serum insulin . the serum 25(oh)d levels in the sixth troms study were 33.9 5.5 for case subjects and 77.6 4.9 nmol / l for control subjects , with corresponding baseline values 40.3 12.8 and 85.6 13.5 nmol / l ( table 1 ) . median time ( 5th to 95th percentiles ) between attendance date in the sixth troms study and baseline was 13 months ( 826 ) . as expected according to the inclusion procedure , there were no significant differences between case and control subjects at baseline regarding age , bmi , or sex . leisure - time physical activity level was significantly higher in control subjects , as were use of vitamin d supplementation , sun bed use , and sunny holidays during the past 3 months . serum pth , tgs , and hba1c were significantly higher in case subjects , while isi was lower ( table 1 and fig . these results were similar also when statin users were excluded ( data not shown ) . baseline characteristics in subjects with low serum 25(oh)d and subjects with high serum 25(oh)d unless otherwise stated , data are means comparisons between case and control subjects were performed with t tests for independent groups for continuous data and test for categorical data . first phase insulin release ( auc 010 min ) , second phase insulin release ( auc 120180 min ) , m , and isi from a 3-h hyperglycemic clamp comparing participants with low and high serum 25(oh)d at baseline , and at baseline and after completion in the rct . data are geometric means . a : subjects with low serum 25(oh)d ( n = 104 ) ( black bars ) and high serum 25(oh)d ( n = 50 ) ( white bars ) levels at baseline . b : subjects with low serum 25(oh)d ( n = 49 ) randomized to high dose vitamin d3 at baseline ( black bars ) and after 6 months ( white bars ) . c : subjects with low serum 25(oh)d ( n = 45 ) randomized to placebo at baseline ( black bars ) and after 6 months ( white bars ) . * p < 0.05 . these differences between the groups regarding isi , hba1c , and tgs were still significant after adjustment for age , sex , and bmi . adjustment for physical activity level attenuated the differences so that they became nonsignificant for isi and tgs ( table 2 ) . the difference in hba1c remained significant also after additional adjustment for fat fish intake , dairy servings per week , vitamin d supplementation , sunny holidays , and sun bed use ( table 2 ) . comparisons of participants with low and high baseline serum 25(oh)d data are estimated means ( 95% ci ) , using general linear models . model 1 : means adjusted for age , sex , and bmi ; model 2 : model 1 plus leisure time physical activity ; and model 3 : model 2 plus fat fish intake , dairy servings per week , sun bed use , sunny holidays past 3 months , and vitamin d supplementation . statin users excluded ( five case subjects and six control subjects ) . from the 108 case subjects with low serum 25(oh)d , 51 were randomized to vitamin d treatment and 53 to placebo , and 49 and 45 case subjects , respectively , completed the study . compliance was 98 and 97% in the treatment and placebo group , respectively , and all but 1 subject in each group had a compliance > 80% . nmol / l in the treatment group and remained low in the placebo group ( 42.9 nmol / l ) with no overlap between the groups ( table 3 ) . conversely , plasma pth decreased in the treatment group while remaining unchanged in the placebo group . there were no statistically significant differences between the two groups after 6 months regarding measures of insulin secretion , insulin sensitivity , or lipids ( table 3 and figs . 3 and 4 ) . the results were essentially the same if statin users were excluded , if the analyses were performed as intention - to - treat analyses or per - protocol analyses , or if adjustments for baseline bmi , sex , and age were performed . the treatment group had a statistically significant increase in fasting glucose and hba1c during the study and also a slight decrease in bmi ; however , these changes were not significantly different from the placebo group ( table 3 ) . there were no statistical interactions between treatment group and sex , below / above median homa - ir , bmi , or dairy servings per week on the effect on isi ( p = 0.94 , 0.19 , 0.38 , and 0.09 , respectively ) . accordingly , analyses stratified by sex , above / below baseline median of homa - ir ( 1.83 ) , bmi ( 26.8 kg / m ) , or dairy servings per week ( 18 servings ) revealed similar results ( data not shown ) . baseline , final , and -values and relative differences between treatment and placebo groups in the 94 subjects who completed the intervention study data ( baseline , 6 months , and -values ) are means paired t tests were used to study change from baseline to 6 months within each treatment group . independent t tests were used to compare baseline and -values between the treatment groups . to allow adjustment for baseline values when comparing effect of vitamin d against placebo , ancova models were used and the results presented as the relative effect of vitamin d , with the effect of placebo set to 1 as reference . * p < 0.05 vs. baseline . * * p < 0.01 vs. baseline . baseline ( a c ) and final ( d f ) results in completers of the rct comparing 6 months of high dose vitamin d3 ( n = 49 ) ( ) and placebo ( n = 45 ) ( ) in vitamin d insufficient participants . . there were no significant differences between the groups regarding side effects , with 45 and 46 events in the vitamin d and placebo group , respectively . complications related to the clamp procedure included vasovagal syncopes ( n = 7 ) , extravasal infusion of glucose ( n = 1 ) , pain in the infused arm ( n = 2 ) , and thrombophlebitis in the infused vein ( n = 2 ) . a total of 108 case subjects and 52 control subjects attended the baseline examination and a successful hyperglycemic clamp was performed in 104 and 50 participants , respectively ( fig . 1 ) . mean plasma glucose level the last hour of the clamp was 9.9 0.3 mmol / l , with no difference between case and control subjects ( p = 0.85 ) . figure 2 shows plasma glucose levels , infused glucose ( mg / kg / min ) , and serum insulin levels in the case and control subjects . results from a 3-h hyperglycemic clamp in 104 subjects with low serum 25(oh)d ( ) and 50 subjects with high serum 25(oh)d ( ) . a : mean ( 95% ci ) ln serum insulin . the serum 25(oh)d levels in the sixth troms study were 33.9 5.5 for case subjects and 77.6 4.9 nmol / l for control subjects , with corresponding baseline values 40.3 12.8 and 85.6 13.5 nmol / l ( table 1 ) . median time ( 5th to 95th percentiles ) between attendance date in the sixth troms study and baseline was 13 months ( 826 ) . as expected according to the inclusion procedure , there were no significant differences between case and control subjects at baseline regarding age , bmi , or sex . leisure - time physical activity level was significantly higher in control subjects , as were use of vitamin d supplementation , sun bed use , and sunny holidays during the past 3 months . serum pth , tgs , and hba1c were significantly higher in case subjects , while isi was lower ( table 1 and fig . these results were similar also when statin users were excluded ( data not shown ) . baseline characteristics in subjects with low serum 25(oh)d and subjects with high serum 25(oh)d unless otherwise stated , data are means comparisons between case and control subjects were performed with t tests for independent groups for continuous data and test for categorical data . first phase insulin release ( auc 010 min ) , second phase insulin release ( auc 120180 min ) , m , and isi from a 3-h hyperglycemic clamp comparing participants with low and high serum 25(oh)d at baseline , and at baseline and after completion in the rct . data are geometric means . a : subjects with low serum 25(oh)d ( n = 104 ) ( black bars ) and high serum 25(oh)d ( n = 50 ) ( white bars ) levels at baseline . b : subjects with low serum 25(oh)d ( n = 49 ) randomized to high dose vitamin d3 at baseline ( black bars ) and after 6 months ( white bars ) . c : subjects with low serum 25(oh)d ( n = 45 ) randomized to placebo at baseline ( black bars ) and after 6 months ( white bars ) . * p < 0.05 . these differences between the groups regarding isi , hba1c , and tgs were still significant after adjustment for age , sex , and bmi . adjustment for physical activity level attenuated the differences so that they became nonsignificant for isi and tgs ( table 2 ) . the difference in hba1c remained significant also after additional adjustment for fat fish intake , dairy servings per week , vitamin d supplementation , sunny holidays , and sun bed use ( table 2 ) . comparisons of participants with low and high baseline serum 25(oh)d data are estimated means ( 95% ci ) , using general linear models . model 1 : means adjusted for age , sex , and bmi ; model 2 : model 1 plus leisure time physical activity ; and model 3 : model 2 plus fat fish intake , dairy servings per week , sun bed use , sunny holidays past 3 months , and vitamin d supplementation . from the 108 case subjects with low serum 25(oh)d , 51 were randomized to vitamin d treatment and 53 to placebo , and 49 and 45 case subjects , respectively , completed the study . compliance was 98 and 97% in the treatment and placebo group , respectively , and all but 1 subject in each group had a compliance > 80% . nmol / l in the treatment group and remained low in the placebo group ( 42.9 nmol / l ) with no overlap between the groups ( table 3 ) . conversely , plasma pth decreased in the treatment group while remaining unchanged in the placebo group . there were no statistically significant differences between the two groups after 6 months regarding measures of insulin secretion , insulin sensitivity , or lipids ( table 3 and figs . 3 and 4 ) . the results were essentially the same if statin users were excluded , if the analyses were performed as intention - to - treat analyses or per - protocol analyses , or if adjustments for baseline bmi , sex , and age were performed . the treatment group had a statistically significant increase in fasting glucose and hba1c during the study and also a slight decrease in bmi ; however , these changes were not significantly different from the placebo group ( table 3 ) . there were no statistical interactions between treatment group and sex , below / above median homa - ir , bmi , or dairy servings per week on the effect on isi ( p = 0.94 , 0.19 , 0.38 , and 0.09 , respectively ) . accordingly , analyses stratified by sex , above / below baseline median of homa - ir ( 1.83 ) , bmi ( 26.8 kg / m ) , or dairy servings per week ( 18 servings ) revealed similar results ( data not shown ) . baseline , final , and -values and relative differences between treatment and placebo groups in the 94 subjects who completed the intervention study data ( baseline , 6 months , and -values ) are means independent t tests were used to compare baseline and -values between the treatment groups . to allow adjustment for baseline values when comparing effect of vitamin d against placebo , ancova models were used and the results presented as the relative effect of vitamin d , with the effect of placebo set to 1 as reference . * p < 0.05 vs. baseline . * * p < 0.01 vs. baseline . data missing in one participant . baseline ( a c ) and final ( d f ) results in completers of the rct comparing 6 months of high dose vitamin d3 ( n = 49 ) ( ) and placebo ( n = 45 ) ( ) in vitamin d insufficient participants . there were no significant differences between the groups regarding side effects , with 45 and 46 events in the vitamin d and placebo group , respectively . complications related to the clamp procedure included vasovagal syncopes ( n = 7 ) , extravasal infusion of glucose ( n = 1 ) , pain in the infused arm ( n = 2 ) , and thrombophlebitis in the infused vein ( n = 2 ) . results from this population - based case - control study confirm the observed inverse relationship described in previous studies between serum 25(oh)d and tgs and hba1c and the positive association with isi ( 9,1417,22 ) . these effects , however , were attenuated after adjustment for physical activity and no longer significant for tgs and isi . in addition , there were no beneficial effects on the same outcomes after 6 months of supplementation with vitamin d as compared with placebo . the major strength of the study is the sophisticated methodology used to measure insulin secretion and sensitivity . insulin sensitivity measured by hyperglycemic clamp technique correlates well with the gold standard euglycemic clamp technique ( 25 ) , includes both hepatic and peripheral insulin resistance ( 32 ) , and provides measures of insulin secretion . another strength of the study is that low and high serum 25(oh)d levels were confirmed through two different measurements , some of which were > 2 years apart . the doses used were high enough to achieve a substantial increase in serum 25(oh)d levels , which was verified in serum measurements . good compliance and high retention increased the validity of the findings . finally , we had the opportunity to adjust for possible confounding factors , such as physical activity and fat fish intake . most important , the study was powered to detect a difference between the groups after treatment of 0.08 mol kg min / pmol l. however , the difference between the case and control groups at baseline was only 0.03 mol kg min / pmol l , which would have been a more realistic intervention goal . we lacked power to detect such a small difference and can not exclude that a larger study would have disclosed an effect of vitamin d intervention on isi . on the other hand , the relative effect of vitamin d supplementation on isi in our study was 0.99 , and we find it unlikely that we have missed a pronounced effect of vitamin d on glucose metabolism . since the intervention lasted only 6 months , we can not assess long - term effects on glucose and lipid metabolism or safety . furthermore , our subjects were almost exclusively caucasians , and the results may not apply to other ethnic groups . thus , administration of a similar dose ( 4,000 iu / day ) of vitamin d3 for 6 months lowered fasting insulin and increased insulin sensitivity in south - asian women ( 29 ) , and an increase in oral glucose insulin sensitivity in vitamin d supplemented ( 120,000 iu three times , 2 weeks apart ) indian men after only 6 weeks has also been reported ( 33 ) . the participants included in these studies were more vitamin d deficient and insulin resistant at baseline than in our study . however , stratified analyses in our participants according to baseline homa - ir or bmi did not reveal an effect of vitamin d supplementation . furthermore , our results are consistent with previous studies showing that 1-year supplementation with 20,000 or 40,000 iu / week vitamin d3 did not improve glucose metabolism or serum lipids in 330 overweight or obese caucasian subjects ( 34 ) . nor did injection of two doses of 100,000 iu vitamin d3 improve fasting glucose or insulin sensitivity in 33 primarily caucasian adults with serum 25(oh)d < 50 nmol / l ( 35 ) . no effect on fasting glucose , insulin , homa - ir , or development of diabetes during 7 years of supplementation with 1,000 mg calcium and 400 iu vitamin d3 in > 33,000 women was reported from the women s health initiative study ( 36 ) , and intervention studies with vitamin d in subjects with established type 2 diabetes also fail to show improvement in glycemic control ( 37,38 ) . other minor studies , mainly without control groups , report conflicting results , as reviewed recently ( 21 ) . although there was a significant difference in serum tgs between case and control subjects at baseline , we found no effect of vitamin d supplementation on serum tgs or other lipids . this is in accordance with several other reports ( 29,33,34,3840 ) , although a decrease in serum tgs and an increase in ldl were found in the group supplemented with 83 g ( 3,320 iu)/day vitamin d3 as compared with placebo in a 1-year study of 200 overweight subjects ( 41 ) . none of these studies include participants based on presence of hyperlipidemia or hypertriglyceridemia , and rcts in participants with such traits are still needed . in the case - control study , adjustment for physical activity attenuated the differences between case and control subjects regarding tgs and isi but not hba1c . to address confounding related to vitamin d in this regard is challenging because many factors fulfill the criteria for being confounders while at the same time serving as important contributors to the vitamin d level itself . for instance , the effect of physical activity on isi might in part be mediated by the higher level of vitamin d in physically active subjects as a result of increased outdoor time ( 42 ) . worth noticing is that the final serum 25(oh)d in the intervention study was higher than the serum levels in the high serum 25(oh)d group in the nested case - control study . we might therefore have exceeded the ideal serum concentration , assuming a u - shaped association between serum 25(oh)d and dysregulation of glucose metabolism ( 43 ) . such an association has recently been reported between serum 25(oh)d levels and mortality ( 44 ) , frailty ( 45 ) , and some cancers ( 46 ) . however , there were no differences in changes in isi , tgs , or hba1c when the participants were stratified by quartiles of final serum 25(oh)d level , irrespective of treatment group ( data not shown ) . the ideal serum 25(oh)d level for multiple health outcomes is still not settled but suggested to be at least 75100 nmol / l ( 47 ) . our results do not support that a higher level would be preferable in relation to insulin sensitivity and secretion in glucose tolerant individuals , and although not statistically significant from the placebo group , the finding that both fasting glucose and hba1c increased in the supplemented group is of concern . the role of vitamin d in glucose metabolism among glucose intolerant people remains unsettled and warrants further research , preferably through rcts .	objectivevitamin d deficiency is associated with an unfavorable metabolic profile in observational studies . the intention was to compare insulin sensitivity ( the primary end point ) and secretion and lipids in subjects with low and high serum 25(oh)d ( 25-hydroxyvitamin d ) levels and to assess the effect of vitamin d supplementation on the same outcomes among the participants with low serum 25(oh)d levels.research design and methodsparticipants were recruited from a population - based study ( the troms study ) based on their serum 25(oh)d measurements . a 3-h hyperglycemic clamp was performed , and the participants with low serum 25(oh)d levels were thereafter randomized to receive capsules of 20,000 iu vitamin d3 or identical - looking placebo twice weekly for 6 months . a final hyperglycemic clamp was then performed.resultsthe 52 participants with high serum 25(oh)d levels ( 85.6 13.5 nmol / l [ mean sd ] ) had significantly higher insulin sensitivity index ( isi ) and lower hba1c and triglycerides ( tgs ) than the 108 participants with low serum 25(oh)d ( 40.3 12.8 nmol / l ) , but the differences in isi and tgs were not significant after adjustments . after supplementation , serum 25(oh)d was 142.7 25.7 and 42.9 17.3 nmol / l in 49 of 51 completing participants randomized to vitamin d and 45 of 53 randomized to placebo , respectively . at the end of the study , there were no statistically significant differences in the outcome variables between the two groups.conclusionsvitamin d supplementation to apparently healthy subjects with insufficient serum 25(oh)d levels does not improve insulin sensitivity or secretion or serum lipid profile .
You are an expert at summarizing long articles. Proceed to summarize the following text: one of the greatest goals of biology is the reconstruction of the tree of life . recent advances in high - throughput sequencing technologies have seen an exponential increase in the amount of publicly available genomic data . the huge increase in genomic data requires us to develop efficient high - throughput methods for analysing this data . nowadays it is usual for whole - genome phylogenetic studies to comprise of thousands of different genes and search through large numbers of possible phylogenies . for example , in supertree analysis , researchers first construct a large number of fully optimized phylogenies with partially overlapping taxa and combine these input trees to produce more comprehensive phylogenetic hypotheses ( e.g. 1,2 ) . one of the most accurate techniques for constructing phylogenetic trees is using maximum likelihood ( ml ) estimation ( 3 ) . recently , there have been significant advances in model - based tree search methods that can be mainly attributed to algorithmic improvements rather than hardware improvements . programs such as phyml ( 4 ) , raxml ( 5 ) , mrbayes ( 6 ) and iqpnni ( 7 ) have each introduced better and faster heuristics that have been shown to repeatedly outperform traditional ml programs such as fastdnaml ( 8) in terms of computing time and topological accuracy . the impressive results presented by guindon and gascuel ( 4 ) serve as an example of the extent to which these algorithmic improvements have made it possible to use ml programs to construct relatively large phylogenies quickly using standard hardware . despite these improvements , it can still take a considerable amount of time to perform large - scale phylogenetic analyses involving thousands of alignments using only a single processor . one popular method of addressing this limitation is to take a number of closely coupled processors to form a dedicated processing cluster for performing high - throughput phylogenetic analysis ( 911 ) . although extremely effective , these clusters can be prohibitively expensive as they often require dedicated processors and specialized personnel to maintain these systems . on the other hand , it has been shown in a recent study by ibm that windows and unix servers are idle for approximately 95 and 85% of the day respectively ( 12 ) while another study showed that on average , desktop machines are idle for between 60 and 80% of the day ( 13 ) . the term distributed computing is often taken to mean computing using a non - dedicated pre - existing pool of heterogeneous processors that are not localized in a single room or building and can fail arbitrarily . by harnessing the spare clock cycles of multiple semi - idle desktop machines ( a semi - idle machine is a machine primarily used by another individual that , because of the nature of the usage , is idle some of the time , e.g. a computer in a university teaching laboratory ) , it is possible to emulate the computing power offered by specialized dedicated hardware at a fraction of the cost ( 14 ) . recently , a number of authors have identified the suitability of distributed computing for phylogenetic analysis and shown how it is possible to harness the idle clock cycles of hundreds of standard desktop machines to perform phylogenetic analysis ( 15,16 ) . in this article , we introduce multiphyl , which is a fully cross - platform high - throughput ml - based phylogeny analysis program that allows researchers to create a virtual phylogenetic supercomputer from a group of semi - idle desktop machines . the multiphyl webserver is aimed at researchers who wish to perform phylogenetic analysis of large numbers of alignments in short amounts of time but do not have access to dedicated high - performance computational resources . multiphyl is one of a number of applications that runs on our general - purpose distributed computing system ( 16,17 ) . this model describes a system consisting of a single server computer and a number of client computers . our system is divided into three separate pieces of software : server , client and remote interface ( 18 ) . apart from the server , the system is completely dynamic meaning that new donor machines ( a donor machine is owned by someone that offers their machines spare clock cycles to multiphyl ) can be added at any time and existing donor machines can fail arbitrarily with no adverse effect to the computations . we have deployed the distributed system across our university campus using the idle computing resources of several hundred desktop computers ( see http://www.cs.nuim.ie/distributed/statistics.php for details ) . the overall flow of control in multiphyl can be broken up into three distinct stages : model selection , tree searching and bootstrapping . the user uploads a group of n nucleotide or amino acid alignments in either fasta or phylip file format . multiphyl makes extensive use of the java - based phylogenetic analysis library ( pal ) v1.5 ( 19 ) to perform all likelihood calculations . each of the analysis stages ( model selection , tree searching and bootstrapping ) operates completely asynchronously across different alignments , thus achieving maximum speedup and avoiding performance bottlenecks . one of the essential requirements for ml phylogenetic inference is a model of amino acid or nucleotide substitution . it has been shown that using incorrect or suboptimal substitution models can produce less accurate or incorrect phylogenies when the wrong model of evolution is assumed ( 20 ) . therefore , it may be useful to first compute the most suitable model before performing a treesearch . however , model selection is one area that has been overlooked as an essential part of the phylogeny construction process by many other parallel phylogenetic construction programs . we have recognized the importance of integrating model selection into all phylogenetic studies and therefore multiphyl allows the user to perform model selection on every alignment prior to all tree searches ( 20 ) . the task of testing multiple substitution models against an alignment is very amenable to parallelization as each model can be optimized completely independently and the corresponding likelihoods can be collected and analysed at the server to determine the best model . in order to gain the maximum speedup for the model selection stage of the program , we implemented an adaptive parallel strategy where the server first recruits a single donor machine to construct the initial nj tree to be used to optimize each model . the parallel granularity of a model selection stage is estimated dynamically by recording how many models are optimized by the first donor machine in m min ( where the default value of m is 15 min ) . although it may seem that the optimal parallel granularity would be to just issue a single model per donor machine , this could have a number of adverse effects on the distributed system such as overloading the non - dedicated network or overloading the server with many simultaneous connections . after the server receives the first set of o optimized models , it issues groups of o models to multiple donor machines to be optimized . as multiphyl is based on a network of heterogeneous processors with varying computational abilities , each donor machine has the option to return a partial set of p optimized models ( where p is the number of models optimized by the particular machine within 15 min and p < o ) with the unoptimized models being redistributed to other machines , thereby avoiding a bottleneck that might be caused by a few slow donor machines in the system . in order to address the trade - off between running time and accuracy when performing large - scale analysis , we have implemented two different tree search algorithms in multiphyl and given the user the option to select which algorithm they wish to use to analyse their dataset . the first tree- building algorithm initially constructs an nj tree and then iteratively improves the trees by repeatedly performing all possible simultaneous nni and local branch length optimization swaps that improve the likelihood until convergence ( 4 ) . finally , all of the branch lengths are globally optimized to improve the final likelihood of the tree . the second tree search algorithm implemented in multiphyl allows the user to define a maximal depth of subtree pruning and regrafting ( spr ) rearrangements to perform from each node of the tree . the spr tree search algorithm begins by creating a starting tree by performing the nni search algorithm outlined above and then iteratively visits each node of the tree and performs spr rearrangements spanning increasing levels of the tree ( beginning at 2 levels and continuing up to a user - defined maximum ) . in order to accommodate both long tree searches and the varying computational abilities of the available donor machines , if an individual tree search has not converged after 60 min on a particular machine , then the current state of the tree search is saved and returned to the server . this tree search is then re - issued to another donor machine to continue optimizing the tree . this also ensures that if a donor machine fails ( e.g. crashes or is switched off ) , it is only possible to lose a maximum of approximately 60 min computing time for any tree search . one significant challenge in a distributed computing environment is the huge disparity of available memory on the donor machines . this is a particular issue in phylogenetics as the amount of memory consumed by ml - based phylogeny programs increases linearly with sequence length and number of taxa . multiphyl implements a dynamic memory scheme where the minimum memory requirements of each task is first set to some initial value ( default is 60 mb ) . when a donor machine requests a work unit , the donor machine can only be issued a particular task ( model optimization or tree search ) that has a memory requirement less than the amount of memory available to the java virtual machine ( jvm ) on the donor machine . if a donor machine reports that the jvm ran out of memory while attempting to perform a particular task , the server dynamically increases the minimum memory requirements of that individual task to a level that is suitable for the task . if no machine with sufficient memory can be detected after q attempts ( default value for q is 5 ) , then the problem is removed from the system with an appropriate entry in the log file returned to the user . this dynamic scheme ensures that each phylogenetic computation can gain access to the maximum amount of computational resources available to multiphyl as the user is not required to decide a priori what types of machines are capable of processing their dataset . the multiphyl webserver ( http://www.cs.nuim.ie/distributed/multiphyl.php ) allows any researcher to upload multiple amino acid or nucleotide alignments ( in fasta or phylip format ) to be analysed on our network of computers . a user can upload either a single alignment file or a zip file containing up to 1000 alignments . the user must provide a valid email address to which the results are sent when the analysis is finished . each alignment is first checked for formatting errors and an email is sent to notify the user if any errors are found . the webserver is set to perform model selection by default and the user chooses which tree search algorithm to use and whether or not to perform bootstrapping . for each alignment , a comprehensive report file is produced with information on the alignment ( number of sites , gap content , constant sites ) , search parameters , model selection ranking information , sequence - composition chi - squared test , final likelihood , human - readable tree , phylip format tree and a bipartition table constructed from the bootstrap replicates . a user is presented with a web submission form when they log onto the multiphyl homepage . to avail of the service , the user first selects their alignment file ( or a zip file containing their alignments ) . the user then uses the check - boxes to specify which tree search algorithm ( nni or spr ) to use for their analysis . next , the user can select whether to perform bootstrapping on their dataset and enter how many bootstrap replicates to carry out in the text box . all users must enter their name , institution and email address in the text - boxes provided . finally , the user presses the execute button to start the analysis on the distributed system . in order to benchmark the tree search algorithms implemented in multiphyl , we ran multiphyl on a single processor and compared it to a number of other prominent tree search programs , using a number of previously published well - known real alignments . we obtained the three datasets used to benchmark parallel fastdnaml ( 11 ) corresponding to 50 ( 1858 bp ) , 101 ( 1858 bp ) and 150 ( 1269 bp ) taxa . we also used the 218rdpii ( 4128 bp ) dataset used to benchmark phyml ( 4 ) and the 150arb ( 3188 bp ) , 193v ( 465 bp ) , 200arb ( 3270 bp ) and 250arb ( 3638 bp ) datasets used to benchmark raxml ( 5 ) . as multiphyl optimizes the base frequencies of the model , phyml was executed using the the final likelihood values and running times of each program using the gtr ( 21 ) nucleotide substitution model are given in table 1 . in all cases , the final likelihood values of the trees were calculated using phyml using the branch and model optimisation option to allow for a fair comparison of likelihood values . table 1.comparison of final log likelihood values and runtimes ( seconds in brackets ) of multiphyl v1.0.4 , raxml - vi , phyml v2.4.4 , dprml and iqpnni v3.0 for a number of previously published datasetsdatasetmultiphylphymldprmlmultiphyliqpnniraxml - vi(nni)v2.4.4(spr)v3.050sc436644369143735436514363043630(78)(66)(5994)(6777)(443)(69)101sc738077381873754737907364873610(163)(145)(82935)(13674)(1703)(602)150sc441784413844082441724406144024(162)(113)(141211)(13931)(2513)(342)150arb764727648976571764727647376473(482)(323)(309434)(17441)(4117)(814)193v6479964532n / a648026441364407(235)(263)(13411)(2511)(905)200arb103741103789n / a103740103784103696(1003)(395)(17147)(6470)(1487)218rdpii155967155876n / a155934155607155603(1049)(535)(17233)(11508)(2937)250arb130530130488n / a130518130271130287(1262)(619)(17570)(15226)(3575)spr rearrangements were limited to a maximum of 5 branches of the tree in mulitphyl ( spr ) . all tests were carried out on an amd opteron 2.4 ghz with 1 gb ram . dprml was not tested on some of the larger datasets due to its excessive runtimes . comparison of final log likelihood values and runtimes ( seconds in brackets ) of multiphyl v1.0.4 , raxml - vi , phyml v2.4.4 , dprml and iqpnni v3.0 for a number of previously published datasets spr rearrangements were limited to a maximum of 5 branches of the tree in mulitphyl ( spr ) . all tests were carried out on an amd opteron 2.4 ghz with 1 gb ram . dprml was not tested on some of the larger datasets due to its excessive runtimes . in terms of final likelihood values phyml achieves higher final likelihood values in four out of the eight datasets ( 150sc , 193v , 218rdpii and 250arb ) with multiphyl ( nni ) achieving higher likelihoods in the other four datasets ( 50sc , 101sc , 150arb and 200arb ) . as both programs implement very similar tree search algorithms , the differences in performance can be attributed to slight implementation differences of the search algorithm in the two programs . for the smaller datasets ( 50sc , 101sc , 150sc , 150arb and 193v ) , the runtimes of the two programs are quite comparable with multiphyl ( nni ) producing runtimes up to 1.5 times slower than phyml . however , the runtimes from the three largest datasets ( 200arb , 218rdpii , 250arb ) show more significant differences between the two programs . the performance of the more extensive tree search programs [ multiphyl ( spr ) , raxml and iqpnni ] shows a number of patterns . raxml clearly outperforms the two other programs in terms of final likelihood values . in five out of the eight datasets ( 101sc , 150sc , 193v , 200arb and 218rdpii ) , raxml produced the highest likelihoods of any of the programs tested . multiphyl ( spr ) produced the highest likelihood in one dataset ( 150arb ) with iqpnni also producing the highest likelihood for the 250arb dataset . the scale of the algorithmic improvements in recent years is apparent by examining the performance of dprml compared to all of the other programs . dprml is based on a traditional tree search algorithm that has been in use for many years ( 8,16 ) . however , in three of the four datasets that dprml was executed on , it produced the lowest ( worst ) likelihood values of all of the programs . as the number of fully completed genomes increases , we are becoming greatly interested in performing whole - genome phylogenetic analyses by examining the evolutionary history of large numbers of gene families . despite the recent improvements in ml - based tree search programs , it can still take a long time to perform a full ml phylogenetic analysis of multiple genes on a single computer . in order to address these computational challenges , we have recently developed the first high - throughput implementation of a distributed phylogenetics platform , multiphyl , capable of using the idle computational resources of many heterogeneous non - dedicated machines to form a phylogenetics supercomputer . multiphyl allows users to upload multiple amino acid or nucleotide alignments and perform the tasks of ml model selection , tree searching , and bootstrapping . we have shown that the tree search algorithms implemented in multiphyl are quite comparable to the fastest serial phylogenetic programs . in future versions of multiphyl , we intend to integrate some of the other computationally intensive processes that are performed when carrying out a typical phylogenomic analysis such as multiple sequence alignment and simultaneous estimation of alignment and tree parameters . we also intend to incorporate more complex models of sequence evolution such as heterogeneous mixture models of nucleotide and amino acid evolution . multiphyl is currently installed on several hundred desktop computers in our university campus and we encourage other institutions to also install multiphyl . perhaps the true significance of the multiphyl webserver is that it allows researchers who otherwise do not have access to high performance computational hardware ( e.g. in developing countries ) the opportunity to perform large phylogenomic studies .	with the number of fully sequenced genomes increasing steadily , there is greater interest in performing large - scale phylogenomic analyses from large numbers of individual gene families . maximum likelihood ( ml ) has been shown repeatedly to be one of the most accurate methods for phylogenetic construction . recently , there have been a number of algorithmic improvements in maximum - likelihood - based tree search methods . however , it can still take a long time to analyse the evolutionary history of many gene families using a single computer . distributed computing refers to a method of combining the computing power of multiple computers in order to perform some larger overall calculation . in this article , we present the first high - throughput implementation of a distributed phylogenetics platform , multiphyl , capable of using the idle computational resources of many heterogeneous non - dedicated machines to form a phylogenetics supercomputer . multiphyl allows a user to upload hundreds or thousands of amino acid or nucleotide alignments simultaneously and perform computationally intensive tasks such as model selection , tree searching and bootstrapping of each of the alignments using many desktop machines . the program implements a set of 88 amino acid models and 56 nucleotide maximum likelihood models and a variety of statistical methods for choosing between alternative models . a multiphyl webserver is available for public use at : http://www.cs.nuim.ie/distributed/multiphyl.php .
You are an expert at summarizing long articles. Proceed to summarize the following text: a fundamental problem of clinical diagnosis in psychiatry is the identification of disease as an objective and unique entity . emil kraepelin established the basis for modern nosology of psychiatric diseases ( kraepelin , 1893 , kraepelin , 1896 ) . the contemporary international statistical classification of diseases and related health problems ( icd-10 , 1989 , http://www.who.int/classifications/icd/en/ ) and the diagnostics and statistics manual of mental disorders ( dsm-5 , 2013 , http://www.dsm5.org/pages/default.aspx ) imply a clear distinction of nosological entities from normality and from each other . diagnosis of psychopathologies is mostly based on the presence of deviant behaviour , self - evaluated discontent , behavioural maladaptation and danger posed to the patient or others . the categorical assignment of illnesses is justified by practical needs , such as unification of data across medical institutions , statistics , on default diagnostic efforts and treatment and on official grounds of reimbursement for a diagnostic means and therapeutic interventions by health insurance companies . however , diagnostic complexity and the lack of confidence in the final diagnosis often result in a formal use of contemporary nosological classifications ( maj , 2015 ) . , major efforts have been made to try to identify specific hallmarks of pathogenesis or associated genes using objective measurements in order to gain a high level of diagnostic reliability . despite this effort , no clear markers have been identified that are indicative for existing psychiatric nosological entities . on a morphological level , volume reduction of cortical areas and the hippocampal formation has been reported for major depression and schizophrenia ( bremner et al . complex changes in molecular factors such as receptors expression , transporters and secondary messengers ( nikolaus et al . , 2012 , scarr et al . , 2015 ) contribute to a deterioration in neuroplasticity and synaptogenesis and are seen throughout the brain without clear nosological distinction ( bernardinelli et al . specificity of genetic signatures will only be possible with a tremendous increase in sample size , which will correspond ironically to lower nosological precision ( hyde et al . the failure to identify specific markers can be explained as follows : ( 1 ) a linear and finite relationship between the cause and outcome is a rare in psychiatric disease ( fig . 1 , left ) . instead , there are many reciprocal interactions between the biological background , its functional expression and numerous exogenous factors ( fig . 1 ( 2 ) the theory of allostatic load introduces preceding experience as a factor that may recalibrate the behavioural and physiological reactions and change the adaptation potential ( ellis and del giudice , 2014 , mcewen , 1998 , nederhof and schmidt , 2012 ) . environmental stress is considered as a pathogenetic element of a high importance in psychiatry ( de kloet et al . , 2005 , ( 3 ) the interaction between the genome and the environment has a strong context limiting / permitting component ( notaras et al . , 2016 ) . mechanisms that evolved over millions of years to protect individuals from a life - threatening environment have become maladaptive in respect to contemporary socio - cultural demands ( del giudice , 2016 , ellis and del giudice , 2014 , first and wakefield , 2013 ) . ( 4 ) this research approach is problematic as it keeps the nosological entity as the focus . jaspers ( 1913 ) insisted that a nosological entity is a goal for study , but not an objectively existing phenomenon . thus , any nosological approach to stratify disease should be viewed as a diagnostic strategy rather than approach to research distinct pathogenesis . maclean , 1970 , maclean , 1985 , and 1990 ) first recognized the importance of an evolutionary concept to understand the regulation of mental function and proposed the triune brain model ( fig . 2 , , the phylogenetically oldest protoreptilian brain provides instinctive actions , which are the basis of essential behaviours necessary for survival ( e.g. , exploration , escape behaviour , foraging , feeding , aggression , domination and reproductive behaviour ) . the paleomammalian formation comprises parts of the brain that are conventionally assigned to the limbic system ( or papez circuit , papez , 1937 ) . it is responsible for emotions and motivation and transforms a primary response to more adaptive ones , based on previous experience and instincts . the triune brain model was followed by the affective neuroscience scale system ( davis and panksepp , 2011 , panksepp , 1998 , panksepp , 2005 ) . according to panksepp 's theory , core emotional affects and defensive behaviours are represented by the diencephalic action systems of panic , fear , rage , lust , seeking , care and play ( fig . 2 , middle ) . genetically determined neuronal networks are considered as neurobiological substrates of these behaviours ( panksepp , 1998 ) and appear to be conserved throughout the mammalian evolution ( berridge , 2000 , saudino , 2005 , rutter et al . , 1997 ) . emotions and defence behaviours serve focused and distinguished behavioural goals , and , therefore , can be controlled with specific stimuli and operate relatively independently ( e.g. , anderson and adolphs , 2014 ) . three reference points were suggested to specify the network , responsible for 1 of the behaviour characteristics selected by pankseep : ( 1 ) similar neuronal circuits maintain coherent functions ; ( 2 ) artificial stimulation of the particular network ( with a pharmacological , electrophysiological , and opto-/chemo - genetic means ) generates predicted responses ; and ( 3 ) changes in the carriers of the network activity ( neurotransmitters and other substances with messenger activity ) predict the behavioural changes ( panksepp , 1998 ) . a lot of research aims to decipher the circuitries that predominantly control ( 1 ) arousal and sleep ( herrera et al . , 2016 , kim et al . , 2012 , landgraf et al . , 2016 ) , ( 2 ) fear , ( 3 ) anxiety , ( 4 ) aversive memories ( bravo - rivera et al . , 2014 , kim et al . , 2013 , mccullough et al . , 2016 , tovote et al . , 2015 ) , ( 5 ) reward ( kelley , 2004 , kelley and berridge , 2002 , smith et al . , 2011 ) , ( 6 ) attention and motivation ( berthet et al . , 2016 , carli and invernizzi , 2014 , kim , 2013 ) , ( 7 ) goal - oriented behaviour and habits ( burguire et al . , 2015 , , 2013 , frank , 2011 , gremel and costa , 2013 , medendorp et al . , 2011 ) and ( 8) social functions ( konopka and roberts , 2016 , kragel et al . , 2015 , sladky et al . , 2015 , zikopoulos and barbas , 2013 ) . thus , emotional affect networks are integrated into the limbic system of the brain . in turn , the emotional homeostasis provided by the limbic system defines the efficacy of both the phylogenetically old defence systems and more advanced cognitive functions ( de waal , 2011 , panksepp , 2005 , park et al . , 2016 , , the refined cortical functions favour better top - down control over the affective behaviours and provide more efficient adaptation strategies ( adhikari et al . , 2015 , comte et al . , 2016 , parikh et al . , 2016 , rajasethupathy et al . , 2015 ) . for instance , recent fmri findings on activity in the prefrontal cortex and anterior / posterior cingulate cortex have shown that these cortical structures exert inhibitory top - down control of emotional responses . this results in suppression of the context - irrelevant behavioural activity ( fair et al . although the interaction between cognitive , emotional and defensive functions is well recognized , the principles and exact mechanisms of their integration are only just starting to be explored ( do - monte et al . , 2015 , fan et al . , 2015 , riga et al . , 2014 , robinson et al . , 2014 ) . cognitive - emotional imbalance , as reflected by disturbances in the functional crosstalk between the cortex and limbic / defence systems , is seen as the basis of psychiatric diseases as well as psychiatric symptoms in neurodegenerative disorders ( reviewed in ploog , 2003 ) . the pathology - associated alteration in brain activity can be visualised by functional imaging studies . for example , fmri has revealed that generalised anxiety coincides with stable characteristic changes in functional connectivity ( makovac et al . , 2016 , mohlman et al . , 2015 ; also , lang et al . , 2000 ) . the research domains criteria ( rdoc , http://www.nimh.nih.gov/research-priorities/rdoc/index ) framework was introduced by nimh experts as an alternative categorization system for psychopathological states ( cuthbert , 2014 , cuthbert and insel , 2010 , insel et al . , 2010 ) . at present , 5 behavioural domains form the basis of the classification matrix : ( 1 ) positive valence systems , ( 2 ) negative valence systems , ( 3 ) arousal / regulation systems , ( 4 ) systems for social processes and ( 5 ) cognitive systems . these 5 domains and their respective constructs ( fig . 2 , the novelty of the rdoc system is that changes at all neurobiological levels , from molecules to networks , are related to the defined behavioural domains . according to the webpage , the proposed units of analysis are : genes , molecules , cells , circuits , physiology , behaviour , self - reports and paradigms . the development of the rdoc diagnostic criteria was supported by the concept of neuronal networks underlying basic behavioural domains and promoted by advances in functional diagnosis and imaging . the european roadmap for mental health research project ( roamer ) aimed to stratify diagnosis , monitoring and treatment of psychiatric disorder . the pharmacological treatment cluster and the psychiatric somatic comorbidity cluster were introduced in addition to the domains already included in the rdoc ( schumann et al . , 2014 ) . the authors of the rdoc system state : there is no claim to understand or explain dsm / icd disorders in terms of these ( domains and subdomains ) functions ; rather , the aim is more simply to seek an understanding of how these various systems may become dysregulated to various extents and to relate such dysregulation to relevant symptoms . the rdoc system has several advantages as a framework for guiding preclinical studies : ( 1 ) the rdoc supports endophenotype ( symptom)-oriented studies of psychiatric disorders . ( 2 ) the behavioural domain principles do not put a strict demarcation line between normality and pathology . the rdoc system offers a biological basis for personality traits complementing the five - factor model of personality ( costa and mccrae , 1992 tupes and christal , 1961 ; also davis and panksepp , 2011 , neuman , 2014 ) . since psychopathology is considered as a margin case of personality type ( routtenberg , 2002 ) , the rdoc framework implies a normality - pathology continuum . this justifies the search for neurobiological correlates of pathology on a basis of conceptual findings in normal / healthy subjects ( karalunas et al . , ( 4 ) at a systemic level , behavioural domains appear to be self - consistent complexes . therefore for example , major depression , as a nosological entity , would be seen not only as result of emotion and mood dysregulation ( i.e. , changes in the negative valence system ) , but also as a failure in the social interactions and positive valence systems with respective re - set of target for pharmacological interventions . as a consequence , pharmacological modulation of the oxytocin system for depression treatment can be better understood in the perspective of its role in social interaction ( slattery and neumann , 2010 ) . the appearance , for instance , of a depressive state across a variety of psychiatric diseases supports the idea that all known nosological entities comprise a continuous spectrum . respectively , the comorbidity seen between major depression and schizophrenia ( samsom and wong , 2015 ) , bipolar disorder , attention deficit hyperactivity disorder and autism ( kiser et al . , 2015 ) imply that the same pathophysiological processes occur . emergence of common genetic risk factors for these diseases is in line with such a scenario ( smoller et al . , 2013 ) . therefore , a symptom ( or a drug response ) instead of a defined psychiatric disease may be the stratifying principle for genetic studies ( gade et al . , 2015 , manchia et al . , 2013 , ohi et al . , 2015 , papassotiropoulos and de quervain , 2015 ) . however , despite its clear advantages , the rdoc system also bears a few shortcomings : ( 1 ) the rdoc system does not explicitly take into consideration the developmental and dynamical aspect of psychiatric disease , but only acknowledges their importance ( owen , 2014 ) . ( 2 ) it does not consider polarity of parameters , either bipolar ( e.g. , locomotor activity ) or unipolar ( e.g. , anxiety ) ( papassotiropoulos and de quervain , 2015 ) . ( 3 ) the rdoc system does not address the fact that gains and losses of function may be determined by different mechanisms . for instance , direct and indirect pathways of basal ganglia circuit exert biphasic effect in controlling locomotor activity ( gerfen et al . ( 4 ) accordingly to phenomenological aspect of disease , a psychopathological state might be appropriately evaluated only in a context of subject - object and subject - subject interactions . as suggested by nigg ( 2015 ) , the rdoc framework does not consider the developmental or psychosocial context of psychopathological signs , therefore , failing to assign a symptom to pathology . ( 5 ) rdoc implies that all units of analysis , from genes and molecules to behaviour and paradigms , have the same specific stratification power . however , no correlation between diagnostic values of parameters belonging to different units of analysis may be observed . at the same time , such congruence may be the only bedrock of units supervenience and a basis to explore their interrelation . finally , ( 6 ) the rdoc system does not intend to understand and explore a hierarchy and rules of interaction between behavioural domains . the deterministic principle in biology represents a powerful way to understand the biological processes that shape both normality and abnormality . in psychiatry , this principle goes back to griesenger ( 1984 ) who put forward the brain as a substrate of psychiatric illnesses . today , psychiatric disorders are seen as a result of an interaction between intrinsic and environmental factors . therefore , a model system should be conceived as a combination of the experimental subject and applied test situation . today we acknowledge the probabilistic aspects of disease that require a combination of biological and ecological approaches to model pathology . this renders models powerful in terms of understanding epigenetic mechanisms of psychopathologies and prerequisites of resilience vs. susceptibility to disease . for instance , social interaction behaviour can now be observed 24 h a day using phenoworld accurate assessment of cognitive function requires a touch screen approach , which is time consuming and apparatus - demanding ( romberg et al . , 2013 ) . contemporary understanding the difference between mechanisms of sustained fear ( anxiety ) and phasic fear need sophisticated protocols with versatile time and context parameters of conditioning ( daldrup et al . , 2015 , grillon and davis , 1997 , seidenbecher et al . , 2016 ) . the following validity criteria are used to judge the quality of the disease model : correspondence to the clinical appearance of disease ( face validity ) ; similarity of the morpho - physiological features of disease ( construct validity ) ; predicted response to pharmacological interventions , specifically active in given pathological conditions ( predictive validity ) ( belzung and lemoine , 2011 , mckinney and bunney , 1969 , vervliet and raes , 2013 , willner , 1984 , willner , 1994 ) . full adherence to these 3 phenotypic validity criteria is rarely achievable in commonly used experimental animals , such as mice and rats . first of all , tests confirming face validity and respective proxy measures are not always species relevant . thus , the same responses ( fear , disgust , affiliation , or pleasure ) may have different expression because they drive species - specific activity ( cosmides and tooby , 2000 , flack and de waal , 2007 ) . second , most models bear a limited number of characteristic pathological traits and rarely show typical comorbid traits , which are co - inherited in human disease . forth , the main drawback of experimental models is that they rarely meet the etiological validity criterion , which includes both the ontopathogenesis and species homology ( belzung and lemoine , 2011 ) . therefore , specific animals , perceived as models of disease , fail to reveal risk factors , prognostic markers and new therapeutic targets . these problems characterize the crisis of experimental studies in animals ( ahmed , 2010 , stewart and kalueff , 2015 , willner and belzung , 2015 ) . the rdoc system is a platform that aims to improve translatability of studies from animals to humans , since it supports the endophenotype - based comparison of animals and humans on an objective neurobiological basis across all behavioural domains . the idea of using observable and objectively measured behaviour to create animal models of pathology had already been introduced ( geyer and moghaddam , 2002 , segal and geyer , 1985 ) . the rdoc system advanced to allow the models to be systematized and grouped , which makes the behavioural endophenotype the primary focus . the rdoc system offers a useful validation matrix , where the units of analysis serve as criteria and , together with the domains , it may be feasible to delineate the areas of homologies between animal and humans . the rdoc system provides a conceptual approach to study of abnormal endophenotypes considering them as a deviation of normality . therefore , it strongly supports basic / disease focused studies ( bertuzzi and cleveland , 2015 ) and justifies using experimental animals to better understand pathological processes . we assume that the most reliable comparison between animals and humans can be done within the 4 rdoc domains , which describe basic emotions and defence responses . these domains fully overlap with the affective neuroscience scale ( fig . 2 ) . for instance , the negative valence systems domain includes the fear and panic systems . the positive valence systems domain , in turn , includes the systems responsible for feelings of pleasure and attachment ( play , care , lust , and seeking ) . the arousal and regulatory systems combines play , seeking , and rage clusters . the social processes domain can be defined as a constellation of the play and care . the anthropocentric names given to emotions , arousal and defence responses should be used with precaution in animals , since they are rather nominal or provisional terms . using these behavioural emotions with respect to their significance to the entire brain and body would be more representative of their respective functions ( see a review of emotion definition in de waal , 20 ; also , ledoux , 2014 ) . to prove behavioural and physiological homologies of emotions and defence programs between species , we should be assured that even if they do not share similar immediate expression , they may still induce the same changes or specifically modify evoked responses to ( any ) other stimuli . together with the phenomenological and neuronal networks homologies , a similarity between humans and animals in physiological mechanisms as well as in common genetic and developmental phenomena of the affective systems ( anderson and adolphs , 2014 , heilbronner et al . , 2016 , mishra and gazzaley , 2016 ) support validity and reliability of the experimental models of dysfunction in the emotional , regulatory and defence responses . the fifth domain of the rdoc system , the cognitive system is the loose accumulation of a variety of cognitive functions ( i.e. , perception , attention , declarative memory , language , working memory , cognitive control ; https://www.nimh.nih.gov/research-priorities/rdoc/constructs/cognitive-systems.shtml ) . although the phylogenetic , physiological and clinical data testify a role of the cortical structures in the implementation of cognitive functions ( reviewed in geschwind and rakic , 2013 ) , so far , neither an exclusive area of the cortex nor a key network were confirmed to be a primary bearer or centre of cognition . as a system , the cognitive systems domain emerges as an epi - formation including all components of the affective systems plus neocortex and paleocortex . the functional connectivity concept ( friston , 2011 ) spans neurobiological and ( meta)system approaches and implies integration of all brain regions in maintaining cognitive performance . at least in preclinical studies using animal models , it appears to be impossible to separate the cognitive systems domain from other behavioural domains ( cromwell and panksepp , 2011 ) . the lack of specific responses serves as indirect evidence that the cognitive system has no specific morphological and neurobiological representation . thus , cognition can not be selectively modulated and pharmacological intervention is often accompanied by changes in other behavioural domains . cognitive abilities can be accelerated coincidentally with improved attention and vigilance in attention deficit hyperactivity disorder , adhd ( briars and todd , 2016 , chan et al . , 2016 ) or suppression of negative symptoms in major depression ( al - sukhni et al . , 2015 , baune and renger , 2014 ) or schizophrenia ( goff et al . , 2008 ) . primary failure in cognitive control may impact emotion processing and represents a major factor of psychopathology for schizophrenia and anxiety disorders ( for instance , mochcovitch et al . , 2016 , kim et al . , 2016 , porter et al . , 2015 ) . for example , dysfunction in working memory and cognitive flexibility are observed without relation to actual mood state , but are most pronounced during episodes of acute mood disturbance ( snyder et al . , 2015 ) . a complex motivation phenomenon is another example of a crosstalk between arousal / emotional state and cognitive / learning performance . motivation is perceived as a cognitive function in humans , but at the same time it relates to the positive valence or negative valence systems . the midbrain reward system , in particular , the dopaminergic system , significantly contributes to calculation of reward values in relation to effort and predicted outcome ( cools et al . , 2009 , saddoris et al . , 2015 , schultz and dickinson , 2000 ) . therefore , specific pharmacological interventions effective in monoaminergic systems ( berridge and arnsten , 2013 , westbrook and braver , 2016 ) may be a way to study and modulate cognitive function . the multidomain assignment might be particularly promising if , for instance , the positive and negative valences are considered as both function and argument of the cognitive system . for instance , effective stress coping is a cognitive system - controlled transition from negative affect to positive affect ( fig . 3 ) . in general , the objective difference between the complexity of interactions in the cognitive and affective systems in small experimental animals and humans provide strong limitations for modelling and studying cognitive disturbances in mice and rats . difficulties , which appear when matching animal and human behavioural traits and responses ( nestler and hyman , 2010 ) , might be resolved in the following ways:1.a model should be perceived as an endophenotype / symptom - based model and considered only as biological system representing a distinct pathological process , but not a nosological entity.2.a pathological process must be defined in respect to a particular concept of pathogenesis of psychopathologies . for instance , it might be seen as an imbalance between cortical and subcortical structures or as a state of wrong employment of a generally adaptive process . this will define the interpretation and limit possible misinterpretations acquired due to a deductive analysis ( poldrack , 2006).3.1experimental paradigms , which can be used in both animal and human studies and , presumably , deal with the same endophenotypes and readouts , should be first choice ( fonio et al . , 2015).3.2behavioural tests require validation in respect to their face , predictive and construct validities in the given context . thus , the open field test employed to examine locomotor activity may be a useful tool to discriminate normal adaptive and pathological anxiety ( prut and belzung , 2003 ) . novelty - induced grooming is regarded as an example of coordinated activity rather than a pathological endophenotype ( komorowska and pellis , 2004 , kalueff et al . , 2016 ) . continuous swimming during the forced swim test has an adaptive value if escape is made possible . if not , lasting efforts lead to physical exhaustion , which would increase the probability of negative outcome . the mobility / activity , which can be measured at earlier phases of the forced swim test , may correspond to arousal and high vigilance , whereas the immobility in the later stage may reflect behavioural flexibility ( costa et al . , 2013 , de pablo et al . , 1989 , molendijk and de kloet , 2015 ) . once the meaningfulness of behavioural parameters is validated , a contextual and/or direct analogy between significance of animal and human behavioural traits will indicate the human task equivalent ( czh et al . for example , a high level of aggression , which would serve as an indicator of pathology in humans ( e.g. , during acute alcohol intoxication or due to degeneration of cortical structures ) plays an adaptive role in mice and is not necessarily accompanied by the development of comorbidities like vulnerability to stress and the development of cardiovascular complications ( brain , 1980 , brain et al . , 1993).3.4.underestimation of the species - specific social interactions and environmental cues results in artificial conditions of housing and grouping patterns of animals , like single - housing ( arndt et al . , 2009 , bartolomucci et al . careful analysis and optimization of this and other factors are objective requirements for contemporary experimental designs . conditions including limited sized lodging , a pathogen - free environment , artificial foraging , limited social and sexual interactions should be carefully considered but not as possible confounding factors , rather as ecological determinants of experimental studies ( e.g. , beura et al . , we should use these variables as a source of biological variability of measured parameters ( voelkl and wrbel , 2016).3.5.considering the apparent polymodal character of the domains and context - dependent expression of biomarkers , we have to acknowledge that any behavioural task or biomedical measurement can be done appropriately but only on a relative scale . therefore , an assessment of experimental endophenotypes should be calibrated by coupling genetic models ( e.g. , inbred lines ) with the predicted difference in a particular behavioural domain . for instance , c57bl/6 mice show a higher reactivity but a stronger resistance to acute stress than dba/2 or balb / c mice ( broadhurst , 1976 , francis et al . , 2003 , ibarguen - vargas et al . , 2008 ) . in any test , relevant to assessment of the same domain , we should expect a similar relative difference between reference lines.4.it should be mandatory to assess the pharmacological responses to prototypic drugs across all behavioural domains . for example , in our recent studies , we characterized the inbred low trait anxiety behaviour ( lab ) mice as a model of a psychotic - like continuum ( yen et al . in these lab mice , we observed endophenotypes that may correspond to the attention deficit hyperactivity disorder , manic psychosis and schizophrenia . however , since amphetamine decreases locomotor activity in these mice , they may be an adhd model and represent an endophenotype that relates to dysfunction in the regulation / arousal systems domain . a model should be perceived as an endophenotype / symptom - based model and considered only as biological system representing a distinct pathological process , but not a nosological entity . a pathological process must be defined in respect to a particular concept of pathogenesis of psychopathologies . for instance , it might be seen as an imbalance between cortical and subcortical structures or as a state of wrong employment of a generally adaptive process . this will define the interpretation and limit possible misinterpretations acquired due to a deductive analysis ( poldrack , 2006 ) . experimental paradigms , which can be used in both animal and human studies and , presumably , deal with the same endophenotypes and readouts , should be first choice ( fonio et al . , 2012 , hvoslef - eide et al . , 2015 ) . behavioural tests require validation in respect to their face , predictive and construct validities in the given context . thus , the open field test employed to examine locomotor activity may be a useful tool to discriminate normal adaptive and pathological anxiety ( prut and belzung , 2003 ) . novelty - induced grooming is regarded as an example of coordinated activity rather than a pathological endophenotype ( komorowska and pellis , 2004 , kalueff et al . , 2016 ) . continuous swimming during the forced swim test has an adaptive value if escape is made possible . if not , lasting efforts lead to physical exhaustion , which would increase the probability of negative outcome . the mobility / activity , which can be measured at earlier phases of the forced swim test , may correspond to arousal and high vigilance , whereas the immobility in the later stage may reflect behavioural flexibility ( costa et al . , 2013 , de pablo et al . , 1989 , molendijk and de kloet , 2015 ) . once the meaningfulness of behavioural parameters is validated , a contextual and/or direct analogy between significance of animal and human behavioural traits will indicate the human task equivalent ( czh et al . for example , a high level of aggression , which would serve as an indicator of pathology in humans ( e.g. , during acute alcohol intoxication or due to degeneration of cortical structures ) plays an adaptive role in mice and is not necessarily accompanied by the development of comorbidities like vulnerability to stress and the development of cardiovascular complications ( brain , 1980 , brain et al . , 1993 ) . underestimation of the species - specific social interactions and environmental cues results in artificial conditions of housing and grouping patterns of animals , like single - housing ( arndt et al . careful analysis and optimization of this and other factors are objective requirements for contemporary experimental designs . conditions including limited sized lodging , a pathogen - free environment , artificial foraging , limited social and sexual interactions should be carefully considered but not as possible confounding factors , rather as ecological determinants of experimental studies ( e.g. , beura et al . , 2016 ) . we should use these variables as a source of biological variability of measured parameters ( voelkl and wrbel , 2016 ) . considering the apparent polymodal character of the domains and context - dependent expression of biomarkers , we have to acknowledge that any behavioural task or biomedical measurement can be done appropriately but only on a relative scale . therefore , an assessment of experimental endophenotypes should be calibrated by coupling genetic models ( e.g. , inbred lines ) with the predicted difference in a particular behavioural domain . for instance , c57bl/6 mice show a higher reactivity but a stronger resistance to acute stress than dba/2 or balb / c mice ( broadhurst , 1976 , francis et al . , 2003 , ibarguen - vargas et al . , 2008 ) . in any test , relevant to assessment of the same domain , we should expect a similar relative difference between reference lines . it should be mandatory to assess the pharmacological responses to prototypic drugs across all behavioural domains . for example , in our recent studies , we characterized the inbred low trait anxiety behaviour ( lab ) mice as a model of a psychotic - like continuum ( yen et al . , 2013 , yen et al . , 2015 ) . in these lab mice , we observed endophenotypes that may correspond to the attention deficit hyperactivity disorder , manic psychosis and schizophrenia . however , since amphetamine decreases locomotor activity in these mice , they may be an adhd model and represent an endophenotype that relates to dysfunction in the regulation / arousal systems domain . based on the rdoc , the following principles can be applied to better model pathology in animals:assume a model is an endophenotype model ( symptom - based);assign the experimental endophenotype to 1 of the 5 rdoc domains;identify corresponding symptoms in humans in the same domain;reveal a spectrum of related clinical symptoms preferentially within a single syndrome;examine whether developmental , dynamic and co - morbidity features of the experimental endophenotype fit to the particular syndrome corresponding to a nosological entity.since disturbance in the cognitive system is a characteristic feature of psychopathology , evaluation of cognitive function ( in terms of modality and intensity of changes ) should be an ultimate step in proposing the phenotype as a psychiatric disease model . assume a model is an endophenotype model ( symptom - based ) ; assign the experimental endophenotype to 1 of the 5 rdoc domains ; identify corresponding symptoms in humans in the same domain ; reveal a spectrum of related clinical symptoms preferentially within a single syndrome ; examine whether developmental , dynamic and co - morbidity features of the experimental endophenotype fit to the particular syndrome corresponding to a nosological entity . since disturbance in the cognitive system is a characteristic feature of psychopathology , evaluation of cognitive function ( in terms of modality and intensity of changes ) should be an ultimate step in proposing the phenotype as a psychiatric disease model . the recently proposed rdoc diagnostic framework is a new strategy of symptom - based classification . it revives and upgrades the idea of characterizing the basic function of brain rather than the typical pathological traits ( schneider , 1959 ) . the rdoc system exploits objective measurements at all levels of neurobiological investigation from molecules to circuits and behaviour and offers a biological basis of diagnosis . at present , the proposed system is still mechanistic and its nosology - dissecting and aetiology - finding abilities are a matter of debate . the rdoc system offers a good platform for the integral study of clinical data and for the critical evaluation of existing animal models based on systematic examination of endophenotypes . to summarise our analysis of the rdoc system , we may conclude that:1.the rdoc system implies the same mechanisms underlie normal and dysfunctional brain function . the rdoc system also suggests the existence of a psychopathological continuum.2.in the present state , the rdoc system does not consider dynamical and developmental aspects of a disease , psychosomatic co - morbidities , paradigms of therapeutic interventions nor interactions between domain and components of units of analysis.3.four of the 5 rdoc domains correspond to the affective neuroscience scale . a homology of the affective systems in humans and animals supports experimental models of the emotion and defence response dysfunction . however , the high translational value of these models is limited by the dissimilarities between developmental programs and psycho - social contexts of human disorders.4.nonetheless , the rdoc system offers a valid and instructive framework for basic research allowing one to focus on domains and their constructs and to explore endophenotype - based models . this avoids a major challenge of translational studies , which assume a strict disease - to - model correspondence . the rdoc system also suggests the existence of a psychopathological continuum . in the present state , the rdoc system does not consider dynamical and developmental aspects of a disease , psychosomatic co - morbidities , paradigms of therapeutic interventions nor interactions between domain and components of units of analysis . a homology of the affective systems in humans and animals supports experimental models of the emotion and defence response dysfunction . however , the high translational value of these models is limited by the dissimilarities between developmental programs and psycho - social contexts of human disorders . nonetheless , the rdoc system offers a valid and instructive framework for basic research allowing one to focus on domains and their constructs and to explore endophenotype - based models . this avoids a major challenge of translational studies , which assume a strict disease - to - model correspondence .	the recently proposed research domain criteria ( rdoc ) system defines psychopathologies as phenomena of multilevel neurobiological existence and assigns them to 5 behavioural domains characterizing a brain in action . we performed an analysis on this contemporary concept of psychopathologies in respect to a brain phylogeny and biological substrates of psychiatric diseases . we found that the rdoc system uses biological determinism to explain the pathogenesis of distinct psychiatric symptoms and emphasises exploration of endophenotypes but not of complex diseases . therefore , as a possible framework for experimental studies it allows one to evade a major challenge of translational studies of strict disease - to - model correspondence . the system conforms with the concept of a normality and pathology continuum , therefore , supports basic studies . the units of analysis of the rdoc system appear as a novel matrix for model validation . the general regulation and arousal , positive valence , negative valence , and social interactions behavioural domains of the rdoc system show basic construct , network , and phenomenological homologies between human and experimental animals . the nature and complexity of the cognitive behavioural domain of the rdoc system deserve further clarification . these homologies in the 4 domains justifies the validity , reliably and translatability of animal models appearing as endophenotypes of the negative and positive affect , social interaction and general regulation and arousal systems dysfunction .
You are an expert at summarizing long articles. Proceed to summarize the following text: the goal of this report is to describe the outcome of sequential particulated cartilage allograft and autologous osteochondral transfer treatments for an osteochondral lesion of the medial femoral condyle . a 44-year - old woman was treated with a particulated juvenile articular cartilage allograft ( denovo nt ) for a chondral lesion of the knee . as a result of continued pain , she had 2 further surgeries , including an autologous osteochondral transfer system procedure and finally a unicondylar knee arthroplasty . at the final procedure the quality of the residual cartilage tissue was assessed first by equilibrium partitioning of an ionic contrast agent via micro computed tomography ( epic-ct ) , and then by hematoxylin and eosin , safranin o staining , and polarized light microscopy . despite showing good healing at 7 months postsurgery by mri , at 28 months post denovo nt tissue implantation the excised cartilage tissue was heterogeneous , with some regions of hyaline - like cartilage and some regions of fibrocartilage . the later mosaicplasty may have helped maintain hyaline - like cartilage of the denovo nt tissue in its vicinity . this case report describes the cartilage repair tissue produced by denovo nt implantation and compares it with autologous osteochondral plug tissue . osteochondral lesions of the knee represent a large spectrum of injuries that range from softening and fibrillation of cartilage to complete loss of cartilage and bone . techniques such as abrasion chondroplasty , drilling , or microfracture promote lesion infilling with fibrocartilaginous scar tissue . this tissue , which is predominantly composed of type i collagen , has poorer mechanical properties than the native hyaline cartilage . newer salvage techniques such as autologous osteochondral transplant , autologous chondrocyte implantation , and particulated juvenile articular cartilage have been developed in an attempt to repair the lesion with hyaline cartilage . this study describes the treatment performed on a 44-year - old woman who had previously undergone 2 meniscectomies and was still experiencing knee pain . denovo nt ( zimmer , warsaw , in ) is a scaffold - free tissue , which can be used as a single - stage procedure for the repair of articular cartilage lesions and is typically sealed in place with fibrin glue . the tissue is procured from donors 13 years or younger since higher levels of type ii collagen and proteoglycan production are typically seen in cartilage donors from this age group compared with adults . to the best of our knowledge there have been no reported cases of equilibrium partitioning of an ionic contrast agent via micro computed tomography ( epic-ct ) analysis or histological findings from particulated juvenile articular cartilage allograft tissue treatment . we detail a case of an active patient who initially presented to our clinic at the age of 44 years . she had complaints of left medial side knee pain and had already undergone 2 partial medial meniscectomies that had not resulted in any pain relief and so prompted our evaluation . the preoperative workup included an mri and a long - leg frontal hip knee ankle alignment radiograph . she was noted to have varus malalignment and a full - thickness chondral lesion of the medial femoral condyle ( mfc ) measuring 22 mm wide by 36 mm long ( fig . she was counseled on all surgical and nonsurgical options and elected to undergo a joint preserving salvage surgery . setting , the calcified subchondral layer was debrided and the chondral lesion was filled with particulated juvenile articular cartilage allograft ( denovo nt ) and sealed in place with fibrin glue . mri and sample processing . ( a ) preoperative mri shows full thickness ( 36 mm 22 mm ) chondral lesion of the medial femoral condyle ( mfc ) . ( b ) mri at 7 months post denovo nt implantation shows good cartilage resurfacing apart from a residual lesion of 8 mm 21 mm on the medial aspect of the initial lesion , opposite the meniscal excision ( arrow ) . ( c ) preoperative mri shows area of the autologous osteochondral plugs appears well healed ( arrow ) . ( d ) ( left ) photograph taken during surgery indicates normal appearing cartilage plugs grossly . the area of the denovo nt tissue also had good cartilage coverage but did have a hypertrophic appearance . the micro computed tomography image of sample ( right ) shows division into 4 segments , using tissue dye to label posterior and anterior quadrants . the patient had improved pain after the procedure as her preoperative visual analogue scale ( vas ) score was 8/10 and she had an improvement to 3/10 . a routine follow - up mri was performed at 7 months postoperation to evaluate healing which showed a residual lesion of 8 mm wide by 21 mm long on the medial aspect of the initial lesion ( fig . the patient returned to the clinic 13 months after the procedure with complaints of worsening of medial side knee pain with her vas pain score increased to 5/10 to 6/10 with activity . another mri was obtained that showed no change in lesion size from the previous mri . in an attempt to continue with the salvage effort , the patient elected to proceed with the removal of hardware followed by an osteochondral autologous transfer to address the residual lesion in the mfc . at the time of surgery , we found the residual lesion to be 6 to 10 mm wide by 28 mm long , indicating a 72% surface area reduction compared with the original lesion . the area of the denovo nt tissue that had healed showed stable cartilage , which had an appearance and turgor comparable to the native surrounding cartilage . the area that had a residual osteochondral lesion was directly opposite the site where the previous partial menisectomy had been performed . two 10 mm and one 6 mm diameter autologous osteochondral plugs were harvested from the lateral trochlea and used in a mosaicplasty fashion to fill the lesion ( fig . postoperatively , the patient s pain was decreased after the autologous osteochondral transfer , but she continued to have pain with moderate impact activities . a course of viscosupplementation injections also failed to improve her activity - related pain . at this time it was felt that joint preservation options had been exhausted . at approximately 28 months after her index procedure , the patient underwent a medial unicompartmental knee arthroplasty . at the time of unicompartmental knee arthroplasty , the area of the autologous osteochondral plugs , which was easily defined from the surrounding cartilage , appeared well healed and the cartilage appeared normal on gross examination ( fig . the area of the denovo nt tissue also had good turgor , stability , and cartilage coverage . there was full - thickness cartilage loss on the mfc posterior to the area of previous cartilage repair . samples of the tissue from the mfc , which included both areas of denovo nt tissue and autologous osteochondral plugs , were harvested . the tissue was subsequently fixed in 10% neutral buffered formalin at 4 c for 48 hours . once epic-ct scanning was complete , the tissue was decalcified in cal ex ii ( fisher scientific , waltham , ma ) for 14 days and then divided into 4 segments ( fig . 1d , ct image ) before paraffin embedding . the ct images showed a heterogeneity of signal attenuation within the denovo nt tissue with areas of high attenuation being indicative of low proteoglycan content ( fig . histologically , the denovo nt tissue in segments 1 and 2 ( i.e. , in the vicinity of the plug tissue ) stained positively for proteoglycans throughout and appeared hyaline - like under polarized light . in segments 3 and 4 , furthest from the autologous plug tissue , the cartilage was metachromatic for safranin o staining and had more disorganized areas of collagen under polarized light , suggesting fibrocartilage ( fig . four blinded reviewers were asked to grade both denovo nt and autologous tissue in the 4 segments using a modified osscore index for histological parameters ( maximum score of 9 as mineralization could not be assessed because of tissue decalcification ) . there was an indication that the denovo nt tissue graft in segments 1 and 2 , close to the autologous cartilage plugs , better maintained its hyaline nature . ( a ) micro computed tomography ( ct ) image ( representing segments 1 and 4 ) shows heterogeneity of signal attenuation in denovo nt tissue ( blue / green = low attenuation corresponding to high proteoglycan [ pg ] content , red = high attenuation corresponding to low pg content ) . tissue was submerged in 30% hexabrix 320 contrast agent ( covidien pharmaceuticals , hazelwood , mo ) in phosphate - buffered saline ( pbs ) , for 24 hours at room temperature and scanned at e = 45 kvp , i = 177 a , 300 ms integration , 36 mm field of view , 1024 1024 pixel matrix ( 36 m voxel size ) with ct40 ( scanco medical , brttisellen , switzerland ) . following automatic image reconstruction to grayscale 2-dimensional ( 2d ) tomograms , 3d grayscale stacks containing linear attenuation data were rotated to match the histological sectioning plane . pseudocolor scales were applied to demonstrate variations in linear attenuation coefficient , previously shown to be inversely proportional to pg content . ( b ) sagittal sections ( 5 m thick ) stained for hematoxylin and eosin ( h&e ) , safranin o ( segment 1 top , segment 4 bottom ) . deparaffinized sections were mounted unstained in permount ( fisher scientific , waltham , ma ) and viewed under polarized light . ( c ) graph of modified osscores of histological parameters in both denovo nt and autologous plug tissue for the four segments . a maximum score of 9 possible as mineralization key : tissue morphology : hyaline = 3 , hyaline / fibrocartilage = 2 , fibrocartilage = 1 , fibrous tissue = 0 ( h&e , polarized light ) . matrix staining : near normal = 1 , abnormal = 0 ( saf 0 ) . surface architecture : near normal = 2 , moderately irregular = 1 , very irregular = 0 ( h&e ) . integration of calcified cartilage and underlying bone : good = 1 , poor = 0 ( polarized light ) . adapted from roberts et al ) . ( d ) table of individual parameters constituting osscore index for plug tissue and denovo nt tissue segments 1 to 4 . results are displayed as means standard deviation and show interobserver variability as there was only one sample . the purpose of this study was to evaluate the medium - term histologic outcome of denovo nt graft , used for the repair of cartilage in the knee . despite showing good healing at 7 months postsurgery by mri , and the patient experiencing reduced pain at 7 and 13 months , the excised cartilage tissue was heterogeneous , with some regions of hyaline - like cartilage and some regions of fibrocartilage . further surgical intervention was associated with the persistence of a residual chondral lesion opposite the area of the previous meniscectomy , which was resurfaced with the autologous plugs . this suggests that an intact meniscus may be an important factor in the success of this procedure . a direct comparison of the denovo nt tissue to the autologous plug tissue was not entirely appropriate as the plugs were only implanted for 15 months whereas the denovo nt was implanted for more than 2 years . it does , however , appear that the later mosaicplasty may have helped maintain hyaline - like cartilage of the denovo nt tissue in its vicinity . limitations of this study include a paucity of excised denovo nt tissue samples . collection of data from a larger study population with longer follow - up times would provide more information on long - term efficacy . denovo nt tissue has been commercially available since 2007 and , as of march 2011 , has been implanted in more than 2,200 patients in the united states . preliminary reports have shown promise . in a cohort of 4 patients reporting 24 months after denovo nt implantation , mris showed lesion infilling and pain indices were improved and in a case report of a de novo nt cartilage implantation in the talus , the patient was no longer experiencing ankle pain at 2 years postoperatively . in this case , the denovo nt tissue provided a stable , if heterogeneous , tissue on the lateral side of the osteochondral lesion . the differences between mri and follow - up histology highlight the difficulties in assessment of cartilage repair surgery . this juvenile tissue graft is still offered to patients who meet the indications for cartilage repair and the multicenter denovo nt longitudinal data collection ( ldc ) knee study ending in 2018 should provide a wealth of information on treatment outcomes .	objective : the goal of this report is to describe the outcome of sequential particulated cartilage allograft and autologous osteochondral transfer treatments for an osteochondral lesion of the medial femoral condyle.methods:a 44-year - old woman was treated with a particulated juvenile articular cartilage allograft ( denovo nt ) for a chondral lesion of the knee . as a result of continued pain , she had 2 further surgeries , including an autologous osteochondral transfer system procedure and finally a unicondylar knee arthroplasty . at the final procedure , the areas of the allograft and autograft tissue were biopsied for histological evaluation . the quality of the residual cartilage tissue was assessed first by equilibrium partitioning of an ionic contrast agent via micro computed tomography ( epic-ct ) , and then by hematoxylin and eosin , safranin o staining , and polarized light microscopy.results:despite showing good healing at 7 months postsurgery by mri , at 28 months post denovo nt tissue implantation the excised cartilage tissue was heterogeneous , with some regions of hyaline - like cartilage and some regions of fibrocartilage . the later mosaicplasty may have helped maintain hyaline - like cartilage of the denovo nt tissue in its vicinity.conclusion:this case report describes the cartilage repair tissue produced by denovo nt implantation and compares it with autologous osteochondral plug tissue .
You are an expert at summarizing long articles. Proceed to summarize the following text: in the past few years , in orthodontics , the use of invisible appliances like clear aligners has widely increased especially in adult patients . moreover , other kinds of invisible appliance like insignia ( ormco , west collins orange , ca , usa ) or harmony ( american orthodontist , sheboygan , wisconsin , usa ) are now developing : these appliances are not clear aligners but fully customized lingual brackets and wires that can deliver accurate forces to the teeth . however , both clear aligners and invisible lingual brackets set up their treatment plan only on crown information deriving from scanned plaster models . therefore when a patient is treated with clear aligners , orthodontists do not have either 3d information of dental roots for a treatment plan or root control for an orthodontic movement during therapy [ 3 , 4 ] . this represents an issue considering that the potential consequence of moving teeth buccally ( if roots are in the proximity of the cortical bone ) is that these could be moved too buccally , outside the supporting alveolar bone , creating a dehiscence and a potential gingival recession . this is also an issue because roots could be moved one against the other , causing root resorption or root proximity ( which is a risk factor for progression of alveolar bone loss ) . it is therefore essential to be able to distinguish position and volume of dental roots in order to prevent root and bone resorptions . a further problematic aspect which is becoming increasingly significant not only in orthodontics , but also throughout dentistry is radiation protection in terms of the absorbed dose of x - rays in diagnostic imaging . considering 3d images , cone beam computed tomography ( cbct ) has greatly reduced the dose of x - rays absorbed compared to traditional computed tomography ( ct ) , but still ( even providing a larger number of information than 2d radiographs ) , cbct produces a greater x - ray dose than a panoramic radiograph ( pan ) added to a teleradiography [ 7 , 8 ] . recently , a study has been published showing the correlation between x - ray diagnostic tests used in dentistry and an increased risk of developing meningioma : this is especially true when x - ray exams are performed repeatedly and in young patients . panoramic radiographs however have the disadvantages of no constant magnification , image distortion , and narrow image layer . there are in the literature a few quantitative measurement studies , which evaluate tooth length and mesiodistal root angulation : dimensions in the vertical direction may entail a variable amount of magnification that can be as high as 1727% in the maxillary premolar and 1st molar region with the palatal root having the worst vertical magnification . this is why panoramic radiographs have been of limited use for quantitative studies , preferring 3d imaging or newer technologies instead . lahreim also measured tooth lengths from panoramic radiographs and showed that measurement error varies from 0.43 to 0.56 mm , indicating that the main source of error was the recognition of reference points . it is questionable if it is necessary to get the patient to undergo a cbct or a ct to have 3d information about the shape and volume of dental roots . the aim of this study is to construct a 3d parametric model of teeth , starting from 2d information ( the panoramic radiograph of the patient ) . this has the ultimate goal of simulating a crown - root movement and not only a crown movement during the treatment plan . this has the ultimate goal of simulating a crown - root movement and not only a crown movement during the treatment plan . the methodology used in this study to construct and validate the three - dimensional parametric model involved four phases : 2.1 . construction of the parametric model . 2.4 . optical integration and teeth segmentation from cbct . 2.1 . construction of the parametric model . 2.4 . optical integration and teeth segmentation from cbct . a cbct and a pan were acquired from a patient . the patient , a woman , 24 years old and in good health condition , had given consent for the cbct which was required for the extraction of the lower third molars . she had undergone a previous fixed orthodontic treatment and presented well - aligned arch forms ; no periodontal disease was present and neither was any kind of metal appliances ( retainers , amalgam restorations , implants ) that could interfere with x - rays . the cbct was obtained with a planmeca promax 3d unit , ( planmeca oy , helsinki , finland ) ; cbct data were stored in dicom format and processed to generate volumetric representations of anatomical structures . the cbct scan was necessary for the validation of the study : it was used as a 3d reference model to compare with 2d panoramic measurements . the pan was obtained with a planmeca promax unit ( planmeca oy , helsinki finland ) ; data were stored and processed in dicom format . the panoramic radiograph was used to choose and measure those parameters which control the parametric model . different parameters were considered for each tooth ; these were measured in vivo , from the pan ( figures 1(a ) and 1(b ) ) and from the cbct . measurements were obtained with the already validated method imagej 1.46r ( bethesda , maryland , usa ) a digital software for dicom image processing ; in vivo measures were obtained with a digital caliper : no root measures were taken in vivo . the error method was calculated with dahlberg 's equation , and it resulted in less than 1 mm for each method . historically , dahlberg was the first to provide a formula for repeatability error ; the formula originally described is ( 1)sd=i=1ndi22n , where d is the difference between the pairs of replicate measurements , n is the number of cases , and sd is the statistical estimate of the true error ( standard deviation ) . measures were differentiated according to the number of dental roots ( mono- or multiradicular teeth ) . all the measurements listed below have been carried out by a single person monoradicular equator ( equ ) : widest part of the crown ; where possible distance between contact points has been considered.coronal height ( c - h ) : highest part of the crown , from gingival azimuth to coronal cusp.cement-enamel junction ( cej ) : narrowest part of the crown ; in x - ray images a visual transition from cement to enamel was considered.width of the root ( rad ) : 1 width measurements at half root length.tooth height ( t - h ) : length from the dental apex to the corresponding cusp . equator ( equ ) : widest part of the crown ; where possible distance between contact points has been considered . coronal height ( c - h ) : highest part of the crown , from gingival azimuth to coronal cusp . cement - enamel junction ( cej ) : narrowest part of the crown ; in x - ray images a visual transition from cement to enamel was considered . width of the root ( rad ) : 1 width measurements at half root length . tooth height ( t - h ) : length from the dental apex to the corresponding cusp . multiradicular equator ( equ ) : widest part of the crown ; where possible , distance between contact points has been considered.mesial coronal height ( mc - h ) : length from the mesial cusp to the cej.distal coronal height ( dc - h ) : length from the distal cusp to the cej.cement-enamel junction ( cej ) : narrowest part of the crown ; in x - ray images a visual transition from cement to enamel was considered.distal root width ( drad ) : 1 width measurements of the distal root at half root length.mesial root width ( mrad ) : 1 width measurements of the mesial root at half root length.palatal root width ( prad ) : 1 width measurements of the palatal root at half root length.mesial tooth height ( mt - h ) : length from the mesial root apex to the corresponding cusp.distal tooth height ( dt - h ) : length from the distal root apex to the corresponding cusp.palatal tooth height ( pt - h ) : length from the palatal root apex to the corresponding cusp.furcation height ( h - furc ) : distance between furcation and root apex . equator ( equ ) : widest part of the crown ; where possible , distance between contact points has been considered . mesial coronal height ( mc - h ) : length from the mesial cusp to the cej . distal coronal height ( dc - h ) : length from the distal cusp to the cej . cement - enamel junction ( cej ) : narrowest part of the crown ; in x - ray images a visual transition from cement to enamel was considered . distal root width ( drad ) : 1 width measurements of the distal root at half root length . mesial root width ( mrad ) : 1 width measurements of the mesial root at half root length . palatal root width ( prad ) : 1 width measurements of the palatal root at half root length . mesial tooth height ( mt - h ) : length from the mesial root apex to the corresponding cusp . distal tooth height ( dt - h ) : length from the distal root apex to the corresponding cusp . palatal tooth height ( pt - h ) : length from the palatal root apex to the corresponding cusp . furcation height ( h - furc ) : distance between furcation and root apex . the parametric model was generated with the use of solidworks ( dassault systmes solidworks corp . , concord , ma , usa ) , which is a cad software that can create 2d and 3d surfaces and objects . several b - spline curves or control curves have been determined : a spline curve is defined by a function composed by a set of polynomials connected to each other . the purpose of these polynomials is to connect a set of points ( called nodes of the spline ) in a single interval so that the curve is continuous at each point of the range . spline curves are therefore defined by specific points ( nodes ) that are determined by the operator according to previously defined parameters . in this study , tooth geometry was modeled through b - spline curves ( two - dimensional ) and by the aid of nurbs ( nonuniform rational basis splines ) , which are free - form surfaces ( three - dimensional ) . the modeling approach is therefore parametric : measures from the panoramic radiograph have been defined as general control parameters for tooth models . this allows the construction of a 3d virtual model simply by inserting data measured from the panoramic radiograph . in this study we have constructed two models : a model of a monoradicular tooth ( maxillary incisor , tooth 2.1 ) and a model of a multiradicular tooth ( mandibular molar , tooth 3.6 ) . the parametric model of the maxillary incisor was made by 3 closed b - spline curves to define the root width ; the crown was modeled with a free - form surface bounded by 4 b - spline curves , which defined its width and its depth . the control parameters used weret - h to define the overall height of the tooth;cej to define the diameter of the circle connecting the root to the crown;equ to define the width of the crown;c - h to set the height of the crown;rad to define root width . t - h to define the overall height of the tooth ; cej to define the diameter of the circle connecting the root to the crown ; equ to define the width of the crown ; c - h to set the height of the crown ; rad to define root width . the relationship between the parameters used and the not specifically defined sizes has been chosen on a statistical basis from the literature ( or databases ) and maintained as constant as possible ( figure 2 ) multiradicular . the mandibular molar parametric model was constructed using revolution surfaces for the roots : these were obtained by using b - splines as profile curves . the crown was modeled with free - form surfaces bounded by six curves : three closed b - spline curves for the tooth cross - sections and three open b - spline curves for the tooth profile , width , and depth . the control parameters used weremt - h and dt - h to define the height of the tooth;cej to define the width of the connection curve between root and crown;equator to define the width of the crown;dc - h and mc - h to define the coronal heights;drad and mrad to set mesial and distal root widths . mt - h and dt - h to define the height of the tooth ; cej to define the width of the connection curve between root and crown ; equator to define the width of the crown ; dc - h and mc - h to define the coronal heights ; drad and mrad to set mesial and distal root widths . the relationship between the parameters used and the not specifically defined sizes has been chosen on a statistical basis from the literature ( or databases ) and maintained as constant as possible ( figure 3 ) . segmentation of a digital image is the process of partitioning this image into significant regions . it is used to obtain more compact representations in order to extract objects or to analyze images . there are different ways to obtain a segmentation , and usually in orthodontics the aim in using segmentation is the partition of dental crowns for the simulation of tooth movement [ 19 , 20 ] . in this study segmentation was obtained through the identification of a reference threshold value ; the accuracy of 3d models segmented from cbct is strongly influenced by acquisition parameters and reconstruction settings ; a volumetric representation is the result of a threshold value entered by the user according to the visual segmentation of different tissues ( it may therefore be subjected to mistakes and inaccuracies ) . in this study , polyether impressions of the patient were taken , poured in cast , and scanned ( using dental vision - scansystems s.r.l . , cascina , italia , an optical scanner that has an overall accuracy of 0.01 mm [ 2224 ] ) : dicom images have been segmented using 3d scanned models as a reference . the optimal threshold value has been calculated through superimposition of 3d scanned models and cbct ; in such way any difference between the two different scanning technologies has been minimized ( figure 4 ) . the purpose of segmentation was to isolate a maxillary incisor and a mandibular molar from the cbct . the 3d segmented models were superimposed to the parametric models of the corresponding teeth so the accuracy level could be verified . segmentation was performed using the software amira 5.4.3 ( visage imaging corp , san diego , ca , usa ) ( figures 5(a ) and 5(b ) ) , which is a validated method [ 26 , 27 ] . it was necessary to calculate a scaling factor ( 0.313854 ) to make a comparison between cbct measures and all other measures possible . above all it was necessary to verify values distribution ; the shapiro - wilk test was applied to cbct data , to pan data , and to their difference : it showed that they are not normally distributed ; moreover , it was not possible to normalize them through a logarithmic transformation . the wilcoxon signed - rank test , applied to the outcome of the two variables ( cbct and pan ) , was not significant ( p = 0.5227 ) . the same test was used to verify differences between upper and lower dental arches , and in both cases it is not significant ( upper arch p = 0.0678 , lower arch p = 0.3588 ) . the kruskal - wallis test , applied to analyze differences between groups of teeth , also was nonsignificant ( p = 0.0709 ) . cbct and pan were found statistically comparable for all root and crown measures , with no difference in maxillary and mandibular arches and in different groups of teeth . the shapiro - wilk test was then applied to in vivo , cbct , and pan crown measures : it showed that these data were not normally distributed . the kruskal - wallis test was applied on all four methods , and it was nonsignificant ( p = 0.1135 ) meaning that also crown measures are all statistically comparable . the wilcoxon signed - rank test was then applied to crown measures to verify differences in pairs of methods : it still resulted in an insignificance for cbct and pan ( p = 0.9494 ) , for cbct and in vivo ( p = 0.0490 ) , and for pan and in vivo ( p = 0.0259 ) measures . parametric models and segmented models were superimposed using geomagic ( geomagic qualify 2012 , nc , usa ) ( figures 6(a ) , 6(b ) , and 6(c ) ) , a dedicated software which enables both the superimposition and the dimensional comparison . during alignment a best - fit algorithm was used to minimize the models overlap . with geomagic views of the dimensional comparisons were obtained : the figures show the mesial , buccal , and distal views of the maxillary incisor ( figures 7(a ) , 7(b ) , and 7(c ) ) and the mesial and distal views of the mandibular molar ( figures 8(a ) and 8(b ) ) . the dimensional comparison must be interpreted according to colors : in presence of warm colors there is an area of excess parametric model with respect to the segmented model ; cold colors , on the other hand , represent a lacking area of the parametric model compared to the segmented model . the maxillary incisor model on the mesial side ( figure 7(a ) ) has an overall gap of 0.8 mm compared to the segmented model ; the discrepancy increases at the apex level with a model excess , which arrives up to 1.1 mm . on the buccal side ( figure 7(b ) ) the distal side presents a discrepancy that goes from 0 to 1.6 mm : maximum error is at the cement - enamel junction level . the mandibular molar model ( figures 8(a ) and 8(b ) ) it presents areas with a 00.5 mm gap ( lingual side ) and areas where the discrepancy arrives up to 2 mm ( vestibular and occlusal side ) . to define the accuracy level it is necessary to analyze errors , which may be intrinsic to the method : data acquisition errors , segmentation process errors , and errors due to model alignment . regarding the data acquisition process , according to the literature , cbct can be used for dental measurements with an acceptable accuracy level , while images from a panoramic radiograph may be distorted . in the present study reference points and measuring methods proved to be reliable : dhalberg 's equation resulted in less than 1 mm for each method . moreover , the risk of panoramic radiograph deformation had been taken into account : all measurements were compared with cbct and statistics resulted nonsignificant , as a consequence the parametric model could be constructed . parametric models of only two teeth were constructed ( this is a preliminary study ) but all teeth were measured : this was necessary to provide a sufficient amount of data for a valid statistic - test on panoramic radiograph accuracy . segmentation was performed with particular attention to the threshold value : the most accurate threshold value possible was obtained by superimposing the scanned model and the cbct . furthermore , the literature shows that the difference between the volume of extracted teeth and cbct - segmented teeth varies from 4% to 7% , a value that is clinically acceptable if the purpose is the simulation of tooth movement . finally , the superimposition and the dimensional comparison of the models were performed using a best - fit algorithm , which minimizes models alignment error . the models alignment error is therefore the minimum possible and depends just on how different the models are between them : if the models were the same , the error would be zero . the alignment error is comparable to the error detected by the comparison of the two models superimposed ( in this case , from 0 to 1.6 mm for the incisor and from 0 to 2 for the molar ) . in this study we obtained only mesio / distal measurements : we are not able to achieve buccal / lingual measures from a pan . the only way to verify the buccal / lingual accuracy level is with the superimposition of the two models ( figures 7(a ) , 7(b ) , 7(c ) , 8(a ) , and 8(b ) ) that show that the model can be superimposed to a segmented tooth with a clinically valid accuracy at root level . the crucial point of this study was the root model : the crown model was not developed as much in detail because it will be integrated with a more precise 3d scanned model . have published a study the aim of which is the reconstruction of dental roots directly on the scanned model : their study presents more accurate and reliable results than those presented in this study ( average discrepancy of 0.025 0.007 mm ) , but their method contemplates the use of cbct in every patient and therefore an increased dose of radiation that should be justified . recent studies have also shown that a cbct needs to be interpreted by a person trained in advanced interpretation techniques in radiology because of the wide scope of incidental findings noted on these scans : this methodology would be an easier and safer way both for clinicians and patients to access 3d root information . the parametric model shown in this study was comparable with the segmented model with a final , clinically acceptable error ; however , it is simplified : any curves or root malformations are undetectable . the patient had well - aligned teeth ; how would the parametric model work if there were rotations in teeth or overlaps due to crowding or ectopic eruption ? and what about measures for those teeth that according to the literature have the worst vertical magnification in panoramic radiographs ? we do believe that having the scanned plaster models and merging them with the parametric models will help reduce root errors even in displaced teeth . more studies are necessary and are already underway to make the construction of more accurate and reliable models possible , in order to construct and validate all teeth from all quadrants . this preliminary study showed a new method , which makes possible the construction of a three - dimensional parametric model . above all , the importance of this method is the reduction of the radiation dose because it provides 3d information of dental roots without using cbct , with benefits for patients ' health . the models have an accuracy level that is statistically and clinically acceptable ; however , the quality of the crown of the parametric model is poor , and room for improvement still exists . further studies are necessary and are underway in order to build models for every tooth and to reconstruct the entire dental arch .	objectives . to build a 3d parametric model to detect shape and volume of dental roots , from a panoramic radiograph ( pan ) of the patient . materials and methods . a pan and a cone beam computed tomography ( cbct ) of a patient were acquired . for each tooth , various parameters were considered ( coronal and root lengths and widths ) : these were measured from the cbct and from the pan . measures were compared to evaluate the accuracy level of pan measurements . by using a cad software , parametric models of an incisor and of a molar were constructed employing b - spline curves and free - form surfaces . pan measures of teeth 2.1 and 3.6 were assigned to the parametric models ; the same two teeth were segmented from cbct . the two models were superimposed to assess the accuracy of the parametric model . results . pan measures resulted to be accurate and comparable with all other measurements . from model superimposition the maximum error resulted was 1.1 mm on the incisor crown and 2 mm on the molar furcation . conclusion . this study shows that it is possible to build a 3d parametric model starting from 2d information with a clinically valid accuracy level . this can ultimately lead to a crown - root movement simulation .
You are an expert at summarizing long articles. Proceed to summarize the following text: [ psi ] is the prion form of the translational release factor , sup35 . variants of [ psi ] are frequently distinguished on the basis of the level of cellular sup35 protein in the aggregated prion vs. soluble non - prion form . in addition , other properties can further distinguish variants that have identical levels of soluble sup35 . strong [ psi ] variants have less soluble sup35 than do weak [ psi ] variants . thus the strong variants have less functional sup35 termination factor available and cause readthrough of premature nonsense codon mutations ( i.e. , nonsense suppression ) more efficiently than weak [ psi ] variants . while strong [ psi ] variants have more aggregated prion protein , the protein aggregates are composed of detergent resistant oligomers that are smaller in size than the corresponding oligomers in weak [ psi ] variants . indeed , there are on average more prion seeds in strong [ psi ] variant cells than in weak [ psi ] variant cells . the larger number but smaller size of the strong [ psi ] seeds , is because their fibers break more easily than the weak [ psi ] fibers . since prions grow at their fiber ends , strong [ psi ] , grows more rapidly than weak [ psi ] and thus have less soluble / functional sup35 . [ pin ] , the prion form of the rnq1 protein , was initially uncovered by its ability to dramatically increase the de novo appearance of [ psi ] when sup35 is overexpressed . [ pin ] variants were first distinguished on the basis of the ( low , medium , high , and very high ) efficiency with which they promoted [ psi ] appearance . [ pin ] variants also differ in the amount of aggregated vs. soluble rnq1 protein and the size and number of fluorescent dots that appear when rnq1:gfp is overexpressed . however , these characteristics do not correlate with the efficiency with which the variants promote the induction of [ psi ] ( see table 1 ) . the ability of [ pin ] to promote the de novo appearance of [ psi ] could not result from inactivation of the aggregated rnq1 protein because a deletion of rnq1 does not promote the efficient induction of [ psi ] . we thus proposed that in addition to self - seeding , [ pin ] can also cross - seed the de novo conversion of the heterologous sup35 prion protein into the [ psi ] prion . the frequency of the cross - seeding was proposed to be much less efficient than self - seeding , and to depend on the conformation of the specific [ pin ] prion variant used . another possibility also proposed is that the [ pin ] prion aggregate binds to a prion inhibitor , titrating it away from the cytosol resulting in the more frequent conversion to the prion state . support for the cross - seeding model comes from in vitro demonstrations that prion fibers can promote the aggregation of heterologous prion protein . furthermore , sonication of the fibers not only increases its ability to self - seed , but also enhances its ability to promote the aggregation of heterologous protein . in addition , another group showed that low level expression of a fusion of sup35 and rnq1 dramatically increases the de novo appearance of [ psi ] in the presence of [ pin ] . this can be explained by the cross - seeding model since the rnq1 in the fusion is expected to join the [ pin ] aggregate thereby bringing the soluble sup35 in the fusion in contact with [ pin ] , where it can be cross - seeded . support for the chaperone titration model has come from the findings that amyloid aggregates bind to and titrate chaperones away from the cytosol . it is also possible that both mechanisms contribute to the increased de novo appearance of the heterologous prion . in our recent article we investigated why some [ pin ] variants cause the appearance of [ psi ] more efficiently than other [ pin ] variants in terms of the cross - seeding model . we hypothesized that the cross - seeding event contains two steps : ( 1 ) binding of soluble sup35 to the [ pin ] seed and ( 2 ) conversion of the bound sup35 to the prion state ( see fig . 1 ) . if the major difference between the efficiency of the [ pin ] variants were due to differences in the efficiency of binding of sup35 to the [ pin ] cross - seed ( step 1 ) we reasoned that the different [ pin ] variants would be immune - captured with sup35 with different efficiencies . furthermore the number of [ pin ] seeds per cell characteristic for each [ pin ] variant , as determined by a genetic method , also did not correlate with their efficiency of [ psi ] induction ( table 1 ) . taken together , this indicates that [ pin ] variant - specific differences are not caused by differences in the ability of sup35 to bind to the growing fiber ends of [ pin ] aggregates . model showing preferential seeding of specific [ psi ] variants by [ pin ] variants at different temperatures . very high and high [ pin ] prion domains are cartooned as parallel in register sheets ( black bars ) with non- sheet loops in variant - specific positions . the sup35 prion domain ( gray ) is preferentially cross seeded into parallel in register sheets ( gray bars ) by different lengths of sheet regions available in high and very high [ pin ] . in the left , sup35 is shown to first bind to the [ pin ] aggregates ( step 1 ) . only then does the [ pin ] amyloid region convert the sup35 into amyloid ( step 2 ) . due to the interference of its non- sheet loop , very high [ pin ] preferentially seeds strong [ psi ] , with a small -sheet core which is vulnerable to sheering and the production of the smaller aggregates characteristic of strong [ psi ] . high [ pin ] , which has a larger uninterrupted -sheet region , preferentially seeds weak [ psi ] with a large -sheet core . at 4 c , soluble sup35 is shown forming a nucleus that interferes with the initial sheet conversion even when seeded by high [ pin ] . this results in the formation of a smaller sheet - core and the induction of strong [ psi ] . evidence for the in vitro formation of such a sup35 nucleus at 4 c has been presented . we also examined chaperones known to affect the propagation of prions , but found no differences in the levels of the chaperones hsp104 , sis1 , or ssa1 associated with the different [ pin ] variant aggregates . the above results suggested to us that the distinctions between the [ pin ] variants may reflect their different abilities to convert bound sup35 into the prion conformation ( step 2 ) . if this were true , we reasoned that the [ pin ] variants may not only differ in the efficiency with which they convert soluble sup35 to a prion , but may also differ in their preference to convert sup35 into particular [ psi ] variants . more weak than strong [ psi ] variants were induced in the presence of low and high [ pin ] variants , while the reverse was true in the presence of very high [ pin ] ( table 1 and fig . 1 ) . to determine if the [ pin ] variant aggregates themselves were sufficient to control the spectrum of [ psi ] variants induced , we set up an in vitro system . as expected , low , high , and very high [ pin ] aggregates made in vitro promoted the conversion of soluble sup35 to amyloid . however , when the in vitro seeded sup35 amyloid was transformed back into [ psi ] yeast , where the [ psi ] variant induced could be scored , we found no preference for induction of weak vs. strong [ psi ] by any of the [ pin ] variants . clearly other cellular factors not present in the in vitro system were necessary for the variant - specificity of cross - seeding seen in vivo . incubation of soluble sup35 at 4 c in vitro in the absence of any seed , has been shown to promote the appearance of strong [ psi ] , while incubation at higher temperatures preferentially causes the appearance of weak [ psi ] . in contrast , once fibers are formed , they seed the formation of fibers with their variant specificity despite the incubation temperature . here were show that temperature also exerts a strong effect in vivo on the variants of [ psi ] preferentially induced in the presence of high [ pin ] ( figs . 1 and 2 ) . weak [ psi ] appeared preferentially when cells overexpressing sup35 were incubated at room temperature , 30c , or 37c . however high [ pin ] variant by overexpressing the prion and middle domains of sup35 fused to gfp under the control of a copper promoter from plasmid pcup1-sup35nm - gfp . induction was in plasmid selective glucose medium supplemented with 50 m copper at room temperature ( rt ) , 30 c and 37 c for 48 h , and at 4 c for one week . to score for the variant of [ psi ] induced we made use of the nonsense suppressible allele , ade114 present in our yeast strain . the standard colony color assay for suppression of ade114 was used : [ psi ] colonies are red , weak [ psi ] colonies are pink , strong [ psi ] colonies are white . these colors reflect the level of readthrough of the ade114 nonsense mutation caused by the appearance of [ psi ] and inactivation of the sup35 , translational release factor . it remains to be determined if temperature ( a ) exerts its effect indirectly by changing the concentration of chaperones and other cellular proteins , ( b ) directly alters the conformation of the [ pin ] seed , or ( c ) alters the conformation of soluble sup35 as depicted in figure 1 and previously proposed to explain the in vitro results . whatever the case , it is clear that both intra- and extracellular factors influence the frequency of induction of specific heterologous prion variants . while the work shown here is specific for effects of temperature , other stresses on the cell such as oxidative stress my also influence the preference for the appearance of specific prion variants . since variants have different effects on the cells , the environment could select for variants that promote survival . the data presented in our recent article supports the cross - seeding model and suggests that variant differences occur at the second step of cross - seeding . indeed , different [ pin ] variants appeared identical in the efficiency of the first step in cross - seeding , the binding of soluble sup35 to [ pin ] fiber . furthermore , cross - seeding efficiencies did not reflect differences in the average number of [ pin ] prion seeds per cell characteristic for the variant . rather , the second step in cross - seeding , the actual conversion of the bound sup35 to an amyloid conformation , is implicated as the mechanism of [ pin ] variant differences . in this case the shape of the cross - seeding [ pin ] variant would be intrinsically more or less capable of converting bound heterologous sup35 into the [ psi ] prion . this is further supported by our finding that the [ pin ] prion variant used as the cross - seed affects the kinds of [ psi ] variant preferentially induced . in contrast , since none of the chaperones tested were preferentially titrated into one vs. another [ pin ] variant , there is no evidence supporting the titration model . other cellular stressors may also influence the type of prion variant induced . if so the environment could preferentially induce prions that provide an advantage in the stress condition . these findings are likely to be relevant to the de novo formation of amyloid aggregates of specific proteins associated with other neurodegenerative diseases . whether amyloid aggregates of a single protein can always form distinct variants associated with different disease characteristics remains to be determined . evidence already hints that disease associated amyloid aggregates can cross - seed the de novo appearance of amyloid aggregates associated with a different disease .	prions are protein conformations that self - seed the misfolding of their non - prion iso - forms into prion , often amyloid , conformations . the most famous prion is the mammalian prp protein that in its prion form causes transmissible spongiform encephalopathy . curiously there can be distinct conformational differences even between prions of the same protein propagated in the same host species . these are called prion strains or variants . for example , different prp variants are faithfully transmitted during self - seeding and are associated with distinct disease characteristics . variant - specific prp prion differences include the length of the incubation period before the disease appears and the deposition of prion aggregates in distinct regions of the brain.1 other more common neurodegenerative diseases ( e.g. , alzheimer disease , parkinson disease , type 2 diabetes and als ) are likewise caused by the misfolding of a normal protein into a self - seeding aggregate.2 - 4 one of the most important unanswered questions is how the first prion - like seed arises de novo , resulting in the pathological cascade .
You are an expert at summarizing long articles. Proceed to summarize the following text: eczema is the most common dermatological disorder of the hands , with an annual prevalence of up to 12% and 16% in parts of europe and the united states , respectively.1,2 hand eczema is characterized by vesicles , papules , erythema , edema , scaling , fissures , and hyperkeratosis , as well as pruritic and painful symptoms.3,4 while there is no specific morphological classification system , clinical subtypes include vesicular , atopic , endogenous , discoid , acral , irritant , pompholyx , and hyperkeratotic eczema.5 included in the differential diagnosis are irritant contact dermatitis , allergic contact dermatitis , endogenous eczema , psoriasis / pustulosis , fungal infection , keratoderma , lichen planus , and granuloma annulare.6 hand eczema has a multi - factorial etiology , involving both endogenous and exogenous factors.7 the primary endogenous predisposing factor is a history of atopy , which is the underlying etiology in as high as 50% of affected individuals.3 genetic inheritance also plays a role , as demonstrated by a recent population - based twin cohort study.8 exogenous factors primarily include exposure to irritants ( ie , food , oils , soap , solvents ) , and contact allergens ( ie , nickel , chromate , rubber ) . occupational exposure to these causative agents , primarily among dressers , cooks , healthcare workers , for example , are the most common causes of hand eczema.9 the interrelatedness of these etiologies renders it difficult to isolate and remove the offending agents , and is therefore a factor for development of hand eczema into a chronic , relapsing course . when hand eczema persists for more than 6 months despite therapeutic measures , it is considered to be a chronic form.6 this variant of hand eczema develops in 5% to 7% of affected individuals and has significant social , psychological , occupational , and economic impacts.10,11 not only does this painful condition affect the utility of the hands in performing mechanical work , but the often disfiguring manifestations lead to negative social stigmata.3 a recent cross - sectional , multi - center study of 416 patients demonstrated that affected individuals had a significantly decreased quality of life , which was directly correlated to the severity of their disease.12 a broad variety of both pharmacological and non - pharmacological strategies exist for the management of chronic hand eczema . these are usually delivered in a step - wise approach and begin by lifestyle modifications , including educating the patient about the avoidance of irritants and allergens , the avoidance of occupational - related irritation , and the use of emollients.6 a recent clinical study demonstrated that petroleum - based emollients and skin lipid - based emollients are equally effective therapeutic measurements for hand eczema , and patients should be encouraged to use them as an adjunct to other therapies.13 topical steroids are usually the first - line pharmacological measure , but their use is limited by the adverse effects of skin atrophy , tachyphylaxis , potential adrenal suppression , and their futility in treating severe manifestations.14,15 phototherapy with uva-1 and uvb has been successfully used in the treatment of chronic hand eczema , but the inadequacy of evidence - based trials has limited its use.16,17 systemic oral immunosuppressants , such as azathioprine , ciclosporin , and mycophenolate mofetil , have also been used with various responses . however , most of these are not licensed for the treatment of chronic hand eczema , owing to the lack of clinical evidence supporting their lack of efficacy and safety . oral corticosteroids are also an option , but their long - term use is limited by well - studied adverse affects such as osteoporosis , hyperglycemia , cataracts , hypertension , and immunosuppression.18 a recent epidemiological study reviewing various clinical trials from 1977 to 2003 , which mostly involved the use of the above - mentioned topical steroids , systemic immunosuppressants , and uv irradiation , concluded that the poor quality of the studies was not sufficient to dictate clinical management of chronic hand eczema.19 the high prevalence of chronic hand eczema , its adverse impact on quality of life , and its failure to respond to standard therapeutic measures has ignited much recent interest in the search for an effective and tolerable medication . eczema is the most common dermatological disorder of the hands , with an annual prevalence of up to 12% and 16% in parts of europe and the united states , respectively.1,2 hand eczema is characterized by vesicles , papules , erythema , edema , scaling , fissures , and hyperkeratosis , as well as pruritic and painful symptoms.3,4 while there is no specific morphological classification system , clinical subtypes include vesicular , atopic , endogenous , discoid , acral , irritant , pompholyx , and hyperkeratotic eczema.5 included in the differential diagnosis are irritant contact dermatitis , allergic contact dermatitis , endogenous eczema , psoriasis / pustulosis , fungal infection , keratoderma , lichen planus , and granuloma annulare.6 hand eczema has a multi - factorial etiology , involving both endogenous and exogenous factors.7 the primary endogenous predisposing factor is a history of atopy , which is the underlying etiology in as high as 50% of affected individuals.3 genetic inheritance also plays a role , as demonstrated by a recent population - based twin cohort study.8 exogenous factors primarily include exposure to irritants ( ie , food , oils , soap , solvents ) , and contact allergens ( ie , nickel , chromate , rubber ) . occupational exposure to these causative agents , primarily among dressers , cooks , healthcare workers , for example , are the most common causes of hand eczema.9 the interrelatedness of these etiologies renders it difficult to isolate and remove the offending agents , and is therefore a factor for development of hand eczema into a chronic , relapsing course . when hand eczema persists for more than 6 months despite therapeutic measures , it is considered to be a chronic form.6 this variant of hand eczema develops in 5% to 7% of affected individuals and has significant social , psychological , occupational , and economic impacts.10,11 not only does this painful condition affect the utility of the hands in performing mechanical work , but the often disfiguring manifestations lead to negative social stigmata.3 a recent cross - sectional , multi - center study of 416 patients demonstrated that affected individuals had a significantly decreased quality of life , which was directly correlated to the severity of their disease.12 a broad variety of both pharmacological and non - pharmacological strategies exist for the management of chronic hand eczema . these are usually delivered in a step - wise approach and begin by lifestyle modifications , including educating the patient about the avoidance of irritants and allergens , the avoidance of occupational - related irritation , and the use of emollients.6 a recent clinical study demonstrated that petroleum - based emollients and skin lipid - based emollients are equally effective therapeutic measurements for hand eczema , and patients should be encouraged to use them as an adjunct to other therapies.13 topical steroids are usually the first - line pharmacological measure , but their use is limited by the adverse effects of skin atrophy , tachyphylaxis , potential adrenal suppression , and their futility in treating severe manifestations.14,15 phototherapy with uva-1 and uvb has been successfully used in the treatment of chronic hand eczema , but the inadequacy of evidence - based trials has limited its use.16,17 systemic oral immunosuppressants , such as azathioprine , ciclosporin , and mycophenolate mofetil , have also been used with various responses . however , most of these are not licensed for the treatment of chronic hand eczema , owing to the lack of clinical evidence supporting their lack of efficacy and safety . oral corticosteroids are also an option , but their long - term use is limited by well - studied adverse affects such as osteoporosis , hyperglycemia , cataracts , hypertension , and immunosuppression.18 a recent epidemiological study reviewing various clinical trials from 1977 to 2003 , which mostly involved the use of the above - mentioned topical steroids , systemic immunosuppressants , and uv irradiation , concluded that the poor quality of the studies was not sufficient to dictate clinical management of chronic hand eczema.19 the high prevalence of chronic hand eczema , its adverse impact on quality of life , and its failure to respond to standard therapeutic measures has ignited much recent interest in the search for an effective and tolerable medication . oral alitretinoin ( 9-cis - retinoic acid ; toctino ; basilea pharmaceuticals , ltd . , united kingdom ) , an endogenous retinoid , is the only drug that has been specifically approved as a treatment option for adults with chronic hand eczema unresponsive to topical steroids.6 retinoids are naturally occurring and synthetic derivatives of vitamin a , which plays an important role in the immune system by enhancing cytotoxicity , t - cell proliferation , and , under some conditions , b - cell proliferation.20 concurrently , retinoids are also involved in fetal development , bone formation , cell proliferation , cell differentiation , apoptosis , hematopoiesis , and vision.21 these influences are mediated through the binding and subsequent activation of two types of intracellular receptors : retinoic acid receptors ( rars ) and retinoid x receptors ( rxrs ) , which each contain three different subgroups , , , and .22,23 while other retinoids are limited in their binding to subgroups of either rars or rxrs , alitretinoin is a unique panagonist that binds to all six retinoid receptors with high affinity , with a greater affinity for rars than for rxrs.24 given its effects on cell proliferation , alitretinoin is a potent teratogen and is therefore contraindicated in pregnant women and women who might become pregnant during the course of treatment.25 moreover , studies on rat embryos have demonstrated that it can cause deleterious malformations at the second visceral arch.26 alitretinoin s effects on cell proliferation have been exploited for beneficial effects as well ; a recent study demonstrated its ability to induce apoptosis in breast cancer cells.27 in addition to exerting its effects on cell proliferation , alitretinoin has also been shown to produce an anti - inflammatory response by inhibiting the production of nitric oxide and such proinflammatory molecules as tumor necrosis factor ( tnf)- , interleukin ( il)-1 , and il-12 p40.28 since eczema is mediated through the th1 cellular immune response , the inhibition of these cytokines by alitretinoin could explain its therapeutic efficacy . the immunological manipulation by oral alitretinoin was also the basis for two phase ii trials in the treatment of aids - related kaposi s sarcoma , a cutaneous tumor mediated by hhv-8 . 60 and 57 participants received treatment for a median of 15 weeks , with an overall response rate of 37% and 39% , respectively . yet despite its efficacy , the investigators concluded that serious adverse events at high doses , such as pancreatitis and hypercalcinuria , limit its potential use for the treatment of kaposi s sarcoma.29,30 the metabolic effects of alitretinoin have also been extensively studied . it was recently shown to increase sex steroid synthesis in the rat hippocampus and therefore play a role in reproductive behavior.31 it was also shown to have protective effects against ischemia - induced brain injury in rats , with implications for its use in patients susceptible to strokes.32 oral alitretinoin has only been clinically approved for its use in chronic hand eczema , but recent studies have demonstrated its potential use in other dermatologic settings . in a small study with six patients who were treated for the hand eczema , alitretinoin was also shown to be effective in treating lesions of their extrapalmar atopic eczema.33 furthermore , a recent case report of two patients treated with alitretinoin for palmoplantar hyperkeratotic - rhagadiform had a surprising clinical improvement of their sezary syndrome and mycosis fungoides , implicating its potential use for cutaneous t - cell lymphomas.34 while alitretinoin potentially has profound dermatological and non - dermatological applications , this review focuses on its treatment for chronic hand eczema . in a pilot open - label study in 1999 , thirty - eight patients ( 19 men and 19 women ) with chronic hand eczema unresponsive to conventional treatment were treated with 2040 mg of oral alitretinoin for 1 to 5 months.25 the various classifications of their hand eczema included hyperkeratotic palmar eczema , fingertip eczema , pompholyx , and discoid eczema . lesions and symptoms consisting of erythema , vesicles / papules , desquamation , hyperkeratosis , rhagades , and pruritis / pain , were objectively recorded by the physicians on a 4 point scale ( 0 = none , 1 = slight , 2 = moderate , 3 = marked , 4 = severe ) , and the reduction of their total score was expressed in a percentage . side effects , such as headache , chelitis , conjunctivitis , and other mucocutaneous manifestations , were similarly recorded on a 4 point scale . objective assessment by the physicians determined that 55% of the patients showed a very good response , 34% showed a the mean reduction of the total lesions and symptoms was 86% in the 36 patients who responded to treatment , with all various forms responding in a similar manner . subjective assessment by the patients yielded similar results , as 66% believed they showed a very good response , 26% believed they showed a good response , 1 felt a 7 patients experienced a recurrence of their lesions after discontinuation of the therapy , but a second regimen of treatment resulted in a successful response similar to the first course , thereby demonstrating a lack of resistance to the medication . only mild side effects related to hypervitaminosis a were noted , namely transient headache , chelitis , transient flushing , and conjunctivitis . overall , the pilot study demonstrated the efficacy of alitretinoin , as 89% of the patients assessed by the physician and 92% assessed by the patients showed a positive therapeutic response with minimal side effects . in a larger randomized , double - blind , placebo - control study in 2004 , alitretinoin was again determined to be an efficacious and well - tolerated treatment for the treatment of refractory chronic hand eczema.35 the study was held in 43 clinics across europe , enrolling 319 patients with moderate or severe refractory chronic hand eczema . patients were randomized into four treatment groups of placebo , 10 mg , 20 mg , and 40 mg of oral alitretinoin taken once a day for 12 weeks , and assessed at the end of the study as well as at a 3 month follow - up . the primary efficacy measure for the therapeutic response used by the researchers were the physician s global assessment ( pga ) of overall severity , which was categorized into clear , patients were considered to be responders if they were rated as clear ( no residual visible dermatitis ) or almost clear ( minimal erythema and/or scaling ) at the end of the 12-week study . the total lesion symptom score ( tlss ) , the patient s global assessment ( paga ) of improvement , and the extent of disease were used as secondary efficacy measures . at the end of the study , the pga assessment yielded results of 27% , 39% , 41% , and 53% responders to placebo , 10 mg , 20 mg , and 40 mg doses , respectively . the researchers suggested that the response rate in the placebo group may be related to a variety of factors such as the natural course of the disease , placebo effects , or changes in influential factors of the disease ( eg , climate , level of stress , occupation ) . the cochran armitage trend test demonstrated a significant dose - dependent effect ( p < 0.001 ) . the paga assessment yielded similar results of 12% , 29% , 34% , and 43% responders to the placebo , 10 mg , 20 mg , and 40 mg doses , respectively , which was shown to be significant by test ( p = 0.01 for 10 mg , p = 0.002 for 20 mg , and p < 0.001 for 40 mg ) . for all dosages of alitretinoin , the median tlss was higher compared to placebo ( decreases of 25% , 59% , 52% , and 70.5% for the placebo , 10 mg , 20 mg , and 40 mg doses , respectively ) . these results were shown to be significant ( p < 0.001 ) with the kruskal wallis test , and showed dose - dependence ( p < 0.001 ) with the jonckheere safety evaluation of the drug at a 4 week follow - up revealed adverse effects only in the 40 mg dosage group , which included headache , flushing , hyperlipidemia , decreased hemoglobin level , and decreased free thyroxin level . three months after cessation of treatment , it was revealed that 26% of patients relapsed in a dose - independent manner . overall , this study demonstrated that alitretinoin at well - tolerated doses effectively resulted in positive responses in up to 53% of patients and up to a 70% mean reduction in signs and symptoms . in 2008 , the results of a large , randomized , double - blind , placebo - controlled , parallel - group phase iii study , the benefit of alitretinoin in chronic hand dermatitis ( bach ) , were published.36 the study was conducted in 111 clinics throughout europe and canada , enrolling 1032 patients with severe refractory chronic hand eczema . the patients were randomized to three treatment groups of placebo ( n = 205 ) , 10 mg ( n = 418 ) , or 30 mg ( n = 409 ) of oral alitretinoin administered once daily for up to 24 weeks . patients stopped treatment if they responded within the first 12 weeks , while the others continued for the full duration of the study . the types of chronic hand eczema included hyperkeratotic , pompholyx , fingertip , and other , which was seen in 85% , 27% , 46% , and 14% of patients , respectively . as with the previous study , the investigators used pga as the primary efficacy parameter , whereby patients were considered to be responders if they were rated as clear or almost clear . the results of the investigation were concordant with the results in the previous study in 2004 . the pga results demonstrated a dose - dependent efficacy with 48% , 28% , and 17% responders in the 30 mg , 10 mg , and placebo group , respectively . these results were confirmed by the secondary endpoints ; the percentage of patients with clearing as determined by the paga were 40% , 24% , and 15% , and the median percentage reductions in mtlss were 75% , 56% , and 39% in the 30 mg , 10 mg , and placebo groups respectively . there was not a uniform response rate amongst the various morphological classifications of hand eczema . for instance , in the 30 mg treatment group , there was a 49% response rate in those with hyperkeratotic features and a 33% response rate in those with the pompholyx variant . however , these classifications were not mutually exclusive so it would not be feasible to conclude that alitretinoin is more effective in one variant over the other . there was also a dose - dependence seen with the time to response , as it was significantly shorter in the 30 mg group than the 10 mg group ( p < 0.001 ) . the median time to relapse , which the investigators defined as a recurrence of 75% of the initial signs and symptoms in the absence of treatment , was 5.5 to 6.2 months . adverse events were seen in 49.5% , 37.1% , and 34.5% of the respective treatment groups , of which headache was the most commonly reported . serious adverse events were minimal , with only 1% of patients in each treatment group reporting such a problem . one fatal event was reported in the 10 mg group , although it was from a myocardial infarction unrelated to treatment . typical retinoid - related laboratory abnormalities were noted , which included increases in serum cholesterol and triglyceride levels , and decreases in thyroid - stimulating hormone ( tsh ) . as the largest clinical investigation on chronic hand eczema to date , this study demonstrated promising results of dose - dependent efficacy of oral alitretinoin that were consistent with previous studies . in 2009 , the results of an extension of the bach study were published.37 this investigation examined the efficacy and safety of oral alitretinoin in patients who initially responded well to treatment in the bach study , but had relapsed within 24 weeks . 117 patients were randomized to three treatment groups ; placebo ( n = 47 ) , 10 mg ( n = 21 ) , and 30 mg ( n = 49 ) . of the 31 previous responders to 10 mg of alitretinoin , 10 received placebo and 21 received alitretinoin 10 mg / day . of the 73 previous responders to 30 mg of alitretinoin , 24 received placebo and 49 received alitretinoin 30 mg / day . patients were treated for 24 weeks , but they stopped treatment if they responded within the first 12 weeks . consistent with the previous large scale studies , the investigators used pga as the primary efficacy parameter , and the paga and a mtlss as the secondary parameters . response rates were 80% ( n = 39 ) in patients retreated with 30 mg of alitretinoin , compared to 8% ( n = 2 ) for patients retreated with placebo . response rates were 48% ( n = 10 ) in patients retreated with 10 mg of alitretinoin , compared to 10% ( n = 1 ) for placebo . the secondary endpoints correlated with the pga results ; the median percentage reduction in mtlss was 92% for the 30 mg group and 71% for the 10 mg group , while the paga results demonstrated that 76% ( n = 37 ) of patients in the 30 mg group and 38% ( n = 8) of patients in the 10 mg group reported clear or almost clear hands . adverse events were similar in frequency to the previous studies , with headache being the most common . six patients in total ( 2 from each treatment group ) withdrew from the study due to adverse events . laboratory abnormalities were comparable to those reported in previous studies , namely hypercholesterolemia , increased triglyceride levels , and reduced tsh levels . this investigation was the first to show the long - term management of chronic hand eczema with intermittent systemic treatment , as it demonstrated the efficacy of retreatment with oral alitretinoin in patients who had previously relapsed . chronic hand eczema has a significant detrimental effect on quality of life , work productivity , activity impairment , and heath care costs.38 while previous investigations have demonstrated the clinical efficacy and tolerability of oral alitretinoin , there have been little to no data regarding its impact on the patient s quality of life . blome et al recently presented a method whereby patients answered two sets of questionnaires to weigh the importance of their treatment needs ( patient needs questionnaire ) against their achieved benefits ( patient benefit questionnaire).39 patient s needs and achieved benefits included to be pain free , have lower personal treatment costs , and to be able to touch others . the resultant patient benefit index ( pbi ) was calculated from the importance of needs before therapy and the achievement of these needs . the instrument was utilized in an open label study in the safety and efficacy of oral alitretinoin in 249 patients with severe refractory hand eczema , in which the patients received 24 weeks of treatment with 30 mg of oral alitretinoin daily . based on the pbi , an overwhelming 84.3% of the patients had achieved at least minimal benefit from alitretinoin , and 14.1% of patients had their treatment needs completely fulfilled . the most common needs the patients wanted were to have their skin lesions improved , have confidence in therapy , get rid of itching , and to find a clear diagnosis and therapy . likewise , the most common treatment benefits included having confidence in the therapy , having confidence in the therapy , and being free of itching , as well as to lead a normal daily life . overall , all treatment needs after alitretinoin therapy had been achieved by at least 57% of the patients . oral alitretinoin ( 9-cis - retinoic acid ; toctino ; basilea pharmaceuticals , ltd . , united kingdom ) , an endogenous retinoid , is the only drug that has been specifically approved as a treatment option for adults with chronic hand eczema unresponsive to topical steroids.6 retinoids are naturally occurring and synthetic derivatives of vitamin a , which plays an important role in the immune system by enhancing cytotoxicity , t - cell proliferation , and , under some conditions , b - cell proliferation.20 concurrently , retinoids are also involved in fetal development , bone formation , cell proliferation , cell differentiation , apoptosis , hematopoiesis , and vision.21 these influences are mediated through the binding and subsequent activation of two types of intracellular receptors : retinoic acid receptors ( rars ) and retinoid x receptors ( rxrs ) , which each contain three different subgroups , , , and .22,23 while other retinoids are limited in their binding to subgroups of either rars or rxrs , alitretinoin is a unique panagonist that binds to all six retinoid receptors with high affinity , with a greater affinity for rars than for rxrs.24 given its effects on cell proliferation , alitretinoin is a potent teratogen and is therefore contraindicated in pregnant women and women who might become pregnant during the course of treatment.25 moreover , studies on rat embryos have demonstrated that it can cause deleterious malformations at the second visceral arch.26 alitretinoin s effects on cell proliferation have been exploited for beneficial effects as well ; a recent study demonstrated its ability to induce apoptosis in breast cancer cells.27 in addition to exerting its effects on cell proliferation , alitretinoin has also been shown to produce an anti - inflammatory response by inhibiting the production of nitric oxide and such proinflammatory molecules as tumor necrosis factor ( tnf)- , interleukin ( il)-1 , and il-12 p40.28 since eczema is mediated through the th1 cellular immune response , the inhibition of these cytokines by alitretinoin could explain its therapeutic efficacy . the immunological manipulation by oral alitretinoin was also the basis for two phase ii trials in the treatment of aids - related kaposi s sarcoma , a cutaneous tumor mediated by hhv-8 . 60 and 57 participants received treatment for a median of 15 weeks , with an overall response rate of 37% and 39% , respectively . yet despite its efficacy , the investigators concluded that serious adverse events at high doses , such as pancreatitis and hypercalcinuria , limit its potential use for the treatment of kaposi s sarcoma.29,30 the metabolic effects of alitretinoin have also been extensively studied . it was recently shown to increase sex steroid synthesis in the rat hippocampus and therefore play a role in reproductive behavior.31 it was also shown to have protective effects against ischemia - induced brain injury in rats , with implications for its use in patients susceptible to strokes.32 oral alitretinoin has only been clinically approved for its use in chronic hand eczema , but recent studies have demonstrated its potential use in other dermatologic settings . in a small study with six patients who were treated for the hand eczema , alitretinoin was also shown to be effective in treating lesions of their extrapalmar atopic eczema.33 furthermore , a recent case report of two patients treated with alitretinoin for palmoplantar hyperkeratotic - rhagadiform had a surprising clinical improvement of their sezary syndrome and mycosis fungoides , implicating its potential use for cutaneous t - cell lymphomas.34 while alitretinoin potentially has profound dermatological and non - dermatological applications , this review focuses on its treatment for chronic hand eczema . in a pilot open - label study in 1999 , thirty - eight patients ( 19 men and 19 women ) with chronic hand eczema unresponsive to conventional treatment were treated with 2040 mg of oral alitretinoin for 1 to 5 months.25 the various classifications of their hand eczema included hyperkeratotic palmar eczema , fingertip eczema , pompholyx , and discoid eczema . lesions and symptoms consisting of erythema , vesicles / papules , desquamation , hyperkeratosis , rhagades , and pruritis / pain , were objectively recorded by the physicians on a 4 point scale ( 0 = none , 1 = slight , 2 = moderate , 3 = marked , 4 = severe ) , and the reduction of their total score was expressed in a percentage . side effects , such as headache , chelitis , conjunctivitis , and other mucocutaneous manifestations , were similarly recorded on a 4 point scale . objective assessment by the physicians determined that 55% of the patients showed a very good response , 34% showed a good response , 2 patients showed a the mean reduction of the total lesions and symptoms was 86% in the 36 patients who responded to treatment , with all various forms responding in a similar manner . subjective assessment by the patients yielded similar results , as 66% believed they showed a very good response , 26% believed they showed a good response , 1 felt a 7 patients experienced a recurrence of their lesions after discontinuation of the therapy , but a second regimen of treatment resulted in a successful response similar to the first course , thereby demonstrating a lack of resistance to the medication . only mild side effects related to hypervitaminosis a were noted , namely transient headache , chelitis , transient flushing , and conjunctivitis . overall , the pilot study demonstrated the efficacy of alitretinoin , as 89% of the patients assessed by the physician and 92% assessed by the patients showed a positive therapeutic response with minimal side effects . in a larger randomized , double - blind , placebo - control study in 2004 , alitretinoin was again determined to be an efficacious and well - tolerated treatment for the treatment of refractory chronic hand eczema.35 the study was held in 43 clinics across europe , enrolling 319 patients with moderate or severe refractory chronic hand eczema . patients were randomized into four treatment groups of placebo , 10 mg , 20 mg , and 40 mg of oral alitretinoin taken once a day for 12 weeks , and assessed at the end of the study as well as at a 3 month follow - up . the primary efficacy measure for the therapeutic response used by the researchers were the physician s global assessment ( pga ) of overall severity , which was categorized into clear , almost clear , mild , moderate , and severe . patients were considered to be responders if they were rated as clear ( no residual visible dermatitis ) or almost clear ( minimal erythema and/or scaling ) at the end of the 12-week study . the total lesion symptom score ( tlss ) , the patient s global assessment ( paga ) of improvement , and the extent of disease were used as secondary efficacy measures . at the end of the study , the pga assessment yielded results of 27% , 39% , 41% , and 53% responders to placebo , 10 mg , 20 mg , and 40 mg doses , respectively . the researchers suggested that the response rate in the placebo group may be related to a variety of factors such as the natural course of the disease , placebo effects , or changes in influential factors of the disease ( eg , climate , level of stress , occupation ) . the cochran armitage trend test demonstrated a significant dose - dependent effect ( p < 0.001 ) . the paga assessment yielded similar results of 12% , 29% , 34% , and 43% responders to the placebo , 10 mg , 20 mg , and 40 mg doses , respectively , which was shown to be significant by test ( p = 0.01 for 10 mg , p = 0.002 for 20 mg , and p < 0.001 for 40 mg ) . for all dosages of alitretinoin , the median tlss was higher compared to placebo ( decreases of 25% , 59% , 52% , and 70.5% for the placebo , 10 mg , 20 mg , and 40 mg doses , respectively ) . these results were shown to be significant ( p < 0.001 ) with the kruskal wallis test , and showed dose - dependence ( p < 0.001 ) with the jonckheere safety evaluation of the drug at a 4 week follow - up revealed adverse effects only in the 40 mg dosage group , which included headache , flushing , hyperlipidemia , decreased hemoglobin level , and decreased free thyroxin level . three months after cessation of treatment , it was revealed that 26% of patients relapsed in a dose - independent manner . overall , this study demonstrated that alitretinoin at well - tolerated doses effectively resulted in positive responses in up to 53% of patients and up to a 70% mean reduction in signs and symptoms . in 2008 , the results of a large , randomized , double - blind , placebo - controlled , parallel - group phase iii study , the benefit of alitretinoin in chronic hand dermatitis ( bach ) , were published.36 the study was conducted in 111 clinics throughout europe and canada , enrolling 1032 patients with severe refractory chronic hand eczema . the patients were randomized to three treatment groups of placebo ( n = 205 ) , 10 mg ( n = 418 ) , or 30 mg ( n = 409 ) of oral alitretinoin administered once daily for up to 24 weeks . patients stopped treatment if they responded within the first 12 weeks , while the others continued for the full duration of the study . the types of chronic hand eczema included hyperkeratotic , pompholyx , fingertip , and other , which was seen in 85% , 27% , 46% , and 14% of patients , respectively . as with the previous study , the investigators used pga as the primary efficacy parameter , whereby patients were considered to be responders if they were rated as the results of the investigation were concordant with the results in the previous study in 2004 . the pga results demonstrated a dose - dependent efficacy with 48% , 28% , and 17% responders in the 30 mg , 10 mg , and placebo group , respectively . these results were confirmed by the secondary endpoints ; the percentage of patients with clearing as determined by the paga were 40% , 24% , and 15% , and the median percentage reductions in mtlss were 75% , 56% , and 39% in the 30 mg , 10 mg , and placebo groups respectively . there was not a uniform response rate amongst the various morphological classifications of hand eczema . for instance , in the 30 mg treatment group , there was a 49% response rate in those with hyperkeratotic features and a 33% response rate in those with the pompholyx variant . however , these classifications were not mutually exclusive so it would not be feasible to conclude that alitretinoin is more effective in one variant over the other . there was also a dose - dependence seen with the time to response , as it was significantly shorter in the 30 mg group than the 10 mg group ( p < 0.001 ) . the median time to relapse , which the investigators defined as a recurrence of 75% of the initial signs and symptoms in the absence of treatment , was 5.5 to 6.2 months . adverse events were seen in 49.5% , 37.1% , and 34.5% of the respective treatment groups , of which headache was the most commonly reported . serious adverse events were minimal , with only 1% of patients in each treatment group reporting such a problem . one fatal event was reported in the 10 mg group , although it was from a myocardial infarction unrelated to treatment . typical retinoid - related laboratory abnormalities were noted , which included increases in serum cholesterol and triglyceride levels , and decreases in thyroid - stimulating hormone ( tsh ) . as the largest clinical investigation on chronic hand eczema to date , this study demonstrated promising results of dose - dependent efficacy of oral alitretinoin that were consistent with previous studies . in 2009 , the results of an extension of the bach study were published.37 this investigation examined the efficacy and safety of oral alitretinoin in patients who initially responded well to treatment in the bach study , but had relapsed within 24 weeks . 117 patients were randomized to three treatment groups ; placebo ( n = 47 ) , 10 mg ( n = 21 ) , and 30 mg ( n = 49 ) . of the 31 previous responders to 10 mg of alitretinoin , 10 received placebo and 21 received alitretinoin 10 mg / day . of the 73 previous responders to 30 mg of alitretinoin , 24 received placebo and 49 received alitretinoin 30 mg / day . patients were treated for 24 weeks , but they stopped treatment if they responded within the first 12 weeks . consistent with the previous large scale studies , the investigators used pga as the primary efficacy parameter , and the paga and a mtlss as the secondary parameters . response rates were 80% ( n = 39 ) in patients retreated with 30 mg of alitretinoin , compared to 8% ( n = 2 ) for patients retreated with placebo . response rates were 48% ( n = 10 ) in patients retreated with 10 mg of alitretinoin , compared to 10% ( n = 1 ) for placebo . the secondary endpoints correlated with the pga results ; the median percentage reduction in mtlss was 92% for the 30 mg group and 71% for the 10 mg group , while the paga results demonstrated that 76% ( n = 37 ) of patients in the 30 mg group and 38% ( n = 8) of patients in the 10 mg group reported clear or almost clear hands . adverse events were similar in frequency to the previous studies , with headache being the most common . six patients in total ( 2 from each treatment group ) withdrew from the study due to adverse events . laboratory abnormalities were comparable to those reported in previous studies , namely hypercholesterolemia , increased triglyceride levels , and reduced tsh levels . this investigation was the first to show the long - term management of chronic hand eczema with intermittent systemic treatment , as it demonstrated the efficacy of retreatment with oral alitretinoin in patients who had previously relapsed . chronic hand eczema has a significant detrimental effect on quality of life , work productivity , activity impairment , and heath care costs.38 while previous investigations have demonstrated the clinical efficacy and tolerability of oral alitretinoin , there have been little to no data regarding its impact on the patient s quality of life . blome et al recently presented a method whereby patients answered two sets of questionnaires to weigh the importance of their treatment needs ( patient needs questionnaire ) against their achieved benefits ( patient benefit questionnaire).39 patient s needs and achieved benefits included to be pain free , have lower personal treatment costs , and to be able to touch others . the resultant patient benefit index ( pbi ) was calculated from the importance of needs before therapy and the achievement of these needs . the instrument was utilized in an open label study in the safety and efficacy of oral alitretinoin in 249 patients with severe refractory hand eczema , in which the patients received 24 weeks of treatment with 30 mg of oral alitretinoin daily . based on the pbi , an overwhelming 84.3% of the patients had achieved at least minimal benefit from alitretinoin , and 14.1% of patients had their treatment needs completely fulfilled . the most common needs the patients wanted were to have their skin lesions improved , have confidence in therapy , get rid of itching , and to find a clear diagnosis and therapy . likewise , the most common treatment benefits included having confidence in the therapy , having confidence in the therapy , and being free of itching , as well as to lead a normal daily life . overall , all treatment needs after alitretinoin therapy had been achieved by at least 57% of the patients . chronic hand eczema is a debilitating disease with profound social , functional , psychological , and economical impacts . standard management to date has failed to provide an efficacious and convenient form of therapy without dangerous adverse reactions . in view of several controlled clinical studies , oral alitretinoin has been proven to be an effective and safe treatment modality in refractory patients with a high disease burden . the current approved drug dosing is 30 mg daily for 12 to 24 weeks , depending on the response , with a dose decrease to 10 mg if any serious adverse reactions are experienced.40 this is conceivably the most appropriate protocol , based on results of the clinical trials that demonstrated dose - dependent responses and minimal side effects . a recent appraisal by the national institute for health and clinical excellence ( nice ) supported this protocol and made recommendations as to when treatment should be stopped . they advocated that the prescribing physician stop treatment once the patient has an adequate response , if the degree of hand eczema continued to be severe after 12 weeks of treatment , or if there was an inadequate response at 24 weeks.41 in the scenario where the patient relapses after having demonstrated an adequate response , re - administration of the drug would be a suitable option . oral alitretinoin has recently been approved in several european countries , but despite positive results , it still faces several challenges for us approval . this impedance can be attributed to revolving teratogenic concerns , its dose - dependent side effects , and a lack of long - term data on its effects on bone density . lastly , adjunct therapies with alitretinoin must be further explored , as studies investigating these are lacking . nonetheless , oral alitretinoin has emerged as a promising treatment for patients with chronic hand eczema refractory to conventional medications .	chronic hand eczema is a debilitating dermatological condition with significant economic , social , and functional impacts . to date , conventional treatments such as topical corticosteroids , phototherapy , and systemic immunosuppressants have yielded disappointing results , owing to either a lack of efficacy or significant adverse events . oral alitretinoin ( 9-cis - retinoic acid ) is a unique panagonist retinoid with immunomodulatory and anti - inflammatory activity that has emerged as a novel treatment for chronic hand eczema . several large - scale clinical studies have demonstrated oral alitretinoin s high efficacy rate of 28% to 89% , its safe tolerability profile , and its positive impact on quality of life , validating it as a therapeutic option for patients with severe chronic hand eczema refractory to standard treatment .
You are an expert at summarizing long articles. Proceed to summarize the following text: a 59-year - old male , height 170 cm and weight 68 kg , was admitted for open reduction and internal fixation of ankle fracture . the patient underwent an open reduction and internal fixation of ankle fracture under spinal anesthesia with bupivacaine 2 years ago . during the surgery , he was sedated by intravenously administered midazolam without premedication and the anesthesia- or surgery - related complications were not reported . for the preoperative treatment , atropine 0.5 mg and midazolam 3.0 mg were intramuscularly administered 30 minutes before the operation . his blood pressure was 122/75 mmhg with a heart rate of 85 beats / min , and a respiratory rate of 16 breaths / min before he transferred to the operation room . after his arrival in the operating room , the patient 's vital signs were monitored by noninvasive blood pressure measurement , electrocardiography , and pulse oxymetry . before induction of general anesthesia , he complained generalized pruritus . urticarial skin rashes of upper and lower extremity and an angioedema of face and tongue were observed . because an anaphylactic reaction was suspected judging from these generalized skin symptoms , the operation was delayed and he was moved to the recovery room . although 250 mg of methylprednisolone and 40 mg peniramin were injected intravenously to treat the anaphylactic reaction , his blood pressure decreased to 70/40 mmhg with heart rate of 98 beats / min and pulse oxygen saturation on pulse oximetry ( spo2 ) of 90% 25 minutes after skin symptoms ( fig . although he began to experience mild dyspnea , the sound of wheezing was not auscultated . simultaneously , epinephrine 50 g and hydrocortisone 100 mg were injected intravenously with plasmalyte solution ( plasma solution - a , cj pharma , seoul , korea ) hydration . and then , the serum tryptase level and the total serum immunoglobulin e ( ige ) level were measured for confirming anaphylaxis . after transient tachycardia of heart rate of 130 beats / min , heart rate decreased to 100 beats / min within 10 minutes and the blood pressure increased to 90/60 mmhg , spo2 to 95% . except the tachycardia , other specific changes of electrocardiography were not observed . during the rest of the period , vital status the elevated tryptase level to 29.9 g / l ( normal range : 011 g / l ) was detected from laboratory test . except that systemic erythematous rash and swelling of the skin around the eyes arterial blood gas analysis ( abga ) gave ph 7.32 , pco2 44 mmhg , po2 155 mmhg , and be 0.5 mm at fraction of inspired oxygen 0.3 . since the results of abga and chest radiography were normal and there were no further specific clinical presentations , the patient was transferred to a general ward . after 2 months , skin prick and intradermal tests were performed to establish the allergen . as a result , midazolam was identified as a cause of anaphylactic shock ( table 1 ) and the patient was informed to avoid this agent . the patient underwent an open reduction and internal fixation of ankle fracture under spinal anesthesia without sedation . because shocks that develop during the perioperative period affect patients ' safety , rapid identification of their cause and management are vital . judging by the absence of abnormalities during the preoperative evaluations and the fact that no procedure except premedication was performed , the possibility of cardiogenic , hypovolemic or neurogenic shock was minimal in the present case . however the appearance of specific skin lesions in the form of urticarial skin rashes and angioedema made us suspect anaphylaxis . the symptoms cardiovascular collapse of anaphylaxis can be mistaken as effects of the anesthetic agents and mechanical ventilation after application of a muscle relaxant may mask respiratory symptoms , which can also make it difficult to diagnose . furthermore , even if anaphylaxis is identified , it is difficult to establish the cause because the variety of agents is exposed to the patients during the brief period of surgery . the most important clues for diagnosing anaphylaxis are clinical presentations such as skin and mucosal involvement , respiratory symptoms , and cardiovascular dysfunction . laboratory tests that detect an increase of serum tryptase are the most commonly used diagnostic methods for confirming anaphylaxis . serum tryptase , a neutral serine protease released by mast cells , increases within 12 hours after presentation of clinical symptoms of anaphylaxis , and its level returns to normal after about 24 hours . therefore , anesthesiologists should be aware that detecting elevated serum tryptase is an important indicator confirming the diagnosis when skin reactions are not obvious . lastly , the gold standard for identifying the cause of immunoglobulin - e mediated anaphylaxis are skin tests such as the skin prick test and intradermal test . in order to avoid false negative results caused by depletion of specific immunoglobulin - e antibodies and mast cells , the skin test should be performed 46 weeks after anaphylaxis . of the anaphylaxis occurring during the perioperative period , 5559% are caused by muscle relaxants , while latex ( 2022% ) and antibiotics ( 1315% ) are other major causes . reports of midazolam - associated hypersensitivity reactions have been rare and all such cases occurred after intravenous injection . in this case , fortunately , rapid detection of skin lesions deterred us from using other drugs , to induce anesthesia . therefore , detecting the cause of the anaphylaxis was not difficult ; the candidates were the two drugs injected , and the skin test pointed to midazolam . midazolam is widely used intramuscularly for relieving anxiety before surgery , and anaphylactic shock presenting as severe cardiovascular collapse can occur when it is injected intramuscularly . as this present case has shown , anaphylactic shock can occur about 1 hour after intramuscular injection despite treatment . therefore , if the skin lesions of anaphylaxis are observed , surgery must be postponed until the patient 's safety is secured . cross - reactivity between neuromuscular blocking agents and antibiotics is known to be common due to structural similarity in these drugs . in case of neuromuscular blocking agents however , allergic reactions to benzodiazepines have been reported for individual agents and such reactions are rare . except one study of anaphylaxis caused by tetrazepam which showed there was no cross - reactivity among benzodiazepine , cross - reactivity between drugs in this class is not as well known . therefore , further studies regarding the cross - reactivity between benzodiazepines are needed . in conclusion , although midazolam is generally used as premedication for relieving anxiety of surgery , the danger of anaphylactic shock after intramuscular injection of midazolam is not widely recognized . when it was injected intramuscularly , slow onset of severe anaphylactic therefore , the surgery should be postponed when the anaphylactic reaction was suspected even though the symptoms were limited . additionally , anesthesiologists should be prepared for the occurrence of anaphylaxis at any time in the perioperative period .	although anaphylactic shock during the perioperative period is rare , it can be lethal due to severe cardiovascular and respiratory collapse . midazolam is generally used as premedication for relieving anxiety about the operation , and the danger of anaphylactic shock after intramuscular injection is not widely recognized . we report the first case of anaphylactic shock occurring during the perioperative period after intramuscular injection of midazolam . since anaphylactic shock after intramuscular injection can be of slow onset , the operation should be delayed if an anaphylactic reaction is suspected , even if the symptoms are limited . in addition , anesthesiologists should be prepared for the occurrence of anaphylaxis at any time in the perioperative period .
You are an expert at summarizing long articles. Proceed to summarize the following text: expectations of scientific research run high . internationally , funding bodies and government agencies have placed increasing emphasis on the outcomes and impact of scientific endeavour ( campbell et al . the promise of science lies in expectations of the benefits bioscience can bring to societies and is matched by expectations of the realisation of the significant public investment in that science . in health research , first reported as such in the medical literature in 1993 the concept of translational research has a much longer history ( antoine 1991 ) . the increasing interest , especially recently , is evident in even a cursory search of pubmed where citations including the term translational research have increased nearly 200-fold since 1993 , with more than half of these citations occurring in the past 2 years . likewise , the use of the term bench to beside to describe the transformation of bioscience into therapeutic practice , seen as early as 1985 ( merz 1985 ) , has exploded across the biosciences . in addition , therein lies a conundrum for translational research in biobanking . population biobanks represent an ontologically distinct approach to knowledge generation when compared with the dominant scientific forms envisaged by translational research . population biobanks merge the promise of genomics with foundational public health science , including classical epidemiology ( khoury et al . 2009a , b ) , principally in the form of population - based cohort studies ( burton et al . 2010 ; p3 g observatory 2009 ) . biobanking science is implicitly oriented to the population focus of its historical epidemiological forebears as well as to the individualist focus of contemporary genomic medicine . biobanking steers away from the hypothesis testing that is fundamental to much basic and applied bioscience ; i.e. genome - wide association studies ( gwas ) and clinical trials , respectively . instead , it embraces methods of knowledge generation which prepare us to ask questions we may not yet be able to formulate 2011 ; wallace et al . 2009 ) , management ( borugian et al . 2010 ; litton et al . 2003 ; peakman and elliott 2008 ; yuille et al . 2008 ) and harmonisation ( fortier et al . 2010 ; stover et al . 2011 ) of biobanking platforms and to promote and facilitate liberal data access ( p3 g consortium et al . part of global and local endeavours to translate raw biomedical evidence into practice , their purpose is to provide a platform composed of high quality data and samples that can later provide a firm foundation for generating new scientific knowledge to inform development of new policies , systems and interventions to enhance the public s health ( davey smith et al . effectively translating scientific knowledge into routine practice , however , involves more than good science . it is a complex social process that necessarily involves scientists , health professionals , policy makers , funders , industry and members of the public ( including research participants ) ; i.e. it is about the people not just the science . moreover , the mechanisms of successful translation are not well enough understood . drawing on a range of disciplinary perspectives , including biomedical and public health science , social science and philosophy , we overview the scientific logics underpinning the creation of biobanks and describe we argue that if the future utility of population biobanking is to be optimised we must explore what we should be doing now to ensure extension of the transdisciplinary collaborations to include , for example , health policy makers so that biobanking resources are configured with translational aims in mind . this will help ensure that biobanks can best contribute to the evidence - base for health policy decision - making , health - care commissioning and the implementation of new initiatives in practice . the generation of scientific knowledge involves the asking and answering of questions within constraints imposed by contemporaneous needs , knowledge and technology . until recently , most definitive answers in health science pertained to factors with relatively large effects lind s demonstration that citrus fruit prevents scurvy ( kirch 2008 ) ; the causal role of smoking in many diseases ( world health organisation 2008 ) ; the impact of monogenic genetic variants causing major diseases such as huntington s chorea and cystic fibrosis ( carter 1977 ) . recent years , however , have seen a fundamental change in the nature of biomedical investigation . there is therefore a manifest focus on the aetiological architecture of the common chronic diseases that affect these societies ( merikangas and risch 2003 ; pritchard and cox 2002 ) . the aim is to understand , and ultimately intervene in , the complex causal pathways via which genes and environmental / lifestyle / social determinants act alone and in interaction to cause diseases and to influence how those diseases progress once they have developed ( khoury et al . this new challenge demands a comprehensive exploration of gene networks , of much weaker main effects ( manolio et al . 2008 ; merikangas and risch 2003 ; wellcome trust case control consortium 2007 ) and of interactions between genetic , environmental , behavioural and social factors ( manolio et al . 2006 ) . typically , the aim is to identify and quantify the impact of a number of small effects ( genetic , socio - environmental or a combination ) on a given disease or health - related trait , but to do this the effects of the determinants of interest must first be disentangled from an obscuring cacophony of aetiological noise resulting from many other causal determinants . the modern search for the risk factors of complex diseases has often been compared to finding a needle in a hay - stack ( moore et al . 2010 ) , but this simile should probably be extended to note that the needle itself is made of straw . the change in focus from investigating risk factors with relatively large effects to explore networks of risk factors with weak effects requires a radically different approach . this is because many of the effects are very weak : for example , although the relative risk of lung cancer in smokers versus non - smokers is of the order 9.0 ( doll and hill 1952 , 1964 ) , most known associations between genetic variants and chronic diseases reflect weak effects with typical allelic odds ratios in the range of 1.11.4 ( burton et al . 2009 ; spencer et al . 2009 ; zondervan and cardon 2007 ) . critically , effects as weak as this not only provide an obvious challenge from the perspective of statistical power ( burton et al . 2009 ) but , in addition , they can easily be created or concealed by confounding or reverse causality . in fact , these latter concerns led gary taubes to claim that observational epidemiology had already reached its inferential limits ( taubes 1995 ) . there is no doubt that useful scientific inferences can be generated in such settings , but the obvious route to new knowledge would involve well - designed experiments : carefully controlled experiments in the laboratory setting , or studies involving randomised allocation of intervention as in a conventional clinical trial . however , many research questions in human health are simply not amenable to an experimental approach . it is , therefore , fortunate that despite the very real concerns raised by taubes ( 1995 ) , useful inferences on weak effects can sometimes be based on observational studies . although genetic variants can not be allocated randomly as part of an experiment they are allocated randomly at conception ( davey smith 2006 ; davey smith et al . if one of your parents has two different alleles at a particular locus , you must receive one , and only one , of them ( burton et al . 2005 ) . furthermore , the particular allele that is actually transmitted is randomly determined in a manner that is entirely independent of the variants that are inherited at all other loci ( from either parent ) , with the specific exception of those few loci that are in close linkage disequilibrium ( ld ) ( clayton and mckeigue 2001 ; cordell and clayton 2005 ) on the same chromosome . this process forms the basis of what is often known as mendelian randomisation ( mr ) ( davey smith 2006 ; davey smith and ebrahim 2003 ; sheehan et al . 2008 ) which has a number of profound implications : ( i ) genetic variants do not usually confound one another unless they are in close ld ( here we ignore the inferential distortion that can arise from ancestral substructure in an imperfectly designed study ; devlin et al . 2001 ) . ( ii ) genetic variants are not generally associated with socio - environmental determinants ( and can not therefore confound them ) unless a particular genetic variant has a biological mechanism that directly modifies exposure to a socio - environmental determinant of interest . in other words , which of two alleles is received at conception from one parent can not possibly be related to whether an individual later chooses to smoke unless those two alleles have a different and direct impact on their predilection to smoke . in general , therefore , inferences on genetic determinants are not confounded by environmental factors and vice versa . ( clayton and mckeigue 2001 ; davey smith 2006 ; davey smith and ebrahim 2003 ; davey smith et al . 2005 ; sheehan et al . ( iii ) interactions between socio - environmental determinants and genes are typically more robust to confounding than are the direct effects of the socio - environmental determinants themselves . for example , in relation to the role of a gene ( g ) and a socio - environmental determinant ( se ) in causing a disease ( d ) , serious confounding of the direct effect of se could easily arise if confounding factor c was associated both with d and with se and such confounding is extremely common because health - related behaviours tend to cluster ( davey smith et al . 2004 ) : e.g. smokers often take less exercise , drink more alcohol , and take fewer vitamins . this is why it was argued that observational studies have a limited role in relation to studying weak effects ( taubes 1995 ) . but , if scientific interest focuses on the interaction between g and se ( g : se)i.e . it is true that serious inferential problems will arise if the nature of the g : se interaction varies systematically with the level of c , but this is markedly less likely than the near ubiquitous clustering of health - related behaviours ( davey smith et al . ( iv ) items i , ii and iii imply that weak effects associated with genetic variants or with interactions between genes and socio - environmental determinants are of considerably greater inferential value than would be the case in the absence of mr ( taubes 1995 ) . however , mendelian randomisation also provides a firm inferential foundation when scientific interest focuses on the direct effect of an environmental exposure alone . in fact this is the very purpose to which mr has classically been applied ( clayton and mckeigue 2001 ; davey smith 2006 ; davey smith and ebrahim 2003 ; davey smith et al . specifically , if one is interested in whether factor se protects against disease d , if one can identify a genetic variant ( g * ) that has the same impact on an individual as increased ( or decreased ) exposure to se , then demonstration that g * is associated with d provides evidence that se is causally associated with d. this is known as an instrumental variable approach ( davey smith et al . crucially , although this approach negates both confounding and reverse causality , a number of key assumptions that demand proper understanding of the underlying biology and mathematics must be met ( didelez and sheehan 2007 ; palmer et al . 2008 in addition , if enough is known about the underlying biological , environmental and social determinants and if adequate resources can be invested in measuring relevant factors extremely carefully , it will sometimes be possible to control the analysis closely enough to enable inferences to be drawn that may reasonably be viewed as robust to confounding . furthermore , if such an analysis is undertaken as part of a prospective cohort study ( with initial exposure assessments being made whilst participants are still healthy ) reverse causality is far less likely to be a serious problem . as we learn more and more about the underlying biology and social science , our ability to address confounding in ways that use prior knowledge in concert with sophisticated analysis based on the data from very comprehensive databases will inevitably increase . if they are used cautiously and appropriately , it is therefore clear that large observational epidemiological studies can provide a useful basis for investigation of the causal architecture of complex diseases . however , it is also clear that these studies must be designed , set up and managed strategically ( bbmri 2010 ; knoppers et al . this need was reflected in the decision to include european biobanking and biomolecular resources amongst the 36 designated priorities in the esfri roadmap that represented the european union s strategy for development of the infrastructure supporting pan - european science ( european strategy forum on research infrastructures 2006 ) . in effect , biobanks are now seen as the infrastructural equivalent of linear accelerators and telescope arrays in the physical sciences : that is , multipurpose facilities representing broad - based platforms to support the scientific community as a whole in its asking and answering of key questions across the realm of bioscience . however , if their value is to be optimised , these facilities must have a number of pivotal characteristics : they must provide access to data and biosamples relating to vast numbers of individuals ( burton et al . control studies including thousands of cases are required even when interest focuses on the most straightforward situation : the detection of simple associations between single nucleotide polymorphisms ( snps ) ( burton et al . 2005 ) and a disease of interest ( burton et al . furthermore , when , as is likely , scientific emphasis moves on to focus on the study of gene socio - environment and gene gene interactions , and the exploration of causal pathways more comprehensively , tens of thousands of cases will often be required ( burton et al . 2009 ) . tens of thousands of participants can also be required to study a quantitative phenotype ( e.g. measured blood pressure ) , because allelic effect sizes may be as small as 1/10th of a standard deviation , or even less ( newton - cheh et al . finally , the use of an instrumental variable approach to address confounding increases the sample size requirement still further ( clayton and mckeigue 2001 ) . data and samples must be collected under formal standard operating procedures ( fortier et al . 2010 ; isber 2005 ; moore et al . 2011 ) , and the assessment of disease status , biomarkers , physiological processes and social and environmental factors must be both accurate and precise . when aetiological effects are already weak , measurement error can substantially reduce statistical power yet further ( burton et al . 2003 ) , and if errors are made in assessing confounders , real causal relationships may be obscured or artefacts created.to achieve sample sizes of the magnitude required i.e . involving enough participants that each have high quality data and samples of the nature required it will often be necessary to pool data across multiple studies ( burton et al . this is well - exemplified by the large collaborative consortia that have been responsible for much of the recent progress in human population genomics ( burton et al . 2007 ; frayling et al . 2007 ; hindorff et al . 2009 ; newton - cheh et al . 2009a , b ; saxena et al . 2007 ; scott et al . 2007 ; stacey et al . 2007 ; they must provide access to data and biosamples relating to vast numbers of individuals ( burton et al . control studies including thousands of cases are required even when interest focuses on the most straightforward situation : the detection of simple associations between single nucleotide polymorphisms ( snps ) ( burton et al . furthermore , when , as is likely , scientific emphasis moves on to focus on the study of gene socio - environment and gene gene interactions , and the exploration of causal pathways more comprehensively , tens of thousands of cases will often be required ( burton et al . 2009 ) . tens of thousands of participants can also be required to study a quantitative phenotype ( e.g. measured blood pressure ) , because allelic effect sizes may be as small as 1/10th of a standard deviation , or even less ( newton - cheh et al . finally , the use of an instrumental variable approach to address confounding increases the sample size requirement still further ( clayton and mckeigue 2001 ) . data and samples must be collected under formal standard operating procedures ( fortier et al . 2011 ) , and the assessment of disease status , biomarkers , physiological processes and social and environmental factors must be both accurate and precise . when aetiological effects are already weak , measurement error can substantially reduce statistical power yet further ( burton et al . 2003 ) , and if errors are made in assessing confounders , real causal relationships may be obscured or artefacts created . to achieve sample sizes of the magnitude required i.e . involving enough participants that each have high quality data and samples of the nature required it will often be necessary to pool data across multiple studies ( burton et al . this is well - exemplified by the large collaborative consortia that have been responsible for much of the recent progress in human population genomics ( burton et al . collectively , these various requirements have led to the development of a new field of endeavour in bioscience that may be referred to as biobanking science. the many professionals and researchers that work in this field include : laboratory scientists , clinical scientists , epidemiologists and statisticians , informaticians , ethico - legal experts and social scientists . although they each have their own specialist areas of exploratory interest and expertise within the broader field of biomedical science , they share a collective focus on optimising the design , set up , harmonisation , networking and evaluation of the range of studies that are sometimes called biobanks : organized collection[s ] of human biological material [ e.g. blood , urine or extracted dna ] and associated information stored for one or more research purposes the studies that fall under this umbrella primarily represent population - based cohort studies , large case control studies and tissue repositories , but some cross - sectional studies and randomised controlled trials qualify as biobanks too ( burton et al . crucially , although many of these studies were originally designed to support classical phenotype to genotype science ( e.g. nested case control studies ) , they also provide a platform for exposure - based investigation including genotype to phenotype or genotype - based ( burton et al . this latter approach uses exposure - based information ( particularly , genotype data ) to identify informative population - subsamples that , with consent , can be brought in for detailed additional investigation . here , the vast size of modern cohort - based biobanks sometimes viewed as being scientifically inefficient provides a great strength : even a genotype that occurs as rarely as one in one thousand people , will be represented in five hundred participants in a population - based biobank containing 500,000 participants such as uk biobank . in addition , when biobanks are effectively catalogued and harmonised ( burton et al . 2010 ; fortier et al . 2010 ; p3 g observatory 2009 ) , the available sampling frame for such studies can potentially be extended to several millions . the structures and actors within biobanking science are reflective of what is described within social studies of science as mode 2 knowledge production ; that is , a new way of thinking about the generation of knowledge in science ( nowotny et al . mode 2 knowledge production is carried out in the context of application ( research translation ) , brings a heterogeneity of skills and expertise to the problem solving , and is transdisciplinary in nature ( nowotny et al . 2001 ) . transdisciplinarity is not simply another of the proliferation of terms for multidisciplinarity , but rather points to the transgressive character of knowledge generation ( nowotny et al . 2001 ) that there is a co - evolution or co - production ( callon et al . 1992 ; callon 1999 , p. 69 ; jasanoff 2004 , p. 70 ; geels 2005 ) of knowledge that transgresses disciplinary boundaries . transdisciplinarity requires actors to engage actively in the messy and thorny work of overcoming difference and awkwardness whilst also drawing strength and value from the very existence of those differences ( demir 2008 , 2011 ) . demir ( 2011 ) demonstrates how scientists achieve translation of their work across disciplinary borders by extending their own concepts and working language to incorporate new concepts ; much as in second language acquisition . through informal and formal exchanges , scientists in one discipline acquire , albeit in a limited way , the language , ideas and practices of another group ( demir 2011 ) . integration of these borrowed concepts and practices reshape the frameworks of the adopting discipline or field ; which might , for example , facilitate harmonisation and data sharing . within biobanking , there is clear evidence not only of transdisciplinary structures , but of the transdisciplinary generation of knowledge . an ongoing ethnographic study ( hammersley and atkinson 2007 ) of the development of datashield ( wolfson et al . 2010 ) by authors of this paper ( m.m . , p.b . ) demonstrates how the intersection of ethics , informatics and statistics is shaping the structure of the ensuing technology that is datashield . the rapid progress of biobanking science over the last 5 years reflects a successful professional networking of biobanking scientists across the world that has been led by organisations , institutions and projects such as : pg ( knoppers et al . 2008 ) , phoebe ( wolfson et al . 2010 ) , bbmri ( wichmann et al . 2011 ) , gen2phen ( 2010 ) , bioshare - eu ( 2011 ) , isber ( 2005 ) , and nci ( moore et al . 2011 ) . crucially , the work carried out by these complementary and overlapping groups has , to date , focussed primarily on designing and setting up biobanks and on exploring a variety of approaches to networking and harmonisation ( borugian et al . 2010 ; burton et al . 2009 ; fortier et al . 2010 ; isber 2005 ; litton et al . 2010 ; wallace et al . 2009 ; wichmann et al . 2011 ; yuille et al . however , the scientific focus is now entering a new phase in which the priorities are to provide liberal , but secure , access to data and samples ( pisani and abouzahr 2010 ; walport and brest 2011 ) , to ensure that biobanks are used widely and effectively , and to streamline pooled analysis involving multiple biobanks ( fortier et al . 2010 ) . the success of the large transdisciplinary organisations that comprise international biobanking is in no small part due to the fact that the science underpinning the successful construction and use of biobanks is philosophically very different from that underpinning hypothesis - based science . although biobanks are undoubtedly a child of contemporary bioscience and are aimed primarily at facilitating new scientific discoveries , they are not hypothesis - driven per se . rather , they may be seen as being part of a pre - competitive endeavour on the part of many bioscientists to advance and facilitate future hypothesis - driven science . in consequence , although biobanks are costly and may take many years to mature to full value , they should not be viewed as competitors to hypothesis - based science . an essential pre - requisite if hypothesis - based research is to be as successful at disentangling the causal structures underpinning complex diseases as it has historically been at revealing the impact of much stronger determinants of health and disease . in essence , biobanks will ensure a flexible yet valid platform for the as yet unpredicted ( and unpredictable ) bioscience questions of tomorrow . this not only impacts on the scientific design of biobanks , but it has major ethico - legal and social implications . how , for example , can we effectively ask participants to consent to answer detailed questionnaires , provide invasive tissue samples and agree to long - term monitoring of their health when even the scientists do not know how all of the data and samples will be used in the future ? of course , one possible answer to this , seemingly rhetorical , question is to ask them. there can be little argument , but that the development of biobanking science over the first decade of the new millennium has been remarkable . although it may be of great interest and reward to the scientists involved , no part of bioscience can ever be an end in itself . society invests heavily in scientific research related to medicine because it is assumed that this will ultimately improve the health of the community and of individuals within that community ( cooksey et al . the raison detre of biomedical research is therefore to enhance public health through primary prevention , improved diagnosis and treatment , and the enhanced long - term control of chronic diseases . such ends may be achieved via a wide range of different interventions at either the individual or population levels and biobanks can undoubtedly make a pivotal contribution to these aims . but if biobanks are to achieve optimal utility in the long term , it is critical that extensive thought is now put into how we should build on the successes of biobanking science to date , to ensure that biobanks are able to provide effective translational return in the future . the transdisciplinary collaborations must be extended to include professionals in public health , health policy making and health economics . this will facilitate the enrichment of biobank databases with population - based and hospital - generated health event data . it will also enhance the future potential for biobank - driven translational activity ; particularly , translation into population level public health . demonstrating what has been described as a shift from regimes of truth to regimes of hope in clinical and bioscience ( moreira 2009 ; moreira and palladino 2005)that is , the speculative potential of new therapeutic interventions discussion of translational research begins in earnest with the nih roadmap ( us ) ( zerhouni 2003 ) , cooksey report ( uk ) ( cooksey et al . 2006 ) and mrc framework for complex interventions ( uk ) ( campbell et al . one is the process of applying discoveries generated during research in the laboratory , and in preclinical studies , to the development of trials and studies in humans . the second area of translation concerns research aimed at enhancing the adoption of best practices in the community ( nih 2011 ) . that is , bench to bedside and research into practice . called t1 and t2 translational research , respectively , we can think of these endeavours as the processes and practices of transforming data into knowledge and knowledge into practice . the first gap arises in the translation of basic and clinical research into ideas and products , i.e. at the bench ; the second gap relates to introducing those ideas and products into clinical practice 2006 ) . whilst the nih areas of translation describe a transition from the bench to the community , the backyard , it is gaps in t1 translational research , from bench to bedside , that are the predominant focus of the translational research literature and funding ( woolf 2008 ) thus , the long standing viewpoint of the biomedical lens , which more often includes the individual than the population , is maintained ( murtagh and hepworth 1997 ; thomson et al . nonetheless , just how these translational transitions might be bridged has been the subject of much discussion , though there is a paucity of empirical research on these processes . what is clear , however , even in the seemingly most straightforward of translational processes , for example from biomarker to drug discovery to testing to adoption in routine clinical practice , is that it is not sufficient to simply throw the outputs of science over the wall ( cox 2011 ) . that is , without aim , direction , purpose and without communication on either side between scientists , clinicians and others involved in disseminating and implementing that science . there is recognition within the bioscience community that translational research presents challenges and that the translational research model as initially described does not adequately account for the range of activity within bioscience or for the embeddedness of bioscience in and with other disciplinary , professional or public groupings and settings . early appeals for the involvement of a range of disciplines envisaged an expansion to include biomedical and informatics scientists with bioscience ( zerhouni 2003 , 2005 ) . more recent expectations reflect what social studies of science describe as communities of promise ( martin et al . 2008 ) in which the articulation of clinical and biosciences are fundamental to the dynamics of translation and innovation and include the involvement of social , behavioural and ethico - legal disciplinary contributions ( khoury 2010 ; khoury et al . 2009b , 2011 ; zimmern and brice 2009 ) as well as public and participant engagement in translational research , especially in the knowledge to practice phase ( armstrong et al . 2006 elaborations of the nih / cooksey model have largely included disambiguation of the t2 phase . roadmap to ameliorate the myriad detours , speed traps , roadblocks , and potholes [ that ] limit the movement of treatments from bench to practice i.e. the limited external validity of randomised controlled trials , the diversity of health care practice efficiency and effectiveness , limited successful collaboration between researchers , clinicians and patients and failure to address the identified needs of the community . they expand translational research to incorporate t1t3 components : where t1 represents translation to humans of basic science in the form of preclinical and animal studies ; t2 incorporates translation to patients of research through guidelines development , meta - analyses and systematic reviews ; and , in t3 the translation to practice via dissemination and implementation research ( westfall et al . colleagues describe a t1t4 continuum to accelerate appropriate integration of human genome discoveries into health care and disease prevention ( khoury et al . 2007 ) . in the context of the hoary debates regarding population impact ( public health ) and individual outcomes ( personalised medicine ) of genomic discovery , burke et al . ( 2010 ) have most recently added a t0 pre - scientific phase in a t0t4 model to represent the context of population health needs . the t0 phase represents assessment of the population health - disease burden ( burke et al . 2010 ) which prompts ( whether formally or informally ) t1 translational research that aims to move scientific discovery into candidate applications . evaluation of candidate applications ( treatments and other health interventions ) in t2 translational research assesses these applications and shapes development of evidence - based guidelines and policy . t3 translational research aims to move evidence - based recommendations and policy into health care practice via implementation , dissemination and diffusion research . phase four , t4 translational research aims to evaluate the health impact of the application in practice . and thus the cycle begins again albeit , we hope , with a modified population health - disease burden . though not addressing the t1/t2 model explicitly , the recent review by green and guyer ( 2011 ) references a disarticulation of the t1 phase . describing translation in genomics as moving from base pairs to the bedside , green and guyer ( 2011 ) add understanding of the structure of genomes , the the biology of genomes and the biology of disease to the t1 model . a molecular , cellular and somatic disease model implied by green comprise what we call the t1.1 , t1.2 , t1.3 components of the t1 phase ( see fig . 1 ) . added to this , we include t1.4 , the understanding of the social context and determinants of disease : this may be in terms of the social construction and experience of the disease itself ( cf . murtagh and hepworth 2003 ) , understandings of the social context of disease to inform new interventions in the t2 setting ( cf . as we state above , understanding of the social , behavioural and ethico - legal dynamics are fundamental to successful implementation and improvement science . also missing from current models of translation is an explicit acknowledgment of the tools and methodologies that underpin translation of basic and applied research : for example , innovative theories , tools and methods for analysing data to maintain privacy and confidentiality ( wolfson et al . 2007 ) ; enhancing the processes of knowledge translation and exchange ( graham and tetroe 2007 ; kitson as 2009 ) ; improving practice ( dixon - woods et al . 2001 ) ; implementing policy guidelines and new practice in complex organisations ( may 2006 ; may et al . we call these ttm or , t0tm , t1tm , and t2tm as appropriate to the phase of translation ( see fig . 1 ) . in terms of t2tm 2010 ; 2 derived from green and guyer 2011 , 3 terms used by khoury et al . 2007 ) an expanded translational research continuum ( 1 term used by burke et al . 2010 ; 2 derived from green and guyer 2011 , 3 terms used by khoury et al . 2007 ) as much as we can not simply throw the science over the wall and expect the generation of appropriate interventions , nor can we simply throw these interventions over the wall . whilst the models of translational research above have been elaborated beyond the dyadic t1 and t2 translational research , concern with the processes by which knowledge is translated into practice in the real world that is , the messy , contingent , ambiguous , peopled world have been taken up by a range of disciplines under the rubrics dissemination , implementation , and most recently , improvement science , i.e. t2tm . the important distinction between research translation and these variants of implementation / improvement science is the focus of the former on the content of the science and form of the interventions generated and of the latter on the processes of moving the resultant science and interventions across the research translation continuum into practice . key amongst these approaches is knowledge translation ( kt ) which is defined by the canadian institute for health research ( cihr ) as a dynamic and iterative process that includes synthesis , dissemination , exchange and ethically sound application of knowledge to improve the health of canadians , provide more effective health services and products and strengthen the health care system ( cihr 2011 ) . with adjustments for citizenship this is the definition used in the international literature and in the canadian context goes under the banner better research , better decisions , better health. kt has an inherently democratising orientation . kt draws upon a long history within health promotion , health education and community development of engaging communities , health care providers and policy makers with health care issues , action and change . these multiple perspectives share a common understanding of the translation of knowledge to practice as a complex dynamic social process . moreover , these are public , not simply scientific issues . as with nowotny et al.s ( 2001 , 2006 ) call for transdisciplinary knowledge generation , the forums for discussion and development of the translation of biobanking knowledge necessarily involve the representation and participation of scientists with industry , government and health service stakeholders as well as research participants and the public . being neither the expert forums of academic conferences , select committees and health department committee meetings nor the public forums of patient groups , public meetings and demonstrations , these are , instead , what callon et al . translation of biobanking science demands the active involvement and intersection of perspectives of the full range of stakeholders : that is , the co - evolution of translational research . knowledge translation under the cihr definition takes place within a complex system of interactions between researchers and knowledge users which may vary in intensity , complexity and level of engagement depending on the nature of the research and the findings as well as the needs of the particular knowledge user ( cihr 2011 ) . kt offers a number of strategies of translation and exchange , the primary mode of which is a knowledge - to - action framework , which incorporate cycles of development that iterate between problem identification , knowledge synthesis , contextualising , tailoring and adapting knowledge , product and tools development , and evaluating and sustaining knowledge use ( graham and tetroe 2007 ; kitson and straus 2009 ) . practices of kt include : use of consensus conferences or expert panels , systematic reviews , narrative syntheses , meta - analyses , meta - syntheses and practice guidelines to contextualise and integrate research findings ; dissemination via briefings and educational sessions with stakeholders , including patients , practitioners and policy makers , engaging knowledge users in developing and executing dissemination / implementation plans , and media engagement ; knowledge exchange through interaction between knowledge users and researchers and results in mutual learning through the process of planning , producing , disseminating , and applying existing or new research in decision - making ; and , are consistent with ethical principles and norms , social values , as well as legal and other regulatory frameworks ( kitson and straus 2009 ) . empirical studies of kt strategies demonstrate their promise , but also their challenges ( lwy 1996 ; mitton et al . 2009 ; mitton et al . 2007 ) and such networks demand the reshaping of some members normative cultures and beliefs . in one example , the processes were inclusive and facilitated the involvement of non - academic actors , but tended to conceal political tensions ( lehoux et al . the resultant science was a pragmatic one whose intention was not to provide a critique or to produce unconventional knowledge ( lehoux et al . although we must guard against an untrammelled science , an overly civilised science runs the risk of quashing innovation . limits may impede bioscientific creativity and imagination but the challenges offered by transdisciplinarity can become a driving force for creativity ( nowotny 2008 ) . as in biobanking science , the challenges of ethico - legal scholars ( cambon - thomsen et al . 2007 ; gottweis and lauss 2010 ; hoeyer 2008 ; knoppers and chadwick 2005 ) related to privacy and security of data have led to development of new technologies ( wolfson et al . 2010 ) . studies of implementation suggest a range of challenges to moving new bioscience knowledge into practice . kitson and straus ( 2009 ) demonstrate inherent resistance in many organisations to embrace change and that most people ( including professionals ) operate most of the time on automatic pilot and ( 2007 ) identifies the organisational components as necessary for kt and implementation knowledge as : capabilities ( support to use and diffuse knowledge , e.g. knowledge brokers , training ) ; process ( e.g. knowledge networks , communities of practice , integration of kt in research ) ; and codification ( e.g. practice guidelines , quality indicators , performance management systems ) . normative process theory ( may 2006 ; may et al . 2009 ) suggests that interventions only become routinely embedded ( implemented and integrated ) in their social , organisational and professional contexts as the result of people working , individually and collectively , to do so . successfully achieving this requires an understanding of : how people make sense of the action(s ) to be implemented ; their attitudes ; and their intentions . importantly , implementation requires continuous investment by people in ensembles of action that carry forward in time and space research translation is a contextual and cumulative process : one that is necessarily dynamic and interactive ; one that involves multiple actors . research translation is broadly conceived as one in which there is a contemporaneous exploration of new avenues of research occurring in the same contexts in which new interventions are being developed and applications anticipated interventions are ideally part of an iterative cycle of translation , incorporating further intervention and reintegration . implementation / improvement science is predominantly focused on the t2 ( i.e. t2t4 ) phases of the translational research continuum . arguably , in biobanking science , the methods of kt as described here are necessary across the continuum to include t0tm and t1tm methodologies to complete and maintain the cycle of translation . what is not yet entirely clear is just how to operationalise the translation cycle . certainly knowledge generation will be collaborative , interactive and transdisciplinary . practical methodologies of translation ( including kt ) in biobanking will likely include collaborative multiple stakeholder networks ( hybrid forums ) to build on the existing transdisciplinary science networks . addressing the complexity of bioscience knowledge generation and this is arguably more so for biobanking science . whilst biobanks undoubtedly provide a fundamental resource for both clinical and public health practice their potentiating ontology that their outputs are perpetually a promise of scientific knowledge generation ( borup et al . biobanking science therefore provides a perfect counterpoint against which to test the bounds of thinking in terms of knowledge generation and its translation . the beginnings of a robust model are to be found across the range of considerations of translational research and knowledge generation described above , both from within bioscience and without . in this paper , we described the distinctiveness of population biobanking and defined distinctions between a range of disciplinary approaches to translation in / of research . that we must imagine instead , for translational research for biobanks , a new paradigm : one that takes us from bench to bedside to backyard and beyond ; that is attentive to the social and political context of translational science ; and is cognisant of all the players in that process be they researchers , health professionals , policy makers , industry representatives or members of the public , amongst others . although the question of just how we achieve this remains open , it is essential to direct our attention to these critical issues in the current phase of biobank development . we need to explore how we can ensure that the maturing biobanks platforms are appropriately set up to optimise their ultimate value as drivers of translational change . there is a vital need to embed biobanks within health systems and to ensure involvement of policy makers , and health care providers early in the process . the depth and breadth of information that is ultimately required is so extensive that we will never have as much as we might ideally like . consequently , it is to everybody s advantage that biobank builders freely share their knowledge and expertise . the long - term management and use of data are social processes with ethico - legal implications . much of the management of the science must focus on these issues rather than on the detailed bioscience itself . this demands the development and provision of new methods and tools , and the active co - involvement of bioscientists , clinical scientists , population and public health scientists , social scientists , and experts in information management and technology , and ethico - legal issues . to optimise ultimate outcomes , it should also involve the general public , health care providers and strategists , politicians and industry . no single group can possibly do the work that is required , and no single group can truly dominate or lead . optimising	the promise of science lies in expectations of its benefits to societies and is matched by expectations of the realisation of the significant public investment in that science . in this paper , we undertake a methodological analysis of the science of biobanking and a sociological analysis of translational research in relation to biobanking . part of global and local endeavours to translate raw biomedical evidence into practice , biobanks aim to provide a platform for generating new scientific knowledge to inform development of new policies , systems and interventions to enhance the public s health . effectively translating scientific knowledge into routine practice , however , involves more than good science . although biobanks undoubtedly provide a fundamental resource for both clinical and public health practice , their potentiating ontology that their outputs are perpetually a promise of scientific knowledge generation renders translation rather less straightforward than drug discovery and treatment implementation . biobanking science , therefore , provides a perfect counterpoint against which to test the bounds of translational research . we argue that translational research is a contextual and cumulative process : one that is necessarily dynamic and interactive and involves multiple actors . we propose a new multidimensional model of translational research which enables us to imagine a new paradigm : one that takes us from bench to bedside to backyard and beyond , that is , attentive to the social and political context of translational science , and is cognisant of all the players in that process be they researchers , health professionals , policy makers , industry representatives , members of the public or research participants , amongst others .
You are an expert at summarizing long articles. Proceed to summarize the following text: it was earlier known by different names such as adamanto - odontome , calcified mixed odontogenic tumor , soft and calcified odontome and ameloblastic odontome . thoma introduced the term oa in 1970 and this term was included in the 1971 world health organization ( who ) histological classification of odontogenic tumors . till date , < 50 cases have been reported as oa or ameloblastic odontoma in the english dental literature , but only 14 , fulfill the histological criteria of the current who histological classification of odontogenic tumors . generally , its clinical presentation is similar to an odontome , therefore curettage and excision followed by histologic analysis is mandatory for the definite diagnosis . oa is defined by who and reichart and philipsen as a very rare neoplasm that includes odontogenic ectomesenchyme in addition to odontogenic epithelium that resembles an ameloblastoma ( sma ) in both structure and behavior . because of the presence of odontogenic ectomesenchyme , inductive changes take place leading to the formation of dentin and enamel in parts of the tumor . here , we are presenting a case of oa in a 17-year - old female mimicking a fibro - osseous lesion in left mandibular premolar region along with a brief review of the related literature . a 17-year - old female patient reported to the out - patient department of our institute with chief complaint of a slow growing swelling in her left lower back tooth region . there was history of extraction of left mandibular first molar 3 months back due to extreme mobility . the patient noticed the swelling after that and the swelling has now increased to present size . intra - oral examination revealed a well circumscribed swelling in the left mandibular premolar region measuring about 2 cm 1 cm in dimensions obliterating the vestibule . intra - oral periapical radiograph of the same region revealed a well - defined mixed radiolucent radiopaque lesion causing displacement of roots of both the premolars [ figure 1 ] . the lesion was surgically enucleated enmasse under local anesthesia [ figure 2 ] and was sent for histological evaluation . intra - oral periapical radiograph of left mandibular premolar region showing well circumscribed mixed radiolucent radiopaque lesion causing displacement of adjacent teeth intra - operative view of the lesion histologically , ameloblast like tall columnar cells were seen arranged in follicles showing nuclear palisading and reversal of polarity . cystic degeneration was also evident in many follicles . in some areas interconnecting cords of ameloblast like cells the epithelial cells were embedded in mature connective tissue stroma . along with ameloblastomatous component , empty spaces suggestive of demineralized enamel were seen surrounding these dentinoid masses [ figure 3a d ] . a histological diagnosis of oa was given . healing was uneventful and the patient is under regular follow - up since last 8 months without any evidence of recurrence . ( a ) photomicrograph showing ameloblastomatous proliferation as well as dentinoid material in a mature connective tissue stroma ( h&e stain , 40 ) . ( b ) photomicrograph showing dentinoid enclosing pulp like space and surrounded by empty space suggestive of enamel ( h&e stain , 100 ) . ( c ) photomicrograph showing dentinoid enclosing pulp like space and surrounded by empty space suggestive of enamel ( h&e stain , 400 ) . ( d ) photomicrograph showing ameloblastomatous follicles with cystic degeneration ( h&e stain , 100 ) the oa , which is also known by some authors as ameloblastic odontoma , is a very rare mixed odontogenic neoplasm , characterized by the simultaneous occurrence of an ameloblastoma and a compound or complex odontoma in the same tumor mass . in the latest , who classification of odontogenic tumors and allied lesions , oa falls in the category of benign tumors of odontogenic epithelium with odontogenic ectomesenchyme with or without dental hard tissue formation . other lesions in this group include : ameloblastic fibroma , ameloblastic fibro - dentinoma , ameloblastic fibro - odontoma ( afo ) , complex odontoma , compound odontoma , calcifying cystic odontogenic tumor and dentinogenic ghost cell tumor . because of the rarity of oa , very little reliable information is available regarding its incidence and prevalence rate . oa affects predominantly young patients with a mean age of 20.12 years in the reported cases , appearing in up to 59% of patients under 15 years of age . there is a slight male predilection but the case presented here occurred in a young female patient . this tumor usually occurs in the posterior segment of either jaw , with a slight inclination for mandible . table 1 represents brief review of literature of oa showing various reported cases , age / sex of the patients , site of the lesion and prognosis . review of literature of odontoameloblastoma this tumor does not affect only the human race but also have been reported in sheep , monkeys , cats and rats . ghost cells may also be seen in some oas and therefore it is important to differentiate oa from other tumors that also contain such cells like calcifying odontogenic cysts and odontogenic ghost cell tumors . oa has been characterized as slow , progressively growing lesions with growth characteristics similar to those of sma . they present as expansile centrally destructive lesions and may cause progressive swelling of the alveolar bone , dull pain , changes in occlusion and delayed eruption of teeth . radiographically , the oa appears as a well - defined unilocular or multilocular radiolucency containing varying amounts of radiopaque substances . the radiopaque material may be in the form of small particles ( denticles representing a compound odontome like appearance ) or of a larger centrally located mass of dental hard structures with the features of a complex odontoma . it exhibits a well - defined margin displacing the surrounding erupted teeth rather than causing root resorption . one theory suggests that the mineralized dental tissues are formed as a hamartomatous proliferation in response to inductive stimuli produced by the proliferating epithelium over the mesenchymal tissue . another possibility is that both an ameloblastoma and an odontoma develop separately and form a collision tumor . this possibility seems unlikely because of the differences between these tumors with respect to age , location and symptoms . also , the microscopic picture of oa shows clearly that the odontoma are intermingled and actively forming within the ameloblastoma . the proliferating odontogenic epithelium portion of the tumor is similar to an ameloblastoma , most commonly of the plexiform or follicular pattern . the ameloblastic component is intermixed with immature or more mature dental tissue in the form of developing rudimentary teeth resembling a compound odontoma or conglomerate masses of enamel , dentin and cementum as seen in a complex odontoma . kaugars and zussmann have suggested following criteria for histological diagnosis of oa - ( a ) unequivocal ameloblastoma , ( b ) connective tissue with a mature homogenous appearance and ( c ) fragments of malformed calcified dental structures . clinical and radiographic differential diagnoses for oa include several odontogenic and nonodontogenic lesions exhibiting well - defined uni- or multilocular radiolucencies with varying amounts of radiopaque material within them . these include developing compound or complex odontomas , ameloblastic fibroodontomas , calcifying epithelial odontogenic tumors , calcifying odontogenic cystic tumors , adenomatoid odontogenic tumors and cement - ossifying fibromas . sometimes , it is very difficult to differentiate oa clinically as well as microscopically from typical odontomes . however , oa causes bone expansion just like ameloblastoma , while odontoma rarely produces swelling of the affected region . some of the oas may result in dull or intermittent pain also , a predominant ameloblastic component either in follicular or plexiform pattern within a mature connective tissue stroma helps in confirming the diagnosis . a case of peripheral oa wachter et al . , compared four cases of oa with 14 case of afo and found no decisive histological criteria to separate these two lesions . however , sma like structures were more characteristic for the oa , whereas ectomesenchymal component was more pronounced in the afo . yamamoto et al . demonstrated a high proliferation potential of the oa based on the expression of tenascin in the basement membrane of the odontogenic epithelium of this tumor and on the results obtained with proliferating cell nuclear antigen staining . in a review by mosqueda - taylor et al.,3 out of 14 cases reported recurrence ( 21.4% ) , which was similar figure to that found by reichart et al . for ameloblastoma . for these reasons , it is necessary to emphasize that oa should be treated in the same manner as the ameloblastoma , with wide excision and close follow - up for at least 5 years . considering all these facts regarding aggressive nature of the lesion	odontoameloblastoma ( oa ) is an extremely rare odontogenic tumor that contains an ameloblastomatous component together with odontoma - like elements . till date , very few cases have fulfilled the criteria of the current world health organization classification of odontogenic tumors . it is characterized by slow , progressively growing lesion with growth pattern similar to solid multi - cystic ameloblastoma . the majority of the tumors are associated with unerupted teeth and commonly seen in males . it is usually asymptomatic and may occur in either maxilla or mandible , but shows a slight predilection for mandible . as this tumor is extremely rare , there exists controversy regarding its treatment . here , we present a case of oa in 17-year - old female patient resembling a fibro - osseous lesion and a brief review of the related literature .
You are an expert at summarizing long articles. Proceed to summarize the following text: cancer cells grow too quickly and this growth continues to cause damage to healthy cells . the growth and abnormal proliferation are a result of the changes or mutations in the genetic material inside the cells . reproductive factors that increase the risk of breast cancer include : having a long menstrual history , not having children , having one 's first child after age 30 , not having breastfed , being overweight or obese after menopause , use of postmenopausal hormone therapy , physical inactivity , and consumption of one or more alcoholic beverages per day . the incidence of breast cancer is the highest in the more developed regions of the world , in urban populations , and among white women . the globocan database for 2002 indicates that the age - standardized rate of breast cancer incidence is 67.8 per 100,000 in more developed regions ( europe , australia , new zealand , north america , and japan ) compared to 23.8 per 100,000 in less developed regions ( africa , central america , south america , all regions of asia except japan , the caribbean , melanesia , micronesia , and polynesia ) . the highest incidence is reported to occur in north america ( 99.4 per 100,000 ) and the lowest in asia ( 22.1 ) and africa ( 23.4 ) . the worldwide age - standardized rate for mortality from breast cancer between 1993 and 2001 was 13.2 per 100,000 , ranging from 8.8 in asia to 19.7 in europe . the rate in more developed countries was 18.1 compared to 10.4 in less developed countries . the risk of developing breast cancer in women during their lifetime is 12.5% ( 1 case out of 8 cases ) and the risk of death occurring from breast cancer is 3.6% ( 1 case out of 28 cases ) . about 10% of women in the united states suffer from breast cancer at some stage of their lives , and this type of cancer is the second leading cause of cancer - related deaths after lung cancer . in iran , the highest incidence of breast cancer was reported to be among women of age between 40 and 49 years . breast cancer incidence in iran is about 22 per 100,000 and its prevalence is 120 per 100,000 among women . isfahan ranks first in the country in cancer incidence , and breast cancer is the commonest cancer among women . based on the statistics of 2004 , about 10% of breast cancer cases in the country have been reported from isfahan . conducting research on the characteristics of cancer tumor is very important in order to prevent breast cancer and its recurrence and for prognosis at diagnosis . the overall risk of cancer is higher in old age because the person would have been exposed to more of carcinogens at that time . the exact size of the tumor , spread of cancer cells to lymph nodes , and tumor grade at diagnosis play an important role for choosing the type of surgery and adjuvant therapy in patients . these receptors allow the breast tissue to change or grow against the hormone changes and , therefore , play an important role in the development and progression of breast cancer . a study conducted in 2007 by jemal et al . in which breast cancer trends were examined in 454,728 women of 45 years of age and above from the united states by age and tumor characteristics showed that there were two distinct patterns in breast cancer . the downturn in the incidence rates in all age groups above 45 years suggests a period effect that is consistent with saturation in screening mammography . this study also showed that the incidence rates decreased for small tumors ( less than or equal to 2 cm ) . a study conducted in 2007 by hausauer et al . examining breast cancer trends in 161,800 asian / pacific islander , hispanic , and african - american women of age 20 years or older from the united states by hormone receptor status and tumor size showed that between 2001 and 2004 , the incidence rates of invasive breast cancer in women of age 50 years or older declined appreciably in asians / pacific islanders and hispanics , but were stable in african - americans . rates of hormone receptor - negative tumors increased in african - americans and hispanics during 20012004 . in asian / pacific islander women , perceptible but statistically nonsignificant decreases a study was conducted in 2007 by kerlikowske et al . by examining breast cancer trends in a breast cancer screening mammography program for 603,411 screening mammography examinations performed on women aged 5069 years . of these women , 3238 were diagnosed with breast cancer within 12 months of a screening examination , and the rate of estrogen receptor ( er)-positive invasive cancer was stable until 2001 and then declined from 2001 to 2003 . a small increase was observed in er - negative disease in the first quarter of 2003 . in 2008 , examined recent breast cancer trends among 387,231 women of all age groups from the united states by age and tumor characteristics and showed that the number of breast cancer cases was more among women who were younger than 39 years during 19922004 . also , despite the reduced use of hormone therapy , from 1999 to 2004 , the age - standardized incidence rates in breast cancer were constant over the entire period - stratified by hormone receptors and the highest incidence rate was seen among 3039 year old women . this study also showed that the highest incidence rate was for small tumors , high tumor grade , and negative lymph nodes . a study conducted in 2010 by marliac et al . who examined breast cancer trends in 192,39 french women showed that since 2003 , the incidence of invasive breast cancer has decreased in women aged 5074 years . in 2010 , shin et al . examined breast cancer trends in 161,800 eastern and southeastern asian women aged 20 years or older and showed that the incidence rates increased gradually in all countries . incidence rates increased in korea during the 10-year period in all age groups except the < 70 year age group . women aged 5069 years had higher apcs in most countries , but not in japan , rural china , or the philippines . breast cancer trends in 82,508 women of age 35 years or older from belgium by age groups showed that belgium ranked first among all countries in europe in the age - standardized incidence rate for all ages combined and in the 3549 and 5069 age groups . in flemish region , while quite a stable incidence rate was observed in the age group 3549 years , two phases were distinguished in women aged 5069 years : first , an increase from 1999 to 2003 and then , a sharp decrease from 2003 to 2006 . in the oldest age group , a steady increase was observed over the whole period . a study conducted in 2012 by rusner et al . who examined age - adjusted breast cancer incidence rate in 63,250 women aged 5069 years from germany by age groups showed the age - standardized incidence rates in breast cancer were virtually constant over the entire period in all regions . no substantial changes occurred over time within the age - specific analyses . determining disease incidence is an important component of any community 's health plans . being aware of the disease incidence pattern in each country could be important for national planning . public health organizations believe that the process of reviewing or monitoring disease incidence , mortality , and social , behavioral , and health risk factors can impact on decrease of the incidence of adverse health events . trend analysis of the observed incidence or prevalence rates provides valuable information for the assessment , planning , program evaluations , and development indicators for each country . the trend analysis of data can be performed by regression analysis , time series , and other statistical methods . to do this if the linear regression models or time - series model is used , ( when the explanatory variable is the time ) , a model is obtained for all data . while many cases have a complex data , assuming a linear relationship between the independent variables and the dependent variable is unacceptable for them . in one of the modeling methods , the data are divided into several sections and a simple linear model is fitted for each section , so that the model is continuous over the entire data , while the simple linear regression model is often useful to describe general changes over time . in studying trend data such as the cancer incidence data , one the joinpoint regression model , which is composed of a few continuous linear phases , is often useful to describe changes in trend data . thus , an appropriate statistical method is necessary to evaluate cancer incidence trends , so that we can estimate the joinpoints in different years and determine the speed and type of changes . in this model , in addition to evaluate the behavior of the response variable ( breast cancer incidence rate ) at different periods of explanatory variable ( time ) , the behavior of response variable can be separately reviewed in characteristics of subjects in the different periods of explanatory variable . joinpoint models have been used in many fields of statistical research such as generalized linear models , risk function , time series , nonparametric methods , and longitudinal studies . in 1961 , sprent used the least square method for estimating segmented regression parameters when the change points are assumed to be known ; in 1964 , robison applied maximum likelihood and conditional maximum likelihood methods for estimating the connected location two regression functions when there are n1 observations in the first segment and n2 observations in the second segment , assuming that the change points are known or unknown ; in 1996 , berman used nonlinear least squares method ; in 1980 , lerman proposed a grid search method to fit segmented regression curves ; in 1966 , hudson fitted segmented curves whose join points have to be estimated ; and in 2004 , kim and fay proposed a procedure to compare two breast cancer incidence rates in two different genders and geographic regions using joinpoint linear regression model and least square method . this regression model is also used for the analysis of other diseases , in addition to using joinpoint regression model in breast cancer analysis . in several studies , joinpoint regression has been used , for example , to examine the trends in the incidence of treatment for diabetes - related end - stage renal disease in the united states from 1990 to 1996 , to examine the trends in hip fracture rates in canada from 1985 to 2005 , to assess the effect of hepatitis b vaccine in decreasing the incidence of hepatitis b disease in italy from 1985 to 2006 , to examine hepatitis c virus infection trends in italy from 1996 to 2006 , to examine whether the low birth weight paradox existed in brazil between 1995 and 2007 , to examine the trend of reduction in young male suicide cases in scotland between 1980 and 2004 , and applying segmented regression model to analyze the trend of tuberculosis incidence rate in iran between 1964 and 2008 . the goals of trend analysis in cancer surveillance are to determine whether cancer incidence has increased or decreased over time and to assess the speed with which the increase or decrease has occurred . changes in exposure to risk factors , the introduction of screening programs , and other interventions are effective in the rate or frequency of some cancers . in this regard , cancer registries have been established to collect data on cancer from different countries . it is , therefore , important to evaluate time trends in breast cancer incidence by age and tumor characteristics . women are an important part of society , and their health and the health of the population are connected . due to the high prevalence of breast cancer in iran and also among iranian women compared to women in the developing countries and as they are affected by the disease for at least a decade earlier , determining the trend of breast cancer incidence rate by age and tumor characteristics in women aged 3069 years and in isfahan city from 2001 to 2010 by using joinpoint regression is very important . this study was a cross - sectional one in which the subjects were patients with breast cancer and information from 2001 to 2010 was obtained from the records of patients in the radiotherapy and oncology departments of isfahan university of medical sciences and the ultra specialized milad hospital . the information of these patients was entered in special forms that were designed by the breast cancer research centre and then were recorded in the medical records of patients . criteria for selection of subjects were age , gender ( women of age from 30 to 69 years due to the high incidence of breast cancer in this group ) , and location ( the city of isfahan and its population were selected in the calculation of incidence rates ) . it is worth noting that the confidentiality of information in patients files was maintained and the information was just collected and analyzed for this study . the main purpose of the study was to analyze the breast cancer incidence and the trend analysis of breast cancer data was described by the annual incidence . statistical yearbook of isfahan province was used to estimate the population of women in the city of isfahan . population of isfahan province using census of 2006 ( also stratified by age in the 5-year groups ) was selected as the standard population . statistical variables included age , tumor size ( less than or equal to 2 cm , 2.15 cm , and greater than 5 cm ) , tumor grade ( well differentiated , poorly differentiated , and moderately differentiated ) , estrogen and progesterone hormone receptors ( positive or negative ) , and the proportion of positive lymph nodes to lymph node surgery ( less than or equal 25% vs. greater than to 25% ) . joinpoint regression model was used to investigate the pattern of breast cancer incidence rates . the response variable for the analysis of incidence was the natural logarithm of the age - standardized breast cancer incidence rates , and the independent variable was the diagnosis year of breast cancer from 2001 to 2010 , stratified by confounding variables including age , tumor grade , tumor size , er , pr , and proportion of positive lymph nodes to lymph node surgery which were analyzed . joinpoint regression program ( 3.5.2 ) and spss 18 were used to analyze the data . the joinpoint regression model , which is composed of a few continuous linear phases , is often useful to describe changes in trend data . the joinpoint regression model for the observations { ( x1 , y1),(xn , yn ) } , where x1 x2 xn represents the time variable and yi , i = 1 , , n are the response variables , can be written as : where in this model , the regression coefficients are represented by , j joinpoint is represented by j , and j segment of data is represented by sj , where nj observed data points are into and defined as sj={xi : j-1 < xi j}={xij-1 + 1, ,xij } , j = 1 , 2 , , k + 1 , and k+1 = max ( x ) , 0= min ( x ) , ik+1= n , i0=0 . . there are three major decisions in any joinpoint analysis : the form of the mean function , the location of the joinpoints given the number of joinpoints , and the optimal joinpoint model . in this study , the response variable was age - standardized rate and not a count ; therefore , normal distribution was employed noting the homogeneous and heteroscedastic variances . in this model , the default value for the maximum number of joinpoints depends on the number of data points ; also , a joinpoint can not occur within a user - specified number of data points from the beginning or end of a series and there must be at least a user - specified number of data points between two joinpoints .. according to the graphical plot to obtain the incidence rates , the initial analysis of the data , and the 10-year period of study , it was clear that there is maximum one joinpoint for the data of the breast cancer incidence rates ; so , considering one joinpoint , the results were analyzed . the least square method ( hudson tests and permutation tests ) for fitting the regression model and estimating segmented regression parameters was used . using the monte carlo permutation technique with the number of 4499 permutations , the number and locations of the joinpoints , and the best model in breast cancer trend was selected . also , permutation test was used for comparing two joinpoint linear regression functions specifically to determine the identity and parallelism of the two functions allowing different intercepts . because in hudson 's method , the joinpoints take any value within the observed data range , it provides a better fit than the other methods . the hudson 's method is more sensitive and has more power to discover the new trends that are missed by the other methods . furthermore , the hudson 's method always provides a smaller sum square error , hence gives more accurate estimates of the regression coefficients and annual percent changes ( apcs ) . in the permutation test procedure , the tests of the null hypothesis are sequentially conducted , so that there are the minimum joinpoints against the alternative of the maximum joinpoints until we reach a conclusion wherein the optimal joinpoints have the minimum sum of squares of residuals . in this method , the distribution of test statistic is not known , and to assess the statistical significance of the observed value , the corresponding probability is estimated . also , to perform the complete enumeration of the permutation test the apc and average annual percent change ( aapc ) were proposed to summarize and compare the rates of changes that are not constant over a given time period of breast cancer incidence . the rate of change increases on average over the selected time period if the lower confidence limit of the aapc is positive , or the rate of change decreases if the upper confidence limit of the aapc is negative . to compare the aapc from two different groups , we may employ a ratio statistic ( 1 + 1)/(2 + 1 ) where the subscripts 1 and 2 indicate apc of group 1 and group 2 , respectively . so , the annual rate of change for group 1 is more rapid than for group 2 over the selected time period if l>1 or , alternatively , the rate of annual change for group 1 is slower than for group 2 if u<1 . this study was a cross - sectional one in which the subjects were patients with breast cancer and information from 2001 to 2010 was obtained from the records of patients in the radiotherapy and oncology departments of isfahan university of medical sciences and the ultra specialized milad hospital . the information of these patients was entered in special forms that were designed by the breast cancer research centre and then were recorded in the medical records of patients . criteria for selection of subjects were age , gender ( women of age from 30 to 69 years due to the high incidence of breast cancer in this group ) , and location ( the city of isfahan and its population were selected in the calculation of incidence rates ) . it is worth noting that the confidentiality of information in patients files was maintained and the information was just collected and analyzed for this study . the main purpose of the study was to analyze the breast cancer incidence and the trend analysis of breast cancer data was described by the annual incidence . statistical yearbook of isfahan province was used to estimate the population of women in the city of isfahan . population of isfahan province using census of 2006 ( also stratified by age in the 5-year groups ) was selected as the standard population . statistical variables included age , tumor size ( less than or equal to 2 cm , 2.15 cm , and greater than 5 cm ) , tumor grade ( well differentiated , poorly differentiated , and moderately differentiated ) , estrogen and progesterone hormone receptors ( positive or negative ) , and the proportion of positive lymph nodes to lymph node surgery ( less than or equal 25% vs. greater than to 25% ) . the response variable for the analysis of incidence was the natural logarithm of the age - standardized breast cancer incidence rates , and the independent variable was the diagnosis year of breast cancer from 2001 to 2010 , stratified by confounding variables including age , tumor grade , tumor size , er , pr , and proportion of positive lymph nodes to lymph node surgery which were analyzed . joinpoint regression program ( 3.5.2 ) and spss 18 were used to analyze the data . the joinpoint regression model , which is composed of a few continuous linear phases , is often useful to describe changes in trend data . the joinpoint regression model for the observations { ( x1 , y1),(xn , yn ) } , where x1 x2 xn represents the time variable and yi , i = 1 , , n are the response variables , can be written as : where in this model , the regression coefficients are represented by , j joinpoint is represented by j , and j segment of data is represented by sj , where nj observed data points are into and defined as sj={xi : j-1 < xi j}={xij-1 + 1, ,xij } , j = 1 , 2 , , k + 1 , and k+1 = max ( x ) , 0= min ( x ) , ik+1= n , i0=0 . there are three major decisions in any joinpoint analysis : the form of the mean function , the location of the joinpoints given the number of joinpoints , and the optimal joinpoint model . in this study , the response variable was age - standardized rate and not a count ; therefore , normal distribution was employed noting the homogeneous and heteroscedastic variances . in this model , the default value for the maximum number of joinpoints depends on the number of data points ; also , a joinpoint can not occur within a user - specified number of data points from the beginning or end of a series and there must be at least a user - specified number of data points between two joinpoints .. according to the graphical plot to obtain the incidence rates , the initial analysis of the data , and the 10-year period of study , it was clear that there is maximum one joinpoint for the data of the breast cancer incidence rates ; so , considering one joinpoint , the results were analyzed . the least square method ( hudson tests and permutation tests ) for fitting the regression model and estimating segmented regression parameters was used . using the monte carlo permutation technique with the number of 4499 permutations , the number and locations of the joinpoints , and the best model in breast cancer trend was selected . also , permutation test was used for comparing two joinpoint linear regression functions specifically to determine the identity and parallelism of the two functions allowing different intercepts . because in hudson 's method , the joinpoints take any value within the observed data range , it provides a better fit than the other methods . the hudson 's method is more sensitive and has more power to discover the new trends that are missed by the other methods . furthermore , the hudson 's method always provides a smaller sum square error , hence gives more accurate estimates of the regression coefficients and annual percent changes ( apcs ) . in the permutation test procedure , the tests of the null hypothesis are sequentially conducted , so that there are the minimum joinpoints against the alternative of the maximum joinpoints until we reach a conclusion wherein the optimal joinpoints have the minimum sum of squares of residuals . in this method , the distribution of test statistic is not known , and to assess the statistical significance of the observed value , the corresponding probability is estimated . also , to perform the complete enumeration of the permutation test , we would create n ! , in general , be too large a number , we take monte carlo samples from these n ! the apc and average annual percent change ( aapc ) were proposed to summarize and compare the rates of changes that are not constant over a given time period of breast cancer incidence . the rate of change increases on average over the selected time period if the lower confidence limit of the aapc is positive , or the rate of change decreases if the upper confidence limit of the aapc is negative . to compare the aapc from two different groups , we may employ a ratio statistic ( 1 + 1)/(2 + 1 ) where the subscripts 1 and 2 indicate apc of group 1 and group 2 , respectively . so , the annual rate of change for group 1 is more rapid than for group 2 over the selected time period if l>1 or , alternatively , the rate of annual change for group 1 is slower than for group 2 if u<1 . the information in the medical records of 3640 women aged 3069 years with breast cancer was studied . the mean ( standard deviation ) of patients age was 47.9 ( 9.4 ) years . tumor size in 11.1% of women was less than or equal to 2 cm ; in 60% patients , it was 2.15 cm ; and in 28.9% patients , it was greater than 5 cm . 18.7% of patients had well - differentiated tumor grade and 50.8% ( 30.4% ) of tumors were moderately ( poorly ) differentiated . overall , 40.5% ( 41.1% ) of patients had estrogen ( progesterone ) receptor negative and 59.5 ( 58.9 ) women had estrogen ( progesterone ) receptor positive cancer . proportion of positive lymph nodes to lymph node surgery in 58.8% of patients was less than or equal than 25% , and in 41.2% patients , it was greater than 25% [ table 1 ] . descriptive statistics of the studied variables table 2 shows the results of joinpoint trend analysis by age and tumor characteristics . the breast cancer incidence during the studied years increased annually by 4.1% [ figure 1 ] . the breast cancer incidence increased in the age groups of 4044 , 4549 , and 5559 years . the aapc in this time period for the above categories was 6.2% , 3.5% , and 5.3% , respectively . the highest increase in breast cancer incidence rate by tumor size was in the group with tumor size less than or equal to 2 cm ( 18.2% ) . also , in 2006.7 [ with confidence interval ( ci ) ( 2004 , 2008 ) ] , a significant change in breast cancer incidence trend with tumor size greater than 5 cm was seen and joinpoint analysis in these two time periods indicated a significant annual increase rate during the first period and a significant annual decrease rate during the second period . the joinpoint analysis by tumor grade showed an increase in breast cancer incidence rates in the well - differentiated ( 8% ) and moderately differentiated tumor grades ( 10.2% ) than in poorly differentiated tumor grade ( 7.3% ) . in this trend , there was a significant change of moderately differentiated tumor grade in 2007.7 [ with ci ( 2004 , 2008 ) ] and of well - differentiated tumor grade in 2007.8 [ with ci ( 2005 , 2008 ) ] . the apc of age - standardized incidence rates in breast cancer in women with well - differentiated and moderately differentiated tumor grades increased by 14.7% for the first time period ( 20012008 ) , while this rates declined by 11.5% for the second time period ( 20082010 ) . the apc of age - standardized incidence rates in breast cancer in women with well - differentiated and poorly differentiated tumor grades increased by 14.5% for the first time period ( 20012008 ) , while this rate declined by 23.2% for the second time period ( 20082010 ) . the apc of age - standardized incidence rates in breast cancer in women with moderately differentiated and poorly differentiated tumor grades increased by 15.6% for the first time period ( 20012008 ) , while this rate declined by 16.6% for the second time period ( 20082010 ) . the estrogen - positive group had the highest breast cancer incidence rates ( 10.5% ) . also , the progesterone - positive group had the highest breast cancer incidence rates ( 8.8% ) , and in 2003 [ with ci ( 2003 , 2007 ) ] , a significant change was seen . the aapcs for the 5 and 10 recent years were calculated and found to be 6.9% and 11% , respectively . the less than or equal to 25% group of proportion of positive lymph nodes to lymph node surgery had the highest breast cancer incidence rates , although this increase was not statistically significant . the apc rates in female breast cancer incidence by positive lymph nodes to lymph node surgery were not different in the two groups . breast cancer incidence rates per 100,000 people and joinpoint regression analysis by age and tumor characteristics the changes in trend of breast cancer incidence rates in isfahan city ( 20012010 ) table 3 shows the results of joinpoint trend analysis and comparability of aapcs by age and tumor characteristics . in table 3 , by running the permutation comparability test for the breast cancer incidence rates in women aged 3049 and 5069 years , we observe that the apc rates were not different in the two groups . therefore , on average , the difference between apcs of breast cancer incidence rates in women with breast cancer with the tumor of size less than or equal to 2 cm in the last five years was faster than women with breast cancer with tumor of size the 2.15 cm ( 28% ) and greater than 5 cm ( 39.7% ) . in addition , in recent 5 years difference between apcs of breast cancer incidence rates in the women with breast cancer with tumor size 2.15 cm was more quickly than women with breast cancer with the tumor of size 5 cm ( 11.7% ) . the apc rates in females with well - differentiated and moderately differentiated tumor grades were not different in the two groups and joinpoint regression mean response functions of the breast cancer age - standardized incidence rate in the two groups of women were [ figure 2 ] respectively . the difference between these two functions of the average response was only in the intercepts . also , there were no differences between the rates of aapc in women with well - differentiated and poorly differentiated tumor grades and joinpoint regression mean response functions for the breast cancer age - standardized incidence rate in these two groups of women were [ figure 3 ] respectively . the difference between these two functions of the average response was only in the intercepts . also , there was no difference between the rate of aapc in women with well - differentiated and moderately differentiated tumor grade and joinpoint regression mean response functions for the breast cancer age - standardized incidence rate in these two groups of women were [ figure 4 ] respectively . it is seen from table 3 that the apc rates between women with positive and negative ers were not different . also , the apc rates between women with positive and negative progesterone receptors were not different . joinpoint regression analysis and comparability of average annual percent changes by tumor characteristics the changes in trend of breast cancer incidence rates in isfahan city by well - differentiated and moderately differentiated tumor grade ( 20012010 ) ( : well differentiated , + : moderately differentiated estimated regression coefficients of comparability of average annual percent changes by age and tumor characteristics the changes in trend of breast cancer incidence rates in isfahan city by well - differentiated and poorly differentiated tumor grade ( 20012010 ) ( : well differentiated , + : poorly differentiated the changes in trend of breast cancer incidence rates in isfahan city by moderately differentiated and poorly differentiated tumor grade ( 20012010 ) ( : moderately differentiated , + : poorly differentiated recent reports have documented sudden , unprecedented decline in the incidence of breast cancer , particularly for er - positive tumors diagnosed in women 50 years and older . substantial drop has been observed in the us , new zealand , and canada , but not in the netherlands , norway , and sweden . in the populations reporting a decrease , gradual decline in the incidence began as early as 1999 , but accelerated in 2002 after the early and widely publicized termination of the women 's health initiative . the study conducted by jemal et al . in the united states showed that the largest percentage decrease occurred from 2002 to 2003 in women of age groups 5559 years ( 11.3% ) , 6064 years ( 10.6% ) , and 6569 years ( 14.3% ) . the study conducted by marliac et al . in france showed an increase in the incidence rates in the 2049 and 75 year age groups , with a mean annual increase of 1.6% and 0.9% , respectively . in the age group of 5074 years , the incidence increased by 1.5% per year from 1990 to 1999 and by 6% per year from 1999 to 2003 . from 2003 , there was a 3.4% annual drop in incidence . the study conducted by renard et al . in belgium showed a stable incidence rate in the age group of 3549 years in flemish region , an increase from 1999 to 2003 ( 5.4% ) , and then a sharp decrease from 2003 to 2006 ( 4% ) . in the oldest age group , a steady increase the study conducted by rusner et al . in germany showed that the age - standardized incidence rates in breast cancer were virtually constant over the entire period in all regions . the study conducted by brinton et al . in the united states showed that the highest incidence rate was found for small tumors , high tumor grade , and negative lymph nodes . the study conducted by shin et al . in eastern and southeastern asian women above 20 years of age showed that the incidence rates increased gradually in all countries . incidence rates increased in korea during the 10-year period in all age groups except the < 70 year age group . women aged 5069 years had higher apcs in most countries , but not in japan , rural china , or the philippines . unfortunately , the incidence of breast cancer among the iranian women occurs 1015 years lower than in western countries and the highest incidence of breast cancer is in the age group of 4049 years . since the incidence rate of cancer in women 55 years or older is high and given the power of the immune system at this age is reducing , thus , the diagnosis of cancer in the lower age is of considerable importance . the results of this study showed that the breast cancer incidence rates increased in all age groups . the increase in incidence rates was found in the 4044 , 4549 , and 5559 year age groups , with a mean annual increase of 6.2% , 3.5% , and 5.3% , respectively . the apc rates stratified by the two groups of 3049 and 5069 years were not different . the results of this study were consistent with the incidence in east asia . the study of jemal et al . on the breast cancer incidence rates by progesterone receptor - positive status showed that the incidence rates significantly increased by approximately 2.9% per year from 1990 to 2000 and then dropped sharply by 9.1% between 2002 and 2003 . in contrast , the incidence rates for er - negative tumors significantly decreased by 1.2% per year from 1990 to 2003 ; however , from 2002 to 2003 , the incidence rate for er tumors decreased by 6.9% . the study of kerlikowske et al . in the united states showed that between 2001 and 2003 , the annual rates of er - positive invasive breast cancer declined by 13% while these rates were stable until 2001 . in the first quarter of 2003 , a slight increase ( not significant ) was observed in patients with er - negative tumors . the study of hausauer et al . in the united states showed that between 2001 and 2004 , the incidence rates of invasive breast cancer in women of age 50 years or older declined appreciably among asians / pacific islanders ( 8.5% ) and hispanics ( 2.9% ) and were stable in african - americans . rates of hormone receptor - negative tumors increased among african - americans ( 26.1% ) and hispanics ( 26.9% ) during 20012004 . also , the study of brinton et al . showed that despite the declining use of hormone therapy , from 1999 to 2004 , the age - standardized incidence of breast cancer was stable in all the time intervals by hormone receptors and the highest incidence ( 21.7% ) was observed at the age group of 3039 years . since about 60% breast cancer cases are er positive and the roles of estrogen and progesterone can not be separated in breast carcinogenesis , the prognosis of patients is very important in this regard . the results showed that the highest increase in the breast cancer incidence according to the estrogen and progesterone receptors status was in the positive receptor group ; furthermore , a significant change was seen in 2003 in the breast cancer incidence with progesterone receptor positive status . the aapc for 5 recent years ( 6.9% ) and for 10 years ( 11% ) was estimated . comparison of the present results with the results of other similar studies on different groups ( age , race , etc . ) showed that from 2002 to 2003 , this rate had a decreasing trend in the united states and had increased in the city of isfahan . 's study on the trend analysis of breast cancer incidence rates by the tumor size confirmed a reduction in the cancer incidence for small tumors ( 2 cm ) . also , the study of brinton et al . showed that the highest incidence rate by tumor size ( 21.2% ) occurred in small tumors ( 2 cm ) . the study of hausauer et al . showed that in asian / pacific women , perceptible but statistically nonsignificant decreases were observed for hormone receptor - positive and small tumors only . results of this study showed that the largest increase of breast cancer incidence was found in tumor size of less than or equal to 2 cm . on average , the difference between apcs of breast cancer incidence rates in women with breast cancer with the tumor of size less than or equal to 2 cm in the last five years was faster than women with breast cancer with tumor of size the 2.15 cm and greater than 5 cm , in addition , in recent 5 years difference between apcs of breast cancer incidence rates in the women with breast cancer with tumor size 2.15 cm was more quickly than women with breast cancer with the tumor of size 5 cm . this rate obtained in the city of isfahan was similar to the results reported in other studies . the study of brinton et al . showed that the highest incidence rate by grade occurred in high - grade tumors ( 24.8 per 100,000 ) . the results of this study show increase in breast cancer incidence rates in well - differentiated and moderately differentiated tumor grades , indicating the role of exact size and differentiation of tumor cells in the diagnosis of breast cancer . the study of brinton et al . showed that the highest incidence rate by lymph node status occurred in negative lymph node ( 21.6 ) . since the probability of relapse in patients with lymph nodes is 75% more than in others , the results of this study show that the highest increase in the incidence of breast cancer by the proportion of positive lymph nodes to lymph node surgery was in less than 25% group , although this increase was not significant . the main strength of this study was that it aimed to introduce and implement an efficient and flexible statistical method called joinpoint regression that was used to determine the change points and trend pattern of the breast cancer incidence rates in different periods . in this model , in addition to assessment of the behavior of the response variable ( the breast cancer incidence rate ) in the different periods of explanatory variable ( time ) , the behavior of the response variable also in terms of the characteristics of subjects in the different periods of explanatory variable can be surveyed separately . due to lack of research analyzing the breast cancer incidence rates by some tumor characteristics ( tumor grade and proportion of positive lymph nodes to lymph node surgery ) using joinpoint regression in iran and in other countries , we could not compare the results . the main strength of this study was that it aimed to introduce and implement an efficient and flexible statistical method called joinpoint regression that was used to determine the change points and trend pattern of the breast cancer incidence rates in different periods . in this model , in addition to assessment of the behavior of the response variable ( the breast cancer incidence rate ) in the different periods of explanatory variable ( time ) , the behavior of the response variable also in terms of the characteristics of subjects in the different periods of explanatory variable can be surveyed separately . due to lack of research analyzing the breast cancer incidence rates by some tumor characteristics ( tumor grade and proportion of positive lymph nodes to lymph node surgery ) using joinpoint regression in iran and in other countries , we could not compare the results . evaluating the breast cancer incidence rates by age and tumor characteristics showed that the trend of incidence rates increased in women with less than or equal to 2 cm tumor size , well - differentiated or moderately differentiated tumor grades , and hormone receptor - positive tumors . determination of the pattern of breast cancer trend by these characteristics can help to improve the patient 's quality of life and long - term survival , prevent relapse of cancer , and in prognosis and choosing the best type of surgery and adjuvant therapy on diagnosis .	background and objectives : breast cancer is a major threat to women 's health . evaluation of the changes in trend of the incidence rate provides valuable information for the assessment and planning of development indicators of each country . the aim of the present study was to apply the joinpoint regression model for determining changes in the trend of the breast cancer incidence rate in isfahan.materials and methods : in this cross - sectional study , 3640 women with breast cancer referring to oncology and radiotherapy departments of seyed - al - shohada and milad cancer treatment centers of isfahan during 20012010 were studied and sampling was not done . joinpoint regression model was used to investigate the pattern of breast cancer incidence rate . response and independent variables were the natural logarithm of the age - standardized incidence rates and year of diagnosis of breast cancer , respectively , in which various levels of cancer tumor characteristics ( p < 0.05 ) were analyzed.results:the incidence rates increased annually in the age groups of 4044 years ( 6.2% ) , 4549 years ( 5.3% ) , and 5559 years ( 5.3% ) . the trend of incidence rates in women with tumor size 2 cm ( 18.2% ) , well ( moderately ) differentiated tumor grade [ 8% ( 10.2% ) ] , positive estrogen ( progesterone ) hormone receptor status [ 10.5% ( 6.9% ) ] , and the proportion of positive lymph node to surgery node 25% ( nonsignificant ) was upward.conclusion:the trend of incidence rates with tumor size 2 cm , well - differentiated tumor grade , moderately differentiated tumor grade , and positive estrogen and progesterone hormone receptors was upward . the pattern of breast cancer can help in cancer prevention and prognosis , and in selecting the best type of surgery .
You are an expert at summarizing long articles. Proceed to summarize the following text: approximately 1.7 billion people are overweight , and 312 million are obese [ 1 , 2 ] . in germany in 2009 , 60.1% of male and 42.9% of female population was overweight . there are currently no conservative treatments having long - term effect on weight loss and amelioration of comorbidities . a bmi 35 kg / m is associated with a 200% increase in health care costs compared to the normal weight range . an indication for bariatric surgery is a bmi 40 kg / m or a bmi 35 kg / m accompanied by obesity - associated diseases . as a result of new technologies with lower risks and better long - term results , bariatric and metabolic surgeries after the magenstrasse and mill procedure , laparoscopic sleeve gastrectomy was performed as the single - step procedure for surgically induced weight loss in 2000 . two - stage procedures are especially necessary for multi morbid patients with bmi above 50 kg / m due to the rising risks of rygbp or duodenal switch ( ds ) . considering the high mortality rate of 6% following biliopancreatic diversion ( bpd ) with ds , sg is to be preferred as a first - step operation for these patients [ 7 , 8 ] . the aim of this systematic study was to investigate nutritional deficiencies and outcomes following sleeve gastrectomy during a followup of two years in the daily routine of a maximal clinical care hospital . from september 26 , 2005 to may 28 , 2009 , 82 patients underwent sleeve gastrectomies in the department of surgery of the srh wald - klinikum gera hospital . after we ensured compliance with international and german guidelines [ 9 , 10 ] and excluded endocrine causes of obesity , the patient participated in an informational seminar and was evaluated by experienced bariatric surgeons , and sg was performed . patients were classified according to the who classifications of obesity ( 3539.9 kg / m ; 4049.9 kg / m ) with expansions to super obesity ( 5059.9 kg / m ) and super - super obesity pneumoperitoneum was established to 15 mmhg using a veress needle ( the alternative open technique ) . the first trocar for placing the camera was inserted 15 cm distal to the xiphoid process , and the abdominal cavity was reflected outwards . another trocar was placed on the epigastric angle , and the liver was retracted superiorly using a fan retractor . the dissection of the greater curve and the division of the short gastric vessels began 5 - 6 cm proximal to the pylorus and extended to the angle of his . sleeve resection of the stomach was performed using an endo gia stapler ( green ) made by covidien , germany . a bougie size 3136 fr was inserted transorally and guided along the lesser curvature toward the antrum of the stomach . the sleeve resection was continued using staple line reinforcement along the length of the bougie to the angle of his . over sewing of staple line was not performed due to the use of staple line reinforcement . at that point , the bougie was removed after the application of methylene blue to inspect for leaks along the staple line . the resected stomach was placed in a retrieval bag and removed by enlarging the trocar incision at the upper right quadrant . the fascial defect was closed , and a sterile surgical dressing was set . at the end of the surgery , the resected stomach was filled with water to determine the volume of the resection . dvt prophylaxis was performed in all patients . besides antithrombotic stockings we used low molecular weight heparin ( nmh ) at least 21 days postoperatively . only in patients with a length of stay in hospital more than 21 days prophylaxis kg nmh was given once a day and over 120 kg twice a day . in all patients a single - shot antibiosis was given using a third - generation cephalosporin . after contrast swallow patients were allowed to drink 250 cc water or tea at the first , 500 cc at the second , 1000 cc at the third postoperative day . after the fifth day we started for a week with liquids and after the second postoperative week patients could eat pulpy . all of the patients were examined throughout a 24-month follow - up period ( at 3 , 6 , 12 , 18 , and 24 months postoperatively ) . the information for this study came from patient records from the hospital and the clinical outpatient department . furthermore , short- and long - term results with regard to bmi , weight , % ewl , and important laboratory parameters ( iron , zinc , selenium , alkaline phosphatase , hemoglobin , mcv , albumin , vitamin b12 , folic acid , calcium , and parathyroid hormone levels ) were registered . furthermore , necessity of medical substitutions or second operations ( ds or rygbp ) had been evaluated . from september 26 , 2005 to may 28 , 2009 , 82 patients ( sex ratio , females : males = 48 : 34 [ 1.4 : 1 ] ) with a mean age of 43.3 years ( range , 2264 ) and a preoperative bmi of 52.5 kg / m ( range , 36.877.0 ) underwent sleeve gastrectomies . operation was performed by three different surgeons , operating as a team in all the 82 recorded operations . patient 's outcome and operation time were not affected by changing the surgeon in these teams . six patients had bmis between 35 and 39.9 kg / m , 23 had bmis between 40 and 49.9 kg / m , 35 had bmis between 50 and 59.9 kg / m , and 18 had bmis over 60 kg / m . a total of 76.5% of the male patients and 56.3% of the females had bmis more than 50 kg / m . of the 82 patients , 81 underwent primarily laparoscopic surgery . in 7.4% of these patients ( 6 of 81 ) , a conversion from laparoscopy to laparotomy was necessary . in one case , a primary laparotomy was performed because of an abdominal wall hernia , resection of an anus praeter , subtotal colectomy with an ileorectostomy and known adhesions of the small intestine . the mean duration of the op was 89.3 min , and the mean resected gastric volume was 1009.3 ml . so they were used in 85.4% of the patients ( table 2 ) . comparing leakage rate and bleeding in patients using staple line reinforcement or over sewing when staple line reinforcements were used , the mean op duration was 80.7 minutes , compared to 141.4 minutes without staple line reinforcements ( p = 0.012 ) . a laparoscopy with conversion to laparotomy was performed significantly more often for patients with bmis over 60 kg / m compared to patients with lower bmis ( p = 0.02 ) . the duration of the op averaged 75.3 minutes for patients with bmis between 35 and 39.9 kg / m , 73.7 minutes for patients with bmis between 40 and 49.9 kg / m , 95.1 minutes for patients with bmis between 50 and 59.9 kg / m , and 102.0 minutes for patients with bmis over 60 kg / m ( p < 0.001 ) . patients with bmis over 50 kg / m had significantly longer op durations compared to patients with bmis under 50 kg / m ( 97.4 versus 74.0 ; p = 0.01 ) . the resected gastric volume was significantly higher in patients with bmis over 50 kg / m compared to patients with bmis under 50 kg / m ( 1109.7 versus 808.3 ml ; p < 0.0005 ) . twenty patients ( 24.4% ) had intraoperative or / and postoperative complications ( table 3 ) . out of the 82 patients , 81 were operated laparoscopically , and in 6 cases ( 7.4% ) , a conversion to laparotomy was necessary . in 4 cases , this conversion was performed because of an insufficient laparoscopic overview with high intraabdominal pressure . in 2 cases , the conversion was because of laparoscopically uncontrollable bleeding , which was related to an insufficient abdominal overview in 1 case . this patient had a bmi of 55.5 kg / m , and on the tenth postoperative day , he complained of left upper abdominal pain . subsequently , to create an internal drainage , a gastroscopy was performed , and during this investigation , the patient aspirated . the patient 's cardiac situation worsened , an ards developed , and the patient died . acute complications have occurred significantly more frequently in patients with bmis over 60 kg / m ( p < 0.001 ) . all of these patients were clinically examined with a laboratory test 24 months after sg , so mean follow - up time is 24 months . the mean preoperative bmi of all of the patients examined was 52.5 kg / m . at the end of the followup , there was a significant reduction in bmi to 35.4 kg / m ( p < 0.0005 ) . the greatest weight loss occurred within the first 12 postoperative months ( 52.5 kg / m to 36.7 kg / m ) , and the loss gradually stabilized , with further weight loss from 36.7 kg / m to 35.4 kg / m for all of the patients examined until now . the % ewl in the bmi categories between 35 and 39.9 kg / m and 40 and 49.9 kg / m was 45.8% and 47.7% , respectively , after 3 months . the greatest % ewl in these categories was achieved after 18 ( 69.6% and 76.7% ) months . patients with bmis between 50 and 59.9 kg / m and over 60 kg / m showed continuous weight loss throughout the entire 24-month follow - up period ( figure 1 ) . table 6 shows the bmi progression for the 57 patients ( 69.5% ) who did not need a second operation for further weight loss . on average , there was a tendency toward increased weight after 18 months in these patients ( 34.0 kg / m to 35.6 kg / m ) . the most significant weight loss was achieved within the first postoperative year ( p < 0.0005 ) ( table 5 ) . regarding the percentage overweight loss , the highest % ewl of 68.4% occurred after 18 months , and after 24 months , there was a further % ewl of 62.6% . the highest % ewl of 83.3% was observed in patients with bmis between 35 and 39.9 kg / m after 18 months ( table 6 ) . one patient died during hospital stay at 73rd day postoperatively , due to sirs and ards . second patient died several months after sg due to his cardiac situation without any relation to operation . over the total observation period of 24 months , a second operation to induce weight loss was required in 30.5% ( 25 ) of the patients to develop further weight loss or amelioration on comorbidities . three patients with bmis between 50 and 59.9 kg / m underwent rygbp as a second operation . six of these patients experienced microcytic anemia following sg , which required the initiation of iron supplementation . all patients did not suffer from iron deficiency before operation and were with normal hemoglobin and iron levels preoperatively . in all patients oral supplementation a parenteral supplementation due to the fact of severe iron deficiency was not necessary in these patients . in 23 of 42 patients , iron supplementation was performed as prophylaxis after a second operation ( rygbp or ds ) , and the other 19 patients ( 23.2% ) were supplemented after sg . of these 19 patients , 16 were female , and 3 were male . to examine if iron supplementation is only necessary in fertile women , we examined especially the data of the women . ten of these 16 women recorded a reduced iron value , and the other 6 women were supplemented with a combination of folic acid and iron . the highest average value for zinc 14.80 mol / l was determined preoperatively ( reference range 1023 there were no significant differences among the average values in the follow - up period . in total , 30 patients underwent zinc supplementation , and 4 of these complained of hair loss . nineteen patients were supplemented preventively because of a second operation ( rygbp or ds ) for weight loss . the highest average value for selenium of 81.7 g / l ( reference range 50120 g after 3 months , a significant decrease of 60.87 g / l ( p < 0.0005 ) occurred . no other significant differences were observed over the course of the followup . due to selenium deficiency in laboratory eight patients after sg were treated with selenium supplementation using 100 g twice a day . among the 57 patients who did not undergo a second operation , there was a gradual increase in the concentration of selenium ( op : 81.6 g / l ; 6th month : 62.7 g / l ; 12th month : 65.2 g / l ; 18th month : 66.8 g / l ; 24th month : 69.7 g / l ) . in 46 of the 82 patients , pth levels were preoperatively determined , and 19.6% of the patients ( 9 ) had hyperparathyroidism . the average pth levels ( reference range 10.069.0 ng / l ) for patients with bmis over 60 kg / m were 81.6 ng / l preoperatively , 67.3 ng / l after 6 months and 61.9 ng / l after 18 months . thirty - one patients ( 37.8% ) were supplemented with calcium carbonate and cholecalciferol , including 15 patients supplemented after a second operation ( rygbp or ds ) . for calcium supplementation patients got four times daily 500 mg calcium with 10 g cholecalciferol . twenty - two patients ( 26.8% ) were treated with separate or additional vitamin d supplementation due to high levels of pth , including 9 patients treated preventively after a second operation for weight loss . under supplementation , after the 6 months , there were no significant differences among the pth levels ( tables 7 and 8) . vitamin d levels were not investigated routinely , due to the fact that follow - up examination in metabolic surgery is not covered by health insurance system in germany . only 3 patients demonstrated hypoalbuminemia 3 months after sg , and all 3 of these patients had experienced intra- or postoperative complications . thirty - eight patients ( 46.3% ) received vitamin b12 supplementation , including 18 patients after rygbp or ds . for vitamin b12 supplementation 1000 g the other 20 ( 24.4% ) supplemented patients were treated with supplementation within the first postoperative year ( table 9 ) . under supplementation , in addition , the other 57 patients , who did not undergo a second operation for further weight loss , demonstrated stable and not significantly different vitamin b12 concentrations ( op : 282.7 pmol / l ; 3rd month : 289.6 pmol / l ; 6th month : 265.8 pmol / l ; 12th month : 260.0 pmol / l ; 18th month : 256.1 pmol / l ; 24th month : 277.5 pmol / l ) . regarding folic acid ( reference range 10.4042.40 nmol / l ) , there was a significant decrease 3 months after the operation from 19.82 nmol / 13 patients were supplemented following sg due to folic acid and/or iron deficiency with a combination of folic acid and iron . after the third month following the operation , an increasing concentration of folic acid was observed as a result of supplementation , with a maximum average level of 20.96 nmol / l occurring after 24 months . supplementation was performed with a combination of folic acid 0.5 mg and iron 40 mg daily . sg may be used as a single operation , or in the case of insufficient weight loss , it can be suggested as a second operation , such as rygbp or ds . additionally , sg can be performed as the first step of a two - stage procedure for high - risk patients to reduce the perioperative risks of ds or rygbp . an analysis of the literature shows the benefits of lsg compared to laparoscopic gastric banding ( lagb ) and laparoscopic rygbp . there are several technical advantages of sg : nonresection of the pylorus , which prevents dumping syndrome ; no intestinal anastomoses and , consequently , no insufficiencies of anastomoses ; nearly regular intestinal absorption and a lower risk of developing an internal hernia . particulary short - term complications as leakage and staple line insufficiency influence the complication rate . in the literature an increasing long - term complication rate is reported to be due to stenosis , gastroesophageal reflux , and reoperation rate due to insufficient weight loss , regain of weight or insufficient amelioration of comorbidities . evidence - based data on nutrient deficiencies , especially vitamin b12 and iron , after sg is not available . rygbp and bpd are the most effective , but also the riskiest , bariatric methods . both procedures tend to increase the risk of perioperative complications based on the difficult technical circumstances surrounding the patients ' weight and the associated comorbidities , such as hypertension , diabetes , and sleep apnea . the complication rates for super - super obese patients are 23% for rygbp and 38% for ds . sg , however , reduces perioperative risks of morbidly obese patients with bmi above 60 as a first step procedure . the reported initial weight loss after sg spans a wide range , between 33 and 83% [ 14 , 15 ] . in a prospective study of 100 patients , johnston et al . presented a % ewl of 60% after 5 years . that study group achieved a % ewl of 59.1% after 12 months and 63.8% after 24 months . over a 24-month period , the entire patient population experienced continuous weight loss up to the 18th month . after 24 months a weight loss to a bmi of 35.4 kg / m was achieved . sg as a single operation is suitable for patients with bmis < 50 kg / m . only 10.3% of these patients ( 3/29 ) required a second intervention to induce further weight loss within the follow - up period ( versus 41.5% with bmis 50 kg / m ) . after 24 months , patients who only underwent sg with bmis between 35 and 39.9 kg / m achieved the highest % ewl . therefore , there was no correlation between the resected volume of the stomach and the % ewl . only one patient ( 16.7% ) needed to undergo a second operation for further weight loss . after 18 months , patients who only underwent sg demonstrated increased mean weights , which may have been due to sleeve dilatation . this possibility was considered by gluck et al . , who presented % ewls of 67.9% after 1 year , 62.4% after 2 years , and 62.2% after 3 years for patients after sg with preoperative bmis between 35 and 43 there is not always sufficient weight loss after sg ; insufficient changes in food patterns or potential recidivism to old food patterns may cause a sleeve dilatation . there are inadequate data to properly appraise this option , and further studies must clarify the utility of this procedure in comparison to rygbp or ds as a second operation . in addition because of the moderate rate of major complications of 9.8% ( 8/82 ) , sg can be recommended as a first - step operation before malabsorptive interventions . however , patients with bmis 60 kg / m required a change to laparotomy significantly more often because of an insufficient intraabdominal view . preoperative implantation of a gastric balloon to reduce morbidity for patients with bmis over 60 kg / m still needs to be addressed . in this study , there was a 30-day mortality of 0.0% , a hospitalization mortality of 1.2% , and a one - year mortality of 2.4% . one patient with a preoperative bmi of 50.5 kg / m first lost weight after sg , but his weight eventually increased to a higher level than before sg ( 59.7 kg / m by the end of the followup ) . an insufficient change in food patterns and intake of high - calorie foods appeared to be the cause . the other patient , with a preoperative bmi of 55.5 kg / m , died after a prolonged course with various complications on day 73 after sg . one other severe obese patient with a preoperative bmi of 68.0 kg / m died 10 months postoperatively . a causal relationship with sg the definitive success rate for sg in this study was 97.6% , with a mortality of 1.2% and a nonresponder rate of 1.2% . twenty - five patients ( 30.5% ) in this study required a second operation via a two - stage procedure for further weight loss . evidence - based data on necessity of supplementation after sg does not exist in the literature . after evaluating nutritional deficiencies , there is no need for supplementation after sg , although preoperative existing deficits should be supplemented . laboratory parameters should be monitored regularly to detect early nutritional deficiencies and to initiate appropriate therapies . therefore , it is likely that , without supplementation , vitamin b12 deficiencies can occur , especially more than two years after operation due to empting of vitamin b12 storage . therefore , a general vitamin b12 supplementation is advisable to avoid pernicious anemia and to prevent neuropathic pain . patients with deficiencies in albumin , vitamin d , or calcium have a higher risk of developing osteoporosis ; therefore , it is recommended that appropriate supplementations be initiated , even if the concentrations of these parameters are only slightly decreased . moreover , supplementation of zinc should be based on symptoms ( hair loss , immune deficiency , dry skin ) . medication of zinc and calcium should be suggested to intake at different times , because zinc reduces calcium absorption . supplementation of selenium is not generally necessary because postoperative deficiencies normalize on their own without supplementation , and an adequate , varied food intake seems to be sufficient . regular determination of laboratory parameters should be performed 3 and 6 months after the operation and semiannually thereafter ; if the patient 's weight stabilizes , laboratory parameters should be determined once a year . our results following sg and those reported in the literature are promising . nevertheless , adequate long - term results are still unavailable because long - term studies ( > 6 years ) are rarely performed . also , the 3rd icssg could not recommend which part of the antrum should be left and to what degree the antrum should be minimized to achieve a long - term volume reduction in the sleeve . additionally , evidence - based data are unavailable concerning the size of the bougie or whether the use of staple line reinforcement could reduce the rates of leakage . good results are not only based on the operation being performed in a center for bariatric surgery ; the patients ' instructions from dietitians are at least as important . the conditions for excellent results are patient compliance , an adequate change in lifestyle and food patterns , and regular aftercare in obesity consultation to optimize results , and detect nutritional deficiencies promptly . sg represents a good possibility as a single - step operation for surgically induced weight loss with a high patient acceptance rate . a second step for further weight loss can follow . sg is an effective intervention for weight loss . for patients with bmis of 3549.9 kg / m , a single - step procedure is suitable . for patients with bmis 50 kg / m , sg is suitable as a first - step procedure for reducing perioperative risks for ds . there is still no consensus on the use of staple line reinforcements or the size of the calibration tubes . for patients with bmi above 60 n. pech , f. meyer , h. lippert , t. manger , and c. stroh attest that they have no commercial associations ( e.g. , equity ownership or interest , consultancy , patent and licensing agreements , or institutional and corporate associations ) that might present a conflict of interests in relation to the submitted paper .	background . the aim of this study was to investigate patient outcomes and nutritional deficiencies following sleeve gastrectomy ( sg ) during a follow - up of two years . methods . over a period of 56 months , all consecutive patients who underwent sg were documented in this prospective , single - center , observational study . the study endpoints included operative time , complication rates , nutritional deficiencies and percentage of excess weight loss ( % ewl ) . results . from september 26 , 2005 to may 28 , 2009 , 82 patients ( female : male = 48 : 34 ) with a mean age of 43.3 years ( range : 2264 ) and a preoperative bmi of 52.5 kg / m ( range : 36.877.0 ) underwent sg . major complications were observed in 9.8% of the patients , with 1 death . during follow up 51.2% of patients were supplemented with iron , 36.6% with zinc , 37.8% with calcium , 26.8% with vitamin d , 46.3% with vitamin b12 and 41.5% with folic acid . % ewl was 54.3 , 65.3 and 62.6% after 6 , 12 and 24 months . conclusion . sg as a single step procedure is an effective bariatric intervention . nutritional deficiencies after sg can be detected by routine nutritional screening . our results show that vitamin b12 supplementation should suggest routinely after sg .
You are an expert at summarizing long articles. Proceed to summarize the following text: unicystic ameloblastoma ( ua ) was first described by robinson and martinez in 1977 , later described by gardner in 1983 . they have the same origin as ameloblastomas and are a less encountered variant , with no sexual or racial predilection , appearing during 2 or 3 decade of life , encountered asymptomatically in the posterior region of the mandible . reduced enamel epithelium , associated with developing tooth , undergoes ameloblastic transformation with subsequent cystic developmentameloblastomas arise in dentigerous or other types of odontogenic cysts in which neoplastic ameloblastoma epithelium is preceded temporarily by nonneoplastic stratified squamous epithelial lining.a solid ameloblastoma undergoes cystic degeneration of ameloblastic islands with subsequent fusion of multiple microcysts and develops into a unicystic lesion . reduced enamel epithelium , associated with developing tooth , undergoes ameloblastic transformation with subsequent cystic development ameloblastomas arise in dentigerous or other types of odontogenic cysts in which neoplastic ameloblastoma epithelium is preceded temporarily by nonneoplastic stratified squamous epithelial lining . a solid ameloblastoma undergoes cystic degeneration of ameloblastic islands with subsequent fusion of multiple microcysts and develops into a unicystic lesion later , in 1992 world health organization ( who ) added classification and subtypes of ua . luminal ualuminal and intraluminal ualuminal intraluminal and intramural ualuminal and intramural ua luminal and intraluminal ua luminal intraluminal and intramural ua luminal and intramural ua in recent literature , molecular alterations indicating the origin of pathogenesis were also observed in ameloblastomas , such as monoclonal neoplasia , overall low cellular proliferation index , association of higher mib-1 labeling index and microsatellite alterations , telomerase activity associated with p16 loss , and dysregulation of sonic hedgehog / patched ( shh / ptch ) pathway but their significance is still not clear . in our cases , the lesions were located in the upper posterior maxillary periradicular region . further , the lesion was not associated with any unerupted tooth ; but was located around carious or grossly decayed tooth with only root stumps . the occurrence of noninflammatory pathosis in the periradicular area was not considered as differential diagnosis initially in these cases . most studies on periradicular lesions focus on radicular cysts and granulomas , as these lesions are highly prevalent and associated with pulpal necrosis and infection . when we searched for reports of lesions which initially presented as periapical pathology and later were confirmed to be of noninflammatory origin , especially ameloblastoma , we did come across a few as described in table 1 . a 50-year - old female patient presented with a swelling in the upper left cheek region . on extraoral examination , we observed a single extraoral nontender swelling about 5 5 cm in size [ figure 1 ] . intraoral swelling was approximately 5 6 cm , soft in consistency , and fluctuant in nature extending up to the midline of the palate medially and anteriorly up to tooth 23 , posteriorly up to tooth 27 , and involved the maxillary sinus . orthopantomograph ( opg ) showed radiolucency of 5 5 cm size in relation to tooth 23 extending till tooth 27 in the periapex with thin radiolucent line [ figure 2a ] . 50-year - old female with a huge swelling in the left cheek diagnosed with unicystic ameloblastoma . the extra - oral photograph shows swelling ( white arrow ) about 5 5 cm in size in the upper cheek . 50-year - old female with a huge swelling in the left cheek diagnosed with unicystic ameloblastoma . a ) panoramic radiograph shows well - defined periradicular radiolucency ( dashed arrow ) in the left maxillary region in relation to carious tooth ( root stump ) 27 ( white arrow ) . c ) photograph shows the excised tissues . in a second case , a 34-year - old female patient presented to the outpatient department with complaints of pain and swelling in the back upper right tooth . the pain had increased gradually over 2 months . on clinical examination , we observed single extra - oral swelling about 5 5 cm in size , a hard and non - tender mass extending from lateral canthus of the eye to 3 cm away from tragus of ear anteroposteriorly , superiorly up to infraorbital margin , and inferiorly upto angle of mouth . intra - orally the swelling was of approximately 7 7 cm in size , soft in consistency , and fluctuant in nature extending up to midline of the palate medially , anteriorly up to tooth 11 , and posteriorly up to tooth 17 region . buccally , it extended into vestibule in the tooth 14 to tooth 17 region resulting in obliteration . on hard tissue examination , there was a carious tooth in relation to tooth 17 . orthopantomograph ( opg ) showed radiolucency of size 5 5 cm extending from tooth 11 to tooth 17 and to the periapical region giving a cystic appearance [ figure 3a ] . case 2 . 34-year - old female patient with complaints of pain and swelling in the back upper right tooth diagnosed with unicystic ameloblastoma . a ) panoramic radiograph shows well - defined periradicular radiolucency ( white arrow ) in the right maxillary region in relation to carious ( root stump ) 17 ( dashed arrow ) . in both the cases our focus was on radicular cysts and granulomas , which are highly prevalent periapical lesions associated with carious tooth , pulpal necrosis , and infection . other noninflammatory periapical lesions such as central giant cell granuloma , aneurysmal bone cyst , odontogenic keratocyst , and ameloblastoma were also considered in the differential diagnosis at a later stage . the patients were referred to the department of oral and maxillofacial surgery and surgical enucleation of the lesion under local anesthesia with adrenaline was performed . a full thickness flap was raised , and an encapsulated lesion was located between the enlarged buccal plates . after enlarging the bony access , the entire cyst was enucleated by performing curettage of the lesion in both the cases [ figure 2b ] . the excised specimens were then submitted for histopathological examination [ figures 2c and 3b ] . histologically , in both the cases the cyst lining showed ameloblastic epithelium with tall columnar basal layer , subnuclear vacuoles , reverse nuclear polarity and thin layer of edematous , degenerate - appearing stellate cells [ figure 4 ] . in case 2 , the cystic lining epithelium also demonstrated rete ridges in some areas with proliferation and archading epithelium mimicking a radicular cyst [ figure 5 ] . both patients had an uneventful postoperative recovery with no signs of recurrence during the 1-year follow - up examinations . hematoxylin and eosin stained section shows degenerating stellate cells ( white arrow ) along with ameloblastic epithelium ( dashed arrow ) ( 40 ) . hematoxylin and eosin stained section shows cystic lining epithelium with proliferation and archading epithelium ( black arrow ) ( 40 ) . ua , a variant of ameloblastoma , refers to those cystic lesions that show clinical and radiologic characteristics of an odontogenic cyst like dentigerous , radicular , glandular odontogenic cyst , but in histologic examination show a typical ameloblastomatous epithelium lining part of the cyst cavity , with or without luminal and/or mural tumor proliferation . this variant is believed to be less aggressive , tends to affect patients at a younger age and its response to enucleation or curettage is more favorable than the classic solid or multicystic ameloblastomas . enucleation is the standard treatment protocol when the ameloblastic elements are confined to the lumen of the cyst , with or without intraluminal tumor extension . local resection of area is indicated as a prophylactic measure if specimens show extension of tumor into fibrous cyst wall for any appreciable distance under radiographic observation . the age of the patient is another influencing factor related to the choice of treatment . as ua tends to affect young adolescent patients , the concern to minimize surgical trauma and permit jaw function and tooth development to proceed reasonably unimpaired should be one of the important aspects in tumor management . to obviate the problem of deformity , a simple enucleation was performed to remove the whole lesion after the completion of the tooth eruption in this region . while conservative surgery seems to have been justified in preference to mutilating radical surgery for these young patients , choice of treatment has to be considered in conjunction with other clinical and pathologic factors such as the size , location , and growth pattern of the tumor . whatever surgical approach the surgeon decides to take , long - term follow - up is mandatory , to check for recurrence of ua . a combination of radiological and histopathological examination is needed to provide definitive diagnosis of certain periapical lesions and is a must for diagnosis of ameloblastoma . ameloblastoma is a benign epithelial neoplasm of odontogenic origin , and depending on the stage of development , it can mimic a periapical lesion and therefore should be considered during differential diagnosis .	unicystic ameloblastoma ( ua ) is one of the variants of ameloblastoma . it manifests as unilocular radiolucency in the mandible or maxilla on x - ray scans . in very rare cases , it can appear as a localized periradicular radiolucent area , imitating a periapical lesion . in this article , we present two cases of ua that were initially misdiagnosed as periapical lesions . subsequently , surgical enucleation was performed and the diagnosis of ua was confirmed histopathologically .
You are an expert at summarizing long articles. Proceed to summarize the following text: it is a major health problem in india and endemic along the sea costs and river banks . clinical manifestations of filariasis range from asymptomatic microfilariasis to acute manifestations such as fever , epididymo - orchitis , lymphangitis , lymphadenitis , or chronic symptoms such as hydrocele , lymphedema , elephantiasis , and topical pulmonary eosinophilia . microfilaria in peripheral blood examination is frequent in filarial - endemic regions both in symptomatic or asymptomatic cases . however , the presence of microfilaria in pleural fluid cytology is very rare finding even in endemic areas . few cases have been reported in association with malignant pleural effusion . however , pleural effusion of filarial origin is extremely rare manifestation . in the present case a 38-year - old male patient attended pulmonology clinic of our institution with a history of cough , right - sided chest heaviness , and breathlessness for 3 weeks . on examination , on chest percussion , there was dullness at lower zone of the right lung and diminished breath sound was noted on auscultation . he had no past history of tuberculosis and no history of hemoptysis . on chest x - ray , he had right - sided pleural effusion . sputum examination was negative for acid - fast bacilli and mantoux test was also negative . biochemical tests of pleural fluid revealed sugar level 72 mg / dl , protein - 3.1 g / dl , lactate dehydrogenase level 248 iu / l , and adenosine deaminase level 14 iu / l . total cell count of pleural fluid was 240/cmm and differential cell count showed lymphocyte 84% , eosinophil 12% , and neutrophil 4% . on cytological examination of centrifuged deposit of pleural fluid revealed lymphocytes , eosinophils , few reactive mesothelial cells and microfilaria of wuchereria bancrofti [ figures 1 and 2 ] . repeat chest x - ray after 3 weeks revealed reduced effusion and complete resolution at 5 week . smear shows three microfilariae in the background of thick proteinaceous material and chronic inflammatory cells ( leishman and giemsa stain , low power view ) smear shows microfilaria of wuchereria bancrofti in pleural fluid cytology smear ( leishman and giemsa stain , high power view ) aspirates from lymph nodes , subcutaneous nodules , breast , and hydrocele fluid containing microfilaria are infrequently reported from the endemic region . the presence of microfilaria in association with malignant lesions also documented in cytological evaluation . however , pleural effusion as sole manifestations of filariasis is very rare . in india , exudative pleural effusion with lymphocyte predominance is supposed to be a case of tuberculous in origin . cytological evaluation of pleural fluid is done for evaluation of differential cell count , evaluation of malignant cells , and ziehl neelsen stain for acid - fast bacilli . topical pulmonary eosinophilia is an occult form of lymphatic filariasis with pulmonary manifestation presents with paroxysmal cough , wheezing , shortness of breath , malaise , anorexia , and weight loss . in the present case pathophysiology of topical pulmonary eosinophilia is immunological hypersensitivity to indwelling microfilarial antigen in pulmonary lymphatics . whereas filarial pleural effusion occurs due to immunological reaction against filarial antigen , lymphangitis , and incomplete lymphatic obstruction . nonchylous effusion is supposed to be coincidental finding in the presence of microfilaria in pleural effusion . most of the previously reported cases in literatures have shown presences of w. bancrofti species . similarly , in our case also pleural effusion was nonchylous exudative type and microfilariae of w. bancrofti were isolated . exudative pleural effusion in such case can be explained by lymphangitis due to incomplete obstruction of pulmonary lymphatics . resolution of effusion after diethylcarbamazine therapy provides strong evidence of causation of pleural effusion primarily of filarial origin . the present case report suggests a careful microscopical examination of pleural fluid before administration of specific treatment .	lymphatic filariasis is endemic in india and southeast asia . detection of microfilaria is infrequently reported during cytological evaluation of various lesions or body cavity fluids . presence of microfilaria in pleural fluid cytology is very rare finding even in endemic areas . few cases of accidental finding of microfilaria have been reported in association with malignant pleural effusion . but pleural effusion of filarial origin is extremely rare manifestation . here we report a classical case of microfilaria in pleural fluid cytology .
You are an expert at summarizing long articles. Proceed to summarize the following text: poor endothelial function ( ef ) predicts future cardiovascular events and is thought to be influenced by several behavioural risk factors for cardiovascular disease ( cvd ) including smoking , physical activity , obesity , and alcohol consumption . thus , poor ef may mediate some of the risks for cvd created by these behaviours . for example , current smokers have been found to have lower ef than those who have never smoked [ 26 ] . furthermore , smoking has been shown to induce an acute decrease in ef [ 4 , 7 ] . to our knowledge , however , there has only been one study that has examined the relationship between lifetime smoking and ef . while this study found that pack / years were inversely related to ef , the generalizability of these results may be limited given the narrow age range of its participants ( 2028 years ) . cross - sectional studies have found that sedentary participants display reduced ef compared with athletes [ 911 ] , though inconsistencies have been noted [ 12 , 13 ] . while some interventions to increase physical activity have been found to have a positive impact on ef [ 12 , 1424 ] , others have failed to do so [ 2528 ] . to our knowledge , only two studies have examined the relationship between ef and physical activity in moderately active participants ; one study found a significant effect of physical activity on ef in children , while the other did not find a relationship in adults . while obesity is influenced by several factors , including physical activity , caloric consumption has been found to be the most important predictor of weight loss or gain and caloric restriction to be the most effective means of inducing weight loss [ 3133 ] . as such , although obesity is not a behaviour per say , here it will be considered a proxy of long - term excess caloric consumption . cross - sectional studies have observed obese and overweight participants , classified according to bmi , have worse ef compared to normal weight controls [ 3437 ] . intervention studies using either gastric bypass surgery or a low - calorie diet [ 39 , 40 ] have also reported weight loss to result in improvements in ef . however , only one study to date has examined the relationship between obesity and ef in participants with a wide range of bmis , finding that both overweight and obese individuals have worse ef than normal weight controls . the effect of alcohol consumption on ef is equivocal . while studies comparing alcoholics to nonalcoholic controls have reported alcoholics to have significantly lower ef [ 4244 ] , the impact of moderate amounts of alcohol on ef is uncertain . acute wine consumption has generally been observed to have a positive impact on ef [ 4547 ] though one study found no difference in ef when pairing a glass of red wine versus a control beverage with a high - fat meal . furthermore , the equivalent of one drink 's worth of ethanol has resulted in no acute change in ef , while four drinks ' worth of ethanol resulted in a significant acute decrease in ef . there has been only one published report on the relationship between moderate alcohol consumption and ef . in this study of 108 men with coronary artery disease , those who drank 13 drinks / day had significantly better ef than abstainers , suggesting an inverted j - shaped relationship between alcohol consumption and ef . while the effects of smoking , physical activity , obesity , and alcohol consumption on ef have been examined , some important gaps in knowledge remain . first , there is a lack of research examining the relationship between lifetime smoking and ef . second , further research is needed to clarify the nature of the relationship between moderate levels of physical activity and ef . third , studies are needed to clarify the relationship between regular moderate alcohol consumption and ef . fourth , since most studies on health behaviours and ef have been conducted in generally healthy noncardiac samples , this relationship should be explored in samples that have or are at risk for cardiovascular disease . finally , since these variables often cooccur , research is needed to determine their independent effects . the primary goal of the current study was to examine the relationship between all four health behaviours and brachial artery reactivity , used as a proxy of ef , in a single sample . this allowed determination of whether each health behaviour had an impact on ef independent of the others and allowed evaluation of their relative impact on ef ( table 1 ) . the study was a substudy of the mechanisms and outcomes of silent myocardial ischemia ( mosmi ) study , a longitudinal study of risk factors for silent ischemia and the impact of silent ischemia on cardiovascular outcome . a total of 904 consecutive patients referred for single - photon emission computed tomography ( spect ) exercise stress tests between july 2005 and december 2006 in the nuclear medicine service of the montreal heart institute were recruited . to be eligible for the mosmi study , patients had to be undergoing spect exercise stress testing , be over 18 years old , and speak either english or french . patients were excluded if they had experienced a cardiac event ( e.g. , myocardial infarction ) in the last 4 weeks , if they had a more prominent medical condition than cvd ( e.g. , cancer , chronic obstructive pulmonary disease ) , or were pregnant or nursing . the selection of this group from the main cohort was done based on the random allocation to available testing time slots . there were no differences in age , sex , or cvd status between this subsample and those patients recruited for the mosmi study but who were not included in final analysis . the mosmi study was approved by the human ethics committee of the montreal heart institute and written informed consent was obtained from all participants . patients presenting to the nuclear medicine service of the montreal heart institute on the day of their exercise stress test were approached to participate in the mosmi study . once consent was obtained , demographic and medical information , including health behaviours , was collected using a self - report questionnaire and waist circumference was measured . patients then underwent standard treadmill exercise stress testing ( bruce protocol ) followed by spect imaging . as per the spect protocol , all patients returned the following day to complete their rest scan . prior to the rest scan patients underwent the forearm hyperaemic reactivity ( fhr ) test to measure brachial artery reactivity in response to hyperaemic challenge . all spect imaging was conducted according to standard procedure [ 5254 ] . in general , patients were maintained on their usual medication , the only exception being that people were asked to withhold taking beta - blockers on the day of the exercise and rest spect studies . the fhr technique , implemented by a trained nuclear medicine technician , was used to assess brachial artery activity . fhr measures alterations in the brachial artery endothelium following a hyperaemic challenge [ 57 , 58 ] . the patient is seated with both arms extended over the top of a standard large field - of - view gamma camera with a low negative high resolution collimater ( scintronix , london , uk ) facing upward , hands prone . to create the hyperaemic challenge , a blood pressure cuff ( adult first responders , b&a instruments , new york , new york ) was placed on the right arm and inflated at 50 mmhg above systolic blood pressure for 5 minutes , after which it was released . forty - five seconds after the cuff was deflated , 0.42 mci / kg of the radioactive tracer tc-99m - tetrofosmin ( myoview , amersham health , princeton , nj ) was injected into the patient 's arm via a small catheter positioned in the bend of the left arm . for the next 10 minutes , dynamic image acquisitions were realized using 128 128 matrices at a sampling rate one frame per second . from this , the ratio between the rate of blood flow into the right ( the hyperaemic arm ) and left ( the control arm ) arms , the relative uptake ratio ( rur ) , was calculated using custom - made software ( sygesa , montreal , canada ) . the higher one 's rur , the better the endothelial tissue is at responding to the hyperaemia , via the promotion of vasodilation . thus , a higher rur indicates better ef and a lower rur indicates worse ef . more specifically , an rur under 3.55 is considered to be indicative of endothelial dysfunction . leisure time physical activity was derived from a slightly adapted 12-month version of the physical activity recall interview . specifically , given the nature of activity patterns in montreal , separate details were collected for winter - like and summer - like activities and then combined . lifetime cigarette consumption was assessed using the standard calculation of pack / years ( average number of packs smoked / day number of years having smoked ) . as centrally distributed fat seems to be more significant in the aetiology of cvd , waist circumference was used as our measure of central adiposity . prior to the ef test , the attending technician measured the participants ' waist circumference at the mid - point between the super - illiac crest and the lower thoracic cavity . participants were asked to report their usual daily or weekly consumption of alcoholic beverages . using this data , weekly units of alcohol consumed were estimated . our missing data analysis procedures used missing at random ( mar ) assumptions , as per rubin 's rules . we independently analyzed 5 copies of the data , each with missing values imputed , and then used proc mianalyze to average estimates of the variables to give a single mean estimate and adjusted standard errors according to harrell 's guidelines . details of the amount of missing data per variable are included in table 2 . to examine the contributions of physical activity , smoking , obesity , and alcohol consumption to ef , a series of glms on the individual variables was also conducted , first for the individual health behaviours alone , second with the individual health behaviours and covariates , and third for all four behaviours together and the covariates . since a nonlinear relationship was expected to exist between alcohol consumption and ef , participants were split into one of three groups in terms of their alcohol consumption . group 1 consisted of heavy drinkers ( defined as 22 or more drinks per week ) , group 2 consisted of abstainers , and group 3 consisted of moderate drinkers ( 121 drinks per week ) . the groups were defined as such since consuming 13 drinks per day has been associated with better ef than abstinence , while 4 or more drinks have been found to negatively impact ef acutely . it was therefore expected that heavy drinkers would have the worst ef and moderate drinkers would have the best ef , creating a linear relationship between group number and ef . age , sex , cvd status ( cvd was defined as having a previous myocardial infarction , stroke , angioplasty , or coronary artery bypass graft ) , ace inhibitor use , statin use , hypertension , diabetes , and hypercholesterolemia were chosen as covariates a priori , as all have been shown to have strong independent effects on ef [ 7 , 6571 ] . to examine potential interactions between the health behaviours an interaction term for each pair of continuous health behaviours was included one at a time in a glm including the above - mentioned covariates . to examine possible associations between the health behaviours and risk of having endothelial dysfunction , defined as an rur under 3.55 , two logistic regression analyses were conducted predicting endothelial dysfunction from all four health behaviours and the covariates together . for these analyses , waist circumference was split into tertiles : < 92 cm , 92108 cm , and > 108 cm . finally , physical activity was split into tertiles : 0 , 09.7 and > 9.7 met - hrs / week . the glm analyses for individual health behaviours revealed that waist circumference ( ( sem ) = .03 ( .01 ) , p < .0001 ) contributed significantly to ef . a trend for an effect of smoking on ef measured using pack - years ( f = 1.78 , p = .075 ) however , physical activity ( ( sem ) = .01 ( .01 ) , p = .528 ) , smoking status ( ( sem ) = .22 ( .15 ) , p = .131 ) , and alcohol consumption ( ( sem ) = .19 ( .12 ) , p = .136 ) were not associated with ef as a continuous variable . glms for the individual health behaviours with age , sex , cvd status , ace inhibitor use , statin use , hypertension , diabetes , and hypercholesterolemia as covariates were then conducted . these analyses revealed that waist circumference ( ( sem ) = .04 ( .01 ) , p < .0001 ) contributed significantly to the variability in ef , while physical activity ( ( sem ) = .01 ( .01 ) , p = .398 ) , alcohol consumption ( ( sem ) = .17 ( .13 ) , p = .167 ) , and smoking measured according to pack - years ( ( sem ) = .01 ( .01 ) , p = .203 ) or smoking status ( ( sem ) = .21 ( .15 ) , p = .153 ) did not . results of a glm with all covariates and health behaviours included revealed that waist circumference was a significant independent predictor of ef considered as a continuous variable ( table 3 and figure 1 ) . neither alcohol consumption , physical activity , nor smoking , measured according to pack years were significantly related to ef ( table 3 ) . the results of the glms separately examining the interaction between each pair of health behaviours revealed no significant interaction effects . a logistic regression analysis , including all covariates and health behaviours in the model revealed that in comparison to the lowest tertile of waist circumference ( < 92 cm ) , being in the second tertile ( 92108 cm ) was associated with a 90% increased risk of endothelial dysfunction ( or = 1.90 , 95% ci = 1.013.59 ) . being in the third tertile for waist circumference ( > 108 cm ) , on the other hand , was associated with more than double the risk of endothelial dysfunction ( or = 2.39 , 95% ci = 1.154.98 ) . alcohol consumption group was also a significant predictor of endothelial dysfunction such that being a nondrinker versus a moderate drinker was associated with nearly double the risk of endothelial dysfunction ( or = 1.99 , 95% ci = 1.083.70 ) , while the risk associated with being a heavy drinker did not differ from being a moderate drinker ( or = 1.57 , 95% ci = 0.822.86 ) . being a past smoker versus a never smoker was associated with double the risk of endothelial dysfunction ( or = 2.00 , 95% ci = 1.263.75 ) , while the risk associated with being a current smoker did not reach significance ( or = 2.17 , 95% ci = 0.884.84 ) . finally , the odds ratios for being in the first ( or = 0.82 , 95% ci = 0.441.53 ) or second tertile ( or = 1.29 , 95% ci = 0.702.35 ) in comparison with the third tertile for physical activity were not significant ( figure 2 ) . this study is the first attempt to assess the effects of waist circumference , physical activity , alcohol consumption , and smoking on ef in a single sample of cardiac patients . the glm analyses revealed that waist circumference was negatively associated with continuous variations in ef and that there was a trend for a significant negative association between lifetime smoking and ef when they were each included in the model alone . however , when covariates were added to the model , this trend disappeared but the significant effect of waist circumference on ef remained . when all four health behaviours were included in the same model with the covariates , additional logistic regression analyses , including all four health behaviours and covariates together , revealed that increased waist circumference also increased risk for clinical endothelial dysfunction . surprisingly , abstinence from alcohol and past smoking predicted endothelial dysfunction , while heavy alcohol consumption and current smoking did not . consistent with the current findings , several studies have found measures of central adiposity such as waist circumference and waist - hip ratio , to be predictors of cardiovascular outcomes in patients both with and without [ 7377 ] known cvd . although the exact mechanism behind this obesity - induced increase in endothelial dysfunction is unclear , two candidate processes have been proposed : ( 1 ) via alternations in adipokine levels ; and ( 2 ) via increases in free fatty acid levels . in brief , it would appear that increasing levels of obesity are associated with increases in adipokines that negatively influence the endothelium , and decreases in adipokines that exert positive effects on the endothelium . for example , leptin , which is increased in obese patients , has been shown to increase the release of reactive oxygen species in human endothelial cells , thus diminishing the bioavailability of nitric oxide ( no ) , an important vasodilator and inhibitor of inflammation and platelet aggregation . alternatively , adiponectin , which is downregulated in obese individuals , stimulates nitric oxide production , and promotes vasodilation . recent studies have also found increased levels of endothelial dysfunction when free fatty acids , which are abundant in patients with abdominal obesity , were administered exogenously [ 82 , 83 ] . this alteration is thought to occur by free fatty acids decreasing endothelial nitric oxide synthase ( enos ) activity . that is , glm analyses indicate that these variables were not associated with continuous fluctuations of ef . however , the logistic regression analyses reveal that past ( but not current ) smoking and abstinence from alcohol ( but not heavy consumption ) both increased the risk of endothelial dysfunction . the fact that the odds ratios for current smoking did not reach significance may be partially due to small sample sizes since relatively few participants were current smokers . the finding that past smoking was associated with an increased risk of endothelial dysfunction suggests that smoking - induced endothelial damage is long lasting . this is consistent with previous research finding that the somewhat improved flow - mediated dilation of former smokers was not statistically greater than current smokers . smoking is thought to damage endothelial cells directly and to increase oxidative stress , thereby decreasing nitric oxide availability . smoking also appears to reduce the immune system 's ability to repair this endothelial damage by decreasing the number of circulating endothelial progenitor cells , which are mobilised in response to vascular injury . following smoking cessation , the number of circulating endothelial progenitor cells has been found to increase rapidly , suggesting that the ef of ex - smokers should begin improving soon after quitting . however , it is unknown to what extent the length of time of smoking or the length of time since quitting impacts current ef . it may therefore be the case that the ex - smokers in the current study had either smoked too long or had not been smoke - free long enough to exhibit fully recovered ef . our finding that heavy alcohol consumption is not associated with greater risk of endothelial dysfunction is inconsistent with previous research finding that heavy consumption has been found to induce endothelial cell apoptosis by increasing oxidative stress and impairing nitric oxide production . this finding may therefore be related to sample size , considering the relatively small number of heavy drinkers in the current study . however , that moderate alcohol consumption is associated with better ef than abstinence is consistent with previous findings . it is believed that moderate alcohol consumption may improve ef by increasing no levels and decreasing homocysteine levels , which is an amino acid causing oxidative stress . that physical activity was not found to be associated with ef is inconsistent with studies comparing sedentary individuals with athletes [ 911 ] but is consistent with the one study that has examined the relationship between moderate physical activity and ef in adults . this finding suggests that physical activity may contribute little to ef among moderately active individuals at high risk for cardiovascular disease who likely engage in several poor health behaviours at once . considering the average participant in this study does not meet the minimum requirements for physical activity set by the american college of sports medicine and the american heart association , which is between 7.5 and 12.5 met - hrs / week , greater levels of physical activity may be needed to see its effect on ef . of course , the results of the current study must be considered in light of some limitations . as with all cross - sectional studies , it is impossible to draw conclusions about the cause and effect relationship between the health behaviours assessed and ef . the current study also used retrospective self - report measures for physical activity , alcohol consumption , and smoking , which may be susceptible to recall bias . drink type was also not taken into account for alcohol consumption , which is problematic given that wine has been found to have a unique beneficial effect on ef [ 47 , 93 ] . our failure to record patients ' use of nicotine replacement therapy , known to affect ef , is also a limitation . while the current study has its limitations , the fact that it examined the relationship between ef and smoking , obesity , physical activity , and alcohol consumption in the same statistical model is an important and unique strength . while other studies that have examined the effect of only one health behaviour on ef risk overestimating the portion of variance in ef explained by the behaviour , the present study should more accurately estimate the independent effect of each health behaviour on ef it is also a strength that this study examined the effect of health behaviours on ef in a sample of patients at risk for cardiovascular disease since poor health behaviours would be expected to have the most important and imminent impact in this population . other strengths of this study include its large sample size , the inclusion of several important covariates , and the quality of the health behaviour measures used . finally , despite the relative novelty of the fhr technique , it has been shown to be highly reliable and reproducible [ 58 , 95 ] . in conclusion , the results of this study indicate that central adiposity and smoking are independently associated with worsening ef , while moderate alcohol consumption appears to have an independent positive effect on ef . physical activity , on the other hand , does not seem to be associated with ef when controlling for other health behaviours and relevant covariates . these findings may imply that within a population exhibiting numerous risk factors for cardiovascular disease , weight reduction , smoking cessation , and moderate alcohol consumption should be emphasized and prioritized over increasing physical activity as interventions to improve patients ' cardiovascular profiles . this prioritization may be particularly helpful given the difficulty with which individuals change just one health behaviour . further work is needed to confirm the mechanisms by which central adiposity , smoking and alcohol consumption influence ef . further research is also needed to examine the effect of health behaviours on ef over a longer period of time to examine how ef changes as a function of health behaviours over time . future research should also aim to assess the extent to which the relationship between health behaviours and cardiovascular disease is explained by the impact of health behaviours on ef .	background . the effects of smoking , alcohol consumption , obesity , and a sedentary lifestyle on endothelial function ( ef ) have only been examined separately . the relative contributions of these behaviours on ef have therefore not been compared . purpose . to compare the relative associations between these four risk factors and brachial artery reactivity in the same sample . methods . 328 patients referred for single - photon emission computed tomography ( spect ) exercise stress tests completed a nuclear - medicine - based forearm hyperaemic reactivity test . self - reported exercise behaviour , smoking habits , and alcohol consumption were collected and waist circumference was measured . results . adjusting for relevant covariates , logistic regression analyses revealed that waist circumference , abstinence from alcohol , and past smoking significantly predicted poor brachial artery reactivity while physical activity did not . only waist circumference predicted continuous variations in ef . conclusions . central adiposity , alcohol consumption , and smoking habits but not physical activity are each independent predictors of poor brachial artery reactivity in patients with or at high risk for cardiovascular disease .
You are an expert at summarizing long articles. Proceed to summarize the following text: our second lesson is often easier said than done : get to the root of the problem . when confronted with heartbreaking human need and urgent clinical challenges , it is tempting to race ahead to exploring therapeutic possibilities before gaining a firm , or even tentative , grasp on the molecular roots of a disease . but much time , money , and , ultimately , lives may be lost if a translational research team rushes into clinical trials without a basic understanding of the molecular mechanisms underlying the disease in question . in the case of hgps , we were fortunate that it only took us a couple of years to get the proverbial cart hooked up to the horse and heading in the right direction . in 2003 , through a combination of hard work and serendipity , the collins laboratory discovered that hgps is caused by a c - to - t point mutation near the end of the lamin a ( lmna ) gene ( eriksson et al . , 2003 ) . the point mutation activated a splice donor in the middle of an exon , leading to the production of an abnormal protein , now called progerin , that is 50 amino acids shorter than normal ( fig . 1 ) . posttranslational processing of lamin a. a farnesyl group is added to the c terminus of the lamin a protein by the enzyme farnesyltransferase , and , subsequently , the last three amino acids are cleaved by the endoprotease zmpste24 . zmpste24 then removes the terminal 15 amino acids , a step that is blocked in hgps because of the internal deletion of the cleavage site in the progerin protein . since the gene discovery , understanding of hgps has advanced at a rapid pace , fueled by basic research using both in vitro and animal models of disease this understanding has opened many doors ; some were expected , others unexpected , with some leading to exciting translational strategies and others pointing us back to the basics of human biology . how we set about exploring what lay beyond these doors leads us to our third lesson . i not only use all the brains i have , but all that i can borrow . in the case of hgps , although the earliest iteration of our team was made up primarily of genomic researchers , molecular biologists , and clinical researchers , we soon realized the need to access the impressive body of knowledge offered to us by cell biology . once we discovered that the lmna gene was the culprit in hgps , nearly two decades of lamin a cell biology provided almost immediate insights about how this mutation might cause disease in a dominant fashion . 1 ) , with the addition of a farnesyl group at the c terminus that seems to assist in zip - coding the protein to the inner surface of the nuclear membrane . the protein then needs to be released from this tether , which is accomplished by an enzyme called zmpste24 . the abnormal splice event that gives rise to progerin eliminates the zmpste24 cleavage , so progerin remains permanently farnesylated . to explore the cell biological consequences , we forged a rewarding collaboration with robert goldman , noted for his lamin a work . his laboratory helped us to document quickly the consequences of lmna mutations at the cellular level , including abnormal nuclear morphology , premature senescence , and loss of peripheral heterochromatin ( fig . 2 , a , d , and e ; goldman et al . , 2004 ) . it also became clear that we needed more cell biology expertise within our own group , and , in 2005 , the collins laboratory recruited a postdoc ( cao ) with a strong background in cell biology research . the move paid off , and subsequent work showed effects of lmna mutations on mitosis , causing incomplete disassembly of nuclear envelope , chromosome missegregation , and binucleation ( fig . 2 , b and c ; cao et al . , 2007 ; dechat et al . , 2007 ) . ( a ) abnormal nuclear morphology ( nuclear blebbing ) . a nucleus of a passage 17 hgps cell ( hgadfn167 ) was stained in green with an anti lamin a / c antibody . a binucleated hgps cell ( hgadfn167 ) stained with an anti - progerin antibody is shown in green . senescence - associated -galactosidase staining is shown for hgps cells ( hgadfn167 ) at passage 17 . ( e ) loss of peripheral heterochromatin and extensive nuclear disorganization of a passage 18 hgps cell ( hgadfn167 ) . source of cells : the progeria research foundation cell and tissue bank ( providence , ri ) . bars : ( a c and e ) 5 m ; ( d ) 20 m . our pathway from bench to clinic has been illuminated by the brilliance of a diverse array of scientists , including seminal papers describing the genomic instability in hgps ( liu et al . , 2005 ) and the mechanical changes in the lamina of hgps cells ( dahl et al . , 2006 ) . likewise , several groups have generated induced pluripotent stem ( ips ) cells from hgps patients , providing all of us in the field with a powerful new tool for studying the pathogenesis of hgps and testing new therapeutic strategies ( liu et al . , 2011 ; zhang et al . , 2011 ; progeria research foundation , 2012 ) . like most biomedical researchers , cell biologists aspire to see their discoveries turned into better health outcomes as swiftly as possible . however , in our experience , the translational clock usually ticks faster when there is a clinician on the translational team who is acutely aware of how short the timeline is for many who suffer from lethal , progressive diseases , or when basic scientists interact with patients and their families through meetings organized by advocacy groups ( gordon et al . , 2008 ) . while our discovery of the lmna mutation and elucidation of its mechanism of action raised a host of fascinating questions that could fuel years of basic research , we also knew that time was of the essence for children with hgps and their families . because hgps is so rare , and many hgps patients are in fragile health , there are very limited opportunities to conduct human trials of potential therapies . consequently , we needed to select and use the scientific tools at our disposal in highly strategic ways if we were to move forward expeditiously . theory predicted that farnesyltransferase inhibitors ( ftis ) would be of potential use in hgps by reducing the amount of permanently farnesylated progerin , so that is where we began . tests in cell culture by the collins laboratory and others showed that ftis can significantly ameliorate the nuclear - shape abnormalities seen in hgps cells ( capell et al . , 2005 ) . we also needed a good animal model with the precise genetic mutation seen in humans or , even better , a number of genetically precise models created via multiple strategies . our group developed a mouse model of hgps by reengineering human lmna to carry the hgps mutation , and then inserting it into the mouse germline ( varga et al . our mice lack the skin , hair , or bone abnormalities seen in humans with hgps , but , like the human patients , exhibit progressive loss of vascular smooth muscle cells in the media of large arteries . tests of ftis in this and other mouse models ( fong et al . , 2006 ; capell et al . , 2008 ) complemented other data in support of an initial clinical trial that administered an fti , lonafarnib , to hgps patients ( fig . 3 ) . other work provided an evidence - based rationale ( varela et al . , 2008 ) for a second generation of clinical trials that combined ftis with statins and bisphosphonates . nonclinicians embarking on translational research projects would also do well to acquaint themselves with another powerful time saver : studies of the natural history of the disease in humans . well - conducted natural history studies can define the range of manifestations and progression of rare conditions , and also identify biomarkers and other correlates of clinical outcomes that can be used to design an effective clinical trial . in the case of hgps , such studies were limited , and so efforts to identify statistically reliable outcome measures ( gordon et al . , 2007 , 2011 ; merideth et al . , 2008 ; gerhard - herman et al . , 2012 ) had to proceed simultaneously with the planning and implementation of treatment trials . work in cell culture supports the possibility that an analogue of rapamycin , an fda - approved immunosuppressant drug used to prevent rejection in organ transplantation , may provide benefit if added to the current combination approach . the nuclear morphology analysis work that provided a quantitative assessment of treatment effectiveness also highlights how cell biology can serve to guide , not just support , translational strategies ( cao et al . readers will have noted that all of these therapeutic ideas have been based upon repurposing drugs originally developed for other purposes . but that is not the only option . led by a better understanding of the basic biology of hgps , concurrent investigations on high throughput assay and drug development ( auld et al . , 2009 ) , gene therapy ( scaffidi and misteli , 2005 ; osorio et al . , 2011 ) , and stem cell treatment ( wenzel et al . , 2012 ) although the primary goal of translational research is helping patients , basic researchers going after this goal may also find themselves rewarded with unexpected insights into fundamental biological processes . in our case , the translation - oriented discovery of the hgps mutation paved the way for a series of cell biology studies that demonstrated that progerin is also made in normal cells . the splice site activated in hgps to create progerin is actually used at a low level in normal cells , and becomes more active as cell senescence approaches ( scaffidi and misteli , 2006 ; mcclintock et al . this splice site even may play a role in normal development , such as in closure of the ductus arteriosus ( bkenkamp et al . , 2011 ) . most recently , our work suggests that use of this splice site is somehow triggered by shortened telomeres , hastening the irreversible process of cellular senescence ( cao et al . , 2011b ) . these findings establish hgps as a valid model system for future basic research into aging . the example of hgps should make it clear that translational science is not just a one - way street , with basic research discoveries flowing from the bench toward more applied research in the clinic . rather , the translational process is a virtuous circle , in which basic science benefits clinical research and vice versa . in the span of a decade , hgps has gone from being a rare and mostly ignored disorder to being hot science in both basic and clinical journals . if clinical researchers had not persuaded basic researchers to devote significant effort to solving the translational riddle posed by hgps , the entire biology community might have missed out on a valuable window into development , senescence , and aging . although this is still a work in progress , we think hgps is a translational success story worth repeating , and we would like to encourage more cell biologists to give it a try . with more than 4,500 human conditions now having their molecular causes defined , many scientists working on basic research into particular genes , proteins , or pathways may have new opportunities to make these translational connections . for cell biologists who are considering heading down the translational pathway , we suggest checking out the online mendelian inheritance in man database ( http://www.omim.org/ ) to see what disorders might now connect to their work . we also encourage cell biologists to reach out to clinicians and patient advocacy organizations to seek potential collaborations , as well as to welcome the occasions when they reach out . it is true that serendipity played a significant role for hgps , and that does not always happen . but we do view our experience as a beacon of hope that shows what basic and clinical researchers can accomplish when they join together to tackle a translational challenge . we look forward to seeing what cell biology can do in the next few years to help us light up more of these beacons for the millions of people awaiting treatments and cures .	cell biologists love to think outside the box , pursuing many surprising twists and unexpected turns in their quest to unravel the mysteries of how cells work . but can cell biologists think outside the bench ? we are certain that they can , and clearly some already do . to encourage more cell biologists to venture into the realm of translational research on a regular basis , we would like to share a handful of the many lessons that we have learned in our effort to develop experimental treatments for hutchinson - gilford progeria syndrome ( hgps ) , an endeavor that many view as a poster child for how basic cell biology can be translated to the clinic .
You are an expert at summarizing long articles. Proceed to summarize the following text: the rationale and design of the origin trial were reported previously ( 9 ) . in brief , it was a multinational randomized trial with a 2 2 factorial design that tested two pairs of interventions . titrated basal insulin glargine was compared with standard stepwise oral therapy , and an omega-3 fatty acid supplement with placebo . participants were required to have a prior cardiovascular ( cv ) event or other evidence of high cv risk together with documented dysglycemia , defined as either impaired fasting glucose , impaired glucose tolerance ( or the two together ) , or newly detected or previously diagnosed type 2 diabetes . participants with diabetes could be treated with lifestyle alone or accompanied by no more than a single oral glucose - lowering agent . the present analysis concerns the glycemic intervention , with use of omega-3 fatty acids included only as a covariate . participants assigned to standard care continued their prior glucose - lowering treatment and were managed according to the investigators judgment and local guidelines for glycemic control and therapeutic approaches . investigators were advised not to prescribe insulin for standard participants unless they were on full doses of two or more oral agents , and if insulin was added , glargine was not to be used . participants assigned to basal insulin glargine who were taking a thiazolidinedione prior to randomization stopped this medication but continued to take other glucose - lowering agents . insulin glargine ( lantus ; sanofi ) was added to their regimen starting at 26 units daily , based on fasting glucose levels . participants were advised to inject the glargine in the evening and to self - titrate the dosage using a simple algorithm supported by the site investigators . self - measured , plasma - referenced fasting capillary blood glucose tests were done at least twice - weekly to guide titration , with the goal of achieving and maintaining fasting glucose at 5.3 mmol / l ( 95 mg / dl ) . other oral agents could be continued , reduced , or discontinued as judged appropriate during treatment with insulin glargine . the only oral agent that could be added ( if not previously used ) was metformin , which the site investigator initiated for individual participants if judged necessary to limit the risk of hypoglycemia . in addition to self - measured glucose tests , venous blood for measurement of fpg and a1c at local laboratories was collected at intervals during treatment . measurements of a1c were done at baseline , yearly thereafter , and at the end of treatment for all participants . all participants in the glargine treatment group and the nondiabetic participants in the standard care group had fpg levels measured at baseline , annually , and at the end of treatment . participants with diabetes in the standard care group had fpg measurements at baseline , after 2 years , and at the end of treatment . historical information about participants ( such as smoking and alcohol habits , prior cv events , depression , and other medical problems ) was systematically collected at baseline by participant self - report . summary statistics were computed for baseline characteristics of the whole population and for subgroups by glycemic treatment allocation and by glycemic status at enrollment ( diabetes absent or present ) . median fpg and a1c with interquartile ranges were computed for each subgroup for all time points . percentages of participants in each subgroup having a1c < 6.5 and < 7.0% ( two levels commonly identified as targets for glycemic control ) ( 15,16 ) were calculated for each time point from the beginning to the end of the trial . to determine the relationships between baseline characteristics and glycemic outcomes , findings for all randomized participants during the first 5 years of treatment were analyzed . maintenance of an a1c < 6.5% during treatment was defined as having the mean of all available annual measurements , including the 1-year value , up to and including the 5-year value ( i.e. , the updated mean a1c ) below those levels . univariable analyses of the relationships between clinical characteristics and a maintained a1c < 6.5% were performed using linear regression models . model 1 included all baseline characteristics meeting this criterion , including baseline glycemic status ( diabetes vs. no diabetes ) , but not glycemic treatment allocation . the independent effect of allocation to basal insulin glargine versus standard care was assessed by adding this variable to model 2 , which included all variables statistically significant at p < 0.05 in model 1 . the unadjusted effect of allocation to insulin glargine within subgroups was estimated using logistic regression and statistical tests for interactions between allocation and these subgroups . the rationale and design of the origin trial were reported previously ( 9 ) . in brief , it was a multinational randomized trial with a 2 2 factorial design that tested two pairs of interventions . titrated basal insulin glargine was compared with standard stepwise oral therapy , and an omega-3 fatty acid supplement with placebo . participants were required to have a prior cardiovascular ( cv ) event or other evidence of high cv risk together with documented dysglycemia , defined as either impaired fasting glucose , impaired glucose tolerance ( or the two together ) , or newly detected or previously diagnosed type 2 diabetes . participants with diabetes could be treated with lifestyle alone or accompanied by no more than a single oral glucose - lowering agent . the present analysis concerns the glycemic intervention , with use of omega-3 fatty acids included only as a covariate . participants assigned to standard care continued their prior glucose - lowering treatment and were managed according to the investigators judgment and local guidelines for glycemic control and therapeutic approaches . investigators were advised not to prescribe insulin for standard participants unless they were on full doses of two or more oral agents , and if insulin was added , glargine was not to be used . participants assigned to basal insulin glargine who were taking a thiazolidinedione prior to randomization stopped this medication but continued to take other glucose - lowering agents . insulin glargine ( lantus ; sanofi ) was added to their regimen starting at 26 units daily , based on fasting glucose levels . participants were advised to inject the glargine in the evening and to self - titrate the dosage using a simple algorithm supported by the site investigators . self - measured , plasma - referenced fasting capillary blood glucose tests were done at least twice - weekly to guide titration , with the goal of achieving and maintaining fasting glucose at 5.3 mmol / l ( 95 mg / dl ) . other oral agents could be continued , reduced , or discontinued as judged appropriate during treatment with insulin glargine . the only oral agent that could be added ( if not previously used ) was metformin , which the site investigator initiated for individual participants if judged necessary to limit the risk of hypoglycemia . in addition to self - measured glucose tests , venous blood for measurement of fpg and a1c at local laboratories was collected at intervals during treatment . measurements of a1c were done at baseline , yearly thereafter , and at the end of treatment for all participants . all participants in the glargine treatment group and the nondiabetic participants in the standard care group had fpg levels measured at baseline , annually , and at the end of treatment . participants with diabetes in the standard care group had fpg measurements at baseline , after 2 years , and at the end of treatment . historical information about participants ( such as smoking and alcohol habits , prior cv events , depression , and other medical problems ) was systematically collected at baseline by participant self - report . summary statistics were computed for baseline characteristics of the whole population and for subgroups by glycemic treatment allocation and by glycemic status at enrollment ( diabetes absent or present ) . median fpg and a1c with interquartile ranges were computed for each subgroup for all time points . percentages of participants in each subgroup having a1c < 6.5 and < 7.0% ( two levels commonly identified as targets for glycemic control ) ( 15,16 ) were calculated for each time point from the beginning to the end of the trial . to determine the relationships between baseline characteristics and glycemic outcomes , findings for all randomized participants during the first 5 years of treatment were analyzed . maintenance of an a1c < 6.5% during treatment was defined as having the mean of all available annual measurements , including the 1-year value , up to and including the 5-year value ( i.e. , the updated mean a1c ) below those levels . univariable analyses of the relationships between clinical characteristics and a maintained a1c < 6.5% were performed using linear regression models . model 1 included all baseline characteristics meeting this criterion , including baseline glycemic status ( diabetes vs. no diabetes ) , but not glycemic treatment allocation . the independent effect of allocation to basal insulin glargine versus standard care was assessed by adding this variable to model 2 , which included all variables statistically significant at p < 0.05 in model 1 . the unadjusted effect of allocation to insulin glargine within subgroups was estimated using logistic regression and statistical tests for interactions between allocation and these subgroups . the characteristics of the origin population at enrollment , divided by treatment assignment and glycemic status , are shown in table 1 . of 12,537 subjects randomized , 6,264 were assigned to treatment with insulin glargine and 6,273 to standard care . for the whole population , the mean age was 63.5 years , median fpg 6.9 mmol / l ( 125 mg / dl ) , and median a1c 6.4% ( 46 mmol / mol ) . eighty - eight percent of participants had either a prior diagnosis of diabetes ( of mean duration of 5.4 years ) or newly detected diabetes . the 12% without diabetes clearly differed from those with diabetes in fpg and a1c levels and also in other ways , including more frequent prior cv events , use of alcohol , depression , and use of statins and -blockers . baseline characteristics of participants the median period of follow - up on randomized treatment was 6.2 years . the effect of treatment allocation on the responses of fpg and a1c during treatment is shown in fig . standard care led to little change of fpg in this subgroup , but insulin glargine caused a sustained decrease to median values of 5.0 ( 4.55.5 ) , 4.9 ( 4.45.5 ) , 5.0 ( 4.55.7 ) , and 5.1 mmol / l ( 4.55.8 ) at 1 , 2 , 5 , and 7 years . for participants with diabetes , mmol / l ( 6.28.4 ) . with standard care , the values at 2 years and the end of treatment were 6.8 ( 5.98.1 ) and 7.0 mmol / l ( 5.98.4 ) ( fig . treatment with glargine reduced median fpg to 5.2 ( 4.65.9 ) , 5.0 ( 4.45.8 ) , 5.1 ( 4.56.1 ) , and 5.3 mmol / l ( 4.56.4 ) after 1 , 2 , 5 , and 7 years . median fpg values and median a1c values at baseline , yearly during randomized treatment , and at the end of treatment are shown separately for participants without diabetes ( a for fpg , c for a1c ) and with diabetes ( b for fpg , d for a1c ) at baseline . the group assigned to use basal insulin glargine is shown by solid lines and solid circles , and the group assigned to standard care by broken lines and open circles . the numbers at the bottom of each panel show the number of observations included at each point in time . for participants without diabetes , a1c changed little from baseline with either regimen ( fig . the median a1c was 5.7% ( 5.46.1 ) at baseline , 5.7% ( 5.46.1 ) at 1 year , and 6.0% ( 5.66.4 ) after 5 years . for glargine - treated participants , median a1c was 5.7% ( 5.46.0 ) at baseline , 5.6% ( 5.35.9 ) at 1 year , and 5.8% ( 5.56.1 ) at 5 years . for participants with diabetes , 1d ) . during standard care , the median a1c values at 1 , 2 , 5 , and 7 years were 6.3 ( 5.87.0 ) , 6.4 ( 5.97.0 ) , 6.6 ( 6.17.3 ) , and 6.6% ( 6.17.3 ) . corresponding values during treatment with glargine declined to 6.0 ( 5.56.5 ) , 6.0 ( 5.66.6 ) , 6.3 ( 5.86.9 ) , and 6.3% ( 5.86.9 ) . for comparison with these median values , mean a1c during treatment is also provided in supplementary table 1 . of participants without diabetes at entry , > 90% sustained a1c levels < 7.0% ( 53 mmol / mol ) , and > 75% achieved an a1c < 6.5% ( 48 mmol / mol ) throughout randomized treatment with both regimens ( fig . , 66% had an a1c < 7.0% and 47% had a1c < 6.5% before starting treatment ( fig . the percentage in the diabetic subgroup achieving an a1c < 7.0% increased to 88% at 1 year and 77% at 5 years , and the percentage achieving an a1c < 6.5% was 74% at 1 year and 60% after 5 years . 7.0% at 1 year and 66% at 5 years , and 58% with a1c < 6.5% at 1 year and 45% at 5 years . percentages of participants with a1c values < 7.0 and < 6.5% at baseline and yearly during randomized treatment are shown separately for those without diabetes ( a for < 7.0% , c for < 6.5% ) and with diabetes ( b for < 7.0% , d for < 6.5% ) at baseline . the group assigned to use basal insulin glargine is shown by solid lines and solid circles , and the group assigned to standard care by broken lines and open circles . associations of various clinical factors with maintaining a mean level of < 6.5% for up to 5 years are shown in table 2 . multivariable model 1 , which included baseline characteristics with a univariate p < 0.1 for this association , displays several factors with independent associations with maintaining a1c < 6.5% . these were greater age , reported use of alcohol , diagnosis of depression , lower a1c , lower waist - to - hip ratio , greater grip strength , lower albumin - to - creatinine ratio ( acr ) , lack of diabetes at baseline , and perhaps lack of statin use ( p = 0.053 ) . model 2 included the baseline characteristics independently associated with mean a1c < 6.5% in model 1 with a p value < 0.05 as well as the effect of allocation to insulin glargine versus standard care . in model 2 , greater age , use of alcohol , depression , lower a1c , lower waist - to - hip ratio , greater grip strength , lower acr , and lack of diabetes were significant independent predictors . the adjusted odds ratio ( or ) for success in maintaining a1c ( p < 0.001 ) . in a further multivariable analysis not reported in detail here , independent predictors of maintaining mean updated a1c < 7.0% during 5 years of treatment were similar . greater age , use of alcohol , lower a1c at baseline , and lack of diabetes at baseline were independent predictors , and the or for glargine versus standard care was 2.41 ( p < 0.001 ) . or ( 95% ci ) of maintaining a cumulative 5-year mean a1c < 6.5% in an unadjusted subgroup analysis , the glargine - based regimen was more effective than standard care in all subgroups , including those with and without diabetes at baseline , with ors close to 2 and no overlap of 95% cis with unity ( supplementary fig . three subgroup comparisons showed a nominally significant interaction with treatment assignment ; glargine may have been modestly more effective in participants with higher waist - to - hip ratios ( p = 0.011 ) , greater grip strength ( p < 0.001 ) , and moderate use of alcohol ( p = 0.029 ) . the usage of oral glucose - lowering agents prior to randomization is listed in supplementary table 2 . less than 2% of participants with dysglycemia not meeting the criteria of diabetes had used such agents prior to entry , and none at the time of oral glucose tolerance testing during screening . of the participants with diabetes at enrollment , 33% were taking no oral therapy , 31% were taking metformin , and 33% were taking a sulfonylurea . supplementary table 3 displays usage of oral agents and insulin at the end of treatment . of the participants without diabetes at entry , 69% of those assigned to glargine and 0.3% of those assigned to standard care were taking insulin at the end of the study . at the end of follow - up , 21% of those randomized to glargine and 29% of those randomized to standard care were taking one or more oral agents , most often metformin ( 18 and 24% ; p < 0.003 ) . of the participants with diabetes at entry , insulin was used at the end by 82% of those who were assigned to glargine treatment and by 12% of those assigned to standard care ( p < 0.001 ) . oral therapies were used by 71% of participants with diabetes assigned to glargine and 88% of those assigned to standard care ( p < 0.001 ) . metformin was taken by 51 and 65% of subjects in the glargine and standard groups , respectively , and sulfonylureas were used by 28 and 52% ( each < 0.001 ) . two or more oral agents were taken by 14% of the glargine - treated group and 42% of the standard care group . the percentages of people with diabetes at enrollment having one or more hypoglycemic episodes confirmed by a glucose test of <3 mmol / l ( < 54 mg / dl ) was 10.5 per 100 person - years with glargine and 3.0 per 100 person - years with standard treatment . the corresponding frequencies for those without diabetes at enrollment were 5.7 and 0.3 per 100 person - years . the characteristics of the origin population at enrollment , divided by treatment assignment and glycemic status , are shown in table 1 . of 12,537 subjects randomized , 6,264 were assigned to treatment with insulin glargine and 6,273 to standard care . for the whole population , the mean age was 63.5 years , median fpg 6.9 mmol / l ( 125 mg / dl ) , and median a1c 6.4% ( 46 mmol / mol ) . eighty - eight percent of participants had either a prior diagnosis of diabetes ( of mean duration of 5.4 years ) or newly detected diabetes . the 12% without diabetes clearly differed from those with diabetes in fpg and a1c levels and also in other ways , including more frequent prior cv events , use of alcohol , depression , and use of statins and -blockers . the effect of treatment allocation on the responses of fpg and a1c during treatment is shown in fig . standard care led to little change of fpg in this subgroup , but insulin glargine caused a sustained decrease to median values of 5.0 ( 4.55.5 ) , 4.9 ( 4.45.5 ) , 5.0 ( 4.55.7 ) , and 5.1 mmol / l ( 4.55.8 ) at 1 , 2 , 5 , and 7 years . for participants with diabetes , mmol / l ( 6.28.4 ) . with standard care , the values at 2 years and the end of treatment were 6.8 ( 5.98.1 ) and 7.0 mmol / l ( 5.98.4 ) ( fig . treatment with glargine reduced median fpg to 5.2 ( 4.65.9 ) , 5.0 ( 4.45.8 ) , 5.1 ( 4.56.1 ) , and 5.3 mmol / l ( 4.56.4 ) after 1 , 2 , 5 , and 7 years . median fpg values and median a1c values at baseline , yearly during randomized treatment , and at the end of treatment are shown separately for participants without diabetes ( a for fpg , c for a1c ) and with diabetes ( b for fpg , d for a1c ) at baseline . the group assigned to use basal insulin glargine is shown by solid lines and solid circles , and the group assigned to standard care by broken lines and open circles . the numbers at the bottom of each panel show the number of observations included at each point in time . for participants without diabetes , a1c changed little from baseline with either regimen ( fig . the median a1c was 5.7% ( 5.46.1 ) at baseline , 5.7% ( 5.46.1 ) at 1 year , and 6.0% ( 5.66.4 ) after 5 years . for glargine - treated participants , median a1c was 5.7% ( 5.46.0 ) at baseline , 5.6% ( 5.35.9 ) at 1 year , and 5.8% ( 5.56.1 ) at 5 years . for participants with diabetes , , the median a1c values at 1 , 2 , 5 , and 7 years were 6.3 ( 5.87.0 ) , 6.4 ( 5.97.0 ) , 6.6 ( 6.17.3 ) , and 6.6% ( 6.17.3 ) . corresponding values during treatment with glargine declined to 6.0 ( 5.56.5 ) , 6.0 ( 5.66.6 ) , 6.3 ( 5.86.9 ) , and 6.3% ( 5.86.9 ) . for comparison with these median values , mean a1c during treatment > 90% sustained a1c levels < 7.0% ( 53 mmol / mol ) , and > 75% achieved an a1c < 6.5% ( 48 mmol / mol ) throughout randomized treatment with both regimens ( fig . 2b and d ) . during glargine treatment , the percentage in the diabetic subgroup achieving an a1c < 7.0% increased to 88% at 1 year and 77% at 5 years , and the percentage achieving an a1c < 6.5% was 74% at 1 year and 60% after 5 years . with standard care , 7.0% at 1 year and 66% at 5 years , and 58% with a1c < 6.5% at 1 year and 45% at 5 years . percentages of participants with a1c values < 7.0 and < 6.5% at baseline and yearly during randomized treatment are shown separately for those without diabetes ( a for < 7.0% , c for < 6.5% ) and with diabetes ( b for < 7.0% , d for < 6.5% ) at baseline . the group assigned to use basal insulin glargine is shown by solid lines and solid circles , and the group assigned to standard care by broken lines and open circles . the effect of treatment allocation on the responses of fpg and a1c during treatment is shown in fig . standard care led to little change of fpg in this subgroup , but insulin glargine caused a sustained decrease to median values of 5.0 ( 4.55.5 ) , 4.9 ( 4.45.5 ) , 5.0 ( 4.55.7 ) , and 5.1 mmol / l ( 4.55.8 ) at 1 , 2 , 5 , and 7 years . for participants with diabetes , mmol / l ( 6.28.4 ) . with standard care , the values at 2 years and the end of treatment were 6.8 ( 5.98.1 ) and 7.0 mmol / l ( 5.98.4 ) ( fig . treatment with glargine reduced median fpg to 5.2 ( 4.65.9 ) , 5.0 ( 4.45.8 ) , 5.1 ( 4.56.1 ) , and 5.3 mmol / l ( 4.56.4 ) after 1 , 2 , 5 , and 7 years . median fpg values and median a1c values at baseline , yearly during randomized treatment , and at the end of treatment are shown separately for participants without diabetes ( a for fpg , c for a1c ) and with diabetes ( b for fpg , d for a1c ) at baseline . the group assigned to use basal insulin glargine is shown by solid lines and solid circles , and the group assigned to standard care by broken lines and open circles . the numbers at the bottom of each panel show the number of observations included at each point in time . for participants without diabetes , a1c changed little from baseline with either regimen ( fig . the median a1c was 5.7% ( 5.46.1 ) at baseline , 5.7% ( 5.46.1 ) at 1 year , and 6.0% ( 5.66.4 ) after 5 years . for glargine - treated participants , median a1c was 5.7% ( 5.46.0 ) at baseline , 5.6% ( 5.35.9 ) at 1 year , and 5.8% ( 5.56.1 ) at 5 years . for participants with diabetes , 1d ) . during standard care , the median a1c values at 1 , 2 , 5 , and 7 years were 6.3 ( 5.87.0 ) , 6.4 ( 5.97.0 ) , 6.6 ( 6.17.3 ) , and 6.6% ( 6.17.3 ) . corresponding values during treatment with glargine declined to 6.0 ( 5.56.5 ) , 6.0 ( 5.66.6 ) , 6.3 ( 5.86.9 ) , and 6.3% ( 5.86.9 ) . for comparison with these median values , mean a1c during treatment of participants without diabetes at entry , > 90% sustained a1c levels < 7.0% ( 53 mmol / mol ) , and > 75% achieved an a1c < 6.5% ( 48 mmol / mol ) throughout randomized treatment with both regimens ( fig . 66% had an a1c < 7.0% and 47% had a1c < 6.5% before starting treatment ( fig . the percentage in the diabetic subgroup achieving an a1c < 7.0% increased to 88% at 1 year and 77% at 5 years , and the percentage achieving an a1c < 6.5% was 74% at 1 year and 60% after 5 years . with standard care , 7.0% at 1 year and 66% at 5 years , and 58% with a1c < 6.5% at 1 year and 45% at 5 years . percentages of participants with a1c values < 7.0 and < 6.5% at baseline and yearly during randomized treatment are shown separately for those without diabetes ( a for < 7.0% , c for < 6.5% ) and with diabetes ( b for < 7.0% , d for < 6.5% ) at baseline . the group assigned to use basal insulin glargine is shown by solid lines and solid circles , and the group assigned to standard care by broken lines and open circles . associations of various clinical factors with maintaining a mean level of < 6.5% for up to 5 years are shown in table 2 . multivariable model 1 , which included baseline characteristics with a univariate p < 0.1 for this association , displays several factors with independent associations with maintaining a1c < 6.5% . these were greater age , reported use of alcohol , diagnosis of depression , lower a1c , lower waist - to - hip ratio , greater grip strength , lower albumin - to - creatinine ratio ( acr ) , lack of diabetes at baseline , and perhaps lack of statin use ( p = 0.053 ) . model 2 included the baseline characteristics independently associated with mean a1c < 6.5% in model 1 with a p value < 0.05 as well as the effect of allocation to insulin glargine versus standard care . in model 2 , greater age , use of alcohol , depression , lower a1c , lower waist - to - hip ratio , greater grip strength , lower acr , and lack of diabetes were significant independent predictors . the adjusted odds ratio ( or ) for success in maintaining a1c < 6.5% when using glargine compared with standard care was 2.98 ( p < 0.001 ) . in a further multivariable analysis not reported in detail here , independent predictors of maintaining mean updated a1c < 7.0% during 5 years of treatment were similar . greater age , use of alcohol , lower a1c at baseline , and lack of diabetes at baseline were independent predictors , and the or for glargine versus standard care was 2.41 ( p < 0.001 ) . or ( 95% ci ) of maintaining a cumulative 5-year mean a1c < 6.5% in an unadjusted subgroup analysis , the glargine - based regimen was more effective than standard care in all subgroups , including those with and without diabetes at baseline , with ors close to 2 and no overlap of 95% cis with unity ( supplementary fig . three subgroup comparisons showed a nominally significant interaction with treatment assignment ; glargine may have been modestly more effective in participants with higher waist - to - hip ratios ( p = 0.011 ) , greater grip strength ( p < 0.001 ) , and moderate use of alcohol ( p = 0.029 ) . the usage of oral glucose - lowering agents prior to randomization is listed in supplementary table 2 . less than 2% of participants with dysglycemia not meeting the criteria of diabetes had used such agents prior to entry , and none at the time of oral glucose tolerance testing during screening . of the participants with diabetes at enrollment , 33% were taking no oral therapy , 31% were taking metformin , and 33% were taking a sulfonylurea . supplementary table 3 displays usage of oral agents and insulin at the end of treatment . of the participants without diabetes at entry , 69% of those assigned to glargine and 0.3% of those assigned to standard care were taking insulin at the end of the study . at the end of follow - up , 21% of those randomized to glargine and 29% of those randomized to standard care were taking one or more oral agents , most often metformin ( 18 and 24% ; p < 0.003 ) . of the participants with diabetes at entry , insulin was used at the end by 82% of those who were assigned to glargine treatment and by 12% of those assigned to standard care ( p < 0.001 ) . oral therapies were used by 71% of participants with diabetes assigned to glargine and 88% of those assigned to standard care ( p < 0.001 ) . metformin was taken by 51 and 65% of subjects in the glargine and standard groups , respectively , and sulfonylureas were used by 28 and 52% ( each < 0.001 ) . two or more oral agents were taken by 14% of the glargine - treated group and 42% of the standard care group . the percentages of people with diabetes at enrollment having one or more hypoglycemic episodes confirmed by a glucose test of <3 mmol / l ( < 54 mg / dl ) was 10.5 per 100 person - years with glargine and 3.0 per 100 person - years with standard treatment . the corresponding frequencies for those without diabetes at enrollment were 5.7 and 0.3 per 100 person - years . as previously reported , the methods of therapy used in origin maintained excellent control of both fpg and a1c for at least 5 years of follow - up in the whole study population with dysglycemia . the present analysis expands this demonstration by examining the subpopulations with and without diabetes at baseline separately . in the subgroup without diabetes at baseline , there was a small increase of median a1c from 5.7% ( 39 mmol / mol ) initially to 6.0% ( 42 mmol / mol ) with standard care and to 5.8% ( 40 mmol / mol ) with glargine after 5 years of follow - up . in those with diabetes at entry , median a1c decreased slightly from the 6.5% ( 48 mmol / mol ) baseline after initiation of either glargine or standard care , and after 5 years , the median a1c was 6.6% ( 49 mmol / mol ) with standard care and 6.3% ( 45 mmol / mol ) with glargine . relative stability of a1c levels over time was not unexpected for the subpopulation without diabetes , but the finding that both treatment regimens had sustained success in people with overt diabetes at entry is reassuring . in contrast , glycemic control steadily worsened over the course of 510 years in some other long - term studies of type 2 diabetes ( 911 ) . sustained glycemic control in origin presumably was related to the use in each treatment arm of treat - to - target schemes , which called for intensification of treatment in response to evidence of rising levels of glucose . mmol / l , and metformin could be added to mitigate the risk of hypoglycemia . similarly , during standard therapy , oral medications were added and their dosage increased , with the aim of keeping a1c below either 6.5 or 7.0% , depending on locally accepted guidelines . at the end of treatment , 42% of those using the standard regimen were taking two or more oral agents , and 14% of participants assigned to glargine therapy were doing so . treatment in the belfast ( 9 ) , uk prospective diabetes study ( ukpds ) ( 10 ) , and a diabetes outcome progression trial ( adopt ) ( 11 ) studies , in contrast , was based on assignment to monotherapy regimens , including diet alone , metformin , sulfonylurea , thiazolidinedione , or basal insulin , with escalation of therapy only under certain conditions . the glycemic control attained in origin resembled that achieved in action in vascular disease : preterax and diamocron modified release controlled evaluation ( advance ) ( 17 ) , action to control cardiovascular risk in diabetes ( accord ) ( 18 ) , and veterans affairs diabetes trial ( vadt ) ( 19 ) , other trials in which glucose - lowering therapies in the intensive treatment groups were systematically adjusted seeking near - normal glycemic control . however , compared with the population in origin , participants in these studies had a longer duration of diabetes and in many cases established therapy with multiple glucose - lowering agents prior to enrollment . the a1c levels attained in advance ( 6.5% [ 48 mmol / mol ] ) and accord ( 6.4% [ 46 mmol / mol ] ) were close to those at baseline in origin ( 6.5% ) , whereas those in vadt were slightly higher ( 6.9% [ 52 mmol / mol ] ) . in all three studies , these values were achieved by strenuous efforts to improve control from higher a1c levels at baseline . hence , maintenance of a1c at or below near - normal entry levels in origin contrasts with the other trials efforts to restore previously inadequate glycemic control . keeping glycemic control below a level associated with increasing risk of diabetes complications by advancing therapy as needed may be a more desirable approach than the historically common practice of allowing marked hyperglycemia to occur and then attempting to reduce levels to a lower target ( 2022 ) . this concept is in keeping with the recent adoption of a1c 6.5% as one option for timely diagnosis of diabetes to allow intervention to minimize the risk of complications ( 23,24 ) . this analysis also identified baseline characteristics of origin participants that were predictive of maintaining an updated mean a1c from the first year of treatment to the end of treatment or 5 years of follow - up at < 6.5% . this measure of treatment success was selected because it was close to the median value at entry to the trial and also reflects a level of control now endorsed as a threshold for diagnosing diabetes . data after 5 years of treatment were not included because of the smaller numbers of participants who had been in the study long enough to complete 6 or 7 years . individuals with diabetes at baseline were understandably less likely than those without diabetes to have this level of success in controlling a1c , having an adjusted or of 0.309 ( p < 0.0001 ) . an association of long - term treatment success with lower baseline a1c , independent of the presence of overt diabetes , was also demonstrated , consistent with other studies . other predictive factors included greater age , use of alcohol more than two times weekly , depression , lower a1c , and lower waist - to - hip ratio ( all p < 0.001 ) . less clearly associated factors were greater grip strength ( p = 0.038 ) and lower urinary albumin excretion ( p = 0.035 ) . better success for individuals who were older at enrollment might reflect slower progression of the underlying defects of diabetes in those with later onset . lower waist - to - hip ratio , greater grip strength ( 25 ) , and lower albumin excretion might be markers for better physical fitness and a lower burden of microvascular complications of diabetes . moderate use of alcohol may be associated with favorable physiological patterns and reduced risk of type 2 diabetes and mortality ( 26 ) , and participants who reported depression might have been more willing to make changes to reduce depression or otherwise improve health - related behavior . several of these associations support the assumption that various behavioral characteristics of participants influenced the success of these treatment regimens in maintaining glycemic control . finally , allocation to basal insulin glargine with titration of dosage seeking normal fpg levels led to a nearly threefold increase in the likelihood of maintaining mean a1c < 6.5% for 5 years . moreover , this effect was observed in subgroups representing characteristics that were associated with success in maintaining a1c this observation is not surprising given that an ambitious glycemic target for glargine titration , fasting glucose < 5.3 mmol / l , was systematically sought . experience in origin showed that early use of this basal insulin was able to both attain and maintain this level of control of fpg , and thereby keep a1c from rising above baseline levels ( median 6.5% [ 48 mmol / mol ] ) for a majority of people with overt diabetes at baseline for up to 5 years ( 5-year median 6.3% [ 45 mmol / mol ] , 60% of participants . however , the short- and long - term risks versus benefits of this method of treatment relative to standard care in origin are not yet well - defined . as previously reported ( 13,27 ) , the use of systematically titrated glargine in origin was associated with 1.6-kg gain of weight and 0.7% increased incidence of severe hypoglycemia . these unwanted effects of seeking nearly normal glycemic control were less prominent in origin than in the trials in which participants had a longer duration of diabetes and more elevated a1c levels at baseline ( 18,19 ) . for example , the mean gain of weight with the intensive treatment regimen in the vadt was 8.2 kg ( 19 ) . also , the annual incidence of severe hypoglycemia with intensive treatment in accord was 3.1% ( 27 ) , whereas it was 1.0% with basal insulin and 0.3% with standard therapy in origin ( 13 ) . although maintenance of nearly normal glycemic control for 5 years may be predicted to delay the development of complications of diabetes , the present analysis lacks information about the predictors and consequences of hypoglycemia and other unwanted effects of insulin glargine relative to standard care . therefore , further examination of data from origin is needed to clarify the balance of risks to potential benefits from early intervention with insulin glargine . in conclusion , early intervention with basal insulin glargine or with standard care kept median a1c near the starting level for at least 5 years in both the subgroup without diabetes and the subgroup with diabetes at entry . maintaining the mean of yearly a1c measurements at < 6.5% ( 48 mmol / mol ) was more often accomplished when the initial a1c was lower and with titrated basal insulin glargine than with standard care . however , the risks versus benefits of this approach remain to be determined by further analyses and additional follow - up of origin participants .	objectiveto assess the success and baseline predictors of maintaining glycemic control for up to 5 years of therapy using basal insulin glargine or standard glycemic care in people with dysglycemia treated with zero or one oral glucose - lowering agents.research design and methodsdata from 12,537 participants in the outcome reduction with initial glargine intervention ( origin ) trial were examined by baseline glycemic status ( with or without type 2 diabetes ) and by therapeutic approach ( titrated insulin glargine or standard therapy ) using an intention - to - treat analysis . median values for fasting plasma glucose ( fpg ) and a1c and percentages with a1c < 6.5% ( 48 mmol / mol ) during randomized treatment were calculated . factors independently associated with maintaining updated mean a1c < 6.5% were analyzed with linear regression models.resultsmedian a1c in the whole population was 6.4% at baseline ; at 5 years , it was 6.2% with glargine treatment and 6.5% with standard care . of those with diabetes at baseline , 60% using glargine and 45% using standard care had a1c < 6.5% at 5 years . lack of diabetes and lower baseline a1c were independently associated with 5-year mean a1c < 6.5% . maintaining mean a1c < 6.5% was more likely with glargine ( odds ratio [ or ] 2.98 [ 95% ci 2.673.32 ] , p < 0.001 ) than standard care after adjustment for other independent predictors.conclusionssystematic intervention with basal insulin glargine or standard care early in the natural history of dysglycemia can maintain glycemic control near baseline levels for at least 5 years , whether diabetes is present at baseline or not . keeping mean a1c < 6.5% is more likely in people with lower baseline a1c and with the glargine - based regimen .
You are an expert at summarizing long articles. Proceed to summarize the following text: familial amyloid polyneuropathy ( fap ) type iv ( finnish ) is a very rare life - threatening disorder and reported only in a few countries . faps transmitted as an autosomal dominant trait neurodegenerative disorder associated with extracellular deposition of amyloid fibrils , particularly in the peripheral nervous system . mutations in the genes for transthyretin ( prealbumin ) , apolipoprotein a1 or gelsolin are responsible for the various forms of fap . diagnosis of amyloidosis can be made by genetic testing or by detection of amyloid deposition in abdominal fat pad , rectal , or nerve biopsies . we present the first case of familial amyloid polyneuropathy ( fap ) type iv in an iranian woman with severe involvement of multiple cranial nerves , peripheral limb neuropathy , and orthostatic hypotension . a 27-year - old iranian woman referred to the authors electrodiagnostic department with severe facial muscles atrophy causing cosmetic problems and avoidance of social activities . her medical history was positive for familial amyloidosis diagnosed based on abdominal and rectal biopsies when she was in second grade . she had biopsies because of positive familial history of amyloidosis in her mother and older sister . symptoms developed with mild weakness during chewing food and progressed to severe facial muscle atrophy with cosmetic problems and mild tingling in feet . soon after , she presented with dizziness during standing up from sitting position and blurred vision . at examination , she showed bilateral severe facial muscle and tongue atrophy and fasciculation of the tongue and left side ptosis . her appearance was sad , with drooping eyelids , and hanging skin of the face ( figure 1 ) . corneal sensation was decreased and sensation was impaired on face with mild sensory disturbances in feet accompanied by mild sensory ataxia . slit lamp examination revealed multiple streaks on the cornea ( corneal lattice ) , which was compatible with a characteristic feature of fap type iv . no abnormal findings were observed on mri of the brain and spinal cord . shows familial amyloid polyneuropathy ( fap ) type iv ( finnish ) in a 27-year - old iranian woman presented with severe bilateral facial muscles atrophy . in electrodiagnostic study , severe bilateral facial neuropathy with reduction in facial nerve compound muscle action potentials ( cmap ) amplitude and severe denervation in needle electromyography ( emg ) was present . also in lower limbs , low amplitude sural sensory nerve action potential ( snap ) and low amplitude with mild reduction in conduction velocity of deep peroneal and tibial nerves cmap were evident . there was not any evidence of conduction block except for mild carpal tunnel syndrome ( cts ) in the right side . bipolar needle emg of bilateral facial innervated muscles ( orbicularis oris , orbicularis ocoli , nasalis , and frontalis ) , trigeminal innervated muscles ( temporalis and masseter ) and hypoglossal ( tongue ) demonstrated florid denervation by the way of ample fibrillations ( 3/4 ) , and positive sharp waves ( 3/4 for all ) . additionally , there was a reduction in the recruitment and interference pattern of motor units and chronic motor unit remodeling changes to these muscles . their amplitudes , duration , and polyphasia were within chronic neurogenic range ( muap duration 3 - 4 msec and muap amplitude 4 - 5 mv ) . the motor unit action potential ( muap ) characteristics of cervical and thoracic innervated muscles were normal , with no obvious evidence of denervation , and no changes in motor unit morphology , interference , and recruitment patterns . in lower limbs , emg demonstrated mild denervation by the way of a few fibrillations ( 1/4 ) and positive sharp waves ( 1/4 ) in distal muscles . there was a reduction in the recruitment and interference pattern of motor units and chronic motor unit remodeling changes to these muscles . thus , these studies were indicative of a severe ongoing on chronic denervating process of mainly cranial nerves and length dependent mild axonal neuropathy in the limbs . this patient was diagnosed as having type iv ( finnish ) fap on the basis of clinical manifestations , positive amyloid deposition on biopsied tissues and electrophysiologic findings . clinical features of finnish type fap characterized with the combination of lattice corneal dystrophy and multiple cranial neuropathies ( e.g. , facial palsies , and bulbar weakness ) . onset of symptoms is usually in the third decade of life . over time , a mild generalized sensorimotor polyneuropathy develops . the resultant mutations and amino acid substitutions are felt to lead to a charge change on the protein , which may render the molecule resistant to proteases . we could not perform genetic testing for this patient due to technical unavailability for fap diseases in our country . in type iv fap , cranial nerves are mainly affected by the disturbance of sympathetic nervous system and axonal sensorimotor peripheral polyneuropathy in advanced stages . the clinical electrophysiological patterns in our patient are similar to that of finnish families with cranial neuropathy and corneal lattice dystrophy . biopsy of abdominal fat tissues has been commonly employed for the histological diagnosis of familial amyloidosis , including fap . nerve histopathology of the different forms of fap is similar showing fiber - length - dependent polyneuropathy , loss of myelinated nerves , particularly small myelinated and unmyelinated nerve fibers . endoneurial amyloid deposits can be noxious to nerve fibers in several ways , including mechanical and toxic effects on nerve fibers and impairment of blood supply . as suspected from the clinical features and histopathology , electrophysiologic studies reveal abnormalities consistent with a generalized or multifocal axonal sensorimotor polyneuropathy . snaps are diminished in amplitude and are normal or only mildly prolonged in latency or slow in conduction velocity . electromyography can demonstrate fibrillation potentials and positive sharp waves in the more distal weak limb muscles along with decreased recruitment of polyphasic , long - duration , large - amplitude muaps . with regard to treatment of fap , liver transplantation has reportedly halted the progression of clinical manifestations . in recent years , many new therapeutic strategies have been proposed and several ongoing therapeutic trials involving , for instance , stabilizers of transthyretin tetramers ( tafamidis and diflunisal ) and gene therapies to suppress transthyretin expression . we reported the first type iv fap ( finnish ) iranian woman with neurological deficits , including rapidly progressive cranial neuropathies , mild sensorimotor axonal peripheral polyneuropathy , unilateral cts , corneal lattice dystrophy , and orthostatic hypotension . in 2010 lttmann rj et al . , reported the first german family with finnish type fap . our case presented with rapidly progressive and severe clinical presentation , especially in the cranial region . in the more advanced stages of the disease , most patients showed grossly enlarged protuberant lips and the clinical finding of cutis laxa . it is characterized by loose skin , which causes the patients to look older than their age . our patient showed loose facial skin , mostly in the lower eyelid , but we did not find clinically relevant cutis laxa in other parts . the authors conclude that in any case of symptomatic progressive multiple cranial nerves involvement and electrodiagnostic evidence of polyneuropathy , fap should be considered as differential diagnosis . based on high accuracy of abdominal fat , rectal or nerve tissue histopathology , we encourage biopsies in countries where genetic testing is not available . this case highlights one of the rare conditions causing neuropathy , presenting mainly with facial muscle wasting .	familial amyloid polyneuropathy ( fap ) type iv ( finnish ) is a rare clinical entity with challenging neuropathy and cosmetic deficits . amyloidosis can affect peripheral sensory , motor , or autonomic nerves . nerve lesions are induced by deposits of amyloid fibrils and treatment approaches for neuropathy are challenging . involvement of cranial nerves and atrophy in facial muscles is a real concern in daily life of such patients . currently , diagnosis of neuropathy can be made by electrodiagnostic studies and diagnosis of amyloidosis can be made by genetic testing or by detection of amyloid deposition in abdominal fat pad , rectal , or nerve biopsies . it is preferable to consider fap as one of the differential diagnosis of a case presented with multiple cranial nerves symptoms . the authors present a case of familial amyloid polyneuropathy ( fap ) type iv with severe involvement of multiple cranial nerves , peripheral limb neuropathy , and orthostatic hypotension .
You are an expert at summarizing long articles. Proceed to summarize the following text: a 73-year - old woman was admitted to our hospital with complaints of shortness of breath and malaise . nineteen days prior to admission , she was treated with inhaled steroids and cefpodoxime for acute bronchitis . a week before admission , she complained of fever , chills , wheezing , and cough with yellow sputum . her medical history included asthma with infrequent exacerbations ( three exacerbations in the previous 3 years ) , hypertension , hyperlipidemia , diabetes mellitus , hypothyroidism , gout , spinal stenosis , and chronic kidney disease . her home medications included carvedilol , furosemide , atorvastatin , gemfibrozil , sitagliptin , levothyroxine , allopurinol , erythropoietin , montelukast , fluticasone , and albuterol inhalers . vital signs in the emergency department were temperature 97f , blood pressure 144/66 mm hg , heart rate 80/min , respiratory rate 16/min , and oxygen saturation 99% on room air . laboratory data showed white cell count 2.810 cells / dl with 72% neutrophils , hemoglobin 8.7 g / dl , hematocrit 27.2% , blood urea nitrogen 67 mg / dl , and serum creatinine 2.73 mg / dl . serum mycoplasma antibody , urine legionella antigen , nasal swab for respiratory syncytial virus and influenza antigen , and rapid streptococcal throat tests were negative . on day 5 of admission , a high - resolution contrast tomographic ( hrct ) scanning of the chest revealed bilateral multifocal ground glass opacities . on day 7 of admission , she complained of chest pain and had oxygen saturation of 80% on room air . perfusion lung scan showed perfusion defects highly suspicious for pulmonary embolism , and intravenous heparin was started . on day 10 of admission chest x - ray revealed new multifocal bilateral infiltrates , and ceftazidime and azithromycin were added . repeat hrct showed development of new extensive bilateral pulmonary nodular infiltrates with ground glass opacities ( fig . 1 ) . antibiotics were switched to ertapenem and azithromycin . on day 13 of admission , she was extubated on day 14 of admission per the family 's wishes and she died later that day . autopsy revealed aspergillus hyphae invading through the bronchial mucosa , almost completely obliterating the lumen of mid- to small - sized bronchi ( fig . 2 ) . vascular invasion by aspergillus was also evident with concomitant widespread pulmonary arterial thrombi ( fig . high - resolution computed tomographic scan of the chest revealing multiple foci of ground glass opacities ( blue arrows ) and bilateral pulmonary nodular infiltrates ( green arrows ) . light microscopic findings of lung specimen ( 40 ) stained with hematoxylin and eosin showing aspergillus hyphae invading through the bronchial wall . a blood vessel is visible in the lower left field with an occluding thrombus and inflammatory cells in its lumen . hematoxylin and eosin stain of the lung specimen under a light microscope at 200 showing typical branching , septate aspergillus hyphae , invading through the mucosa of a distal bronchi . ipa is caused by one of the four species of aspergillus : a. fumigatus , a. flavus , a. niger , and a. terreus ( 5 ) . it is increasingly seen due to a rise in the number of patients undergoing sct and solid organ transplants , and also due to increasing number of patients on chemotherapy ( 6 ) . construction work in the vicinity of susceptible patients may increase spore aerosolization and is an independent risk factor ( 7 ) . lower respiratory tract symptoms such as cough with or without sputum production , respiratory distress , wheezing , and fever are common . aspergillus has a predilection for invading vasculature , especially in the neutropenic patients , leading to thrombosis , tissue infarction , and necrosis . in such cases the diagnosis of ipa is challenging due to the non - specific nature of the symptoms and is often delayed due to lack of clinical suspicion in patients without classic risk factors . tissue biopsy with histopathologic demonstration of tissue invasion by fungal hyphae is considered the gold standard ( 9 ) . however , obtaining tissue specimens from critically ill , often intubated , and hemodynamically unstable patients is not always feasible . identification of aspergillus species in the sputum could represent colonization , especially in immunocompetent patients ( 1 , 10 ) . on the contrary , isolation of aspergillus from sputum in patients with leukemia , or in those who have undergone sct , has a positive predictive value of 8090% for the presence of ipa ( 1 , 11 , 12 ) . with regard to imaging studies , patterson et al . , in their review of 595 cases of ipa , reported that 85% of the cases had computed tomographic ( ct ) scan findings suggestive of ipa ( 13 ) . pulmonary nodules are the most commonly seen abnormality whereas the halo sign is relatively more specific with a high predictive value for ipa in patients with neutropenic fever after sct ( 14 ) . laboratory tests to detect aspergillus antigens in body fluids , either serum or bronchoalveolar lavage fluid ( bal ) , are increasingly helpful in the diagnosis of ipa . galactomannan ( gm ) testing or aspergillus polymerase chain reaction ( pcr ) assay in bal has good sensitivity and specificity for ipa ( 2 , 15 ) . testing for both gm and pcr may increase sensitivity without compromising the specificity ( 2 ) . definitions for proven , probable , and possible ipa for the susceptible population of immunocompromised patients with cancer and recipients of sct have been stated ( 16 ) . a criterion has also been suggested for the diagnosis of ipa in chronic obstructive pulmonary disease ( copd ) patients ( 17 ) . the mortality rate of ipa continues to be very high , exceeding 50% in neutropenic patients ( 14 ) , and 90% in sct recipients ( 18 ) . amphotericin used to be the preferred antifungal , until a large randomized clinical trial comparing amphotericin with voriconazole for primary treatment of ipa showed a better response rate and higher survival ( 71 vs. 58% ) at 12 weeks of therapy in the voriconazole group . echinocandins , such as caspofungin , are used as salvage therapy in patients not responding to or not tolerating first - line therapy ( 1 ) . due to differences in their mechanisms of action , combination therapy with azoles , trienes , and echinocandins could be a strategy to treat ipa ( 1 ) . at present , voriconazole is considered the therapy of choice ( 19 ) . prolonged and high - dose corticosteroid therapy is an established risk factor for the development of ipa ( 1 , 2 ) . although ipa is seen in patients with chronic lung diseases on long - term steroids , it is rarely seen with short use of corticosteroids ( 1 , 2 , 22 ) . to the best of our knowledge , diagnosis of ipa after short - course steroid therapy for asthma in a 31-year - old man is the only other case of ipa in a similar clinical scenario ( 3 ) . relatively few cases of ipa are observed in truly immunocompetent patients without classic risk factors ( 3 , 4 ) . classic risk factors for ipa were absent in our patient , and thus ipa was not high on the differential diagnosis . in our patient , hypoxia raised the possibility of pulmonary embolism , and perfusion lung scan further supported this diagnosis . angioinvasive ipa can lead to thrombosis and create perfusion defects ( 2 , 23 ) . thus , the diagnosis of pulmonary embolism confounded the clinical picture by giving an alternate explanation for the patient 's symptoms , preventing further investigations such as bronchoscopy . refractoriness to therapy manifested as worsening clinical symptoms , progressive hypoxia , and increasing pulmonary infiltrates despite aggressive antibiotic therapy should raise suspicion for ipa . in our opinion , bronchoscopy should be considered in such patients along with antigen detection with gm and pcr testing . early treatment with voriconazole is the only hope , and treatment should be initiated as soon as ipa is suspected . the authors have not received any funding or benefits from the industry or elsewhere to conduct this study .	invasive pulmonary aspergillosis ( ipa ) is a severe fungal infection with a high mortality rate . the incidence of ipa is on the rise due to an increase in the number of patients undergoing transplants and receiving chemotherapy and immunosuppressive therapy . diagnosis is challenging due to the non - specific nature of symptoms . voriconazole is the mainstay of therapy . we present a case of an elderly woman presenting with acute bronchitis and asthma exacerbation , who succumbed to overwhelming ipa . it is uncommon for ipa to develop in patients on short - term steroid therapy for asthma exacerbation . the possibility of aspergillosis in immunocompetent patients should be considered in those on systemic steroids and deteriorating pulmonary functions .
You are an expert at summarizing long articles. Proceed to summarize the following text: the incidence of cutaneous melanoma ( cm ) is rapidly increasing in europe , especially in the caucasian population . incidences are known to vary amongst white populations , reaching 15 cases per 100,000 inhabitants per year in scandinavia and 57 cases per 100,000 inhabitants per year in mediterranean countries [ 24 ] . fortunately , these data are matched by active research directed toward a greater identification of risk factors linked with the onset of melanoma . in this regard , the presence of naevi assumes particular importance as an independent and very high risk factor for the development of melanoma . clinically dysplastic naevi and an excess number of melanocytic naevi are among the most serious known risk factors for cutaneous melanoma . in the last decade , a plethora of investigations aimed at identifying risk factors for the development of melanoma have been conducted . more recently , working on 200 patients affected by melanoma and 200 healthy control patients , nikolaou et al . confirmed that the presence of atypical naevi is an important risk factor for the development of cm , tripling the odds ratio ( or ) . according to carli et al . , the greatest difference between subjects with or without atypical naevi is related to their number of common naevi : the authors demonstrated that more than 30 naevi are encountered in 41.5% of melanoma cases , but in only 9% of healthy control subjects ( or 8.0 ; confidence interval ( ci ) 6.310.3 ) . even if atypical clinical features of naevi constitute a very high risk factor for cm , their partial correspondence with histologic dysplasia indicates that the total number of naevi remains the most important factor in the development of cm . these data confirm the major risk of dysplasia or the development of cm when the total number of naevi exceeds 100 , and the presence of an elevated number of naevi needs to be carefully evaluated in the panorama of risk factors for the development of melanoma [ 13 , 14 ] . as a result , numerous studies have been undertaken in order to establish a classification of naevi and to define their physiological and pathological evolution , the majority of which have aimed to correlate the macroscopic appearance of these structures with their histopathological characteristics [ 15 , 16 ] , dividing them into dermal , composed , and junctional . kincannon and boutzale further divided acquired naevi into five categories according to their rough macroscopic appearance and their relationship to the skin surface , noticing that the papillomatous variant is most commonly associated with such phenotypes as blue or green eye colour and fair , light brown , or red hair . these authors underlined the importance of any possible correlations between naevi and phenotype characters and also drew up a more accurate and detailed classification of naevi , even though it was restricted almost exclusively to dermal naevi . gallagher and kwan showed that naevi have a preferred body distribution in the two genders which is already evident in the pediatric age : in males naevi are more numerous on the head , neck , and trunk , whereas females show a greater distribution on their limbs . naevi are much more numerous in children intermittently exposed to the sun , highlighting the importance of sun exposure during childhood in the genesis of benign acquired naevi . however , the same distribution pattern in photoprotected locations raises the possibility that hormonal differences play a consistent role in the development of melanocytic naevi [ 19 , 20 ] . the most famous and widely accepted classification of acquired melanocytic naevi was published by ackermann and magana - garcia who classify naevi into four types , of which clark naevi constitute the predominant type among commonly acquired melanocytic naevi . when their diameter exceeds 5 mm and at least two other signs of clinical activity are present , such as irregular or poorly defined edges , uneven colouring , or erythematous patch variations in skin pattern , they are defined as atypical , whereas when histology shows the presence of specific architectural features they are diagnosed as dysplastic naevi . however , although ackerman 's classification continues to be a reference , all pigmented melanocytic naevi are grouped under the single denomination of clark naevi which does not enable the analytical investigation of naevi in the field of melanoma prevention : further steps in this direction have only led to the conviction that the presence of a small number of clark naevi has weak meaning in young patients with no melanoma familiarity . on the other hand , when clark naevi arise in older subjects , between the ages of 40 and 50 with no familiarity , their meaning is less clear but it is considered as an anomaly of the normal formation and growth process of melanocytes . several variants , whose denominations can be found in the literature , are mentioned and defined by means of clinical criteria in saurat 's book . this publication includes the most common naevi present in the population ; sutton or halo naevus is also mentioned and congenital pigmented naevi are divided into small ( < 1.5 cm ) , medium ( 1.520 cm ) , and large ( > 20 cm ) . further progress in this direction can be achieved by making a precise systematic table of the various subspecies of naevus , free of any excess or overlapping . we have conducted this case - control study with the aim of observing different numbers of moles and different mole typology associations between patients affected by melanoma and control volunteers . the analysis of naevus variants is not only of commercial value but can be of considerable practical value in the self - analysis of naevi , which is of great importance in the prevention of cm . this analysis makes it easier for patient and physician to know the number and distribution of the naevi , thus enabling the timely observation of any anomalous cellular activity in progress , of any lesions at risk or of a still undetected early clinical melanoma . in addition , this study may provide a further contribution to the determination of a naevic map in the patient undergoing a routine dermatological checkup without suspect lesions , evaluating the possibility of identifying one or more categories of naevus variants for every individual in order to identify further guide lines for the study of melanoma risk factors . naevus variants can improve the interaction between doctors and their patients , who will be able to furnish more accurate information on the naevi and their evolution , thus providing doctors with better guidelines for diagnosis and therapy . in this way , they will be able to better orient themselves in the identification of risk naevus / naevi , examining mole variant associations and their numerosity , according to the total number of naevi and the phenotypic features of the people concerned . one of the aims our study is to try to identify the phenotypic features of individual naevus variants with a view to establishing different risk patterns for mc , which may in turn suggest different follow - up procedures . 64 cases and 183 controls were selected amongst patients at the dermatology department of federico ii university , naples between october 2009 and february 2011 . the cases and the controls ( 102 males and 145 females ) had an average age of 34.8 years ( minimum 2 and maximum 82 ) . the 64 cases were equally distributed between the two sexes ; of the 183 controls 70 were males and 113 females . the cases enrolled were patients affected with nodular or superficial melanoma , the thickness of the lesion had been determined in each case ( staging model ajcc 1988 ) , and the time elapsed from the excision was calculated as between 0 and 10 years . patients with melanoma that had developed on a malignant freckle were excluded , as these melanomas rarely break out in association with a preexisting naevus . the controls were first - degree relatives of cases living in the same household for the same period . all patients were caucasian and homogeneous in respect of socioeconomic indicators and occupation ( table 2 ) . before the naevus count , a trained interviewer compiled a form for each case and control . the interview lasted about 15 minutes and included the following data : residence , phenotype characteristics such as eye colour ( brown , hazel , green , and blue ) , hair colour ( black , brown , fair , and red ) ; phototypes for groups and subgroups from i to iv , ( since v and vi are practically absent in our area for ethnic reasons ) , melanoma familiarity , sunburn history subdivided by age ( juvenile 015 years old , and adult over 15 years old ) , and use of sun beds . the naevi were evaluated after being classified into one of three major groups : the common acquired melanocytic naevi ( nmac ) ( > 2 mm ) , congenital naevi , and atypical naevi . the location of each one was reported : head or neck , arm , upper arm , hands , chest , abdomen , upper back , lower back , thigh , and feet . sun freckles or ephelides were recorded by a number code ( l = none , 2 = from 1 to 5 , and 3 = more than 5 ) . those naevi which were identifiable as atypical were reported separately from the total count . in order to minimise possible errors in the naevus count and according to data reported in the literature , a series of clinical criteria identifying the variants was established ( table 1 ) , based on clinical morphological criteria , that considered the following : relationship to the skin surface , this was used by the dermatologists to identify every naevus lesion . for each variant , the presence of naevic elements and their number was reported , as well as the total number of variants present and the total number of naevi > 2 mm , regardless of their variant group membership . univariate analysis was carried out , followed by a chi - square test to evaluate the degree of association between several variables . finally , the or and the 95% confidence limit were adjusted for age , gender , number of naevi , and some known risk factors for cm , such as phototype i - ii , melanoma familiarity , and past sunburn history . more than 70% of the sample had homogeneous phenotypes : phototype ii or iii ; dark hair ; dark eyes ( 9% of the subjects phototype i , 40% phototype ii ; 35% phototype iii ; 14% phototype iv ) . the sample was also homogeneous in relation to the total number of naevi : 42% of cases and 45% of controls , thus nearly half the sample reported a total number of naevi ranging between 10 and 50 elements . 67% of cases and 80% of controls were negative for childhood sunburn : more than 75% of the sample did not present a childhood sunburn risk factor . with regard to our first aim , that is , the distribution of the single types in the sample , our study showed that the small brown naevus was present in more than 70% of controls and of cases . the raised brown naevus , on the other hand , was found in 93% of control subjects and in only 7% of cases . the target naevus was identified in 7.8% of the cases and in 16.1% of the controls . the association small brown + small black is equally distributed between the two groups : 27% of the cases and the controls . the presence of the target naevus varies in the two groups when it is the only type present and , when in association with others , more predominantly in cases ( target : 16% of cases and 8% of controls ; target + small brown : 16% of cases and 7% of controls ; target + small brown + small black : 10% of cases and 3% of controls ; target + small brown + small black + large brown : 8% of cases and 2% of controls ) . the presence of the small brown does not seem to be associated with cm ( small brown or 2.05 ; ci 1.04.42 ) . the risk increases when there is also the target variant ( target or 3.65 ; ci 1.49.7 ) . the raised brown naevus , on the other hand can be considered as protective for the development of cm ( raised nevus or 0.2 ; ci 0.030.8 ) . it can be seen that among subjects with an equal number of naevi , a greater number of variants corresponds to a greater cutaneous melanoma risk . the results were relative to the variants indicated in table 3 . with an equal number of naevi , the combination of only two variants was found to be of slight significance : ( small black + large brown or 3.5 ; ci 1.39.2 ) ; ( target + large brown or 3.6 ; ci 1.111.2 ) ; ( small black + large brown + large black or 5.5 ; ci 1.421.7 ) ; ( target + small brown + small black or 5.9 ; ci 1.523.2 ) indicating that apart from the number of naevi , naevus variants might influence the degree of risk . on the other hand the or does not change when the small brown variant is added to the association of small black and small brown ( small brown + large brown + small black ( or 3.5 ; ic 1.39.5 ) , small black + large brown ( or 3.5 ; ic 1.39.2 ) ) . analysing these data , it can be seen that a further significant element is provided by the specific impact of the different variants : the data indicate that the presence of the very common small brown naevus , does not modify the or , whereas the target naevus requires more careful evaluation ( or 3.65 ; ci 1.49.7 ) . moreover , the association of the target naevus with other variants , increases the degree of risk [ target + small brown or 5.25 ; ci 1.815.4 ] ; [ target + small brown + small black or 5.9 ; ic 1.523.2 ] ; [ target + small brown + small black + large brown or 5.0 ; ic 1.122.4 ] . our study indicates that some variants and/or variant combinations , do not significantly increase risk . ( fried egg or 0.4 ; ci 0.081.86 ; p = 0.23 ) ; ( unna or 0.94 ; ci 0.461.90 ; p = 0.8 ) ; ( meischer or 1.26 ; ci 0.52.9 ; p = 0.6 ) . the self - assessment of pigmented lesions remains an important step in the prevention of skin melanoma . in an australian study , carried out to determine the correspondence between the patient 's and the dermatologist 's naevus check , it was shown that the number of pigmented lesions is always underestimated by the patient , but agreement increases for atypical melanocytic naevi ; however , the role of the atypical naevus has been the subject of much debate in the literature and elsewhere , and , of course , it is not so easy to diagnose clinically . our study aims to introduce the differentiation of naevus variants among the monitoring criteria of risk factors for cutaneous melanoma . the results show that even if the total number of naevi represents a risk factor for the development of cutaneous melanoma , orientation in the naevus panorama of a specific subject requires the identification of several naevus variants . the most common naevus variants , such as dermal naevi and homogeneously pigmented naevi ( small and large brown or small and large black naevi ) can not alone represent a risk marker ; however the combination of two or more variants becomes a significant risk marker , and their combination in a person thus enables the identification of groups of subjects as reference targets potentially at risk of developing cutaneous melanoma . on the other hand , people presenting the target naevus in association with other naevus variants , have a major rearrangement and activity of pigmented lesions , and therefore require a more rigorous follow - up procedure . the greater variability of this variant is perhaps also expressed through its greater clinical inhomogeneity . this introduces a further aspect of our results : it is important to consider carefully not only the non - uniformity of a single type but also the general non - uniformity of the whole naevus panorama . the data actually available in the literature indicate that when the total number of naevi present in a subject increases , the risk of developing cutaneous melanoma also increases . a further datum emerges from our study : when two subjects present a similar number of naevi , the greater risk for cutaneous melanoma is linked to the greater number of naevus variants . subjects having a moderate number of lesions but presenting clinical inhomogeneous pigmentation are included in the group of subjects at risk . conversely , subjects with an elevated number of naevi but with a homogeneous panorama and low variability , can be observed with greater tranquillity , without however neglecting other risk factors . the classification of naevus in variants can be an indicator of clinical predictivity particularly in subjects who present naevi and especially an elevated number of naevi . furthermore , some variants considered singularly can play a key role in determining the clinical picture of the subject and are to be evaluated with great attention . consider , for example , naevi such as the small brown naevus whose presence or absence appears to be totally uninfluential , whereas the presence of others , such as the bullseye naevus , can greatly modify the dermatologist 's attitude toward the patient .	background . the incidence of cutaneous melanoma is rapidly increasing in europe . active research is directed toward the identification of naevi as a risk factor . objective . the aim of our case - control study was to observe different numbers of moles and different mole typology associations in order to evaluate clinical predictivity and to establish a new classification for some naevus variants . methods . a case - control study was carried out , enrolling 64 cases affected by melanoma and 183 controls , between october 2009 and february 2011 . each patient was interviewed and subjected to clinical examination . the resulting data were analysed using the statistical elaboration program spss 16.0 . results . the association of target naevus with other variants increases the degree of risk ( target + small brown odds ratio 5.25 ; confidence interval 1.815.4 ) ; ( target + small brown + small black + large brown odds ratio 5.0 ; confidence interval 1.122.4 ) . therefore , other variants and/or other variant combinations do not significantly increase risk . conclusion . people presenting two naevus variants in association with other naevus variants seem to run a major risk . the general nonuniformity of the whole naevus panorama should be carefully considered .
You are an expert at summarizing long articles. Proceed to summarize the following text: primary peritoneal hydatidosis is a rare condition , even in areas where hydatid disease is endemic . although liver and lung are the organs most commonly involved , peritoneal echinococcosis , either primary or secondary , represents an uncommon but significant manifestation of the disease . we report a case of extrahepatic primary peritoneal hydatid in a patient , who presented with a lump in the lower abdomen . surgical excision and postoperative treatment with albendazole were effective in controlling the disease and preventing a recurrence . a 45-year - old female presented with lump in lower abdomen gradually increasing in size since last 6 months , associated with dull aching pain . ultrasonography of abdomen revealed a large hypoechoic mass with echogenic septations in the lower abdomen ( fig.1 ) . contrast - enhanced computed tomography ( cect ) of abdomen and pelvis revealed a huge cyst , 30 25 cm in size ( fig.2 ) in lower abdomen . initial differential diagnosis of ( 1 ) hydatid cyst of peritoneum , ( 2 ) ovarian cyst was made based on findings of usg and ct abdomen pelvis . , there was a large cyst ( 50 25 cm ) arising from pelvic peritoneum ( fig.3a and b ) . histopathological examination showed cyst wall with a laminated membrane and inner germinal layer containing degenerated eosinophilic protoplasmic mass suggestive of hydatid cyst . hydatid disease is a parasitic disease caused by infection with larva of the cestode echinococcus granulosus . the most common site involved is the liver ( 5975% ) , followed by lung ( 27% ) , kidney ( 3% ) , bone ( 14% ) , and brain ( 12% ) . other sites such as the heart , spleen , pancreas , omentum , ovaries , parametrium , pelvis , thyroid , orbit , retroperitoneum , and muscles are very rarely affected 1 . primary peritoneal hydatidosis is rare and has been reported to occur in 2% of all abdominal hydatids 2 . intraperitoneal hydatid cysts are usually secondary to the rupture ( spontaneous or accidental at surgery ) of a primary hepatic , splenic , or mesenteric cyst 1 . a solitary cyst in the pelvic cavity is considered as primary when no other cysts are present . in such a case , the hydatid embryo gains access to the pelvis by hematogenous or lymphatic route 3 . pelvic hydatid cysts usually present as a nonspecific mass with pressure effects on adjacent organs such as the rectum and urinary bladder . rarely , they can cause obstructed labor , obstructive uropathy , and renal failure . sometimes , they can rupture spontaneously 3 . ultrasound is the preferred first - line imaging but cect gives more precise information regarding the morphology ( size , location , state of surrounding structures , and number ) of the cyst . drug treatment with albendazole has been found to be successful in a proportion of cases , but drug therapy is generally not used as the primary treatment except in cases where the patient is not fit for surgery or the cyst size is smaller or deeply located . combination of preoperative albendazole therapy , surgery and postoperative albendazole therapy is a useful regime . the incidence of primary hydatid cyst of peritoneum is 2% . it can present as a palpable abdominal lump . clinically and radiologically it is worth keeping peritoneal hydatid disease as a differential in ultrasonographically diagnosed pelvic cystic lesions .	key clinical messagethe incidence of primary hydatid cyst of peritoneum is 2% . it can present as a palpable abdominal lump . the differential diagnosis is cystic ovarian tumor clinically and radiologically . peritoneal hydatid disease should be included in differential diagnosis of sonographically diagnosed pelvic cystic lesion .
You are an expert at summarizing long articles. Proceed to summarize the following text: serous and mucous cells are the two predominant epithelial cell types of mammalian airway glands . serous cells contain small electron - dense granules , secrete a wide array of antimicrobials , and are believed to be important in the secretion of water ( meyrick and reid 1970 ; basbaum et al . they lack most of the antimicrobials of serous cells ( bowes and corrin 1977 ; bowes et al . 1990 ) ; their role in the production of the aqueous component of gland secretions is uncertain . in 1990 , tournier et al . ( 1990 ) grew cultures of human tracheal glands in petri dishes and showed that they secreted lysozyme and bronchial inhibitor , two proteins specific to serous cells of native glands ; they did not look for mucous cell markers . in the same year , sommerhoff and finkbeiner ( 1990 ) also described cultures of human airway gland cells and showed them to possess both mucous and serous cell antigens . these so - called seromucous cells were later grown on permeable supports where they exhibited a transepithelial resistance ( rte ) of 600 cm , a transepithelial voltage ( vte ) of 10 mv , and a short - circuit current ( isc , an index of active transepithelial ion transport ) of 15 a / cm ( yamaya et al . 1991 ) . primary cultures of cat and pig airway glands have also been produced with baseline iscs of 3 and 4 a / cm , respectively ( culp et al . all the above values are much less than the isc of the surface epithelium of native human airways of 50 a / cm ( knowles et al . 1984 ; yamaya et al . this suspicion was confirmed in those studies in which electron microscopy was performed ; the cells were lower in height than native gland epithelium and contained few of either the large electron - lucent granules typical of mucous cells or the electron - dense granules typical of serous . thus , the adequacy of the initial primary cell cultures as models of either serous or mucous cells is debatable . in 1994 , we described culture conditions that produced cells of more markedly mucous phenotype ( finkbeiner et al . 1994 ) . whereas our earlier seromucous cultures stained both with an antibody specific for native serous cells and an antibody specific for native mucous cells , only the mucous cell antibody stained the new mucous cultures . furthermore , the mucous cultures contained large electron - opaque granules similar to those of native mucous cells . in this paper , we describe a further set of conditions that produces mucous cells , and more importantly , we describe for the first time cell cultures of obviously serous phenotype . human tracheas were obtained , with the consent of the legal next - of - kin , at autopsy . research protocols were approved by the institutional board of the university of california , san francisco . acini were isolated by enzymatic dispersion as described ( sommerhoff and finkbeiner 1990 ) and plated into t25 flasks in df12 plating medium , which was a 1:1 mixture of dulbecco s modified eagle medium and ham s f12 medium supplemented with fetal calf serum ( 20% ) , penicillin ( 100 g / ml ) , streptomycin ( 100 u / ml ) , gentamicin ( 100 g / ml ) , and amphotericin b ( 2.5 g / ml ) . the day after plating , flasks were rinsed with phosphate - buffered saline ( pbs ) , and the culture medium was switched to begm ( lonza ; walkersville , md ) . cells grew out from the attached acini and when approximately 80% confluent were trypsinized and plated at 3 10 cells per square centimeter onto one or other of five different types of inserts : opaque or clear transwells ( # 3401 & # 3460 ; corning inc . , corning , ny ) , millicell ha or cm ( millipore corp , billerica , ma ) , or cyclopore ( falcon # 353180 ; bd biosciences , san jose , ca ) . opaque transwells are made from polycarbonate , transwell - clears and cyclopores from polyethylene terephthalate ( pet ) , millicell ha from mixed cellulose esters , and millicell - cm from hydrophilic polyfluorotetraethylene . for the first 812 h after seeding , the cultures received plating medium . following attachment , the cultures were rinsed with pbs , and basic gland serum - free medium ( gsfm ) was added to the basal side of the insert only . gsfm consisted of 1:1 mixture of dulbecco s modified eagle medium and ham s f12 medium supplemented with insulin ( 5 g / ml ) , transferrin ( 5 g / ml ) , hydrocortisone ( 0.5 g / ml ) triidothyronine ( 20 ng / ml ) , retinoic acid ( 5 10 m ) , bovine serum albumin ( 2 mg / ml ) , and 0.1% ultroser g serum substitute ( pall biosepra , cergy , france ) . gsfm was made up either with or without epidermal growth factor ( 25 ng / ml ) . the sources of our media additives are given elsewhere ( sachs et al . medium was changed every 12 d. transepithelial electrical resistance and voltage ( vte ) were checked every 2 d with a chopstick voltmeter ( millicell - ers ; millipore corp ) . this generally occurred within 3 to 5 d of plating . for histology and immunocytochemistry , paraffin sections of cell culture inserts and fixed human trachea were prepared . inserts were fixed for at least 30 min in buffered formalin ( 10% ) and stored in 0.1 m phosphate buffer ( ph 7.4 ) . standard tissue dehydration and paraffin infiltration was performed in a tissue - tek vip processor ( sakura finetek , torrance , ca ) . sections were cut at 5 m on a rotary microtome and stained with hematoxylin and eosin . for immunohistochemistry endogenous peroxidase activity was quenched by incubating with 3% hydrogen peroxide in methanol for 10 min . serum - free protein block ( dako protein block , reference # x0909 ; dako , glostrup , denmark ) was used for 10 min to reduce background staining . sections were then incubated with rabbit anti - human lactoferrin ( immuno , lot # 3255h ; mp biomedicals , solon , oh ) at 1/3,000 dilution for 30 min at room temperature . finally , the secondary antibody ( poly hrp , reference 87 - 8963 ; zymed laboratories , san francisco , ca ) was added for 10 min . the reaction was revealed with dab ( dako ) , applied for 5 min , and the slides were counterstained with mayers hematoxylin , dehydrated in graded alcohol , cleared in xylene , and mounted . specimens were viewed and photographed on an olympus light microscope ( olympus america , inc . , melville , ny ) equipped with a digital imaging system ( qimaging , burnaby , canada ) . for electron microscopy , inserts with attached cells were washed two times with pbs , fixed ( 60 min , room temperature ) with 2.5% glutaraldehyde in 0.1 m sodium phosphate buffer ( ph 7.2 ) , and post - fixed ( 1 h , 4c ) in 1% osmium tetroxide in 0.1 m sodium phosphate buffer ( ph 7.2 ) . next , cells were stained with 1% uranyl acetate in 0.05 m sodium maleate ( ph 5.2 ) , dehydrated , and infiltrated with polybed 812 ( polysciences , inc . , semi - thin ( 0.5 m ) sections , cut with glass knifes , were stained with toluidine blue for examination with a light microscope . thin sections of specific areas were then cut with a diamond knife , stained with uranyl acetate and lead citrate , and examined with a jeol 100s electron microscope . to estimate concentrations of mucin and lysozyme in mucosal liquid , two days were allowed for this to pass through the tight junctions and equilibrate with the thin film of liquid on the mucosal surface . control experiments in which cells were exposed to c - mannitol for varying periods of time showed that equilibration between basolateral and mucosal medium was more than 95% complete after 12 h. after 2 d , the mucosal liquid was then obtained by rinsing twice with 300 l pbs . as much as possible of the added pbs was carefully removed with an eppendorf pipette , and the two 300-l samples were pooled . the concentration of mucosal liquid in the pooled rinses ( microliter per microliter ) was determined by comparing the counts in the pooled rinses with counts in the basolateral medium . the ratio of mucin or lysozyme concentration to the concentration of mucosal liquid gives the concentrations of these proteins in the mucosal liquid . from 5 to 10 d after achieving rte 100 cm , filters with attached cell sheets were removed from the bottom of the inserts and studied in conventional ussing chambers as described ( yamaya et al . rte was determined from the current deflections in response to brief voltage pulses across the tissue ( yamaya et al . concentrations of lysozyme and mucin in the samples were determined by established elisas ( dubin et al . microtiter plates ( immulux hb , dynex , chantilly , va ) were coated with 100 l / well rabbit anti - human lactoferrin ( mp biomedicals ) at 5 g / ml in coating buffer ( 0.05 m sodium carbonate buffer , ph 9.6 ) overnight at 4c . plates were washed with pbs then blocked with 0.25 ml / well of 0.1% gelatin ( sigma , st . louis , mo ) in pbs for 2 h at room temperature . after washing with pbst ( pbs + 0.05% tween-20 ) , plates were incubated with varying concentrations of standard ( lactoferrin from human milk , calbiochem , san diego , ca ) or unknown samples , diluted in elisa buffer ( 3% normal goat serum in pbst ) for 1 h at room temperature on a plate shaker ( lab - line instruments , melrose park , il ) . following pbst washes , peroxidase - conjugated rabbit anti - human lactoferrin antibody ( mp biomedicals ) diluted 1:20,000 in elisa buffer was added and incubated for 1 h as above . after final washes with pbst , 2,2-azino - bis 3-ethylbenzothiazoline-6-sulfonic acid ( abts ; sigma ) at 1 mg / ml in phosphate citrate buffer , ph 4.6 , with 0.005% h2o2 was added for color development . plates were read at 415 nm on a spectramax m2 microplate reader ( molecular devices , sunnyvale , ca ) . cell protein and dna were determined with bca and bisbenzamide , respectively ( cesarone et al . 1979 ; smith et al . most pharmacological agents were obtained from sigma and added as 1:100 or 1:1,000 dilutions of stocks made up in water , ethanol , or dmso . student s t test was used to test for statistical differences between means , with p < 0.05 being considered significant . even after several weeks in culture , cells grown on millicell - cm filters failed to develop rte > 100 cm as determined with the chopstick voltmeter , and in most cases , rte was below the limit of detection ( 25 cm ) . in contrast , cells grown on all the other filter types attained rtes between 100 and 1,000 cm within 5 d of plating . an initial assessment of phenotype was made from the release of lactoferrin , a specific serous cell marker ( bowes et al . however , such measurements were not made on cells grown on millicell - cm filters because their failure to develop appreciable rte reflected the absence of tight junctions . there would , therefore , be unrestricted exchange of macromolecules between the apical and basolateral media . 1 shows that cells on transwell filters showed considerably lower lactoferrin release than cells grown on other filter types . furthermore , removing egf from the culture medium stimulated lactoferrin release from cells on all filter types . for medium lacking egf , lactoferrin release into the apical medium was not significantly different for cells on transwell - clear , cyclopore , or millicell - ha filters . across culture conditions , lactoferrin levels in cell lysates paralleled releases into the apical medium ( data not shown ) . cells were grown on four types of insert with ( open columns ) or without ( hatched columns ) egf . removal of egf increased spontaneous secretion of lactoferrin , though maximal levels were dependent on type of insert . values are means se for 8 to 34 inserts from 3 to 11 different cultures . cells were grown on four types of insert with ( open columns ) or without ( hatched columns ) egf . removal of egf increased spontaneous secretion of lactoferrin , though maximal levels were dependent on type of insert . values are means se for 8 to 34 inserts from 3 to 11 different cultures . electron microscopy showed that for the various culture conditions there was a rough correlation between the appearance of lactoferrin in the medium and numbers of electron - dense serous granules resembling those of native serous cells . such granules were not seen in any cells grown in medium containing egf , but were present in cells grown in medium lacking egf provided lactoferrin secretion was > 4 ng cm min ( i.e. , in cells grown on transwell - clear , cyclopore , and millicell - ha filters ) . however , electron - dense granules were most consistently seen in cells grown on cyclopore filters ( fig . cells grown on transwell filters in medium with egf produced the least lactoferrin . by electron microscopy , these cells were characterized by the presence of large electron - lucent granules resembling mucous granules of native glands ( fig . mucous granules were not seen under any of the other culture conditions . in our earlier studies ( sommerhoff and finkbeiner 1990 ; yamaya et al . 1991 ) , we used cells grown on millicell - ha inserts in medium supplemented with egf . cells grown under the other culture conditions resembled seromucous cells if grown in medium supplemented with egf or were intermediate between seromucous and serous cells if grown without egf . table 1.cell typescell typeinsertegfgranules ( lucent / opaque)lactoferrin release ( ng cm min)mucoustranswell+++/01seromucousmillicell ha+0/04serouscyclopore0/++43 the concentration of mucin in the mucosal liquid over mucus cells was higher than that over serous cells ( table 2 ) . conversely , the concentration of lysozyme , a specific marker of serous cells ( bowes and corrin 1977 ) , was higher in the mucosal liquid from serous than mucous cells ( table 2 ) . table 2.composition of mucosal liquid serousmucousmucin ( g / ml)185 62474 38lysozyme ( g / ml)34 1112 4means se ; n = 5 composition of mucosal liquid mucous cells had more total protein and dna than serous cells ( table 3 ) . assuming 4 l of water for every milligram of protein ( widdicombe et al . 1981 ) , then the serous and mucous cell sheets should be 10 and 25 m thick , respectively . these values are in reasonable agreement with light microscopic cross - sections ( fig . consistent with the measurements of lactoferrin release shown in fig . 1 , by immunocytochemistry , the serous cells were positive for lactoferrin ( fig 3a ) and the mucous cells negative ( fig . table 3.protein and dna contents of mucous vs. serous cell cultures serousmucousprotein ( g / cm)185 31469 28dna ( g / cm)17 231 1means se ; n = 510 from two tracheasfigure 3.immunocytochemical localization of lactoferrin in serous ( a ) or mucous cells ( b ) . the signal ( brown deposit ) in mucous cells is no greater than in cells that did not receive primary antibody . dna contents of mucous vs. serous cell cultures means se ; n = 510 from two tracheas immunocytochemical localization of lactoferrin in serous ( a ) or mucous cells ( b ) . the signal ( brown deposit ) in mucous cells is no greater than in cells that did not receive primary antibody . scale bar 10 m . in agreement with our previous results ( finkbeiner et al . 1991 ) , seromucous cultures developed rte of 500 cm and vte of 10 a / cm and showed transient increases in isc in response to agents that elevate intracellular ca . the former had rte and isc of 263 21 cm and 15 2 a / cm ( n = 8) , the latter of 368 48 cm and 35 5 a / cm ( n = 6 ) . amiloride ( a blocker of active na absorption ) reduced isc by 5% . in the presence of amiloride , furthermore , most of this cl secretion is probably mediated by the cystic fibrosis transmembrane conductance regulator ( cftr ) , an apical membrane cl channel ( inglis et al . cholinergic stimulation is the most potent physiological inducer of gland secretion ( finkbeiner and widdicombe 1992 ) , and we found that methacholine increased amiloride - insensitive isc across both serous and mucous cultures ( fig . 4 ) , as it does across seromucous ( yamaya et al . added at the end of the experiment , cftrinh-172 , a specific blocker of cftr ( ma et al . 2002 ) , abolished the majority of the isc ( fig . 4 ) . figure 4.short-circuit current records from mucous ( upper trace ) or serous cell cultures ( lower trace ) derived from the same trachea . the gap in the records was for 2 min , during which time atp ( 10 m ) was added . it caused small transient increases in isc 25% as large as the methacholine response . short - circuit current records from mucous ( upper trace ) or serous cell cultures ( lower trace ) derived from the same trachea . upward - pointing arrows methacholine ( 10 m , serosal side ) . the gap in the records was for 2 min , during which time atp ( 10 m ) was added . it caused small transient increases in isc 25% as large as the methacholine response . they decline in numbers and volume with successive generations ( whimster 1986 ) , but it is likely that in the earliest generations , the mucous glands provide most of the mucous blanket that lines the airway lumen . in human trachea and main stem bronchi , for instance , the volume of mucus in the glands has been estimated as 50 times that in the goblet cells of the surface epithelium ( reid 1960 ) . glands also play a key role in determining the volume of the airway surface liquid ( asl ) that lines the airway lumen . thus , there is about one gland per square millimeter of airway surface ( tos 1966 ; choi et al . 2000 ) . with maximal secretory rates of 20 nl per gland per minute ( ueki et al . 1980 ; choi et al . 2007 ) , this means that they can add liquid to the airway lumen at up to 120 l cm h. given that the depth of asl is 10 m in health ( widdicombe and widdicombe 1995 ) , maximal gland secretion will double the depth of asl every 30 s. absorption by the surface epithelium is 5 l cm h ( jiang et al . 1993 ) and therefore has much slower actions on asl depth ( wu et al . they are , for instance , hypertrophied in asthma , bronchitis , emphysema , and cystic fibrosis , all diseases that are associated with excess airway mucous secretions ( finkbeiner 1999 ) . in cystic fibrosis , glands fail to secrete in response to elevation of intracellular camp ( joo et al . 2007 ) , and it has been suggested that this may lead to a deficiency in gland - derived antimicrobials in asl , thereby promoting the bacterial colonization characteristic of this disease ( choi et al . however , though highly differentiated cultures of surface epithelia from human airways have been available for at least 20 yr ( yankaskas et al . 1985 ; wu et al . 1990 ; yamaya et al . 1992 ) , it has proven harder to obtain cultures of airway gland epithelium that show high levels of differentiation . though we have earlier reported a technique for obtaining cultures of mucous phenotype ( finkbeiner et al . 1994 ) , most gland cultures are dedifferentiated and bear little resemblance to either the mucous or serous cells of native epithelium ( sommerhoff and finkbeiner 1990 ; tournier et al . 1990 ; yamaya et al . 1991 ; culp et al . 1992 ; chan et al . our mucous cultures contain electron - lucent granules typical of mucous cells in general ; they have no electron - dense granules . they release relatively low levels of lactoferrin and have relatively low levels of lysozyme in their mucosal liquid ; lactoferrin and lysozyme localize exclusively to serous cells of native epithelium ( bowes and corrin 1977 ; bowes et al . 1981 ) . they release 40 times as much lactoferrin as the mucous cultures and have high levels of lysozyme , but low levels of mucus , in their mucosal medium . epithelia act as barriers , and the formation of tight junctions between the cells is key to this function . the development of tight junctions is associated with the attainment of a transepithelial resistance ( rte ) that can vary anywhere from 5 to 5,000 cm depending on the epithelium ( fromter and diamond 1972 ) . when tight junctions are opened , by say removal of extracellular ca , rte drops to essentially zero ( cereijido et al . thus , the rtes of 263 21 cm for serous cells and 368 48 cm for mucous cells show that tight junctions have formed and indicate that these epithelia are of intermediate tightness . resistances of airway surface epithelia are generally in the range of 100 to 1,000 cm ( finkbeiner and widdicombe 1992 ) . a second major function of epithelia is the vectorial transport of ions , which in leaky epithelia drives transepithelial osmotic water flows ( diamond 1979 ) . in secretory epithelia of mammals , this , and other electrogenic ion transport processes operating across the epithelium , can be measured in ussing chambers as short - circuit current ( isc ; ussing and zerahn 1951 ) . thus , isc is a rough index of differentiation of cell cultures ; as differentiation and cell height of cultures increases , so too do both the total extent of cell membrane and the isc . for instance , our first cultures of human tracheal epithelium were squamous , about 2 m in cell height and had iscs of 3 a / cm ( widdicombe et al . 1985 ) . when we obtained cultures of full mucociliary differentiation , of 50-m height , they displayed iscs of 50 a / cm , the same as native epithelium ( yamaya et al . 1984 ; kondo et al . 1991 ) and bovine tracheal epithelium ( kondo et al . 1993 ) . the values reported here of 15 a / cm for serous cultures and 35 a / cm for mucous are therefore quite respectable and indicative of high levels of differentiation . we suspect that the higher value in mucous than serous cells reflects the higher protein content ( and therefore cell height ) of the former . amiloride , the inhibitor of active na absorption , had little effect on isc , suggesting that secretion of cl was the predominant active transepithelial ion transport process , a conclusion supported by the inhibitory action of cftrinh-172 , a blocker of cftr , the major cl channel in the apical membrane of mammalian epithelia ( fuller and benos 1992 ) . we had earlier obtained mucous cultures by growth on calfskin collagen gels fixed with glutaraldehyde ( finkbeiner et al . the cells had mucous granules , but their isc was only 2.5 a / cm . thus , the mucous cultures described here are grown on simpler supports and are much better differentiated in terms of their isc . in conclusion , we here describe a set of simple techniques needed to produce cultures of human tracheal glands of either mucous or serous phenotype . these cultures resemble native serous or mucous cells in their ultrastructure , secretory processes , and immunocytochemistry . they generate appreciable values of rte demonstrating that they possess tight junctions and form effective barriers to ion permeation . finally , ussing chamber data indicate that as expected for gland cells they possess high levels of active transepithelial cl secretion . these cells should prove useful in studies of airway gland function in health and disease .	there are two main epithelial cell types in the secretory tubules of mammalian glands : serous and mucous . the former is believed to secrete predominantly water and antimicrobials , the latter mucins . primary cultures of human airway gland epithelium have been available for almost 20 yr , but they are poorly differentiated and lack clear features of either serous or mucous cells . in this study , by varying growth supports and media , we have produced cultures from human airway glands that in terms of their ultrastructure and secretory products resemble either mucous or serous cells . of four types of porous - bottomed insert tested , polycarbonate filters ( transwells ) most strongly promoted the mucous phenotype . coupled with the addition of epidermal growth factor ( egf ) , this growth support produced mucous cells that contained the large electron - lucent granules characteristic of native mucous cells , but lacked the small electron - dense granules characteristic of serous cells . furthermore , they showed high levels of mucin secretion and low levels of release of lactoferrin and lysozyme ( markers of native serous cells ) . by contrast , growth on polyethylene terephthalate filters ( cyclopore ) in medium lacking egf produced serous cells in which small electron - dense granules replaced the electron - lucent ones , and the cells had high levels of lactoferrin and lysozyme but low levels of mucins . measurements of transepithelial resistance and short - circuit current showed that both serous and mucous cell cultures possessed tight junctions , had become polarized , and were actively secreting cl .
You are an expert at summarizing long articles. Proceed to summarize the following text: biofilms ( organic contamination ) are routinely found in dental treatment water delivery systems.18 they can be observed colonizing within dental unit waterlines in as little as two weeks.9 when viewed through a scanning electron microscope ( sem ) , biofilms are characterized by microorganisms embedded in an extracellular matrix with thickness ranging from 30 to 50 microns that may allow chunks of material / biofilm to dislodge , thereby contaminating other areas of the dental treatment water system.10 inorganic deposits ( minerals ) derived from dissolved salts in municipal water also contaminate the lines.11 these inorganic deposits are found interspersed with biofilms and are difficult to remove with most periodic cleaners / disinfectants.11,12 colonization and proliferation of many and varied species of microorganisms has been well documented in dental unit water systems.1320 apart from bacteria , amoebae species have also been observed.21 some of these microorganisms found in this environment have also been associated with hospital infections , and some in particular are of concern for the dental office.2230 in one case , mycobacterium xenopi was implicated in 19 cases of pulmonary disease in a hospital with transmission occurring through infected aerosols when patients used a shower.29 water spray related aerosols generated by high - speed handpieces ; ultrasonic / piezo electric scalers and air / water syringes are common place in the dental environment contaminating the immediate surroundings of patients seated in the chair.31,32 these sprays and aerosols generated in the dental office could be a potential route for the transmission of microbes.18,32,33 atlas et al33 found legionella in treatment water from dental units , water faucets and drinking water fountains . aerosols generated by the dental handpieces were the source of sub - clinical infection with legionella pneumophila in a dental school environment.18 fotos et al34 investigated exposure of students and employees at a dental clinic and found that , of the 270 sera tested , 20% had significantly higher igg antibody activity to the pooled legionella sp . antigen as compared with known negative controls . in a similar sero - epidemiological study reinthaler these two cornerstone sero - epidemiological studies34,35 on legionella a known pathogen , are of significant concern to both dental care providers ( occupational exposure ) , as well as iatrogenic disease risk to patients . other than microbes , very high doses of bacterial endotoxins ( > 100 eu / ml ) were measured in dental unit water , with even municipal water containing more that 25 eu / ml.36 exposure of the patient to certain microbes associated with respiratory , enteric diseases or even conjunctivitis may be very plausible if the water quality is poor.37 the types of organisms may range from amoebae , legionella to e. coli21 seen in dental units connected to municipal water , or when connected to self - contained reservoirs , which may be contaminated by the dental staff not following proper hand washing or aseptic procedures such as wearing gloves while handling self - contained reservoirs.37 considering the presence of these contaminants , control methods for cleaning and disinfecting the dental water system and providing quality irrigant / dental treatment water is warranted . to avoid water from passively dripping from the handpieces , air / water syringes , ultrasonic or piezo electric scalers , this mechanism can actively suck - back contaminants from the oral cavity with the introduction of oral contaminants including microbes into the dental unit waterlines and the dental unit water system . today , many dental water systems ( with retraction mechanisms ) are equipped with anti - retraction values to prevent suck - back of contaminants from the oral cavity and/or are designed to give a short terminal flush of water to push out any suck - back.38 in the in vitro experimental studies , even new and unused antiretraction valves were shown to be quite unreliable , leading to microbial suck - back into the waterline system from the patient end.39,40 factors associated with biofilm formation in dental unit water systems could be-- long periods of stagnation , high surface to volume ratio , nutrient content of water for the microbial survival , mineral content and hardness of water facilitating coating of the lumen , fluid mechanics such as laminar flow , low flow rate , microbial quality ( bacteria , fungi , protozoans and nematodes ) of the water entering the system , and failure of anti - retraction valves leading to contamination from the oral cavity of patients.37,39,40 flushing dental unit waterlines ( duwls ) with water at the beginning and end of patient treatment session have been previously advocated.41,42 this flushing protocol , as recommended earlier by the u.s . department of health and human services , 43,44 may diminish planktonic organisms for a short period of time but will not eliminate contamination or control biofilms . one study concluded that a two minute flushing reduced the counts of planktonic organisms , on average by one - third , but did not reduce counts to zero.6 while it may provide transient reduction in planktonic microbes , purely flushing the water for a few minutes prior to treatment is not effective in biofilm control.21,45 investigators have tested methods such as inline micro filter devices,7,8 flushing water lines with various disinfectant solutions which include hydrogen peroxide based chemicals,46,47 chlorhexidine gluconate,48,49 sodium hypochlorite,5052 povidone - iodine,20 iodine,53 mouthwash,54 silver and silver compounds.55,56 some of these periodic cleaning / disinfection methods , although effective in controlling planktonic organisms and possibly biofilms , do not eliminate existing biofilms or biofilm formation due to the inherent contamination of source water when municipal water or only low grade antimicrobials in the irrigant is used . therefore in addition to initial & periodic cleaning / disinfection of the water systems , purification of water or providing an irrigant of acceptable microbial quality is necessary . using untreated tap / municipal source water for dental treatment is not reliable with respect to microbial quality , as studies have repeatedly demonstrated planktonic counts ranging from zero to at least a few hundred colony forming units , exceeding the contamination levels set per current cdc s recommendations for dental treatment water quality of 500 colony forming units / milliliter ( cfu / ml ) in the united states of america.7,8,11,36,47,49,52,53,57,58 silver compounds and ionic silver have been used as antimicrobials in health care and particularly in dressing materials for burn care and wound care and have little or no side - effects but good antimicrobial properties.5961 silver citrate has been incorporated into the material composition of indwelling urinary catheters and has shown merits with respect to microbial and biofilm control.62,63 silver ion technology ( silver citrate ) in municipal water as a continuously present antimicrobial is also being used to treat the municipal water for irrigation purposes . while use of sodium hypochlorite ( naocl ) in higher concentrations is effective in biofilm control,7,8,11,19 and in low concentrations in improving microbiological quality of dental treatment water , it is very corrosive and damaging to the dental unit water system.51,52 high amounts of trihalomethanes ( carcinogens ) are produced when in contact with organic matter such as biofilms.64 constantly present low levels of naocl in the presence of organic matter can also increase the total trihalomethane levels beyond levels set by the u.s . the use of naocl for the specified purpose of cleaning duwls has not been approved by the u.s . purely using any low level antimicrobial without initial and periodic cleaning of lines may expose patients and employees to endotoxins.36 the objectives of this study were to determine the effects of various concentrations of hydrogen peroxide on mature waterline biofilms and in controlling planktonic ( free - floating ) organisms in simulated dental treatment water systems ; an additional objective was to study in vitro the effects of 2% , 3% , and 7% hydrogen peroxide on the removal of mature biofilms and inorganic compounds in dental waterlines . naturally occurring biofilms of heterotrophic mesophilic microorganisms that had accumulated on dental lines utilized in dental suites were harvested and used in this study . no specific microbes were introduced into the lines . an automated , dental unit water system simulation device ( figure 1a c . ) the simulation device was retrofitted with four dental unit waterlines ( over 10 years old ) to simulate water systems of four operating dental suites . the waterlines had mature biofilms and heterotrophic contamination of more than 400,000 cfu / ml . planktonic contamination was studied using heterotrophic plate counts and biofilm presence was confirmed using laser scanning confocal microscopy ( lscm ) as well as scanning electron microscopy ( sem ) . effluent water was neutralized with sodium thiosulphate prior to heterotrophic plate count ( hpc ) in triplicate , to study contamination by planktonic microorganisms using r2a agar plates . r2a agar growth medium is a low nutrient agar , which , in combination with a low incubation temperature and an extended incubation time , is suitable for the recovery of stressed and chlorine - tolerant bacteria from drinking water.65,66 the automated dental unit water simulation system prototype was initially designed , tested and used by dr . mills at the dental investigations service , brooks afb , san antonio , tx in 1995.7,8 the automated dental unit water system simulator for in vitro use , used in this study was designed by dr . the simulation device uses 8 dental unit water line systems built to scale which function as a dental unit water system . each dental unit has 4 handpiece lines and 1 air / water syringe line attached to a control block . the source water ( inlet water ) can be derived from the municipality or a self - contained reservoir ( to introduce different irrigants ) . all 8 units can be independently controlled ( independent unique functions ) or may be collectively controlled using an allen - bradley logic controller ( allen - bradley & rockwell automation , milwaukee , wi , usa ) that turns the units on and off based on the algorithm provided to simulate water usage ( period of flow ) while manual valves control the flow volume . the algorithms have been programmed into the rslogix ( allen - bradley & rockwell automation , milwaukee , wi , usa ) automation software using a personal computer , which in turn controls the logic controller based on programmed algorithms . the algorithms used in this study simulated typical dental clinic use of about 600 650 ml per day , with an intermittent flow ( hourly cumulative time of 12-minute random flow ) , 6 hour work day of 4 days per week . waterlines from operating dental units ( 10 years or older ) were harvested and attached to the automated dental unit water system simulator . the simulator used municipal water as irrigant for 1 month to maintain viable biofilms and heterotrophic contamination . municipal water ph was 7.0 7.5 and the total dissolved solids 180 ppm to 250 ppm . line samples were removed from each unit to evaluate the biofilm at baseline using lscm ( figure 2 ) . heterotrophic plate count ( hpc ) of planktonic or free - floating microbes in effluent treatment water samples were collected from each unit to measure contamination levels . hpc of effluent water showed a maximum contamination of > 400,000 cfu / ml from the collected water in each dental unit . to study effects of hydrogen peroxide ( h2o2 ) on mature waterline biofilms and in controlling planktonic organisms in dental treatment water , four units in the simulated dental water system unit 1 ( treatment 1 ) used 1% h2o2 for 4 initial cleanings each 5 minutes in contact within the lumen followed by weekly cleaning . unit 2 ( treatment 2 ) used 2% h2o2 for 4 initial cleanings each 5 minutes in contact within the lumen followed by weekly cleaning . unit 3 ( treatment 3 ) used 3% h2o2 for 4 initial cleanings each 5 minutes in contact within the lumen followed by weekly cleaning . unit 4 ( control ) was initially cleaned using 60 ppm of active chlorine dioxide ( clo2 ) 4 times for 5 minutes contact and used municipal water as an irrigant for simulated dental care . the lines hold approximately 20 ml water ; therefore , 10 ml water was collected before use in the morning after the unit remained stagnant overnight . these were pooled samples ( 4 handpiece and 1 air / water syringe lines from each simulation unit ) of about 2 ml each . all the external line surfaces near the effluent area ( 6 inches ) of the tubing were cleaned with an alcohol swab twice before collection to control external contamination . the collected water was neutralized with sodium thiosulphate by mixing 0.1 ml water sample in 0.9 ml sodium thiosulphate ( 10 mg in 125 ml sterile water , millipore whirl - pak bag with thiosulphate ) and held for 30 seconds . a 1.0 ml aliquot of the neutralized sample was plated on r2a agar , incubated at room temperature ( 22c ) for 7 days and the colonies counted . mean heterotrophic cfus / ml were converted into log10 values ( cfus / ml ) for normalization of data and compared using oneway analysis of variance and scheffe s post - hoc test at alpha 0.05 . lscm of biofilms and other deposits in the lumen of lines were studied on the lumenal surfaces from lines , with 1 cm from each unit harvested at baseline ( post initial cleaning ) and at 60 days . the outer surface of the waterline to be harvested was wiped with an alcohol swab on the outside and handled aseptically . a 1 cm section of line from each unit was removed , slit axially and immediately dyed using the molecular probes , invitrogen corporation , carlsbad , california , usa . live / dead baclight assay ( the baclight green ( b-35000 ) and baclight red ( b-35001 ) bacterial stains are fluorescent labeling reagents for detecting and monitoring bacteria . bacteria stained with the baclight green and baclight red bacterial stains exhibit bright green and red fluorescence ( absorption / emission 480/516 and 581/644 nm , respectively . the live / dead baclight bacterial viability kits employ two nucleic acid stains the green - fluorescent syto 9 stain and the red - fluorescent propidium iodide stain . in contrast , propidium iodide penetrates only bacteria with damaged membranes , reducing syto 9 fluorescence when both dyes are present . thus , live bacteria with intact membranes fluoresce green , while dead bacteria with damaged membranes fluoresce red ) . while being observed using laser scanning confocal microscopy , the sample holding mount / immersion slide was wiped with an alcohol swab and sterile water was used for immersion . the complete lumenal surface was scrutinized and the worst case scenario recorded / imaged to identify any residual biofilm or other deposits . although topographic images and channel graphs including quantitative outputs were generated , no quantitative tests or three - dimensional analysis were performed on the output as we did not standardize the view , field or aperture for the images as needed for quantification.67 only live / dead ( green / red ) images were used for qualitative presence or absence of viable biofilm / cells . after lscm the same samples were desiccated , coated with gold palladium for sem and the worst case scenario ( maximum contamination in sample ) viewed and recorded / imaged at 1600x . sem was conducted to see if there were biofilms but mostly for studying inorganic matter such as salt deposits from hardness in municipal water previously used in the lines when they were in use in clinical dental units . to study the effects of 2% , 3% and 7% h2o2 on mature biofilms and inorganic compounds in dental waterlines , three 250 ml monojet syringes were attached to lines ( 30 cm long ) with about 1014 year old biofilms . treatment group 1 used 2% h2o2 , treatment group 2 used 3% h2o2 , and treatment group 2 used 7% h2o2 to challenge biofilms and inorganic matter in lines . for each group , a fresh 10 ml of h2o2 of their respective concentration was loaded at 0 , 5 , 10 , 20 , 30 , 60 , 180 , 360 and 1440 minutes . a line sample ( 1 cm length ) at each time interval was gently harvested from each group ( distal end away from the syringe ) for lscm ( procedures for processing line samples were similar to those in task 1 ) and sem to study removal of both inorganic and deposits . the luminal surface was scrutinized to identify the worst case scenario for both biofilm and inorganic deposits and imaged . a representative sample was not taken or considered as we wanted to identify any residue . outcomes were classified on a 5 level ordinal scale for biofilm / deposit presence with 1=presence of mature biofilm matrix ; 2=biofilm present & no mature matrix ; 3=scattered microbes & no biofilm ; 4=no microbes & no biofilms ; 5=inorganic deposits with no biofilm or microbes . waterlines from operating dental units ( 10 years or older ) were harvested and attached to the automated dental unit water system simulator . the simulator used municipal water as irrigant for 1 month to maintain viable biofilms and heterotrophic contamination . municipal water ph was 7.0 7.5 and the total dissolved solids 180 ppm to 250 ppm . line samples were removed from each unit to evaluate the biofilm at baseline using lscm ( figure 2 ) . heterotrophic plate count ( hpc ) of planktonic or free - floating microbes in effluent treatment water samples were collected from each unit to measure contamination levels . hpc of effluent water showed a maximum contamination of > 400,000 cfu / ml from the collected water in each dental unit . to study effects of hydrogen peroxide ( h2o2 ) on mature waterline biofilms and in controlling planktonic organisms in dental treatment water , four units in the simulated dental water system unit 1 ( treatment 1 ) used 1% h2o2 for 4 initial cleanings each 5 minutes in contact within the lumen followed by weekly cleaning . unit 2 ( treatment 2 ) used 2% h2o2 for 4 initial cleanings each 5 minutes in contact within the lumen followed by weekly cleaning . unit 3 ( treatment 3 ) used 3% h2o2 for 4 initial cleanings each 5 minutes in contact within the lumen followed by weekly cleaning . unit 4 ( control ) was initially cleaned using 60 ppm of active chlorine dioxide ( clo2 ) 4 times for 5 minutes contact and used municipal water as an irrigant for simulated dental care . the lines hold approximately 20 ml water ; therefore , 10 ml water was collected before use in the morning after the unit remained stagnant overnight . these were pooled samples ( 4 handpiece and 1 air / water syringe lines from each simulation unit ) of about 2 ml each . all the external line surfaces near the effluent area ( 6 inches ) of the tubing were cleaned with an alcohol swab twice before collection to control external contamination . the collected water was neutralized with sodium thiosulphate by mixing 0.1 ml water sample in 0.9 ml sodium thiosulphate ( 10 mg in 125 ml sterile water , millipore whirl - pak bag with thiosulphate ) and held for 30 seconds . a 1.0 ml aliquot of the neutralized sample was plated on r2a agar , incubated at room temperature ( 22c ) for 7 days and the colonies counted . mean heterotrophic cfus / ml were converted into log10 values ( cfus / ml ) for normalization of data and compared using oneway analysis of variance and scheffe s post - hoc test at alpha 0.05 . lscm of biofilms and other deposits in the lumen of lines were studied on the lumenal surfaces from lines , with 1 cm from each unit harvested at baseline ( post initial cleaning ) and at 60 days . the outer surface of the waterline to be harvested was wiped with an alcohol swab on the outside and handled aseptically . a 1 cm section of line from each unit was removed , slit axially and immediately dyed using the molecular probes , invitrogen corporation , carlsbad , california , usa . live / dead baclight assay ( the baclight green ( b-35000 ) and baclight red ( b-35001 ) bacterial stains are fluorescent labeling reagents for detecting and monitoring bacteria . bacteria stained with the baclight green and baclight red bacterial stains exhibit bright green and red fluorescence ( absorption / emission 480/516 and 581/644 nm , respectively . the live / dead baclight bacterial viability kits employ two nucleic acid stains the green - fluorescent syto 9 stain and the red - fluorescent propidium iodide stain . in contrast , propidium iodide penetrates only bacteria with damaged membranes , reducing syto 9 fluorescence when both dyes are present . thus , live bacteria with intact membranes fluoresce green , while dead bacteria with damaged membranes fluoresce red ) . while being observed using laser scanning confocal microscopy , the sample holding mount / immersion slide was wiped with an alcohol swab and sterile water was used for immersion . no neutralization of the biofilm samples was conducted . following staining , the complete lumenal surface was scrutinized and the worst case scenario recorded / imaged to identify any residual biofilm or other deposits . although topographic images and channel graphs including quantitative outputs were generated , no quantitative tests or three - dimensional analysis were performed on the output as we did not standardize the view , field or aperture for the images as needed for quantification.67 only live / dead ( green / red ) images were used for qualitative presence or absence of viable biofilm / cells . after lscm the same samples were desiccated , coated with gold palladium for sem and the worst case scenario ( maximum contamination in sample ) viewed and recorded / imaged at 1600x . sem was conducted to see if there were biofilms but mostly for studying inorganic matter such as salt deposits from hardness in municipal water previously used in the lines when they were in use in clinical dental units . to study the effects of 2% , 3% and 7% h2o2 on mature biofilms and inorganic compounds in dental waterlines , three 250 ml monojet syringes were attached to lines ( 30 cm long ) with about 1014 year old biofilms . treatment group 1 used 2% h2o2 , treatment group 2 used 3% h2o2 , and treatment group 2 used 7% h2o2 to challenge biofilms and inorganic matter in lines . for each group , a fresh 10 ml of h2o2 of their respective concentration was loaded at 0 , 5 , 10 , 20 , 30 , 60 , 180 , 360 and 1440 minutes . a line sample ( 1 cm length ) at each time interval was gently harvested from each group ( distal end away from the syringe ) for lscm ( procedures for processing line samples were similar to those in task 1 ) and sem to study removal of both inorganic and deposits . the luminal surface was scrutinized to identify the worst case scenario for both biofilm and inorganic deposits and imaged . a representative sample was not taken or considered as we wanted to identify any residue . outcomes were classified on a 5 level ordinal scale for biofilm / deposit presence with 1=presence of mature biofilm matrix ; 2=biofilm present & no mature matrix ; 3=scattered microbes & no biofilm ; 4=no microbes & no biofilms ; 5=inorganic deposits with no biofilm or microbes . figure 3 shows the graph of longitudinal observation of the contamination levels ( hpc ) of the effluent water from the control and the treatment units and were computed as cfus / ml . after initial cleaning of all the units ( treatment and control units ) , all effluent counts started below the 500 cfu / ml maximum contamination level of treatment water set by the cdc . the control unit showed unacceptable levels from week 1 onwards reaching a maximum contamination level of 400,000 cfu / ml by the end of the 12 week study . treatment unit 1 showed a maximum contamination in week 2 and thereafter remained below 500 cfu / ml . treatment units 2 & 3 remained below 500 cfu / ml limit throughout the 12 week study . a summary of descriptive statistics ( table 1 ) addresses the mean contamination levels ( both absolute values and log10 values of the cfus / ml ) . one way analysis of variance ( =0.05 ) and scheffe s post hoc tests were used to study any difference between the log10 values of the effluent heterotrophic plate counts of the four units . test for homogeneity of variance showed a significant difference between the contamination levels among the groups ( p<.05 ) . scheffe s post hoc test for multiple comparisons determined that there was no significant difference between any of the treatment groups ( p>.05 ) , while all treatment groups showed significantly lower contamination levels than the control group ( p<.05 ) . lscm and sem of the waterline surfaces to study the effects of periodic cleaning with h2o2 and the use of dilute h2o2 as irrigant in differing concentrations conducted in task 1 are described as a template ( figure 4 ) . at baseline , the control unit had a minimal amount of salt deposits and biofilms while the treatment unit 1 had a clean line surface with no visible salt or biofilm deposits in the field of view treatment units 2 and 3 showed very little biofilm deposits but a significant amount of salt deposits at baseline . at the end of the study , treatment units 2 and 3 showed cleaner line surfaces with respect to salt deposits but still showed residual biofilm . all z - view samples ( control & treatment groups ) showed residual biofilm deposits ranging from traces to a large mass . in this 12 week study , only the 3% and 2% h2o2 showed better salt removal than the 1% h2o2 . the in vitro test ( task 2 ) to study the effects of 2 , 3 and 7% h2o2 on biofilm removal were a 24 hour longitudinal challenge study . 2% h2o2 periodic cleaner / disinfectant had a minimal noticeable disruption of the mature biofilm with some removal of inorganic deposits . although minimal , there still remained some residual biofilm on the line surface in both the 3% and 7% h2o2 treatments ( figure 5 ) . contamination of dental unit water systems and possibility of risks to patients have been addressed for over 50 years.15,16 although the american dental association ( ada ) set goals of < 200 cfu / ml of heterotrophic counts for dental treatment water contamination levels , only in the recent past , the ada and the centers for disease control & prevention concluded that the maximum contamination of dental treatment water should be < 500 cfu / ml and that biofilms in dental unit water systems should be controlled.44,68,69 these guidelines are based on microbial characteristics , patient susceptibility , lack of and difficulties associated with epidemiological surveillance ( morbidity and mortality ) other than sero - epidemiological studies demonstrating health risks for both patients and employees.4,5,14,18,21,3136,68,69 hydrogen peroxide in different formulations ( alkaline peroxide as well as silver added to 6% h2o2 respectively ) has been studied with respect to biofilm control in dental unit water systems.56,70,71 in this study we used over the counter hydrogen peroxide that was readily available in pharmacies , for both periodic cleaning as well as a low grade irrigant after dilution in municipal water , and hydrogen peroxide that was marketed as a high - level disinfectant ( sporox , sultan chemicals , ny ) as periodic flush only . the main thrust of this study was to determine in vitro ( but as close as possible to use in dental equipment ) the best concentration of h2o2 for periodic cleaning of already existing deposits ( both inorganic and biofilms ) in dental unit water systems . in addition we wanted to determine a much lower and safer concentration of h2o2 in municipal water as irrigant / coolant for use in dental treatment . after determining periodic cleaning and the irrigant concentrations , the prototype fuel - cell technology based h2o2 electrochemical generator could be calibrated to produce the concentrations on a turn - key basis . the prototype fuel cell based h2o2 generator that was developed and calibrated has demonstrated the capability to produce up to 3.3% h2o2 for greater than 4000 hours of use ( based on testing of the prototype at lynntech inc . other than the biofilm challenge tests and control of microbial contamination of the dental water system , effects of h2o2 on metal and non - metal components of the water system , elemental metal analysis using standardized metal coupons , and effects on composite bonding to enamel and dentin were also studied and will be published in series or in other suitable journals . these types of tests need to be performed not only for efficacy testing of germicides in microbial control , but also to determine deleterious effects if any , on dental unit water systems as well as patient safety . the information generated could be used by regulatory agencies such as the united states environmental protection agency ( us - epa ) for disinfectant / device registration , and the united states food and drug administration ( us - fda ) in providing marketing clearance of the physical device as well as the electrochemically produced germicide for efficacy as well as for patient safety respectively . h2o2 and clo2 were chosen as germicides of choice in this study due to safe history in mouthwash and as a solution to decontaminate items used in patient care . they are relatively less harmful than sodium hypochlorite and do not produce disinfection - by - products such as trihalomethanes in the presence of organic matter.12,36,47,49,53,64 in this study , lines with naturally grown biofilms attached to an automated in vitro system were used to study effects of the germicide ( h2o2 ) . naturally grown biofilms interspersed with salts from hard water can not be standardized and are hardier than rapidly grown biofilms without salt deposits developed in a laboratory.72 natural biofilms in dental waterlines as observed in this study was found interspersed with salt deposits . one of the issues was that the salts may have had a neutralizing / buffering effect on inorganic chemicals ( h2o2 ) used as a biofilm control agent as observed in this study . we proposed that contamination control in dental unit water systems should be a combination approach , addressing biofilm removal / control as well as the control of planktonic microbes that contribute to contamination of dental irrigant / coolant . this combination approach will be helpful in meeting the cdc guidelines of < 500 cfu / ml in dental treatment water from dental units and ultrasonic units for general dental treatment on a consistent basis . this approach of multiple baseline decontamination followed by scheduled periodic treatment of the system to control biofilms and inorganic components demonstrated control of planktonic microbes in dental treatment water ( table 1 , figure 3 ) as within 3 weeks all treatment groups showed mean counts of < 10 cfu / ml . the control group that was initially cleaned but used municipal water had contamination levels exceeding the 500 cfu / ml mark by the second week and reached > 400,000 cfu / ml by week 12 . in contrast , biofilm eradication within 12 weeks was not accomplished ( figure 4 ) . when concentrations as high as 3% were used for initial and periodic cleaning , the representative scans showed no biofilm or salt deposits by the end of study , however , on further scrutiny of the complete line surface , we found occasional clumps of residual biofilm . biofilm disruption and control was seen in all treatment units with varying degrees . in the in vitro biofilm challenge test ( figure 5 ) , 7% h2o2 ( very high concentration ) did not eradicate biofilms in the waterline , even when in contact with the line surface for 24 hours , demonstrating the tenacity of naturally occurring deposits ( inorganic salts and biofilms ) in dental waterlines . 7% h2o2 however should not be used for cleaning lines as it is very corrosive on dental unit water system components ( even 1% h2o2 showed some corrosion over time ) . one possible explanation for not being able to eradicate biofilms could be buffering effects of the salts lining the surface of the waterlines on the h2o2 being introduced and weaken its effects on biofilms . biofilm eradication was difficult and even the control of biofilms could take a long time in older dental units that have never been cleaned before . multiple initial cleanings followed by weekly cleanings with h2o2 as low as 1% and use of resulting 0.05% h2o2 in municipal water regularly as an irrigant controlled biofilms and planktonic contamination of the dental waterlines and treatment water respectively . after reviewing outcomes of various concentrations of h2o2 on dental unit water system components , standardized metal coupons , composite bonding to enamel and dentin ( completed in the broader study12 that will be published separately ) , we determined that 2% h2o2 when used as a periodic cleaner ( < 5 minute contact with lines ) , and 0.05% mixture in municipal water for irrigation purposes was effective in controlling biofilms and planktonic contamination . based on the findings in this study , we conclude that 2% h2o2 used as a periodic cleaner , and diluted to 0.05% in municipal water for irrigation , was beneficial in controlling biofilm and planktonic contamination in dental unit water systems and met the cdc s guidelines of < 500 cfu / ml of heterotrophic microorganisms in dental treatment water . however , to remove well established biofilms , it may take more than 2 months when multiple initial cleanings and repeated weekly cleaning with 2% h2o2 are conducted .	objectives : to study effects of various concentrations of hydrogen peroxide on mature waterline biofilms and in controlling planktonic ( free - floating ) organisms in simulated dental treatment water systems ; and to study in vitro the effects of 2% , 3% , and 7% hydrogen peroxide on the removal of mature biofilms and inorganic compounds in dental waterlines.methods:four units of an automated dental unit water system simulation device was used for 12 weeks . all units were initially cleaned to control biofilms and inorganic deposits . h2o2 at concentrations of 1% , 2% , 3% was used weekly for periodic cleaning in three treatment group units ( units 1 , 2 & 3 ) , with 0.05% , 0.15% and 0.25% h2o2 in municipal water used as irrigant respectively . the control unit ( unit 4 ) did not have weekly cleanings and used municipal water as irrigant . laser scanning confocal microscopy and scanning electron microscopy were used to study deposits on lines , and weekly heterotrophic plate counts done to study effluent water contamination . a 24 hour in vitro challenge test with 7% , 3% and 2% h2o2 on mature biofilms was conducted using harvested waterlines to study biofilm and inorganic deposit removal.results:heterotrophic plate counts of effluent water showed that the control unit reached contamination levels in excess of 400,000 cfu / ml while all treatment units showed contamination levels < 500 cfu / ml through most of the 12 weeks . all treatment units showed varying levels of biofilm and inorganic deposit control in this short 12 week study . the in vitro challenge test showed although there was biofilm control , there was no eradication even when 7% h2o2 was used for 24 hours.conclusions:2% h2o2 used as a periodic cleaner , and diluted to 0.05% in municipal water for irrigation was beneficial in controlling biofilm and planktonic contamination in dental unit water systems . however , to remove well established biofilms , it may take more than 2 months when initial and multiple periodic cleanings are performed using h2o2 .
You are an expert at summarizing long articles. Proceed to summarize the following text: although ultrasound guidance has rendered regional anesthesia safe and predictable , often its cost is considered a big bane by the hospital administration . hence , we conceptualized this study with the aim to compare the cost of ultrasound - guided brachial plexus blocks for upper extremity surgeries with the cost of general anesthesia ( ga ) for the same procedure . we hypothesized that the ultrasound - guided blocks would be more cost - effective than ga . we included patients who underwent upper extremity surgeries in our institute solely under ultrasound - guided brachial plexus blocks during the period from august 2012-august 2013 . the demographics of these ninety patients and their american society of anaesthesiologists grading were recorded . the type of surgeries and the approach to brachial plexus blocks were noted . the brachial plexus blocks were performed using ultrasound machine ( sonosite micromax ; sonosite inc . , bothell , wa , usa ) in awake patients . the procedure was explained to them in details and the block was conducted under strict aseptic precautions . eighty - nine patients were sedated with dexmedetomidine 0.5 g / kg / h and one patient received midazolam 0.05 mg / kg and fentanyl 1 g / kg . we noted the duration of each surgery . we estimated the cost of ga per hour in our institute [ table 1 ] . the cost of sevoflurane nitrous oxide , and ventilator ( anesthesia machine ) were added upon hourly basis . cost of general anesthesia for an hour ( in our institute ) we also calculated the cost required for usg - guided regional block and sedation . we excluded the cost of ultrasound machine but included the cost of local anesthetic drugs used , syringes , needles , and drugs used for sedation , such as bupivacine 0.5% ( rs 37 ) , lignocaine adrenaline 2% ( rs 34 ) , injection dexamethasone ( rs 9 ) , injection dexmedetomidine ( rs 150 ) , oxygen ( 30 rs / h ) , and syringes ( rs 100 ) . this cost was subtracted from the cost that would have been incurred if the surgery was done under ga . this benefit , when put up as the charge for the ultrasound machine per case gave us the duration in years , required to recover the cost of ultrasound machine . the cost of usg guided block was also evaluated as per type of surgery , type of block , and duration of surgery . analysis of variance ( anova ) was applied to compare mean benefits as per surgery , block , and duration . analysis of variance ( anova ) was applied to compare mean benefits as per surgery , block , and duration . of the 90 patients , 31 were american society of anaesthesiologists ( asa ) i , 48 were asa ii , 10 were asa iii , and 1 patient was asa iv . type of surgeries undertaken , their respective numbers , and benefit ( mean standard deviation ) per type of surgery are shown the benefit ( amount saved due to regional block or the cost difference between amount for ga regional anesthesia ) was statistically significant as the p = 0.004 . table 3 shows numbers and types of ultrasound - guided brachial plexus blocks and benefit as per block . table 4 shows the duration of surgeries and the respective benefits . numbers and types of ultrasound - guided brachial plexus blocks and benefits as per block duration of surgery and benefits as per duration total benefit of ultrasound - guided blocks as compared to ga per years = 323270.rough cost of usg machine = 10 lakhs ( approximately).recover cost of usg machine in about 3 years . total benefit of ultrasound - guided blocks as compared to ga per years = 323270 . benefits differed significantly as per the type of surgery , type of block , and duration of the surgery . with the cost benefit that we have obtained , for any concept to be viable in everyday practice , its economical aspect has to be considered . as per our study the economic benefit obtained from the ultrasound - guided block is in the range of rs 323,270/year . the cost benefits would increase if the number of surgery done with ultrasound - guided blocks increases and vice versa . the mean benefit shown for each type of surgery can be put up as the charge of ultrasound machine to recover the cost of ultrasound machine . with our results , it can be assumed that we can recover the cost of ultrasound machine in about 3 years if 90 upper extremity surgeries are performed successfully solely with ultrasound - guided blocks . here , we have assumed that the cost of ga in other institutes could be somewhat similar to that of ours . we analyzed benefits in terms of types and duration of surgeries and types of blocks separately . in our study , they all seem to be interrelated . the interscalene blocks ( n = 52 ) were given mainly for shoulder arthroscopic repairs ( n = 23 ) and shoulder replacements ( n = 7 ) , which also coincided with the longest duration of procedures . humerus fracture had a combination of interscalene ( main block ) and subclavian perivascular ( around 5 ml local anesthetic given ) . these surgeries took almost 33.5 h. fracture clavicle surgeries ( n = 2 ) also received interscalene but were of a relatively shorter duration . the combination of subclavian perivascular and infraclavicular blocks was mostly given for elbow surgeries that were of a relatively longer duration ; hence , table 2 depicts the cost of these blocks accordingly . the radius fracture and the wrist fractures were done under axillary or a combination of subclavian perivascular and axillary block . in general , it is not the type of the brachial plexus block that mattered but the duration of surgery undertaken with the block determined the cost benefit . in this study , we did not consider the cost of operation theater and the staff at all . this study compared the cost - effectiveness of interscalene ultrasound - guided blocks given for shoulder arthroscopies with ga . they either received block or ga . in our study , we had derived the cost of ga depending on the duration of the surgery . this was done after calculating the cost of ga for each hour in our institute . they investigated the following anesthesia - related times : ready for surgical preparation ( from arrival in the or until end of anesthesia induction ) , or emergence time ( from end of dressing until leaving the or ) , anesthesia control time ( from patient 's arrival in the or until readiness for positioning plus time from the end of surgery to patient 's discharge from the or ) , and postanesthesia care unit ( pacu ) time ( from patient 's arrival in the pacu to the eligibility for discharge to normal ward ) . . we did take into consideration the analgesia time rendered by the block in the postoperative period . in this study , they too had excluded the personnel costs from statistical analysis which is similar to us . the main difference is we estimated the period of amortization of the ultrasound machine which turns out to be approximately 3 years with our assumptions . of course , the period can be shorter if the number of surgeries increases and would be longer if the machine is more expensive than the cost we have considered . the retrospective nature of our study is one of the main limitations of this study . . it may not be always possible to keep track of them as they comparatively inexpensive and most casually used . in case , we have missed on them surely the difference is innocuous . it is important to know that the cost of ga almost repeats itself every hour , unlike regional anesthesia . from this study , we believe that ultrasound - guided regional anesthesia is cost - effective . this is besides the fact that ultrasound equipment can be used for several purposes such as venous cannulation and shared with other users too . the safety and predictability it renders to regional blocks can not be compared in cost . there were significant cost benefits using ultrasound guidance as compared to gabenefits differed significantly as per type of surgery , blocks , and durationthe cost of usg machine can be recovered in about 3 years . there were significant cost benefits using ultrasound guidance as compared to ga benefits differed significantly as per type of surgery , blocks , and duration the cost of usg machine can be recovered in about 3 years . investment in an ultrasound machine solely for regional anesthesia need not be considered as a big bane .	background and aims : the cost effectiveness of ultrasound - guided regional anesthesia is an issue which requires discussion . based on our experience , we hypothesized that this is an economically viable option.material and methods : in this retrospective study , we included 90 patients who underwent upper extremity surgeries in our institute solely under ultrasound ( usg)-guided brachial plexus blocks in a year . the cost of the block was derived by adding the cost of the material and drugs used for the block . this cost was subtracted from the cost that otherwise would have been incurred for general anesthesia ( ga ) of similar duration . this cost difference or benefit per case was then used to calculate the duration in years required to recover the cost of the ultrasound machine.statistics:data were analyzed using spss 15.0 . analysis of variance was applied to compare mean benefits as per surgery , block , and duration . ninety - five percent confidence interval for mean were calculated . level of significance was taken as p = 0.05.results:there were significant economic benefits using ultrasound guidance as compared to ga . benefits differed significantly as per the type of surgery , type of block , and duration of the surgery . with the cost benefit that we have obtained , the cost of usg machine can be recovered in about 3 years.conclusion:usg regional anesthesia is an economically viable concept . the cost benefit increases with the duration of a given surgery and increases with the number of blocks .
You are an expert at summarizing long articles. Proceed to summarize the following text: autogenous arteriovenous fistula ( aavf ) for haemodialysis access is associated with a lower incidence of stenosis , occlusion and other postoperative complications . it has a mean patency period of 58 - 70 months , compared to the mean patency period of 24 - 36 months for synthetic grafts ( 1 ) . therefore , the dialysis outcomes quality initiative guidelines recommend the use of aavfs as the first choice for vascular access , despite the disadvantages of a longer maturation time and high failure rate of maturation ( up to 50% ) compared to those for synthetic grafts ( 1 , 2 ) . to reduce failed aavf maturity , doppler ultrasonography ( us ) and/or venography has been used to screen for stenosis of the venous limb or for accessory veins , which are the most common causes of aavf failure ( 3 , 4 ) . many studies have reported that percutaneous transluminal angioplasty ( pta ) is a well - known and effective modality for salvaging immature aavfs ( 5 , 6 ) . however , technical and clinical factors that can predict successful aavf maturation after salvage pta ( spta ) have not been well elucidated , especially with respect to the role of doppler us during and after spta ( 5 , 6 ) . the purpose of this study was to identify factors predicting successful aavf maturation during and after spta by means of doppler us measurement . the local institutional review board approved this study , and the requirement for informed consent was waived because of the retrospective nature of the study . fifty - nine patients who had undergone spta for immature aavfs were included in this study . they were selected from 478 patients with end - stage renal disease who had undergone aavf creation for haemodialysis access from november 2008 to may 2014 ( primarily during the latter three years ) . two board - certified vascular surgeons with > 10 years of experience created the aavfs during the study period . the subjects included 32 males and 27 females , and their ages ranged from 40 to 85 years , with a mean age of 66 years ( table 1 ) . the presence of hypertension , diabetes mellitus , cardiovascular disease , and/or end - stage renal disease was evaluated to determine risk factors . if a patient had more than two risk factors , he or she was considered to have co - morbidity . abbreviations : avf , arteriovenous fistula ; bc - avf , brachiocephalic arteriovenous fistula ; preop . thirty - nine patients had undergone haemodialysis via permanent haemodialysis catheters for a period ranging from two days to 4.5 years ( mean , 154 days ) before avf creation . a total of 51 patients underwent radiocephalic ( rc ) avf creation , and the remaining eight patients underwent brachiocephalic ( bc ) avf creation . the fistula age , defined as the time period between the avf surgery and spta , ranged from 18 to 152 days ( mean , 92.8 days ) . fifty - five patients had co - morbidities ( diabetic nephropathy in 59 and hypertension in 55 ) . all doppler us examinations and pta procedures were performed by two board - certified interventional radiologists with > 15 years of experience in vascular interventions . we did not include patients with recurring stenosis of the aavf after initial clinical success in this series . routine preoperative mapping doppler us was performed to assess the status of the cephalic veins on both arms from the wrist joint to the elbow in longitudinal and transverse directions . the following characteristics were recorded : 1 ) size of the cephalic vein , 2 ) tortuosity of the cephalic vein , 3 ) depth of the cephalic vein , 4 ) presence of accessory veins , 5 ) stenosis of the cephalic vein , and 6 ) stenosis or significant calcification of the radial artery . all doppler us procedures were performed with iu-22 and hdi-5000 us machines ( philips ultrasound , bothell , wa , usa ) using a 5 - 10 mhz linear transducer . the criteria for favourable pre - surgical avf creation were : 1 ) size of the cephalic vein being > 2 mm in the forearm and > 2.5 mm in the arm , 2 ) no evidence of significant stenosis or thrombi of the cephalic vein , 3 ) no visible ipsilateral central vein stenosis or occlusion , and 4 ) size of radial artery being > 1.5 - 2 mm ( 4 ) . the criteria for suspicious aavf maturation failure were : 1 ) weak or no thrill on physical examination , and 2 ) size of < 4 mm or volume flow of < 500 ml / minute within four weeks after the surgery ( 7 ) . doppler us for detection of immature aavfs was performed in three steps : 1 ) standard measurements of the diameter of the overall avf draining vein , 2 ) visual estimation of the size at the focal stenotic or diffuse narrowed portions of the vein , which most severely limit venous flow on the draining vein of the avf , respectively , and 3 ) volume flow measurements at the normal sized draining vein of the avf . measurement of volume flow at the focal stenotic or narrowed portions was avoided due to turbulent or laminar flow . all patients with suspected aavf maturation failure underwent doppler us examination ( in most cases by the same interventional radiologist who performed the preoperative evaluation ) after surgical fistula creation , to evaluate changes in size , depth , course of the cephalic vein , as well as the presence of intraluminal stenosis in the cephalic vein and accessory veins . during follow - up doppler us examination , we used several methods in an attempt to measure the identical lesion location of the cephalic vein ( such as comparing the current us image to previous doppler us images , with the same examiner who performed the previous doppler us examination , and obtaining consensus between two interventional radiologists ) . arterial access through the brachial ( n = 50 ) or radial artery ( n = 9 ) was originally utilized to reduce the risk of injury to the immature distal trunk of the fistula during puncture or haemostasis after spta , especially when the distal trunk of the fistula was < 2 mm on us examination . puncture was routinely performed with a 21-g micropuncture set ( cook , bloomington , in , usa ) , under ultrasonographic guidance . the brachial artery was punctured in the antegrade direction for rc - avf and in the retrograde direction for bc - avf . after insertion of a 4 fr short vascular sheath ( terumo , tokyo , japan ) , angiography was performed to detect stenosis , thrombosis , and accessory veins in the entire trunk of the fistula , arteriovenous anastomosis , artery and veins . after the passage of a 0.014 or 0.018 inch micro - guide wire , a 2.5 - 5.0 mm balloon catheter ( powercross tm ; covidien corp . , plymouth , mn , usa ) was advanced and inflated up to 14 mmhg at the site of the stenosis for one to five minutes after routine injection of 3,000 - 5,000 iu of heparin ( 8) . the strategy for selecting balloon size was to select one with the same diameter or one 0.5 mm in diameter smaller than the diameter of the normal portion of the cephalic vein . if a residual stenosis of > 30% remained after the initial pta with the conventional balloon catheter , additional angioplasty was carried out with a same - sized , high - pressure balloon ( conquest ; bard , tampe , az , usa ) or a cutting balloon ( flextometm ; boston scientific , natick , ma , usa ) . if there was difficulty in crossing the anastomosis with the above - described balloon catheter due to its stiff nature and large diameter , we performed an additional puncture of the radial artery distal to the anastomosis under ultrasonographic guidance . the endpoint of the spta was : 1 ) residual stenosis of < 30% , 2 ) no visible dissection , and 3 ) improved luminal flow on completion angiography ( 9 , 10 ) . all spta procedures were performed by two board - certified interventional radiologists with > 15 years of experience in vascular interventions . haemostasis of the arterial puncture site was achieved by using a haemostatic closure pad ( clo - surplus padtm ; scion , miami , fl , usa ) and haemostatic compression bandage ( tr bandtm ; terumo , tokyo , japan ) . the interventional radiologists who performed the sptas confirmed complete haemostasis of the puncture site for all cases . the results of the spta were evaluated in accordance with the standards of the society of vascular surgery , the american association for vascular surgery , and the society of interventional radiology ( 9 , 10 ) . if luminal flow through the entire fistula trunk to the central vein was completely restored and the extent of residual stenosis remained below 20% of the initial value , on completion of the angiography , the procedure was considered a technical success . if sufficient vascular maturation occurred and haemodialysis was successfully performed with a mean flow rate of 300 ml / minute at least three times , the procedure was considered a clinical success ( 11 ) . primary patency was defined as the time period for which the aavf maintained a sufficient flow rate for haemodialysis without revision after the first pta . secondary patency was defined as the time period between the first pta and surgical revision or abandonment ( 12 ) . the anatomic success ratio ( asr ) was calculated by dividing the diameter of the dilated segment of the venous limb of the fistula checked by follow - up us two weeks after spta , by the diameter of the dilated segment of the venous limb of the fistula checked by us immediately after spta . for asr measurement , a doppler us examination was performed immediately after spta , before haemostasis of the puncture site , and within two weeks after spta for all patients . in addition , the diameter of the non - stenotic venous limb of the avf was measured again as a normal diameter , and the lumen of the venous limb of the fistula was examined for the presence of a thrombus or dissection . if the asr was < 0.7 and physical examination did not reveal a distinct thrill , additional secondary doppler us was performed in the next two weeks . if the asr decreased further and the thrill was more aggravated on the second follow - up us compared to that of the first follow - up us , additional spta was performed immediately in the same manner as for the first spta . we analysed the data from all medical records and radiological images , including those obtained during preoperative mapping and postoperative doppler us , spta , and follow - up doppler us after spta . the definition of maturation success was as follows : 1 ) a main trunk diameter of the fistula of > 4 mm , and 2 ) a volume flow through the main trunk of the fistula of 300 ml / minute . the definition of maturation failure was anything in contrary to the definition of maturation success ( 13 ) . the following factors were analysed with cox univariate and multivariate analyses for their ability to predict successful maturation of aavfs after spta : 1 ) patient factors ( age [ < 65 years or 65 years ] , gender [ male or female ] , presence of co - morbidities , such as diabetes and hypertension [ present or absent ] , age of the aavf [ < 60 days or 60 days ] , side of aavf [ right or left ] , and type of aavf [ rc or bc ] ) ; 2 ) vessel factors ( diameter of the cephalic vein on preoperative imaging [ < 2.5 mm or 2.5 mm ] , depth of the cephalic vein on preoperative imaging [ < 3.0 mm or 3.0 mm ] , accessory veins [ present or absent ] , and radial artery disease [ present or absent ] ) ; 3 ) lesion factors ( type of lesion [ stenosis or occlusion ] , number of lesions [ single or multiple ] , location of the lesion [ juxta - anastomotic or > 2 cm from anastomosis ] , and severity of stenosis [ 50% - 74% , 75% - 89% , 90% - 99% ] ) ; and 4 ) technical spta factors ( residual stenosis [ present or absent ] and asr on follow - up doppler us [ < 0.7 or 0.7 ] ) . vascular lesions that led to aavf maturation failure were classified as follows : 1 ) stenosis or 2 ) occlusion without thrombosis , based on the findings of postoperative doppler us examination and spta . a thrombus was defined as an echogenic mass of blood clots within the vascular lumen on doppler us and a filling defect within the lumen surrounded by contrast material on spta ( 8) . a significant accessory vein was defined as a venous channel originating from the main trunk of the fistula , similar in size to the main trunk , and reducing the flow through the main trunk of the fistula ( 9 ) . the location of the lesion was classified as : 1 ) native radial artery , adjacent to the anastomosis ; 2 ) arteriovenous anastomosis ; 3 ) juxta - anastomotic vein ( in the fistula within 2 cm from anastomosis ) ; 4 ) venous outflow ( > 2 cm from the anastomosis , cannulation zone ) ; 5 ) distal outflow ( defined as a draining portion of the cephalic vein above the elbow joint for rc - avf and above the mid - humerus for bc - avf ) ; and 6 ) central venous system ( 14 ) . the diameter of the stenotic lesion was measured at the narrowest segment in the trunk of the fistula , and the normal diameter was defined as the largest diameter of the fistula . comparisons between groups were performed with the chi - square or fisher s exact test for categorical variables . the risk factors against and predictors for successful fistula maturation were analysed with cox multivariate analysis . technical factors of the spta were analysed with the mann - whitney u - test . chicago , il , usa ) was used for statistical analysis , and p values of < 0.05 were considered statistically significant . the local institutional review board approved this study , and the requirement for informed consent was waived because of the retrospective nature of the study . fifty - nine patients who had undergone spta for immature aavfs were included in this study . they were selected from 478 patients with end - stage renal disease who had undergone aavf creation for haemodialysis access from november 2008 to may 2014 ( primarily during the latter three years ) . two board - certified vascular surgeons with > 10 years of experience created the aavfs during the study period . the subjects included 32 males and 27 females , and their ages ranged from 40 to 85 years , with a mean age of 66 years ( table 1 ) . the presence of hypertension , diabetes mellitus , cardiovascular disease , and/or end - stage renal disease was evaluated to determine risk factors . if a patient had more than two risk factors , he or she was considered to have co - morbidity . abbreviations : avf , arteriovenous fistula ; bc - avf , brachiocephalic arteriovenous fistula ; preop . thirty - nine patients had undergone haemodialysis via permanent haemodialysis catheters for a period ranging from two days to 4.5 years ( mean , 154 days ) before avf creation . a total of 51 patients underwent radiocephalic ( rc ) avf creation , and the remaining eight patients underwent brachiocephalic ( bc ) avf creation . the fistula age , defined as the time period between the avf surgery and spta , ranged from 18 to 152 days ( mean , 92.8 days ) . fifty - five patients had co - morbidities ( diabetic nephropathy in 59 and hypertension in 55 ) . all doppler us examinations and pta procedures were performed by two board - certified interventional radiologists with > 15 years of experience in vascular interventions . we did not include patients with recurring stenosis of the aavf after initial clinical success in this series . routine preoperative mapping doppler us was performed to assess the status of the cephalic veins on both arms from the wrist joint to the elbow in longitudinal and transverse directions . the following characteristics were recorded : 1 ) size of the cephalic vein , 2 ) tortuosity of the cephalic vein , 3 ) depth of the cephalic vein , 4 ) presence of accessory veins , 5 ) stenosis of the cephalic vein , and 6 ) stenosis or significant calcification of the radial artery . all doppler us procedures were performed with iu-22 and hdi-5000 us machines ( philips ultrasound , bothell , wa , usa ) using a 5 - 10 mhz linear transducer . the criteria for favourable pre - surgical avf creation were : 1 ) size of the cephalic vein being > 2 mm in the forearm and > 2.5 mm in the arm , 2 ) no evidence of significant stenosis or thrombi of the cephalic vein , 3 ) no visible ipsilateral central vein stenosis or occlusion , and 4 ) size of radial artery being > 1.5 - 2 mm ( 4 ) . the criteria for suspicious aavf maturation failure were : 1 ) weak or no thrill on physical examination , and 2 ) size of < 4 mm or volume flow of < 500 ml / minute within four weeks after the surgery ( 7 ) . doppler us for detection of immature aavfs was performed in three steps : 1 ) standard measurements of the diameter of the overall avf draining vein , 2 ) visual estimation of the size at the focal stenotic or diffuse narrowed portions of the vein , which most severely limit venous flow on the draining vein of the avf , respectively , and 3 ) volume flow measurements at the normal sized draining vein of the avf . measurement of volume flow at the focal stenotic or narrowed portions was avoided due to turbulent or laminar flow . all patients with suspected aavf maturation failure underwent doppler us examination ( in most cases by the same interventional radiologist who performed the preoperative evaluation ) after surgical fistula creation , to evaluate changes in size , depth , course of the cephalic vein , as well as the presence of intraluminal stenosis in the cephalic vein and accessory veins . during follow - up doppler us examination , we used several methods in an attempt to measure the identical lesion location of the cephalic vein ( such as comparing the current us image to previous doppler us images , with the same examiner who performed the previous doppler us examination , and obtaining consensus between two interventional radiologists ) . arterial access through the brachial ( n = 50 ) or radial artery ( n = 9 ) was originally utilized to reduce the risk of injury to the immature distal trunk of the fistula during puncture or haemostasis after spta , especially when the distal trunk of the fistula was < 2 mm on us examination . puncture was routinely performed with a 21-g micropuncture set ( cook , bloomington , in , usa ) , under ultrasonographic guidance . the brachial artery was punctured in the antegrade direction for rc - avf and in the retrograde direction for bc - avf . after insertion of a 4 fr short vascular sheath ( terumo , tokyo , japan ) , angiography was performed to detect stenosis , thrombosis , and accessory veins in the entire trunk of the fistula , arteriovenous anastomosis , artery and veins . after the passage of a 0.014 or 0.018 inch micro - guide wire , a 2.5 - 5.0 mm balloon catheter ( powercross tm ; covidien corp . , plymouth , mn , usa ) was advanced and inflated up to 14 mmhg at the site of the stenosis for one to five minutes after routine injection of 3,000 - 5,000 iu of heparin ( 8) . the strategy for selecting balloon size was to select one with the same diameter or one 0.5 mm in diameter smaller than the diameter of the normal portion of the cephalic vein . if a residual stenosis of > 30% remained after the initial pta with the conventional balloon catheter , additional angioplasty was carried out with a same - sized , high - pressure balloon ( conquest ; bard , tampe , az , usa ) or a cutting balloon ( flextometm ; boston scientific , natick , ma , usa ) . if there was difficulty in crossing the anastomosis with the above - described balloon catheter due to its stiff nature and large diameter , we performed an additional puncture of the radial artery distal to the anastomosis under ultrasonographic guidance . the endpoint of the spta was : 1 ) residual stenosis of < 30% , 2 ) no visible dissection , and 3 ) improved luminal flow on completion angiography ( 9 , 10 ) . all spta procedures were performed by two board - certified interventional radiologists with > 15 years of experience in vascular interventions . haemostasis of the arterial puncture site was achieved by using a haemostatic closure pad ( clo - surplus padtm ; scion , miami , fl , usa ) and haemostatic compression bandage ( tr bandtm ; terumo , tokyo , japan ) . the interventional radiologists who performed the sptas confirmed complete haemostasis of the puncture site for all cases . the results of the spta were evaluated in accordance with the standards of the society of vascular surgery , the american association for vascular surgery , and the society of interventional radiology ( 9 , 10 ) . if luminal flow through the entire fistula trunk to the central vein was completely restored and the extent of residual stenosis remained below 20% of the initial value , on completion of the angiography , the procedure was considered a technical success . if sufficient vascular maturation occurred and haemodialysis was successfully performed with a mean flow rate of 300 ml / minute at least three times , the procedure was considered a clinical success ( 11 ) . primary patency was defined as the time period for which the aavf maintained a sufficient flow rate for haemodialysis without revision after the first pta . secondary patency was defined as the time period between the first pta and surgical revision or abandonment ( 12 ) . the anatomic success ratio ( asr ) was calculated by dividing the diameter of the dilated segment of the venous limb of the fistula checked by follow - up us two weeks after spta , by the diameter of the dilated segment of the venous limb of the fistula checked by us immediately after spta . for asr measurement , a doppler us examination was performed immediately after spta , before haemostasis of the puncture site , and within two weeks after spta for all patients . in addition , the diameter of the non - stenotic venous limb of the avf was measured again as a normal diameter , and the lumen of the venous limb of the fistula was examined for the presence of a thrombus or dissection . if the asr was < 0.7 and physical examination did not reveal a distinct thrill , additional secondary doppler us was performed in the next two weeks . if the asr decreased further and the thrill was more aggravated on the second follow - up us compared to that of the first follow - up us , additional spta was performed immediately in the same manner as for the first spta . we analysed the data from all medical records and radiological images , including those obtained during preoperative mapping and postoperative doppler us , spta , and follow - up doppler us after spta . the definition of maturation success was as follows : 1 ) a main trunk diameter of the fistula of > 4 mm , and 2 ) a volume flow through the main trunk of the fistula of 300 ml / minute . the definition of maturation failure was anything in contrary to the definition of maturation success ( 13 ) . the following factors were analysed with cox univariate and multivariate analyses for their ability to predict successful maturation of aavfs after spta : 1 ) patient factors ( age [ < 65 years or 65 years ] , gender [ male or female ] , presence of co - morbidities , such as diabetes and hypertension [ present or absent ] , age of the aavf [ < 60 days or 60 days ] , side of aavf [ right or left ] , and type of aavf [ rc or bc ] ) ; 2 ) vessel factors ( diameter of the cephalic vein on preoperative imaging [ < 2.5 mm or 2.5 mm ] , depth of the cephalic vein on preoperative imaging [ < 3.0 mm or 3.0 mm ] , accessory veins [ present or absent ] , and radial artery disease [ present or absent ] ) ; 3 ) lesion factors ( type of lesion [ stenosis or occlusion ] , number of lesions [ single or multiple ] , location of the lesion [ juxta - anastomotic or > 2 cm from anastomosis ] , and severity of stenosis [ 50% - 74% , 75% - 89% , 90% - 99% ] ) ; and 4 ) technical spta factors ( residual stenosis [ present or absent ] and asr on follow - up doppler us [ < 0.7 or 0.7 ] ) . vascular lesions that led to aavf maturation failure were classified as follows : 1 ) stenosis or 2 ) occlusion without thrombosis , based on the findings of postoperative doppler us examination and spta . a thrombus was defined as an echogenic mass of blood clots within the vascular lumen on doppler us and a filling defect within the lumen surrounded by contrast material on spta ( 8) . a significant accessory vein was defined as a venous channel originating from the main trunk of the fistula , similar in size to the main trunk , and reducing the flow through the main trunk of the fistula ( 9 ) . the location of the lesion was classified as : 1 ) native radial artery , adjacent to the anastomosis ; 2 ) arteriovenous anastomosis ; 3 ) juxta - anastomotic vein ( in the fistula within 2 cm from anastomosis ) ; 4 ) venous outflow ( > 2 cm from the anastomosis , cannulation zone ) ; 5 ) distal outflow ( defined as a draining portion of the cephalic vein above the elbow joint for rc - avf and above the mid - humerus for bc - avf ) ; and 6 ) central venous system ( 14 ) . the diameter of the stenotic lesion was measured at the narrowest segment in the trunk of the fistula , and the normal diameter was defined as the largest diameter of the fistula . comparisons between groups were performed with the chi - square or fisher s exact test for categorical variables . the risk factors against and predictors for successful fistula maturation were analysed with cox multivariate analysis . technical factors of the spta were analysed with the mann - whitney u - test . chicago , il , usa ) was used for statistical analysis , and p values of < 0.05 were considered statistically significant . the results of the detailed analysis of the vessel and lesion characteristics obtained during spta and pre- and postoperative doppler us ( figure 1 ) are shown in tables 2 and 3 . all 59 patients underwent additional follow - up doppler us between 10 days and two weeks after spta . two patients had an asr of < 0.7 on the first and second follow - up doppler us , and one patient was converted to open repair . abbreviations : avf , arteriovenous fistula ; bc - avf , brachiocephalic arteriovenous fistula ; postop . abbreviations : bc - avf , brachiocephalic arteriovenous fistula ; rc - avf , radiocephalic arteriovenous fistula . the first spta was technically and clinically successful in 56 and 54 patients , respectively . furthermore , the second spta was clinically successful in two cases , in spite of the technical success of the first spta . therefore , the overall technical and clinical success rates were both 94.9% ( 56/59 ) . neither technical nor clinical success was achieved in three patients after one to three spta procedures ( figure 2 ) . there were no complications related to the spta procedure , such as hematoma or infection , except for one case of pseudoaneurysm after spta of an rc - avf with a same - sized balloon catheter for stenosis of the juxta - anastomotic vein , and in which was considered a technical failure of the first spta . consequently , an additional bc - avf was created in the ipsilateral arm ( figure 3 ) . the mean asr on follow - up doppler us after spta was 0.84 ( range , 0.28 - 1.23 ) , and the mean asrs in the rc - avf and bc - avf groups was 0.86 and 0.79 , respectively . there were no puncture site complications , such as hematoma , dissection , or pseudoaneurysm , after haemostasis with use of the previously mentioned haemostasis device in our series . nine patients , in whom the initial spta was clinically successful , had significant recurrent stenosis after haemodialysis , and nine patients underwent one additional pta . compared with the initial spta , the recurrent stenosis was observed at the same location in six patients ( juxta - anastomotic vein ) and at a more distal location in the trunk in three patients ( venous outflow > 2 cm from the anastomosis ) . primary patency was 96.6% at three months , 83% at six months , and 71% at 12 months . the cox multivariate analysis revealed that an asr of 0.7 ( or , 6.9 ; p < 0.001 ) and the absence of significant residual stenosis ( or , 1.1 ; p < 0.001 ) on the last follow - up doppler us were significant predictors of successful aavf maturation after spta . patient factors ( age ; gender ; co - morbidities ; and age , side , and type of aavf ) , vessel factors ( diameter and depth of the cephalic vein on preoperative imaging , presence of accessory veins , and presence of radial artery disease ) , and lesion factors ( type , number , and location of lesions and severity of stenosis ) were not significantly associated with successful aavf maturation ( table 4 ) . in the present study , stenosis of the cephalic vein within 5 cm from the arteriovenous anastomosis was the most common cause of immaturity ( 84.7% , 50/59 ) . juxta - anastomotic stenosis of aavfs has been shown to be the most common vascular lesion that causes immature aavfs ( 6 ) . stenosis in the venous swing point ( the region from the arteriovenous anastomosis to the point of the cephalic vein , located 5 cm distal to the anastomosis ) is considered an acquired lesion associated with the surgical technique , as this point is the site of surgical creation and mobilization of the artery and vein ( 15 ) . other vascular lesions , such as lesions in the central veins , other venous outflow tract obstructions related to previous puncture and catheter insertion , small size of the cephalic vein , and large size of accessory veins are also well - known causes of aavf immaturity ( 16 ) . previous studies have identified older age , female gender , and the presence of diabetes , hypertension , and an upper - arm fistula as predictors of aavf maturation failure . moreover , several studies have shown that preoperative arterial and venous diameters of > 2 mm and 2.5 mm , respectively , predict maturation of the aavf ( 16 - 18 ) . recently , vein diameter and volume flow measured with doppler us before and after the surgery have been suggested to be very useful for predicting fistula maturation ( 19 ) . according to robbin et al . ( 7 ) , venous diameter of > 4 mm and volume flow of > 500 ml / minute within four weeks after the surgery were the main determinants of successful aavf maturation . our attempts to evaluate immature aavfs using the above diagnostic criteria were difficult because of the lack of clearly defined reference values for volume flow that would allow researchers to distinguish between mature and immature aavfs . therefore , appropriate cut - off values for size and volume flow need to be established for immature aavfs ( 20 ) . ( 8) demonstrated that patients aged > 65 years and lesion factors , such as stenosis 90% and residual stenosis 20% , were independently associated with reduced primary or secondary patency rate . however , liang et al . ( 21 ) found no significant differences among three types of lesions , stenosis , obstruction , and thrombosis , on primary and secondary patency rates after spta . furthermore , they found no significant difference in patency rate between groups with and without significant residual stenosis after spta . in agreement with the latter results , we did not find statistically significant associations between successful aavf maturation after spta and various patient , vessel and lesion characteristics . physicians should bear in mind , however , that cut - off values for the size , depth , and volume flow of the cephalic vein , associated with immature aavfs in the asian population , may be lower than those in the western population , and therefore further studies are needed to verify this result . in our study , asr 0.7 and the absence of significant residual stenosis were significant independent factors predicting successful fistula maturation after spta ( p < 0.001 ) . in particular , fistulas with asr of 0.7 on follow - up doppler us performed within two weeks after spta tended to have a greater rate of fistula maturation than fistulas with asr of < 0.7 , yet this tendency was not statistically significant ( p > 0.05 ) . early elastic recoil , one of the drawbacks of angioplasty , may have contributed to the above results . in this study , we performed follow - up us examinations within two weeks after spta to assess the diameter of the fistula . furthermore , asr was calculated based on the acquired maximal diameter of the venous limb of the fistula on follow - up us two weeks after spta and the diameter of the dilated segment of the venous limb of the fistula immediately after spta . this quantitative evaluation of the dilated venous limb of the fistula , during short - term follow - up doppler us after spta , may be very useful for predicting successful aavf maturation . although same - sized balloon catheters or catheters up to 20% larger than the normal vessel diameter are often used in conventional pta , this selection principle does not fully apply to spta for several reasons . first , immature fistulas in most patients from our series had very small diameters ( 3 mm ) ( 90% , 53/59 ) , which may have been smaller than the normal vessel diameter in the healthy population . second , a larger balloon catheter increases the risk of damage to the immature vein , such as by causing a perforation or dissection . third , immaturity typically results in a very small diameter of the distal venous limb of the fistula , and this increases the risk of vascular injury during puncture or haemostasis . therefore , in most cases , we used same - sized balloon catheters or one approximately 0.5 mm smaller than the diameter of the adjacent normal venous limb of the fistula during spta . as a result , no major complications were observed immediately after balloon inflation except for one case of pseudoaneurysm , in which spta was performed for an rc - avf with a same - sized balloon catheter ( 3 mm ) . even though our study had a shorter follow - up period and a smaller sample size compared to some other studies , the superior clinical success rate of this study indicates the usefulness of this approach for balloon catheter size selection for spta . the rate of fistula maturation after spta obtained in the current study was higher than that in previous reports ( 6 , 8) . there may be several reasons for this difference . first , access via arterial puncture reduced the risk of damage to cephalic veins , which could preclude maturation . second , the proportion of cases with severe stenosis ( > 90% ) was lower than that in other studies . third , the incidence of meaningful accessory veins was lower than that of previous reports . second , this was a single - center study , the number of patients was relatively small , and the follow - up period was relatively short , which may affect the generalizability of the results . third , there may have been inter- or intra - observer variation in performing the doppler us in each examination , in spite of verification of the ultrasonographic results by two board - certified interventional radiologists with > 15 years of experience in vascular interventions . fourth , the number of failed cases was very low in this series , which could be a major weakness of this study because the failure cases could be important in predicting the causes of aavf maturation . in conclusion , an asr of 0.7 and the absence of significant residual stenosis at the two - week follow - up doppler us after spta can be used to predict successful aavf maturation . immediate additional spta was helpful for successful aavf maturation in cases with significant residual stenosis and asr < 0.7 .	background : maturation failure of autogenous arteriovenous fistula ( aavf ) has been increasing after surgical procedures and the salvage percutaneous transluminal angioplasty ( spta ) for immature aavf has been identified as an effective treatment modality.objectives:the aim of this study was to identify factors predicting successful aavf maturation and to determine positive technical aspects of spta.patients and methods : we retrospectively reviewed medical records and radiological images of 59 patients who had undergone spta for non - maturing aavfs . we analysed images from pre - surgical mapping doppler ultrasonography , angiography , and angioplasty and follow - up doppler ultrasonography performed within two weeks after spta . we assessed the following factors , for their ability to predict successful aavf maturation : 1 ) patient factors ( age ; sex ; co - morbidities ; and aavf age , side and type ) ; 2 ) vessel factors ( cephalic vein diameter and depth , presence of accessory veins , and pre- and postoperative radial artery disease ) ; 3 ) lesion factors ( stenosis number , location and severity ) ; and 4 ) technical factors ( presence of residual stenosis and anatomic success ratio ( asr ) on follow - up doppler ultrasonography).results : the technical and clinical success rates were both 94.9% ( 56/59 ) ; the mean asr was 0.84 . an asr of 0.7 and no significant residual stenosis ( < 30% ) ( both p < 0.001 ) on two - week follow - up doppler ultrasonography predicted successful aavf maturation.conclusion:for more precise prediction of successful aavf maturation after spta , short - term follow - up doppler ultrasonography ( < 2 weeks ) was useful . if the asr was < 0.7 or if residual stenosis was 30% , immediate repeat spta is recommended .
You are an expert at summarizing long articles. Proceed to summarize the following text: thailand is a developing country in southeast asia with an acknowledged requirement for improvement of the national medical system . although the new ( western ) system in medicine has been introduced to thailand for about a century , the present status of medicine in thailand is still not as good as those developing countries in europe and usa . this is in spite of the fact that the country is well known as a hub of medical tourism abroad . focusing on endocrinology in thailand , it is classified as a specific branch of medicine that is taught in medical schools . as far as the post - graduate training system is concerned , there is no specific resident training for endocrinology . however , specific postresidency training , fellowship in endocrinology is available . to be an endocrinologist this is considered a very long period compared with the period for training for other specialties , such as neurology ( only 9 years ) . annually , up to 5 million patients with endocrine disease are recorded in thailand , and this is significantly higher than the number of endocrinologists in thailand ( the present number is 474 ) . the primary care of common endocrine disorders , such as diabetes mellitus and thyroid disease is still delivered by the general practitioner . the other reasons that there are very few endocrinologists in thailand include the following : ( a ) this specialty is not a money - making specialty . the newly graduated physician would like to join the other branches that make more money , such as cardiology and neurology , ( b ) there is no -additional salary for endocrinologists although this kind of specialist knowledge is still inadequate , similar to some specialists , such as pathologists and radiotherapists , who get -additional salary , and ( c ) not all medical schools can train the endocrinology specialists . lack of education and financial constraints are still major problems in thailand , similar to many other developing countries . focusing on education , not only the problems of very long training period , and lack of good training centers ( only 6 medical colleges offer specific endocrine courses ) , but also limitations in the present training curriculum can be seen . interestingly , the specialty training curriculum in thailand is still not approved and certified by the international standards . lack of local experts in endocrinology leads to weakness of the endocrinology society in thailand . the specific society of endocrinology has been present in thailand for years ( 1981 ) but it does not function well . at present , there are very few professors of endocrinology in thailand , and most are not well accepted by scientific society . the rate of scientific publication is low , and this leads to poor recognition of thai endocrinology . focusing on the medical economics aspect , the huge number of endocrine patients in thailand implies the need equally strong funding . however , based on the general universal coverage principle in thailand , the average payment for all kinds of diseases by the thai government might not be sufficient for some endocrine cases that have a high management cost . apart from the general problems , some unique problems in thailand can be seen . due to the tropical nature of the country the good examples are hiv - related endocrinopathy , malaria - related endocrinopathy , and diabetic foot ( with superimposition of tropical fungus and bacterial infections ) . however , the more important consideration is of the thai culture , which is a buddhism - based culture with mixed indian and chinese roots . superstitious belief is very common , and patients usually use unacceptable alternative treatment when they get endocrine dysfunction or diseases . sometimes , some rare endocrine disorders are perceived as spiritual processing . this can be called a thai culture bound condition that modifies the endocrinology presentation and disease course . examples of superstitions are usage of holy water from buddhist temples hoping for disease cure and usage of horoscope indeed , buddhism has both positive and negative effects on endocrine care . for positive effect if the patients do not get standard treatment but use only superstitions , the disease will worsen . finally , focusing on the problem of endocrine disorder among buddhist monks , there is a previous report showing that the buddhist monks have a trend of lower incidence of disorder , which might be due to the strict lifestyle in medical practice . the unique challenges in thailand can be explained as the complex situation of ( a ) lack of good education and training system , ( b ) lack of specialists and experts , ( c ) lack of funding for management and poor resource allocation , and ( d ) the problem in management due to rooted thai culture and belief . how to manage these problems implementation of quality system for assurance on all education and service process in medicine has just been set for about 5 years . however , the system is not effective and seems to focus on paper work , and not the actual practice . in addition , the auditors are not well trained and do not have good quality . to solve the problem of the case management , hence , the present solution is the strengthening of the quality of the family physician to cope with the basic endocrine problems . this is via the continuous medical education system and use of new technology for case management . based on the concept that prevention is better than correction or treatment , many screening programs for common endocrine disorders in thailand are promoted . those examples include the neonatal screening program of hypothyroidism and screening for diabetes mellitus and its complications in population aged more than 35 years . the use of new tools , such as point - of - care testing technology has just recently implemented , over the past few years . it is hoped that thailand will be able to achieve an increase in the coverage of screening and monitoring endocrine and metabolic disease . the future direction of endocrinology is hard to predict . it is the hope that there will be sufficient number of endocrinologists in thailand , working within a good preventive and treatment system . however , with the unstable situation in thailand at present , it is very hard to make a commitment . at least , improved acceptance of the standards and quality in endocrinology practice , by general practitioner and endocrinologists might be successful in improving endocrine care in thailand .	thailand is a developing country in southeast asia with a nationally acknowledged requirement for improvement of the medical system . at present , endocrinology is a specific branch of medicine that is taught in few medical schools . there are very few endocrinologists in thailand , who are unable to cope with the large number of patients with endocrinology problems . primary care for common endocrine disorders , such as diabetes mellitus and thyroid disease , is still the domain of general practitioners . in this article , the author will present unique challenges and unique solutions of endocrinology practice in thailand .
You are an expert at summarizing long articles. Proceed to summarize the following text: triangular fibrocartilage complex ( tfcc ) is composed of multiple distinct anatomic structures including the triangular fibrocartilage ( tfc , the articular disk ) , meniscal homolog ( mh ) , dorsal and volar distal radioulnar ligaments , the extensor carpi ulnaris tendon ( ecu ) , ulnar collateral ligament ( ucl ) , ulnotriquetral ( ut ) ligament , and the ulnolunate ( ul ) ligament . the tfcc is the main stabilizer of the ulnar - sided wrist and the distal radioulnar joint ( druj ) . it is of significance in biomechanics and can dissolve and absorb the force between the ulna and ulnar side of the wrist . it helps to maintain the stability of the ulnocarpal joint and allows the stable motion of the wrist and the rotation of the forearm . injury on structural components of the tfcc may cause ulnar - sided wrist pain and may lead to wrist instability . due to the anatomic complexity of tfcc , it remains a challenge for radiologists to make an accurate imaging diagnosis . therefore , some injuries may be missed or misdiagnosed , especially in the early stage , resulting in delayed diagnosis and treatment , delayed functional recovery , and reduced quality of life . the early accurate diagnosis of the injuries is critical for choosing the appropriate treatment protocols . magnetic resonance imaging ( mri ) , a noninvasive method , can yield a high - resolution image of soft tissue and visualize the detailed anatomic structures of tfcc . several studies have shown that mri , especially high - resolution 3 t mri is the preferred imaging modality in the diagnosis of tfcc injuries . magnetic resonance ( mr ) examination can help select the right treatment for patients with tfcc injuries who complain ulnar - sided pain and can prevent further damages on patients wrists . this research was designed to outline the detailed anatomy and corresponding imaging appearance on the high - resolution 3 t mri of the normal tfcc using cadaveric specimens and healthy volunteers . we aimed to investigate if the high - resolution 3 t mri could demonstrate the detailed complex anatomy of tfcc in chinese . the study was adhered to the guidelines of the declaration of helsinki and approved by the institutional review board of beijing jishuitan hospital . written informed consent was obtained from all participants in this study . fourteen chinese cadaveric wrists were provided by the institute of basic sciences , chinese academy of medical sciences . there were four men and three women with age range between 30 and 60 years at death and mean age of 46 years old . all specimens contain distal part of radius and ulna , entire wrist and hand , which were kept at 42c ( haier biomedical , dw-40w100 , qingdao , china ) for the following experiments . radiographs on posteroanterior and lateral projections were taken before mri to exclude any osseous abnormalities on all the specimens . the normal mri features of tfcc were analyzed on forty wrists ( from twenty healthy chinese volunteers , ten men and ten women ; age range from 21 to 53 years with a mean age of 32 years ) without a history of wrist injuries in beijing jishuitan hospital from march 2014 to march 2016 . the including standards of the healthy volunteers were as following : no history of traumatic injury on the wrist , no osteoarthritis of the radiocarpal joint , free of wrist pain , and with a normal range of motion in wrist . mr examination was performed with a 3 t mri unit ( 5680 da best , philips medical systems , netherlands ) using a 16-channel hand - and - wrist receiver - only coil ( philips hand / wrist 16 3 t tim coil ) . the healthy volunteers were placed in prone position with the examined arms raised above the head , and the wrists were in neutral position in the center of the bore pinpointed by the laser mark . all cadaver specimens and wrists of volunteers underwent mri with the following sequences : fat suppression proton density - weighted imaging ( pd - fs ) in axial , coronal , and sagittal planes ( repetition time / echo time [ tr / te ] : 23473657 ms/4045 ms ) and t1-weighted fast spin - echo in coronal plane ( tr / te : 521780 ms/2040 ms ) ; section thickness : 2 mm ; interslice space : 0.2 mm ; number of excitations : 24 ; field of view : 100120 mm ; and voxel : 0.150.25 mm 0.150.25 mm 1.50 mm . mr arthrography ( mrar ) was performed on one of the cadaveric wrists by intra - articular injection of the contrast media ( 10 ml liquid mixture of 0.5 ml gd - dtpa [ beijing beilu pharmaceutical co. , ltd . , beijing , china ] with 100 ml normal saline + 5 ml iohexol [ beijing beilu pharmaceutical co. , ltd . ] ) with t1 fat - saturated ( t1-fs ) imaging in sagittal , coronal , and axial planes ( tr / te : 350 ms/34 ms ) . after obtained mr images , all cadaveric specimens were immediately frozen in neutral position at 42c and were kept at this temperature for at least 24 h. those specimens were subsequently sliced into 2-mm - thick slices ( that corresponded to the section thickness of the mr images ) with a stainless steel band saw ( american meat equipment corp , montebello , usa ) . six specimens were sectioned along the coronal plane , four along the sagittal plane , and four along the axial plane . each slice was digitally photographed ( eos 6d , canon , japan ) , and colored photographs were obtained for the anatomic correlation analysis with the corresponding mr images . all mr images were interpreted independently by two musculoskeletal radiologists who had 510 years of experience . tfcc of all these cadavers and volunteers was identified on the mr images according to their descriptions in literature . based on the analysis of the mri , the two radiologists reached a consensus regarding each structure of tfcc . the appearance of tfcc and signal intensity on mr images in 14 cadaveric specimens were compared with the appearance derived from the inspection of the corresponding colored photographs obtained from anatomic slices . the mr appearance of the normal tfcc in forty healthy wrists was analyzed and confirmed . identification of each ligament of tfcc on mri was by identifying the linear hyposignal intensity structure from its origin to its insertion on at least two diagnostic planes . fourteen chinese cadaveric wrists were provided by the institute of basic sciences , chinese academy of medical sciences . there were four men and three women with age range between 30 and 60 years at death and mean age of 46 years old . all specimens contain distal part of radius and ulna , entire wrist and hand , which were kept at 42c ( haier biomedical , dw-40w100 , qingdao , china ) for the following experiments . radiographs on posteroanterior and lateral projections were taken before mri to exclude any osseous abnormalities on all the specimens . the normal mri features of tfcc were analyzed on forty wrists ( from twenty healthy chinese volunteers , ten men and ten women ; age range from 21 to 53 years with a mean age of 32 years ) without a history of wrist injuries in beijing jishuitan hospital from march 2014 to march 2016 . the including standards of the healthy volunteers were as following : no history of traumatic injury on the wrist , no osteoarthritis of the radiocarpal joint , free of wrist pain , and with a normal range of motion in wrist . mr examination was performed with a 3 t mri unit ( 5680 da best , philips medical systems , netherlands ) using a 16-channel hand - and - wrist receiver - only coil ( philips hand / wrist 16 3 t tim coil ) . the healthy volunteers were placed in prone position with the examined arms raised above the head , and the wrists were in neutral position in the center of the bore pinpointed by the laser mark . the cadaveric wrists were placed in the same way . all cadaver specimens and wrists of volunteers underwent mri with the following sequences : fat suppression proton density - weighted imaging ( pd - fs ) in axial , coronal , and sagittal planes ( repetition time / echo time [ tr / te ] : 23473657 ms/4045 ms ) and t1-weighted fast spin - echo in coronal plane ( tr / te : 521780 ms/2040 ms ) ; section thickness : 2 mm ; interslice space : 0.2 mm ; number of excitations : 24 ; field of view : 100120 mm ; and voxel : 0.150.25 mm 0.150.25 mm 1.50 mm . mr arthrography ( mrar ) was performed on one of the cadaveric wrists by intra - articular injection of the contrast media ( 10 ml liquid mixture of 0.5 ml gd - dtpa [ beijing beilu pharmaceutical co. , ltd . , beijing , china ] with 100 ml normal saline + 5 ml iohexol [ beijing beilu pharmaceutical co. , ltd . ] ) with t1 fat - saturated ( t1-fs ) imaging in sagittal , coronal , and axial planes ( tr / te : 350 ms/34 ms ) . after obtained mr images , all cadaveric specimens were immediately frozen in neutral position at 42c and were kept at this temperature for at least 24 h. those specimens were subsequently sliced into 2-mm - thick slices ( that corresponded to the section thickness of the mr images ) with a stainless steel band saw ( american meat equipment corp , montebello , usa ) . six specimens were sectioned along the coronal plane , four along the sagittal plane , and four along the axial plane . each slice was digitally photographed ( eos 6d , canon , japan ) , and colored photographs were obtained for the anatomic correlation analysis with the corresponding mr images . all mr images were interpreted independently by two musculoskeletal radiologists who had 510 years of experience . tfcc of all these cadavers and volunteers was identified on the mr images according to their descriptions in literature . based on the analysis of the mri , the two radiologists reached a consensus regarding each structure of tfcc . the appearance of tfcc and signal intensity on mr images in 14 cadaveric specimens were compared with the appearance derived from the inspection of the corresponding colored photographs obtained from anatomic slices . the mr appearance of the normal tfcc in forty healthy wrists was analyzed and confirmed . identification of each ligament of tfcc on mri was by identifying the linear hyposignal intensity structure from its origin to its insertion on at least two diagnostic planes . analysis of the gross specimens confirmed that tfcc was composed of tfc ( the articular disk ) , mh , dorsal and volar distal radioulnar ligaments , ecu , ucl , ut , and ul ligaments [ figures 1 - 4 ] . schematic diagram of triangular fibrocartilage complex in the right wrist . ( a ) coronal illustration ; ( b ) axial illustration demonstrated the anatomy of tfcc ; ( c ) sagittal illustration shows the volar and dorsal capsules ( arrow ) originated from the volar and dorsal aspect of the tfc and inserted into the volar and dorsal edges of the triquetrum ( arrowhead ) . tfc : triangular fibrocartilage ; mh : meniscus homolog ; ucl : ulnar collateral ligament ; ecu : extensor carpi ulnaris tendon ; ul : ulnolunate ligament ; ut : ulnotriquetral ligament ; lt : lunotriquetral ligament ; : prestyloid recess ; : ligamentum subcruentum ; r : radius ; u : ulna ; l : lunate ; t : triquetrum ; drul : dorsal radioulnar ligament ; vrul : volar radioulnar ligament . triangular fibrocartilage complex ( tfcc ) in the right wrist of a 60-year - old cadaver specimen . ( a ) coronal anatomic comparison specimen ; ( b ) coronal pd - fs weighted image ; ( c ) t1-weighted image of the wrist . short arrow : the radial and ulnar insertions of tfc ; : ligamentum subcruentum ; arrowhead : lunotriquetral ligament ; : meniscal homolog ; long white arrow : prestyloid recess ; white dotted arrow : extensor carpi ulnaris ; pd - fs : proton density - weighted imaging with fat suppression . ( a ) transverse anatomic comparison specimen ; ( b ) transverse pd - fs ; ( c ) t1-weighted image . arrow : triangular fibrocartilage ; pd - fs : proton density - weighted imaging with fat suppression . ( a ) sagittal anatomic comparison specimen ; ( b ) sagittal t1-weighted image of the wrist showed the ulnotriquetral ligament and the triangular fibrocartilage ; ( c ) sagittal t1 fat - saturated weighted image with mrar in the specimen displayed in figure 2 showed the ulnotriquetral ligament . arrowhead : ulnotriquetral ligament ; arrow : triangular fibrocartilage ; mrar : magnetic resonance arthrography . the radial and ulnar sides of the triangular fibrocartilage the tfc was the central structure of the tfcc . the radial side of the tfc was attached to the articular cartilage at the most distal aspect of the sigmoid notch of the radius . the ulnar side of the tfc inserted onto the ulnar fovea and the ulnar styloid process . the ulnar attachment of the tfc was composed of two distinct laminas , also refer to the triangular ligament [ figures 1 and 2 ] . the distal lamina was oriented horizontally and lay between the tfc and the styloid process of the ulna . the proximal lamina was oriented vertically and curved from the undersurface of the tfc to the ulnar fovea . the two laminas were separated by an intervening layer of fibrovascular tissue , also known as the ligamentum subcruentum [ figures 1 and 2 ] , which was typically triangular in shape and extended into tfc proper from a broad base near the fovea of ulna . the mh extended from the ulnar styloid to the dorsal edge of the triquetrum , hamate , and the base of the fifth metacarpal . it was adjacent to the ecu dorsally and was connected to lunotriquetral ligament ( which was not the component of tfcc ) on the volar side , whereas it was close to the ucl on the lateral side and was connected to the triquetrum through ut ligament . there was a synovial space between the tfc and mh , where fibers from both tfc and mh were attached to the ulnar styloid process , also termed as the prestyloid recess [ figures 1 and 2 ] . the dorsal and volar distal radioulnar ligaments the dorsal and volar distal radioulnar ligaments , the main components of dorsal and volar marginal portions of tfc , respectively , extended from dorsal and volar rims of the sigmoid notch to the base of the ulnar styloid process . these two ligaments inserted directly into the distal radius , whereas the central portion of tfc inserted into the hyaline cartilage of the distal radius [ figures 1 and 3 ] . the main function of these ligaments was to prevent dorsal and volar subluxation of the druj . the other components of the triangular fibrocartilage complex the ecu ran along the dorsolateral side of the ulnocarpal joint and inserted at the base of the fifth metacarpal . ucl lay on the surface of the mh and linked to the ecu and the mh closely [ figure 1 ] . ut , ul , and ulnocapitate ligaments lay on the volar side of the wrist . ut and ul ligaments originated from the volar side of the volar distal radioulnar ligament , while ulnocapitate ligament had a direct bony origin from the fovea of the ulnar head and located more superficial to the junction between the ul and ut ligaments . these three ligaments inserted to the palmar sides of the triquetrum , lunate , and capitate bone , respectively [ figures 1 , 2 and 4 ] . the volar and dorsal capsules the volar and dorsal capsules were formed by the ulnocarpal ligaments ( included ut and ul ligaments ) and mh , respectively . they originated from the volar and dorsal aspect of the tfc and inserted into the volar and dorsal edges of the triquetrum [ figure 1 ] . on mr images , the normal tfc ( the articular disk ) showed low signal intensity in all the sequences including t1-weighted image and pd - fs . in coronal mr images , tfc , triangular ligament , mh , ecu , and ucl were all clearly appreciated [ figures 2 and 5 ] . in some cadavers and volunteers , lunotriquetral ligament , the dorsal distal radioulnar ligament , ut , and ul ligaments could be clearly identified . there were 14 chinese cadaveric wrists and 30 healthy chinese wrists could find the part of the ulnocapitate ligament on mr images . the ut , ul , and the ulnocapitate ligaments played an important role in preventing palmar subluxation of the ulnar carpus . the normal tfc had an asymmetrical bowtie - shaped image with low signal intensity on coronal images . the signal intensity of the triangular ligaments was higher than that of the tfc and showed as hypointense or slightly hyperintense striated signal , and the ligamentum subcruentum presented as increased signal intensity on pd - fs images [ figures 2 and 5 ] . the mh showed as a triangular shape and ran along the lateral joint capsule [ figure 2 ] . normal triangular fibrocartilage complex in the right wrist of a 32-year - old healthy male volunteer . ( a and b ) coronal pd - fs weighted image and coronal t1-weighted image of the wrist showed the tfcc had two attachments to the ulna , one inserting into the ulnar styloid tip ( distal lamina ) and the other one inserting into the fovea ( proximal lamina ) ( arrowhead ) ; ( c ) axial pd - fs weighted image showed the volar and dorsal radioulnar ligament ( arrowhead ) ; ( d ) sagittal image showed the band - like appearance of the tfc . arrow : triangular fibrocartilage ; pd - fs : proton density - weighted imaging with fat suppression ; tfcc : triangular fibrocartilage complex ; tfc : triangular fibrocartilage . on the axial plane , volar and dorsal radioulnar ligaments were well recognized as a band of low signal intensity extending from the distal radius to the distal ulna along the volar and dorsal side of the tfc disk [ figures 3 and 5 ] . the tfc was biconcave shape in sagittal plane that was thick in the periphery and thin in the central portion [ figure 5 ] . on the sagittal plane , ut , ul ligaments , volar and dorsal capsules , and part of the ulnocapitate ligament could be well evaluated , which also showed band low signal intensity [ figure 4 ] . what is more , ut , ul ligaments , and the volar and dorsal capsules could be visualized more clearly on sagittal t1 fs images with mrar [ figure 4 ] . analysis of the gross specimens confirmed that tfcc was composed of tfc ( the articular disk ) , mh , dorsal and volar distal radioulnar ligaments , ecu , ucl , ut , and ul ligaments [ figures 1 - 4 ] . schematic diagram of triangular fibrocartilage complex in the right wrist . ( a ) coronal illustration ; ( b ) axial illustration demonstrated the anatomy of tfcc ; ( c ) sagittal illustration shows the volar and dorsal capsules ( arrow ) originated from the volar and dorsal aspect of the tfc and inserted into the volar and dorsal edges of the triquetrum ( arrowhead ) . tfc : triangular fibrocartilage ; mh : meniscus homolog ; ucl : ulnar collateral ligament ; ecu : extensor carpi ulnaris tendon ; ul : ulnolunate ligament ; ut : ulnotriquetral ligament ; lt : lunotriquetral ligament ; : prestyloid recess ; : ligamentum subcruentum ; r : radius ; u : ulna ; l : lunate ; t : triquetrum ; drul : dorsal radioulnar ligament ; vrul : volar radioulnar ligament . triangular fibrocartilage complex ( tfcc ) in the right wrist of a 60-year - old cadaver specimen . ( a ) coronal anatomic comparison specimen ; ( b ) coronal pd - fs weighted image ; ( c ) t1-weighted image of the wrist . short arrow : the radial and ulnar insertions of tfc ; : ligamentum subcruentum ; arrowhead : lunotriquetral ligament ; : meniscal homolog ; long white arrow : prestyloid recess ; white dotted arrow : extensor carpi ulnaris ; pd - fs : proton density - weighted imaging with fat suppression . ( a ) transverse anatomic comparison specimen ; ( b ) transverse pd - fs ; ( c ) t1-weighted image . arrow : triangular fibrocartilage ; pd - fs : proton density - weighted imaging with fat suppression . ( a ) sagittal anatomic comparison specimen ; ( b ) sagittal t1-weighted image of the wrist showed the ulnotriquetral ligament and the triangular fibrocartilage ; ( c ) sagittal t1 fat - saturated weighted image with mrar in the specimen displayed in figure 2 showed the ulnotriquetral ligament . arrowhead : ulnotriquetral ligament ; arrow : triangular fibrocartilage ; mrar : magnetic resonance arthrography . the radial and ulnar sides of the triangular fibrocartilage the tfc was the central structure of the tfcc . the radial side of the tfc was attached to the articular cartilage at the most distal aspect of the sigmoid notch of the radius . the ulnar side of the tfc inserted onto the ulnar fovea and the ulnar styloid process . the ulnar attachment of the tfc was composed of two distinct laminas , also refer to the triangular ligament [ figures 1 and 2 ] . the distal lamina was oriented horizontally and lay between the tfc and the styloid process of the ulna . the proximal lamina was oriented vertically and curved from the undersurface of the tfc to the ulnar fovea . the two laminas were separated by an intervening layer of fibrovascular tissue , also known as the ligamentum subcruentum [ figures 1 and 2 ] , which was typically triangular in shape and extended into tfc proper from a broad base near the fovea of ulna . the mh extended from the ulnar styloid to the dorsal edge of the triquetrum , hamate , and the base of the fifth metacarpal . it was adjacent to the ecu dorsally and was connected to lunotriquetral ligament ( which was not the component of tfcc ) on the volar side , whereas it was close to the ucl on the lateral side and was connected to the triquetrum through ut ligament . there was a synovial space between the tfc and mh , where fibers from both tfc and mh were attached to the ulnar styloid process , also termed as the prestyloid recess [ figures 1 and 2 ] . the dorsal and volar distal radioulnar ligaments the dorsal and volar distal radioulnar ligaments , the main components of dorsal and volar marginal portions of tfc , respectively , extended from dorsal and volar rims of the sigmoid notch to the base of the ulnar styloid process . these two ligaments inserted directly into the distal radius , whereas the central portion of tfc inserted into the hyaline cartilage of the distal radius [ figures 1 and 3 ] . the main function of these ligaments was to prevent dorsal and volar subluxation of the druj . the other components of the triangular fibrocartilage complex the ecu ran along the dorsolateral side of the ulnocarpal joint and inserted at the base of the fifth metacarpal . ucl lay on the surface of the mh and linked to the ecu and the mh closely [ figure 1 ] . ut , ul , and ulnocapitate ligaments lay on the volar side of the wrist . ut and ul ligaments originated from the volar side of the volar distal radioulnar ligament , while ulnocapitate ligament had a direct bony origin from the fovea of the ulnar head and located more superficial to the junction between the ul and ut ligaments . these three ligaments inserted to the palmar sides of the triquetrum , lunate , and capitate bone , respectively [ figures 1 , 2 and 4 ] . the volar and dorsal capsules the volar and dorsal capsules were formed by the ulnocarpal ligaments ( included ut and ul ligaments ) and mh , respectively . they originated from the volar and dorsal aspect of the tfc and inserted into the volar and dorsal edges of the triquetrum [ figure 1 ] . on mr images , the normal tfc ( the articular disk ) showed low signal intensity in all the sequences including t1-weighted image and pd - fs . in coronal mr images , tfc , triangular ligament , mh , ecu , and ucl were all clearly appreciated [ figures 2 and 5 ] . in some cadavers and volunteers , lunotriquetral ligament , the dorsal distal radioulnar ligament , ut , and ul ligaments could be clearly identified . there were 14 chinese cadaveric wrists and 30 healthy chinese wrists could find the part of the ulnocapitate ligament on mr images . the ut , ul , and the ulnocapitate ligaments played an important role in preventing palmar subluxation of the ulnar carpus . the normal tfc had an asymmetrical bowtie - shaped image with low signal intensity on coronal images . the signal intensity of the triangular ligaments was higher than that of the tfc and showed as hypointense or slightly hyperintense striated signal , and the ligamentum subcruentum presented as increased signal intensity on pd - fs images [ figures 2 and 5 ] . the mh showed as a triangular shape and ran along the lateral joint capsule [ figure 2 ] . normal triangular fibrocartilage complex in the right wrist of a 32-year - old healthy male volunteer . ( a and b ) coronal pd - fs weighted image and coronal t1-weighted image of the wrist showed the tfcc had two attachments to the ulna , one inserting into the ulnar styloid tip ( distal lamina ) and the other one inserting into the fovea ( proximal lamina ) ( arrowhead ) ; ( c ) axial pd - fs weighted image showed the volar and dorsal radioulnar ligament ( arrowhead ) ; ( d ) sagittal image showed the band - like appearance of the tfc . arrow : triangular fibrocartilage ; pd - fs : proton density - weighted imaging with fat suppression ; tfcc : triangular fibrocartilage complex ; tfc : triangular fibrocartilage . on the axial plane , volar and dorsal radioulnar ligaments were well recognized as a band of low signal intensity extending from the distal radius to the distal ulna along the volar and dorsal side of the tfc disk [ figures 3 and 5 ] . the tfc was biconcave shape in sagittal plane that was thick in the periphery and thin in the central portion [ figure 5 ] . on the sagittal plane , ut , ul ligaments , volar and dorsal capsules , and part of the ulnocapitate ligament could be well evaluated , which also showed band low signal intensity [ figure 4 ] . what is more , ut , ul ligaments , and the volar and dorsal capsules could be visualized more clearly on sagittal t1 fs images with mrar [ figure 4 ] . the tfcc is a fibrocartilage - ligament complex composed of multiple structures and plays an important role in stabilizing the druj , transmitting the load between the carpus and ulna , and stabilizing the ulnar aspect of the wrist . the complexity of the tfcc anatomy makes it difficult to diagnose the tfcc injuries accurately . mri , as a noninvasive examination , has a high resolution of soft tissue and can show the anatomic details of the tfcc . therefore , mri has become the single most important imaging modality for the hand surgeon and orthopedic surgeon in helping them to implement the appropriate treatment plans by revealing the nature , severity , location , and extent of the injuries and the associated injuries . mrar will show some fine anatomy more clearly , improve the diagnosis of the lesion within the joint , and increase the sensitivity and accuracy of diagnosis . in our study , we carried out the direct mrar in one specimen , and in the sagittal plane , we could find the ut , ul ligaments , and the volar and dorsal capsules more clearly than conventional mri . as we have known , palmer and werner first reported that the ulnocarpal ligaments were composed of the ut and ul ligaments . however , some literatures stated that the ulnocarpal ligaments also included the ulnocapitate ligament , and these ligaments were often titled as the ulnocarpal ligamentous complex . in our study , we also can find the ulnocapitate ligament on both anatomic sections and mr images in some chinese volunteers , which was inconsistent with what theumann et al . had found in their research where the ulnocapitate ligament was not seen on mr images . however , we failed to find the ulnocapitate ligament on mr images in ten wrists of volunteers involved in our study , and the discrepancy might be due to these structures were often confluent and indistinguishable from each other , as the literature stated . although there are many descriptions about the complex anatomy of the tfcc , most of them put much emphasis on the coronal or axial view . in our study , we found that the volar and dorsal capsules could be best visualized in sagittal images , especially with mrar . furthermore , by combining all three planes to make a comprehensive evaluation , we could find more details of the tfcc such as ut , ul , and the volar and dorsal capsules . due to the high sensitivity of mri , it is easy to misdiagnose the normal variations in signal intensity as injury . combining with literatures and our research , we want to emphasis some common pitfalls about the structures . ligamentum subcruentum , as a fibrovascular tissue , usually presents as increased signal intensity on pd - fs images and should not be misinterpreted as an injury to the ulnar attachment of the tfc . prestyloid recess , a synovial space between the tfc and mh , is a normal synovial linked recess , may fill with joint fluid , presented as high signal intensity on pd - fs images , and should not be mistaken for an injury . on the coronal images , the proximal lamina appears as a striated pattern and internally relatively high signal intensity . it is a normal appearance due to bundles of collagen fibers with vascular connective tissue that produce the relative higher signal , may mimic or mask tears , and make it difficult to accurately diagnose the tears of the ulnar attachment . since the radial side of the tfc is attached to the articular cartilage at sigmoid notch of the distal radius directly , it is a normal finding that there is intermediate signal intensity between the hyposignal intensity tfc and the subchondral bone of the distal radius . in conclusion , the tfcc is a complex structure , and the high - resolution 3 t mri is capable to demonstrate all the anatomic components . mrar increases the sensitivity of detecting some of the smaller ligaments such as ut ligament . to evaluate the tfcc familiar with the normal mr appearance of the normal structures is vital to distinguish normal anatomical structures from injuries . this study was supported by grants from the national natural science foundation of china ( no . 81371515 ) , the beijing natural science foundation of china ( no . 7142075 ) , and the capital medical development and scientific research fund of china ( no . this study was supported by grants from the national natural science foundation of china ( no . 81371515 ) , the beijing natural science foundation of china ( no . 7142075 ) , and the capital medical development and scientific research fund of china ( no .	background : the injury of the triangular fibrocartilage complex ( tfcc ) is a common cause of ulnar - sided wrist pain . the aim of this study was to investigate if the high - resolution 3 t magnetic resonance imaging ( mri ) could demonstrate the detailed complex anatomy of tfcc in chinese.methods:fourteen chinese cadaveric wrists ( from four men and three women ; age range at death from 30 to 60 years ; mean age at 46 years ) and forty healthy chinese wrists ( from 20 healthy volunteers , male / female : 10/10 ; age range from 21 to 53 years with a mean age of 32 years ) in beijing jishuitan hospital from march 2014 to march 2016 were included in this study . all cadavers and volunteers had magnetic resonance ( mr ) examination of the wrist with coronal t1-weighted and proton density - weighted imaging with fat suppression in three planes , respectively . mr arthrography ( mrar ) was performed on one of the cadaveric wrists . subsequently , all 14 cadaveric wrists were sliced into 2 mm thick slab with band saw ( six in coronal plane , four in sagittal plane , and four in axial plane ) . the mri features of normal tfcc were analyzed in these specimens and forty healthy wrists.results:triangular fibrocartilage , the ulnar collateral ligament , and the meniscal homolog could be best observed on images in coronal plane . the palmar and dorsal radioulnar ligaments were best evaluated in transverse plane . the ulnotriquetral and ulnolunate ligaments were best visualized in sagittal plane . the latter two structures and the volar and dorsal capsules were better demonstrated on mrar.conclusion:high-resolution 3 t mri is capable to show the detailed complex anatomy of the tfcc and can provide valuable information for the clinical diagnosis in chinese .
You are an expert at summarizing long articles. Proceed to summarize the following text: an 8-year - old boy reported with the chief complaint of missing upper and lower front teeth . pregnancy and birth were uneventful , though the newborn showed bilateral hexadactyly of his upper limb . the patient 's stature likely appeared normal for his age ; his head morphology , facial appearance , quantity and quality of the hair were also normal . the skeletal deformities like bilateral postaxial polydactyly , long and narrow appearing thorax compared to the height of lower limb , genu valgum , and short middle and distal phalanges were observed [ figure 1 ] . other striking features included severely dystrophic finger and toe nails [ figures 2 and 3 ] . extraoral examination revealed slight v - notch on the middle part of the upper lip and mild defect in philtrum . the labial frenum of the upper lip was hyperplastic and adhered to the anterior alveolar ridge obliterating the mucolabial sulcus [ figures 4 and 5 ] . multiple lower labial freni attached to the anterior alveolar ridge were present with a serrated margin [ figure 6 ] . all primary and permanent incisors were clinically missing and there was no history of previous exfoliations / extractions of incisors . the erupted permanent canines were conical ; primary and permanent molars of both arches were malformed with abnormal occlusal pattern resembling mulberry shape . long , narrow appearing thorax with knock knees bilateral hexadactyly of the upper limb with dytrophic nails dystrophic nails in the toes adherence of the upper labial frenum with the alveolar ridge obliterating the mucolabial sulcus and serrated margins of the lower alveolar ridge with multiple labial frenum missing incisors and malformed primary and permanent molars in the upper arch missing lower incisors and mulberry - shaped primary and permanent molars the patient was referred to a cardiologist to know the nature of cardiac involvement . an echocardiogram was done and a diagnosis for acyanotic congenital heart disease with large ostium primum atrial septal defect was confirmed . a hand - wrist radiograph revealed shortening of the middle and distal phalanges , and deformity in the fifth and sixth metatarsals and few carpal bones [ figure 7b ] . the findings of routine blood investigations were within normal limits . based on the overall clinical examination and the findings of various diagnostic investigations , a confirmatory diagnosis of evc syndrome ( b ) hand - wrist radiograph reveals shortening of the middle and distal phalanges . ( d ) orthopantomogram reveals congenital absence of all upper and lower incisors treatment plan consisted of mucogingival surgery for excision of the labial frenulum in both upper and lower arch , followed by prosthetic rehabilitation for his missing teeth . restorative care for carious teeth , professionally applied topical fluoride , and home care oral hygiene measures were also insisted with appropriate considerations for antibiotic prophylaxis for his underlying cardiac problem . evc syndrome is a chondral and ectodermal dysplasia characterized by short ribs , polydactyly , growth retardation , and ectodermal and heart defects . mutations of the evc1 and evc2 genes , located in a head - to - head configuration on chromosome 4p16 , have been identified as causative . evc belongs to the short rib - polydactyly ( srp ) group , and these srps , especially type iii ( verma - naumoff syndrome ) , are discussed in the prenatal differential diagnosis . postnatally , the essential differential diagnoses include jeune dystrophy , mckusick kaufman syndrome , and weyers syndrome . recently , evc has been included in a new class of human genetic disorders called ciliopathies , where the underlying defect may be dysfunctional molecular mechanism in the primary cilia of cells . our patient was the first child of non - consanguineous and normally developed parents with no significant pre - natal , natal , and post - natal history , though the newborn showed bilateral hexadactyly of his upper limb . evc presents with characteristic tetrad : ( 1 ) disproportionate dwarfism with short limbs and exceptionally long trunk , ( 2 ) bilateral postaxial polydactyly of the hands , ( 3 ) dystrophic nails , hypodontia , and malformed teeth , and ( 4 ) congenital cardiac malformations occur in 5060% of cases , the most common being the inter - septal defect . cardinal features after birth are short stature , short ribs , polydactyly , and dysplastic fingernails and teeth . the syndrome affects mainly the bones such as the lower limb with genu valgum , which requires surgical correction . cardiac defects , especially abnormalities of atrial septation , occur in about 60% of cases.[1379 ] these patients die due to either cardiac problem or respiratory distress . other ectodermal features in this syndrome are the absence or hypoplastic features of finger and toe nails , natal teeth , conical shaped , or missing teeth . the most constant finding is fusion of the anterior portion of the upper lip to the maxillary gingival margin , as a result of which no mucobuccal fold exists , causing the upper lip to present a slight v - shaped notch in the middle . changes in the upper lip are variously called partial hare - lip , lip tie , and so on . the anterior portion of the lower ridge is often serrated and presents with multiple small labial frenula . the maxillary and mandibular alveolar process presents with notching or submucous clefts and continuous or broad labial frenula and dystrophic philtrum . bilateral incomplete clefts or notchings usually involve the region normally occupied by the lateral incisors , each submucous cleft being marked by a moderately sized fibrous band , whose fibers appear to incise the underlying alveolar process and extend across the mucobuccal fold into the lip . veena et al . , stated that this could be due to the continuation of the normal serrated condition of the gingiva from the third to seventh month in the uterine life of the fetus . most frequent dental findings include neonatal teeth , partial anodontia , peg - shaped teeth , delayed eruption of teeth , and early involvement with caries . our patient had congenital absence of all primary and permanent incisors , which was confirmed by history and radiograph . also , a remarkable feature observed in our patient was that all primary and permanent first molars were malformed with mulberry shape and the cuspids were conical shaped . stated that the dental abnormality occurred in the initiation stage of tooth development and could result in the absence of teeth in the anterior region . a further insult at morphodifferentiation stage is probably responsible for the changes in size and form of the teeth . the changes in the anatomy of the crowns with deep fissures and pits could be a predisposing factor in the high rate of caries . management during the neonatal period is mostly symptomatic , involving treatment of the respiratory distress due to narrow chest and heart failure . prognosis is linked to the respiratory difficulties in the first months of life due to thoracic narrowness and possible heart defects . dental care in childhood includes dietary counseling , plaque control , and oral hygiene instructions . partial dentures can be placed to maintain space and improve mastication , esthetics , and speech because of congenitally missing teeth . dental care during adulthood can be done with implants and prosthetic rehabilitation to replace congenitally missing teeth . an early diagnosis of evc and therapeutic care with a multidisciplinary approach would warrant these patients in achieving a better quality of life care .	ellis van creveld ( evc ) syndrome is an autosomal recessive disorder that is also known as chondro - ectodermal dysplasia . the common manifestations of this syndrome are short ribs , postaxial polydactyly , growth retardation , and ectodermal and cardiac defects . the present case report is about an 8-year - old boy who had the features of bilateral hexadactyly , knocked knees , cardiac problems , congenital absence of incisors , fused upper and lower labial frenulum , and mulberry molars .
You are an expert at summarizing long articles. Proceed to summarize the following text: functional constipation ( fc ) is common in children with an estimated prevalence of 3% worldwide ( 1 ) . the most common pathogenesis of fc is a vicious cycle that begins with painful defecation and leads to stool - withholding behavior as a result ( 2 ) . identifying the factors that lead to painful defecation in early childhood is important in the prevention of fc . over 2 million children attend daycare centers in the republic of korea , for an average 5 - 9 hours per day ( 3 ) . however , no studies have reported the precipitating factors of fc related to daycare centers . previous reports on fc during early childhood involved children who visited a pediatric clinic with a complaint of constipation or other disorder ( 4 ) . our objective was to determine the risk factors associated with the development of fc in young childhood attending daycare centers . a cross - sectional survey using a questionnaire was conducted in children aged 25 to 84 months from 3 randomly selected daycare centers in january 2016 . the questionnaire developed by our institute contained 40 items about demographic characteristics , bowel habits , lifestyles and eating habits associated with fc at home and in daycare centers . data were analyzed with spss , version 17.0 ( spss , chicago , il , usa ) . the items in a questionnaire were compared in the constipated and non - constipated groups using a analysis and student 's t - test . this study was approved by the institutional review board ( hirb-2015 - 11 ) and informed consent was obtained from the caregivers of children in the study . this study was approved by the institutional review board ( hirb-2015 - 11 ) and informed consent was obtained from the caregivers of children in the study . data were collected from a questionnaire completed by caregivers , who were mostly mothers ( 91.2% ) . a total of 217 children were enrolled ; 2 were excluded because of the underlying disease ( 1 had an anorectal malformation and 1 had cerebral palsy ) , and 3 submitted an incomplete questionnaire . a total of 212 children ( boys : 111 [ 53.11% ] , mean age : 54.5 months , standard deviation [ sd ] 15.1 months ) were included ( table 1 ) . of these , 18 children ( 8.5% ) fulfilled the rome iii criteria for fc ( table 1 ) . values are mean sd or no./total no.(% ) . in the analysis of clinical characteristics , the 2 groups did not show significant differences in age ( p = 0.656 ) , gender ( p = 0.782 ) , weight ( p = 0.307 ) , height ( p = 0.820 ) , birth week ( p = 0.964 ) , and the number of mothers with a university degree ( p = 0.521 ) ( table 1 ) . maternal history of constipation ( p = 0.011 ) and parental recognition of a child 's constipation ( p = 0.000 ) were significantly associated with fc ( table 1 ) . seventeen ( 77.3% ) of 22 parents who recognized the child 's fc refused to treat the child at clinic , because modification of eating habits might be adequate to treat the fc , and previous short - term treatment of fc at a clinic was not satisfactory . the two groups showed no significant differences in age of toilet training ( p = 0.744 ) or history of difficult toilet training ( p = 0.595 ) ( table 1 ) . however , the constipated group reported a significantly higher rate of painful defecation before age 1 ( p = 0.000 ) and during toilet training ( p = 0.000 ) than the non - constipated group ( table 1 ) . in the analysis using the rome iii criteria , the constipated group was significantly associated with all items ( p = 0.000 ) , and the most common complaint was pain during defecation ( 55.6% ) ( table 2 ) . a history of rectal bleeding ( p = 0.008 ) , withholding ( p = 0.021 ) and hard stools ( p = 0.003 ) were also significantly associated with fc ( table 2 ) . the constipated group was significantly associated with 2 hours or less of outdoor play activities per day ( p = 0.044 ) , entry into daycare centers before 24 months age ( p = 0.02 ) , 6 hours or more of attendance at daycare centers per day ( p = 0.049 ) , and no or difficult defecation at daycare center ( p = 0.000 ) ( table 3 ) . when analyzed for feeding history , the constipated group was significantly associated with breastfeeding for less than 6 months ( p = 0.033 ) , 3 meals or less a day ( p = 0.021 ) , 500 ml or less of water intake per day ( p = 0.002 ) , no meat consumption ( p = 0.000 ) , and 3 or fewer servings of fruits and vegetables per day ( p = 0.046 ) ( table 3 ) . p < 0.05 ; sedentary activities included watching tv or playing with cell phone ; water intake excluded milk and liquids . multivariate logistic regression analyses revealed that maternal history of constipation ( p = 0.026 ) , history of painful defecation before age 1 ( p = 0.045 ) , history of painful defecation during toilet training ( p = 0.014 ) , no or difficult defecation at the daycare center ( p = 0.000 ) , no meat consumption ( p = 0.036 ) , and 500 ml or less of water intake per day ( p = 0.049 ) were statistically significant predictors of fc in young children ( table 4 ) . p < 0.05 ; sedentary activities included watching tv or playing with cell phone ; water intake excluded milk and liquids . this study showed that maternal history of constipation , early experience of painful defecation , no or difficult defecation at the daycare center , drinking 500 ml or less of water per day , and no meat consumption were risk factors for fc in early childhood , opposed to external factors such as the age of toilet training , the birth of siblings or environmental change ( 7 ) . in agreement with previous studies , our data showed that breastfeeding for less than 6 months , entry into daycare before 24 months age and eating fewer meals with fruits and vegetables were important factors associated with fc in young children ( 89 ) . to our knowledge , this is the first study to assess factors of fc related to daycare centers in early childhood . there have been no reports that children who spent 6 or more hours per day at a daycare center were more likely to present with fc . early recognition and modification of these risk factors are important , because fc associated with daycare centers will continue through middle - school years ( 11 ) . some studies have reported that the earlier a child entered daycare , the more pronounced the socio - behavioral problems ( 12 ) . those who entered into daycare before 24 months age were more likely to present with fc , rather than before 6 months and 12 months age in this study . this result might be related with bowel habit change associated with toilet training . in this study , no and difficult defecation at the daycare center were the predictors of fc with high odds ratio in logistic regression analysis . however , a small number of subjects in this study could lead to an overestimation of odds ratio , because no and difficult defecation at the daycare can be the result and the risk for fc ( 10 ) . to calculate the accurate odds ratio , drinking 500 ml or less of water per day was also a predictor of fc , whereas the amount of water intake at the daycare center was not significantly associated with fc in this study . the results for this item in the questionnaire might be incorrect , because 88 caregivers ( 42% ) reported they did not know . although there is no evidence that extra water intake is useful to treat fc , caregivers need to be concerned about a child 's water intake ( 13 ) . this study is meaningful because we assessed the factors predisposing to fc in daycare centers , where most children spend much of the day . these results could be used in behavioral therapy to prevent fc and to modify precipitating factors in early childhood . notably , this study assessed healthy children in a public environment , while previous studies reported the clinical characteristics of fc in children who visited the hospital with the complaint of constipation or other disorders ( 14 ) . among the items in the questionnaire , the refusal to seek treatment despite recognition of a child 's constipation is meaningful to pediatricians . public education about managing and treating fc is needed and parents must be advised that medication , if needed , could be helpful in an individualized regimen that can vary from months to years . a limitation of the study was the lack of accurate data on the amount of water , meat , and fiber intake provided by 24-hour dietary recall . the item of ' afraid to use the toilet at daycare center ' can be added in the questionnaire for analyzing the bowel habits at daycare centers . to clarify the precipitating factors for fc at daycare centers , multicenter studies with a larger number of children and additional surveys of daycare teachers will be needed . our study determined the predisposing factors for fc in early childhood among the lifestyle and eating habits in the home and in daycare centers . the findings of this study can guide parents , daycare teachers , and clinicians in prevention , early recognition and early intervention for the risk factors associated with fc in young children .	our objective was to determine the risk factors associated with the development of functional constipation ( fc ) in young children attending daycare centers . a cross - sectional survey using a questionnaire based on the rome iii criteria was conducted in children aged 25 to 84 months from 3 randomly selected daycare centers in january 2016 . the items in a questionnaire were statistically compared in the constipated and non - constipated groups . a total of 212 children were included and fc was found in 8.5% . multivariate logistic regression analyses revealed that maternal history of constipation ( odds ratio [ or ] = 4.1 , 95% confidence interval [ ci ] 1.2 - 13.9 ) , history of painful defecation before age 1 ( or = 10.4 , 95% ci 1.1 - 101.3 ) , history of painful defecation during toilet training ( or = 28.9 , 95% ci 1.9 - 423.8 ) , no or difficult defecation at a daycare center ( or = 5,804.6 , 95% ci 134.4 - 250,718.4 ) , no meat consumption ( or = 10.1 , 95% ci 1.2 - 88.1 ) , and 500 ml or less of water intake per day ( or = 9.9 , 95% ci 0.9 - 99.5 ) were powerful predictors of fc in young children ( p < 0.05 ) . additionally , the constipated group was significantly associated with 2 hours or less of outdoor play activities per day , entry into daycare centers before 24 months age , 6 hours or more of attendance at a daycare center per day , breastfeeding for less than 6 months , 3 meals or less per day , and 3 or fewer servings of fruits and vegetables per day ( p < 0.05 ) . the findings of this study can guide parents , daycare teachers , and clinicians in prevention , early recognition and early intervention for the risk factors associated with fc in young children .
You are an expert at summarizing long articles. Proceed to summarize the following text: in recent years a number of proteins have been discovered that contain a macrocyclic backbone consisting of a continuous cycle of peptide bonds . such macrocyclic proteins were unknown a decade ago but have now been discovered in bacteria , plants and animals ( 1 ) . unlike bacterial polyketides and small cyclic peptides such as cyclosporin that are constructed by peptide synthetases ( 2 ) , these new cyclic proteins are ribosomally produced gene products , with backbone cyclization occurring as a post - translational modification . this new class of protein has excited interest because circular proteins have a range of advantages over conventional proteins ( 3,4 ) . at least one class of cyclic proteins , the cyclotides , has been shown to be resistant to proteolysis and to a wide variety of adverse thermal and chemical conditions ( 5,6 ) . furthermore , since the termini of conventional proteins are often flexible , and as the degree of flexibility can be reduced by cyclization , entropic factors can lead to improved receptor binding affinities of circular proteins over corresponding acyclic proteins ( 7,8 ) . these include the cyclic sex - pilin ( 9 ) and three bacteriocins ( 1012 ) from bacterial sources , trypsin inhibitors from sunflower seeds ( sfti-1 ) ( 7,8 ) and the squash plant momordica cochinchinensis ( mcoti - ii ) ( 13 ) , the -defensins from macaque monkeys ( 14 ) and the cyclotides from plants of the violaceae and rubiaceae ( 1517 ) . the cyclotides are by far the largest family of circular proteins and 60 cyclotide sequences have been reported thus far . screening programs suggest that the number of sequences may soon number in the thousands ( 18,19 ) . in addition to this natural diversity , a large number of synthetic mutants , grafted analogues and acyclic permutants of cyclic proteins have been reported , and several proteins of biological interest have been artificially cyclized ( 2022 ) . this growth in information necessitates a collation of sequence / structure / function data and the development of a uniform nomenclature to prevent duplication of research and multiple naming schemes . furthermore , sequence searching of cyclic proteins adds an extra layer of complexity , with most sequence searching tools assuming a linear sequence of amino acids . because backbone cyclization is a seamless post - translational modification , the location of the n- and c - termini can not be determined from the mature sequence alone . consequently , when searching cyclic sequences , the point at which the sequence begins and ends in the database is often arbitrary and may confound traditional searching techniques . the special considerations needed for dealing with cyclic sequences and the rapidly expanding data on their structure and function has led us to develop a curated database and web - based information source for cyclic proteins called cybase . cybase incorporates a mysql database that contains a repository of information on the amino acid and nucleic acid sequence , structure and activity of cyclic proteins . the layout of the database is shown in figure 1 . at the core of the database related to each protein table entry are tables containing information on nucleic acid sequences , structure , activity and literature references . a web - based interface provides access to the information and allows for text - based searching on all data fields and filtering of results by class , source , activity or other attributes . to account for the cyclic nature of the sequences any sequence search uses a concatenation of two copies of the linear representation of the sequence to simulate a cyclic protein . each protein has a dynamically produced sequence card , which provides cross - links to activity , nucleic acid sequence and structural information contained in the database . as the database is intended to supplement existing biological databases , links to uniprot knowledgebase , genbank and pdb are available for each entry and linkage with the knottin website ( 23 ) is planned . a number of other tools are provided , including coloured alignments and calculation of amino acid frequencies of selected sequences . in general , naturally occurring cyclic proteins are small , with the largest possessing 78 amino acids . this small size makes the combination of mass spectrometry , to obtain sequence information , and nmr , to determine 3d structures , ideal for characterizing these proteins . accordingly , to facilitate the rapid characterization of newly discovered proteins the database can be queried on molar mass , and for cyclotides , the capability exists for searching on the mass of fragments corresponding to particular inter - cysteine loops , facilitating sequence determination when utilizing reduction / alkylation of cysteine residues and tandem mass spectrometry ( 24,25 ) . analysis of nmr - derived data such as chemical shifts and patterns of noe connectivity can provide an early indication of the structure of a protein . to facilitate rapid structural characterization of newly discovered cyclic proteins chemical shift and restraint data from nmr - derived structures are included in the database , along with dihedral angle information . from these data , distances and regions containing defined secondary structure are calculated and stored in the database . these data can be presented visually for the analysis of short- and long - range noe patterns , the backbone dihedral angles and chemical shift patterns . although nmr is the most common technique for analysing these proteins , x - ray structures are also incorporated into the database and sets of inter - atom distances calculated for comparative purposes . as with the protein and nucleic acid entries , each structure possesses an information card , which contains cross - links to protein and nucleic acid entries . these provide for the automated searching of sequence databases , using blast , to provide examples of novel cyclic proteins , and ensure quality control by preventing duplication of sequence data and renaming of already characterized sequences , a particularly important consideration for the cyclotide family , which contains potentially many sequences that may occur in a number of different species . these scripts also provide for the standardizing of residue numbering in new cyclotide structures . despite these automations the addition of new entries is performed manually to ensure maximum quality of database entries . we plan to extend the database by utilizing the growing number of cyclotide structures to provide predictions of cyclotide secondary structures based on primary sequence and to develop methods to search the structures in the database based on the similarity between selected inter - atomic distances and noe connectivities . we also plan to improve the information content of the database by including hydrogen bond and other structural information as well as homology models for cyclotide sequences that have not yet been structurally characterized . cybase is available at and given the growing interest in backbone cyclization , it is hoped that cybase will prove to be a useful resource in the field of structural biology .	cybase is a curated database and information source for backbone - cyclized proteins . the database incorporates naturally occurring cyclic proteins as well as synthetic derivatives , grafted analogues and acyclic permutants . the database provides a centralized repository of information on all aspects of cyclic protein biology and addresses issues pertaining to the management and searching of topologically circular sequences . the database is freely available at .
You are an expert at summarizing long articles. Proceed to summarize the following text: it is caused by the protozoan parasite of genus plasmodium and transmitted by the female anopheles mosquito . so far , only 5 of the 170 species of this parasite have been found which are the cause of disease in humans . they consist of plasmodium falciparum , plasmodium knowlesi , plasmodium ovale , plasmodium vivax , and plasmodium malariae . the latest released statistics by december 2014 showed 198 million cases of malaria in 2013 comprised of estimated 584,000 deaths . malaria mortality rates have fallen by 47% globally since 2000 and by 54% in the who african region . since the 17th century , the bark of the cinchona tree which was the source of quinine had been the first effective western treatment for malaria . however , chloroquine replaced it from the 1940s , although quinine is still used under certain circumstances . the resistance against antimalaria drugs is a drawback of standard drugs like chloroquine , sulphadoxine - pyrimethamine , and even artemisinin . cinnamon consists of cinnamaldehyde compounds , volatile oils , tannins , mucilage , limonene , and safrole that possesses antibacterial , antiseptic , antiviral , and antifungal properties . senhaji et al . in 2005 tested different extracts of cinnamon like the aqueous , hexane , methanol , and ethanol on gram positive and negative bacteria as well as yeast , leishmania , and toxoplasma with positive results . more recently , nkanwen and colleagues in 2013 tested the bark of cinnamon for antiplasmodial activity and found that it had an inhibitory effect on plasmodium falciparum enoyl - acp reductase enzyme . metabonomics is the recent omics that studies simultaneously all the metabolites and small molecules in biological fluids , cells , and tissues . it uses high throughput technology like h nuclear magnetic resonance ( hnmr ) and liquid chromatography mass spectrometry ( lc - ms ) . it plays the most important role in direct observation of the physiological status of an organism or the cell and is a faster and more affordable way of testing drugs and their mechanism of action . earlier studies have reported antiplasmodial effect of cinnamon extract and its result on one of its enzymes . it was decided to study the metabolome of plasmodium falciparum after exposure to cinnamon extract by hnmr spectroscopy . cinnamomum cassia obtained from mumbai , india , were ground into a fine powder . 50 grams of cinnamon powder was dissolved in 500 ml of distilled water and boiled for 3 hours and then filtered through a gauze . the obtained extract was concentrated into an oily extract using a rotary machine and then lyophilized to 12.48 grams of cinnamon powder . briefly , the parasites were cultured in 7 ml rpmi 1640 medium with 5% serum , 10% hematocrit , hypoxanthine , and gentamicin ( complete medium ) in 75 ml flasks . the medium was changed every 48 h and flasks were incubated at 37c with 5% co2 , 5% o2 , and 90% n2 . large - scale cultivation of plasmodium falciparum for metabonomics was carried out by the method modified by radfar et al . with 24 h changes of 75 ml of complete medium enriched with 5% albumax and 0.5% hematocrit . daily monitoring of the culture assisted in increasing its parasitemia to 60% and the ic50 dose of cinnamon extract . after 48 hours , they were harvested by centrifugation at 800 g for 5 min . parasites reaching 5% were then diluted to reduce the parasitemia to 0.5% , and the haematocrit was adjusted to 1.5% . this suspension was then added ( 100 l per well ) to microplates predosed with 90 l of different concentration of cinnamon or artemisinin and incubated for 48 hours at 37c in mixed gas of 5% co2 , 5% o2 , and 90% n2 ; after that thin smears were prepared from each well , stained with giemsa stain for determination of percentage of parasitemia and ic50 detected by microscopy . parasites were isolated by adding 40 times the volume of 0.02% saponin in phosphate buffered saline ( pbs ) on ice for 30 min and then centrifuged at 4,000 g for 20 min at 4c . the cells were washed three times with 1xpbs and pellet collected by centrifugation in the above conditions and final centrifugation was carried out at 14,000 g for 5 min at 4c ; the cells were counted in a hemocytometer and stored at 20c . the samples containing parasites sonicated in a sonifier ( soniprep 150 ) at 9 khz for 5 min in pulse were then centrifuged at 10000 g for 10 min , and the pellet dissolved in 200 l of 1.8 mm cold perchloric acid and ph adjusted by addition of 5.4 m koh to 6.8 and kept on ice for 60 min to precipitate the acid . the parasite extract was then centrifuged for 10 min at 10,000 g and the ph once again adjusted to 6.8 and lyophilized . 1 ml of d2o and 0.01% tsp was added to the lyophilized powder and spectroscopy was performed using 2-dimensional noesy ( nuclear overhauser spectroscopy ) conditions . the spectra from hnmr were fourier transformed by mestrec software . to obtain regression values , the variables of the signal intensities and chemical shifts were integrated and were inserted into the excel file . pls is a supervised method to obtain a model using regression in multivariate techniques via linear combination of original variables in which x is the normal intensities from the hnmr spectra and the y matrix comprises 0 for cinnamon treated and 1 for controls . orthogonal signal correction ( osc ) filters removed noise from the spectrum ; only one factor was removed and pls was applied after osc . metabolites corresponding to these resonances were then identified using chemical shift assignments of spectra of differentiating metabolites of sera based on comparison with chemical shifts of metabolites in human metabolite database data bank ( hmdb ) ( http://www.hmdb.ca/metabolites ) and in other published data . the lyophilized cinnamon was redissolved in rpmi medium and tested on 5% plasmodium falciparum and ic50 of 1.25 mg / ml was obtained with significance p < 0.001 ( figure 1 ) . parasite extract obtained from large - scale cultivation of plasmodium falciparum was analyzed by hnmr . the spectra of the cinnamon treated pasmodium falciparum and controls were superimposed in figure 2 . the chemical shifts ( ppm ) of the spectra were converted into figures and then analyzed using osc - pls in matlab . the metabolites were entered into the metaboanalyst database and differentiating metabolic cycles were recognized ( figure 6 ) . cinnamon has ic50 of 1.25 mg / ml on plasmodium falciparum in vitro with ic50 of 1.25 mg / ml obtained with significance p < 0.001 . the altered metabolites comprise succinic acid , glutathione , l - aspartic acid , beta - alanine , and 2-methylbutyryl glycine ( table 1 ) . the most significant biochemical pathways which have changed are discussed below ( figure 6 ) . the alanine , aspartame , and glutamate pathway which is one of the amino acid cycles is the first one to be affected . there are very early reports about the ability of the parasite to fix carbon dioxide and then synthesize alanine , aspartame , and glutamate . but amino acid uptake by the parasite from the infected erythrocytes is confirmed . when culturing plasmodium falciparum in vitro seven amino acids have to be supplied exogenously ; they are isoleucine , methionine , cysteine , glutamate , glutamine , proline , and tyrosine . proteases act on amino acids especially aspartic proteases , as probable drug targets till a few years ago . it is seen that cinnamon affects the parasite 's amino acid biosynthesis essential for its survival . the second most important pathway affected is pantothenate and coenzyme a biosynthesis associated directly with the tricarboxylic acid ( tca ) cycle . reports have shown that infected human erythrocytes exhibit higher coenzyme a biosynthesis than uninfected ones . human erythrocytes are capable of complete synthesis of pantothenate and coa unlike rat and avian erythrocytes . cinnamon affects this cycle which is imperative in tca and requires the carriage of carbons within the cell and entry of pyruvate to the tricarboxylic acid ( tca ) cycle . it was thought that plasmodium falciparum utilized glucose in an unconventional manner , but further work by metabolic approaches has proved that both asexual and sexual blood stages utilize a conventional tca cycle to catabolize glucose and glutamine [ 23 , 24 ] . the next important cycle to be affected is lysine biosynthesis which has been reported in the parasite , plasmodium falciparum . lysine is generally implicated in posttranslational modifications and is also involved in diverse cellular functions . high throughput technology has identified 421 acetylation sites in 230 proteins in the human malaria parasite plasmodium falciparum during its active proliferation in erythrocytes . lysine - acetylated proteins are distributed in the nucleus , cytoplasm , mitochondrion , and apicoplast . there are also reports of histone lysine methylation , regulated by methyltransferases and demethylases , which play an important role in chromatin structure and gene expression in a wide range of eukaryotic organisms . the set - domain protein methyltransferase superfamily includes all but one of the proteins known to methylate histones on lysine . bioinformatic analysis has shown that nine set - domain - containing genes were found in the malaria parasite plasmodium falciparum and its sibling species . most set - domain genes and histone methyl - lysine marks displayed dynamic changes during the parasite asexual erythrocytic cycle , suggesting that they constitute an important epigenetic mechanism of gene regulation in malaria parasites . they are considered as recent targets for designing of antimalarial drugs and cinnamon extract affects them . glutathione metabolism is the last and most important cycle which has shown a change in the metabolome of plasmodium falciparum to cinnamon . it is reported that plasmodium falciparum employs a complex thioredoxin and glutathione system based on the thioredoxin reductase / thioredoxin and glutathione reductase / glutathione couples . plasmodium falciparum thioredoxin reductase reduces thioredoxin and a range of low molecular weight compounds , while glutathione reductase is highly specific for its substrate glutathione disulfide . since plasmodium spp . lack catalase and a classical glutathione peroxidase , their redox balance depends on a complex set of five peroxiredoxins differentially located in the cytosol , apicoplast , mitochondria , and nucleus with partially overlapping substrate preferences . moreover , p. falciparum employs a set of members belonging to the thioredoxin superfamily such as three thioredoxins , two thioredoxin - like proteins , a dithiol and three monocysteine glutaredoxins , and a redox - active plasmoredoxin with largely redundant functions . it is seen that glutathione metabolism is disturbed by the cinnamon extract . it can be concluded that cinnamon has an inhibitory effect on plasmodium falciparum in vitro with ic50 of 1.25 mg / ml with significance of p < 0.001 . the altered metabolites are succinic acid , glutathione , l - aspartic acid , beta - alanine , and 2-methylbutyryl glycine and the main metabolic cycles affected were alanine , aspartate , and glutamate pathway , pantothenate and coenzyme a biosynthesis , lysine biosynthesis , and glutathione metabolism , all of which are important as drug targets .	malaria is responsible for estimated 584,000 deaths in 2013 . researchers are working on new drugs and medicinal herbs due to drug resistance that is a major problem facing them ; the search is on for new medicinal herbs . cinnamon is the bark of a tree with reported antiparasitic effects . metabonomics is the simultaneous study of all the metabolites in biological fluids , cells , and tissues detected by high throughput technology . it was decided to determine the mechanism of the effect of aqueous extract of cinnamon on the metabolome of plasmodium falciparum in vitro using 1hnmr spectroscopy . prepared aqueous extract of cinnamon was added to a culture of plasmodium falciparum 3d7 and its 50% inhibitory concentration determined , and , after collection , their metabolites were extracted and 1hnmr spectroscopy by noesy method was done . the spectra were analyzed by chemometric methods . the differentiating metabolites were identified using human metabolome database and the metabolic cycles identified by metaboanalyst . 50% inhibitory concentration of cinnamon on plasmodium falciparum was 1.25 mg / ml with p < 0.001 . the metabolites were identified as succinic acid , glutathione , l - aspartic acid , beta - alanine , and 2-methylbutyryl glycine . the main metabolic cycles detected were alanine and aspartame and glutamate pathway and pantothenate and coenzyme a biosynthesis and lysine biosynthesis and glutathione metabolism , which are all important as drug targets .
You are an expert at summarizing long articles. Proceed to summarize the following text: the trunk midline is the reference for orientation of the body in space and is the point of comparison for the synthesis of all tactile , kinesthetic , and pressure - related information from the two sides of the body1 . thus , the trunk midline can be considered the axis of symmetry around which the body organizes motor behavior2 . the corpus callosum is the principal interhemispheric commissure , and its functions include the exchange of information between the two central hemispheres and integration of the inputs that reach one or both of them3 . all somatosensory callosal connections appear to provide a common anatomical substrate : this phenomenon is known as midline fusion . the body regions that are represented in the callosally connected zones of the first somatosensory area ( si ) were identified as the midline of the somatosensory space4 . the subjective vertical midline of the body is the result of multisensory integration of vestibular , proprioceptive , visual , and tactile afferences5 , 6 . meilinger and colleagues hypothesized that every alteration of these afferences produces an abnormal representation of the body system , which receives incoherent information , and answers in a reflex and primitive manner7 . the integration of spatial information that is perceived8 , 9 from different viewpoints is a common yet largely unexamined cognitive ability10 , 11 . locomotion is supported by additional content , which is closely related to behaviors , such as modulation of the gait cycle , from vision control12,13,14 . as logan and colleagues have pointed out , frequency response functions between visual scene motion ( input ) and trunk kinematics ( output ) change very little or not at all with gains in trunk orientation in the standing posture and under walking conditions15 , 16 . there is evidence of a correlation between heading and the rate at which strategic modifications in trunk yaw decrease , because adaptive recalibration of locomotor trajectory using optic flow stimuli depends on the rate at which the kinematic variability that is associated with strategic control is reduced15 . however , logan and colleagues consider that the increased gain reflects a decline in stability , due to a change in the control problem from standing to locomotion . keeping the body upright with the use of vision during walking when vision is deprived , subjects operate not according to a pre - established pattern of action but in relation to its internal representation of the previously seen target . visual feedback allows a subject to have the same gait patterns in various surroundings , whereas visual deprivation has environment - specific effects on gait dynamic stability16 . the significance of visual feedback underscores its importance in pathological conditions , such as patients with post stroke hemiplegia who might be unable to adapt to changing visual or surface conditions17 . iosa and colleagues reported that the surrounding environment influences the performance of subjects who are asked to walk toward a memorized target . when fewer external cues were available , participants relied more on information on body mechanics and body feedback to complete the task accurately . conversely , in a small indoor environment that was rich in environmental cues , subjects perceived the target as a finish line that was not to be overshot18 . mohapatra and colleagues indicated that under blindfolded conditions , anticipatory postural adjustments are not generated . they proposed that the increased emg activity in leg and trunk muscles after a perturbation , indicating lower postural stability , reflects a lack of anticipatory postural adjustments ( and relative compensatory postural adjustments ) when vision is unavailable19 . other research suggests that the priority of whole - trunk control in the mediolateral direction is higher than in other directions and is linked to attention , whereas whole - trunk control in the vertical rotation and anteroposterior directions is passively regulated and requires minimal attentional control20 . as recently demonstrated in chronic pain conditions , alterations in somatosensory perception can change the body s sense of posture21 . the possibility of training a subject to understand his position with respect to the gravitational axis through a specific cutaneous training program opens new avenues in body posture perception and action22 . also , the maintenance of chronic low back pain is linked to a disorder of altered perception of the trunk23 . perceptual surfaces ( pss ) reduce static and dynamic balance impairments , even in patients with parkinson disease ( pd)24 . the function of the trunk is crucial in pd : other studies have shown how vibrotactile biofeedback of the trunk improves postural stability in pd25 . thus , multiple sensory stimuli contribute to conscious awareness of the body , but the manner in which the central nervous system constructs and updates the body schema after injury or on visual deprivation is unknown . for example , pereira and colleagues demonstrated that local muscle vibration does not improve the sit - to - walk performance of healthy young adults26 . the purpose of this study was to determine the effects of tactile and proprioceptive sensory stimulation of the back on perception of the body midline and on the capacity to walk toward a memorized distance without vision or trunk stability in healthy subjects . we hypothesized that training individuals perceptive capacity ( pressure and somesthetic sensation ) by providing dedicated instruction that is based on cognitive exercises that are performed using a specific rehabilitative tool would modify their estimation of walking distance and upright gait stability . ten healthy subjects ( mean age 31.90 2.47 years , mean weight 64 11.4 kg , and mean height 170.4 7.56 cm ) were recruited and matched with 10 healthy control subjects ( mean age 30.5 2.8 years , mean weight 65 10.20 kg , and mean height 169.5 8.40 cm ) . the subjects gave their informed consent to participation in the study , and approval was obtained from the local ethics committee of the s. lucia foundation ( n ce - prog 266 - 09 ) . the subjects were asked to perform an experimental indoor test wearing comfortable shoes that they usually wore , not specialty shoes , such as boots , ballet shoes , high heels , and flip - flops . we examined the subjects abilities to perceive and estimate the length that they were required to walk over a given distance in an indoor environment . the subjects had to walk toward a memorized target 3 m , 6 m , or 10 m from a reference position ( 0 m ) in a 20 by 5 m laboratory , without obstacles on a linear trajectory in the middle of the laboratory , with their eyes closed and prompted by an acoustic signal to begin walking . the environment was quiet , with good natural lighting , and there were no other items or furniture that could serve as external references for the subject . similar to the experiment that was conducted by iosa and colleagues27 , before starting the test , the investigator positioned the subject at 0 m and showed him the distances that were set at 3 m , 6 m , and 10 m to facilitate memorization of the trajectories that the subject had to cover blindfolded . the target was a person who stood on 1 of 3 strips that were placed on the ground 3 m , 6 m , and 10 m from the starting line . the subjects were asked to memorize the position of the target , fixing it for several seconds ; blindfold themselves ; and , after an acoustic signal , walk to the target . participants were asked to stop walking when they believed that they had reached the target . the experimenter promptly warned a subject if he was going to hit a wall . the sequence of the 3 tasks ( 1 for each distance ) was randomized among the subjects . at the end of each test when a subject stopped at one of the targets , a tape measure was used to determine the distance that was traveled and the distance that remained to complete the task . after each sequence , the subject , still blindfolded , was returned to the starting line by the investigator , preventing him from knowing whether an error had been committed to avoid learning opportunities . no side effects were recorded during the test , and the investigator never had to stop a subject . the entire study group was tested before starting treatment with pss ( = t0 ) and after 10 treatment sessions with pss (= tend ) . five randomly chosen subjects repeated the test immediately after the first treatment session of sensory - motor evaluation with pss (= t1 ) to exclude the possible influence of learning of the task . to complete the test , an accelerometer was fixed at the level of the l2/l3 vertebrae with an elastic band ( freesense , sensorize , sampling frequency 100 hz , weight 94 g ) . accelerometry is a technique that generates data on the dynamic stability of gait with regard to movements of the trunk during walking . the accelerometer provided acceleration data of the trunk along the 3 body axes ( anteroposterior , laterolateral , and craniocaudal ) to assess upright gait stability . upright gait stability has been defined as the capacity to minimize upper body accelerations18 . upper body accelerations were analyzed after subtracting their mean values and low - pass filtering at 20 hz , and summarized in terms of acceleration root mean square ( arms ) , which is a measure of acceleration dispersion ( coinciding with the standard deviation due to subtraction of the mean signal ) . we computed the arms for each body axis , to obtain information on upright gait instability18 . the arms was computed for each of the 3 acceleration measures along the 3 body axes and averaged over the 3 values of 3 consecutive steps in the central section of the walking pathway28 . the number of steps that were performed was computed as the number of ap - acceleration negative peaks29 , and the average step length was calculated as the ratio between the distance that was walked and the number of steps ( step length refers to the distance between 2 successive placements of the 2 feet , whereas stride length refers to the distance between 2 successive placements of the same foot , formed by 2 steps ) . the perceptual surfaces protocol ( ps ) stimulation of awareness of the trunk midline is effected using a specific tool , called super ( perceptual surfaces , ps ) , patented in 1997 by ennio spadini ( reference 01291920 , rome , italy ) . super is a therapeutic system that is based on the interaction between a subject s back and a support surface comprised of small latex cones of various dimensions ( height : 38 cm ; base diameter : 24 cm ) and rigidity ( 20 to 60% ) . these cones are applied with their inferior bases on a rigid wood surface through elastic strips , and typically , over 100 cones are used for each session . subjects were asked to lay supine on the surface that was formed by the smoothed apex of these cones , creating reaction forces to the patient s weight , generated by interaction with the cones . the base conformation of the pss comprises blue cones that represent the anteroposterior trunk midline ( 60% rigidity ) , yellow cones that represent the paravertebral , and the remaining areas that are symmetrically adjacent on either side of the midline ( 40% rigidity ) ( fig.1fig . 1.surfaces for perceptive rehabilitation in the basic configuration and below an examples of cones with varying dimensions . ) . we chose this conformation on the basis of the following principles : to provide greater stimulation to the skin of the posterior midline of the trunk ( blue cones with greater rigidity than the yellow ones ) , and to provide symmetrical stimulation to other areas of the body . surfaces for perceptive rehabilitation in the basic configuration and below an examples of cones with varying dimensions . subjects were asked to lie supine on these cones , with their knees and hips flexed , so that their weight was supported by many reaction force vectors , 1 for each cone . these forces generate high pressure in the small areas of contact , resulting in intensive perceptive stimuli . the base conformation allowed us to determine spatial alterations in the back ( subjects with antalgic postures and scoliosis ) , based on the distribution of pressures on the subjects backs and their perception of back pressures ( i.e. , sensory - motor evaluation in the first session ) . subjects were asked to relax and find the most comfortable position , breathing normally . subjects had to recognize the areas of support , indicating the surface of the body that was in contact with a particular area , describing and counting the number of cones , checking the distribution of the load on the bed and correcting it , and paying attention to posture . the subjects reported how they perceived and felt the cones , particularly if the load was distributed uniformly and symmetrically with respect to the trunk midline . after the evaluation session , each subject underwent 10 sessions in 2 weeks ( 5 days per week ) . subjects performed 45 minutes of a cognitive - perceptive task ( divided into perceptual - motor and active phases ) to improve their perception of the trunk and , in particular , their midline . the perceptual phase helps a subject become aware of the position of his body segments with respect to the various cones . the perceptual - motor phase is characterized by growing awareness of the trunk midline . diaphragmatic breathing , associated with retroversion of the pelvis in the expiratory phase , allows the curves of the spine to flatten and the muscles to stretch to increase the support surface . the actual exercise comprises a perceptual task that increases in difficulty , asking the patient to perceive the elasticities and heights of the surfaces . the active phase involves movement of the arms and legs , displacement , and weight control of the trunk and pelvis . the base conformation can be modified during the session to improve contact between the trunk and the surfaces of the cones . at the end of each session , the experimenter examined the interaction between the skin on the back and the surfaces that relieved the hyperemic area on the patient s back . in subsequent sessions , cones with varying elasticities were positioned by the therapist to improve the symmetry of contact between the surface and the patient s back , considering the hyperemia in the previous session . the experimenter measured perception through the symmetry , quality , and uniformity of the supports . empirically , in the static posture after sessions with the pss , the perceptive capacity of the trunk was assessed using quality representation and symmetry , with respect to the line of the spinous processes , of the hyperemic areas that were created by the support with the pss . quality was defined as the magnitude of the hyperemic area that is left by the cones on the skin and signs of pressure from the cones that remain on the skin of the trunk . the aim was to improve the subjects abilities to recognize , perceive , and discriminate the trunk midline and enhance their sensory experience . in the control group , subjects were asked to lay supine with the knees and hip flexed . subjects were asked to relax and find the most comfortable position , breathing normally . lumbar exercises were performed : lumbar bridging , lumbar pelvic tilt and hamstrings and piriformis supine stretching . all measures were continuous and distributed normally ( lilliefors test ) ; thus , parametric statistical methods were employed . to compare the results between pre- and post - treatment performances , repeated - measures analysis of variance was performed using time ( pre- vs post - treatment or first vs second assessment ) and distance ( 3 m , 6 m , or 10 m ) as the main factors , and axis ( ap , ll , or cc ) as an added factor when acceleration was analyzed . before treatment , the subjects displayed the greatest errors in walking 10 m , followed by walking 6 m and 3 m. this error was always negative : subjects tended to walk less distance than required . by analysis of variance , there was a significant effect of time ( pre- vs post- treatment , f=5.968 , p=0.037 , observed power 59% ) and distance ( f=8.055 , p=0.012 , observed power 91% ) but not of their interaction ( f=2.977 , p=0.108 , observed power 36% ) . the reduced error was related to a longer distance being walked , which was founded on longer steps ( in mean + 5% ) and more steps performed ( in mean one more ) . although step length and number of steps did not improve significantly over time ( analysis of variance , p>0.05 for both ) , their combination significantly improved the subjects performances . there were no significant changes in the error in walking distance estimates among the subjects who repeated the test immediately after the first treatment session ( effect of trial : f=0.374 , p=0.574 ) ; the absence of visual and verbal feedback did not allow the subjects to correct their mistakes . non - significant differences in these errors were observed at tend in those who undertook the test for the second time at t1 or at tend . despite the general increase in speed and acceleration after treatment , their changes were not statistically significant ( table 1table 1.mean and standard deviation of the gait parametersparameterstime3 m6 m10 merrors ( m)t00.150.110.700.291.570.45tend0.050.110.130.180.330.29ws ( m / s)t00.840.200.820.130.680.18tend0.890.200.880.150.720.15step length ( m)t00.430.090.510.090.520.09tend0.460.100.530.090.550.05number of stepst071102162tend71112171arms - ap ( m / s)t01.160.351.230.321.180.27tend1.200.331.350.421.330.29arms - ll ( m / s)t01.150.431.140.301.090.22tend1.170.391.320.501.260.31arms - cc ( m / s)t01.400.561.600.511.470.37tend1.400.401.730.521.750.43 ) . time did not affect self - selected walking velocities pre- and post - treatment ( f=2.924 , p=0.121 ) . subjects walked slower over the 10-m distance than over the other 2 distances ( factor distance : f=15.734 , p<0.001 ) , without any significant interaction with time ( f=0.067 , p=0.935 ) ( table 1 ) . similarly , by analysis of variance of arms values along the 3 body axes ( table 1 ) , there were no significant effects of time , pre- versus post - treatment ( f=2.091 , p=0.182 ) , or distance ( f=2.454 , p=0.114 ) ; only axis had a significant effect ( f=11.689 , p=0.001 ) , with greater acceleration along the cc axis . the interactions of time and distance ( f=1.963 , p=0.169 ) and between time and axis ( f=0.141 , p=0.869 ) were not statistically significant . the purpose of this study was to determine whether a training program that is based on tactile and proprioceptive sensory stimulation of the trunk , performed using perceptive surfaces , modified the locomotor body schema and improved estimation of walking distance and upright gait stability . after treatment with perceptive surfaces , the distances that were traversed were closer to the target than those before treatment , because the subjects increased their awareness regarding perception and estimation of the walking body . there was a non - significant increase in trunk acceleration , which were likely related to the increase in gait speed30 , after training31 . the concept of the trunk having a fundamental dynamic function during walking is a recent model . until the 1990s , the trunk was considered to be a static passenger unit of a locomotor apparatus that was located primarily at the lower limb level34 . our study shows that tactile and proprioceptive stimulus of the trunk , with a new rehabilitation tool , can influence the behavioral pattern of locomotion . in particular , the most important result of our study was that stimulation of the trunk improved the ability of the locomotor body schema to walk toward a memorized target without visual support . this result is in conflict with the older model , in which the lower limbs are a locomotor unit and the upper part of the body is merely a passive passenger5 . our findings are consistent with a recent suggestion that the upper body has an active function during walking32 . thus , our results suggest that the locomotor body schema includes the upper body not just the lower limbs . in this model , the cns integrates many sensory inputs visual , vestibular , cutaneous , gravito - inertial , and proprioceptive inputs to compute spatial and body coordinates during a walking task , assigning a different weight to each input , depending on the environment and the constraints in which the movement is performed33,34,35 . shenton suggested that proprioceptive inflow is an important sensory input in the online representation of the body in space36 , and that the processing of proprioceptive information is context - dependent37 . the presence of a body schema has been well described , as has the function of the location of tactile stimuli on body surfaces in promoting a body schema during the spatial representation of the body ( position ) and walking ( locomotor body schema)38 . the perception of tactile stimuli and proprioception is critical for conveying information about the relative positions of body parts when assuming a posture or during walking . the decrease in perception , for example , during pain conditions could drastically change the body schema39 , 40 . two studies of patients with chronic and non - specific low back pain reported that training with perceptual surfaces ( pss ) , targeting back midline perception , reduces pain41 and improves postural control42 . how the body schema is generated in the cns is unclear , but we know that the body schema and sensory information interact ; thus , their conflict might generate pain , as shown in the experiment conducted by mccabe and colleagues using healthy volunteers43 . furthermore , the position of the body ( sitting or standing ) might alter the accuracy of the imagination of movements ( i.e. , mental simulation of an action without its actual execution ) such as walking44 . trunk biomechanics and thus trunk movement perception and action are fundamental for establishing self - body representation ( position ) , and during body movement , efficiency of the locomotor body schema37 . our proposed exercise , the use of the trunk midline , and tactile and proprioceptive stimulation of the trunk enhance the locomotor body schema by generating more accurate information regarding trunk perception , the trunk - body midline , and gravity perception , and the interaction between trunk - body midline perception and space during a specific task . this enhancement in the locomotor body schema is a likely reason why the subjects displayed fewer errors in estimating walking distances after the intervention . that the subjects showed no improvement in estimating errors in a second evaluation ( after the first session ) indicates that the learning effect was negligible during repetition of the task thus , the improvements are likely attributable to the increase in movement perception during walking ( locomotor body schema ) while blindfolded . the blindfolded walking test is a complex task in which perception of the distance that has been walked should match the actual distance that is covered without visual correction . as reported by schmidt , better trunk proprioception improves the efficiency of walking while blindfolded . schmidt and colleagues applied vibratory stimuli if the trunk muscle spindle noted changes in the trajectory direction during walking , even in the presence of vision45,46,47,48 . overstimulation of perceptual and proprioceptive trunk sensory information , as occurs during trunk muscle vibration , might disrupt the steering of locomotion49 . this was likely due to enhanced trunk proprioception , which was the target of our training program . further studies should confirm these preliminary results and our hypothesis with more rigorous experiments and a larger sample . our study highlights the importance of trunk perception in computing egocentric space information during body locomotion . an example of the relative dependence of postural control on visual , vestibular , and somatosensory inputs was discussed by horak and nashner , who measured changes in postural sway in the standing position . they proposed that the apparent displacement of visual information and postural vertical input was the result of a recalculation of the central orientation of the gravity vector , based on a model in which the central nervous system extracts and interprets afferent information to construct a picture of reality ( motor imagery)50 . before treatment , subjects made errors that were proportional to the distance that was to be traveled . the mistakes were always negative : subjects tended to choose a shorter distance than the distance required . this pattern might be due to fear of hitting a wall or the ground , resulting from decreased body perception during walking ( the locomotor body schema ) . this hypothesis is supported by the finding that before treatment , subjects walked with shorter steps , which is typical of people who are fearful of falling51 , and of those with reduced somatosensory information , as might occur during indoor blindfolded walking29 . our results reinforce the hypothesis that working on the representation of the midline and motor imagery of the trunk creates a bridge between perception and movement , which can give rise to new functional strategies52 . blindfolded subjects evaluate movements better , because the motor patterns that are learned for ambulation , compared with specific tasks , can be affected by and depend on visual representations of the same image and are related to motor imagery , which is linked to somesthetic perception . our results also show that after training , upright gait stability was unchanged , likely because upright gait stability is modified in pathological walking pattern conditions to a greater extent than in healthy subjects30 . but , this hypothesis should be confirmed with an ad hoc sample with pathological conditions and age - matched healthy subjects . this study had several limitations , such as the absence of a control group ; however , the repetition of the test immediately after the first treatment session should eliminate any suspicion of a bias linked to the learning effect . furthermore , our small sample size did not allow us to examine the differences between genders29 , 53 , only within - subject comparisons were made pre- and post - treatment . we did not plan to measure lateral errors , but we noted lateral deviations during the tests . also , we did not measure joint kinematics during walking , losing important information , especially with regard to the function of the hips . finally , a potential bias of our test was the learning effect . although we did not find statistically significant differences in the performance of subjects who were tested and immediately retested , the absence of significant differences could be due to the reduced sample size ( 5 subjects ) with which this sub - analysis was performed . nevertheless , the values of their performance during the retest were similar to those that were recorded in the first test , suggesting the absence of any effect . the potential bias of learning should be taken into account , and the interpretation of our results should be made with caution . in light of our results , future studies in this field should be performed with larger sample sizes to determine whether perceptive rehabilitation , integrated into traditional rehabilitation programs , improves locomotor body awareness and enhances stability and walking performance in pathological conditions ( e.g. , stroke , ataxia , cerebral palsy , juvenile idiopathic scoliosis , and low back pain ) . in conclusion , this pilot study demonstrated that perceptive stimulation of the trunk midline improves the estimation of walking distance , implicating the upper body in the locomotor body schema .	[ purpose ] recently , there has been growing interest in the somatosensory system , but little data exist on the interaction between dynamic postural control and the somatosensory system . the purpose of this study was to determine whether a training program , based on tactile and proprioceptive sensory stimulation of the trunk with the use of perceptual surfaces , improved the estimation of walking distance by healthy subjects , the ability to walk toward a memorized distance without vision , and whether it increases upright gait stability . [ subjects and methods ] ten healthy subjects with a mean age of 31.9 2.5 years were enrolled and participated in 10 daily sessions of perceptive training using perceptual surfaces , for 45 minutes each session . an experimental indoor test measured the subjects ability to perceive walking distances to a memorized target in an indoor environment . [ results ] after treatment , the distances that were traversed were closer to the target than before treatment . trunk acceleration did not differ significantly between pre- and post - training and did not increase significantly after training . [ conclusion ] treatment with perceptual surfaces stimulating the trunk midline improves the estimation of walking distance and modifies proprioceptive gait patterns , allowing various corrective strategies to be implemented during ambulation .
You are an expert at summarizing long articles. Proceed to summarize the following text: the aim of this case report was to study that headache maybe the initial symptom in rasmussen 's syndrome ( rs ) . we studied a case of rs in which the patient experienced a recurring headache for about one year prior to the onset of partial seizures . magnetic resonance imaging ( mri ) results were normal when the headache first occurred and showed left brain atrophy three years later . it was difficult to relieve the patient 's headache , even once seizures were controlled . rasmussen syndrome ( rs ) , also called rasmussen 's encephalitis , is a chronic t - cell - mediated disorder that usually affects one cerebral hemisphere , and that typically presents in childhood . in 2005 , a panel of experts established formal rs diagnostic criteria . the nonspecific prodromal period lasts for about 7 months ( range : 0 months to 8 years ) and may involve mild signs and symptoms , typically including low frequent focal onset seizures and rarely mild hemiparesis . in the subsequent acute phase , which lasts for about 8 months ( range , 48 months ) , frequent focal onset seizures occur , sometimes presenting with epilepsia partialis continua ( epc ) , accompanied by progressive cortical dysfunction . finally , patients in the residual stage exhibit stable neurologic deficits and continuation of seizures . however , some cases involve atypical features , manifesting absence or delayed - onset seizures , and dual pathology , suggesting that focal onset seizures are not necessary for rs diagnosis . we reported a case of rs in a child who presented with the initial onset of headache , and who later was admitted to the hospital several times with the chief complaint of headache , even after her seizures were controlled . a nine - year - old girl with normal development presented with a headache and a feeling like her whole head was expanded without localizing characteristics , unaccompanied by nausea or vomiting , and having no obvious etiology about five years ago . the headache was mild and could remit spontaneously , but repeat about five times , each time with a duration of about 15 days . one year after the onset of headache , this patient experienced a headache that lasted for several hours , with a 2-minute generalized tonic after this incident , the patient frequently experienced focal motor seizures involving the right lower limb without losing consciousness . electroencephalograph ( eeg ) confirmed the presence of epileptiform discharge with increased slow waves in the whole brain without focal abnormalities . epilepsy was diagnosed , and levetiracetam ( about 20 mg / kg / d , twice a day ) was prescribed . the patient 's symptoms showed no improvement after taking oral levetiracetam for about two months . at this time brain mri revealed abnormal signal foci in the left frontal cortex , and eeg showed diffuse slowing with epileptiform discharge in the left hemisphere . lumbar puncture revealed normal cerebral spinal fluid ( csf ) cell count , protein , glucose , chloride , and cryptococcal meningitides . blood test results were normal for ceruloplasmin , lactic acid , ammonia , immunoglobulins ( iga , igm , igg ) , rheumatoid factor ( rf ) , antistreptolysin o ( aso ) , c - reactive protein , autoantibody to nuclear antigen ( ana ) , extractable nuclear antigen ( ena ) , and autoantibody to double - stranded dna ( anti - dsdna ) were negative . rasmussen syndrome ( rs ) was diagnosed according to the diagnostic criteria ( part a ) . the patient received iv methylprednisolone ( 25 mg / kg / d ) pulse therapy for three days and intravenous immunoglobin ( ivig , 400 mg / kg / d ) for five days . the patient also received oral prednisone ( 1 mg / kg / d , three times a day ) , carbamazepine ( 10 mg / kg / d , twice a day ) , and phenobarbital ( 10 mg / kg / d , three times a day ) for seizures , and oxycodone acetaminophen ( oxycodone 5 mg with acetaminophen 325 mg per tablet , one tablet three times a day as needed ) for headache . after about five months , the seizures stopped , and the patient 's parents discontinued the patient 's antiseizure medication without consent from the doctors . after approximately half a year without headache and focal seizures , the headache and focal seizures resumed . occasional skin rash developed when the patient was treated with carbamazepine , and this was a reason for the discontinuation of treatment . the patient was then prescribed sodium valproate sustained release tablets ( 20 mg / kg / d ) and oxycodone acetaminophen ( one tablet three times a day as needed ) , with follow - up every three months , and with blood concentration of sodium valproate maintained at around 90 g / ml . 1a ) showed atrophy of the left frontal temporal lobe and deep gray matter , large patchy hypointensities on t1 and increased t2 signals , and bilateral ventricular enlargement . the headache disappeared and the patient was seizure - free for about 2 years and 6 months , at which time the treatment with sodium valproate and oxycodone acetaminophen was stopped . after about 6 months without symptoms , the headache resumed , and the patient was hospitalized again . the headache was mild to moderate and could be tolerable , and only localized in the left unilateral head region . at this time 1b ) revealed atrophy of the left cerebral hemisphere , with this space occupied by abnormal t1 and t2 signals , as well as enlargement of the third and fourth ventricles and the left ventricle . physical examination showed clear consciousness ; dysarthria ; defects in calculation ability ; weakness of the right lower limb ; decreased grip strength of the right hand ; slightly enhanced muscular tone of the right limbs ; and normal movement , strength , and muscular tone in the left limbs . the patient 's right babinski sign was positive , and the left one was negative . a consulted neurosurgeon advised that the patient was not an optimal candidate for surgical treatment . because of concerns regarding side effects of corticosteroids , ivig ( 400 mg / kg / d ) was administered for 5 days with the informed consent of her parents . the headaches eased , but dyskinesia in the right limbs remained , and oral oxycodone in rs , the initial damage to the brain is mediated by t cells and microglia , and there may be a window for treatment if rs is diagnosed early enough . inflammatory processes observable with mri can support an rs diagnosis , and early diagnosis may be easier in typical cases that closely align with the diagnostic criteria . on the other hand , diagnosis remains challenging in some atypical cases , as there are not yet diagnostic biomarkers available . in our present case , the patient suffered from headaches for about one year prior to her first focal seizure . headaches without functional loss are very common among children and are often due to migraines in the absence of abnormalities upon ancillary testing . thus , a diagnosis of rs was not suspected in our case during the first year . we can not confirm that the headaches in our case were specifically symptoms of rs , but some pathogenic factors for rs may also stimulate headaches . it is possible that some cases of rs may have the same pathogenesis as some headaches , and that analyzing headaches in rs may represent a new route to clarifying rs pathogenesis . the headache could appear and disappear without treatment at the start , and then became a concomitant symptom when the patient was diagnosed with epilepsy . when the headache relapsed the third time , it was hard to tolerated , and then oxycodone acetaminophen was prescribed . oxycodone acetaminophen ( oxycodone 5 mg with acetaminophen 325 mg per tablet ) has multimodal analgesia through a combination of an opioid ( oxycodone ) with a nonopioid ( acetaminophen ) component . the intensity and frequency of headache were decreased , and the patient was headache free after about two weeks . immunomodulatory treatments , such as corticosteroids and/or ivig , appear to slow but not halt disease progression , without substantially changing the eventual outcome . during the first year in our case , headaches without any concomitant symptoms could be relieved by rest , like migraines , and did not show any specific characteristics indicating their cause . thus , these headaches could not be identified as prodromal symptoms of rs at that time . only once seizures occurred during the headaches did we consider that rs and the headache were symptoms of the same disease . from then on , headaches and focal seizures were due to the same complaints and , over time , the headache could no longer be relieved without medication . in the final stage , based on the evolution of the headache with the disease progression , we conclude that the initial headache was a presenting symptom of rs . here , we reported an rs case that started with repetitive headaches , adding to the current body of knowledge about rs . rasmussen syndrome ( rs ) without seizures is considered a potentially under - recognized cause of progressive unilateral neurological deficits in childhood . thus , it is important to diagnose atypical cases , even if we can presently only delay but not halt rs progression . this requires recognizing early possible signs and making follow - up observations . in our case , follow - up was inadequate for the first two years because the patient 's parents did not understand the natural history of the disease process . regular follow - up was performed only after confirmation of cerebral lesions identified on brain mri . because of the outcome of rs , in cases involving differential diagnoses of headaches , it is important to consider some rare diseases , such as rs . we think that follow - up for headache patients is important to verify the cause or diagnosis . in our experience , we suggest that repeated brain mri and eeg examinations should be considered to re - evaluate the headache causes even when the examinations were normal previously . in addition to re - evaluating patients with ancillary testing when new symptoms arise such as with new onset seizures . our single case can not serve as an example of what is typical , but our observations suggest that the initial syndrome of rs may involve only headache . though while rs is not presently curable , we hope to help promote early diagnosis and prompt treatment to delay disease progression .	objectivethe aim of this case report was to study that headache maybe the initial symptom in rasmussen 's syndrome ( rs).introductionheadache has not yet been reported as prodromal symptom.methodswe studied a case of rs in which the patient experienced a recurring headache for about one year prior to the onset of partial seizures.resultsmagnetic resonance imaging ( mri ) results were normal when the headache first occurred and showed left brain atrophy three years later . it was difficult to relieve the patient 's headache , even once seizures were controlled.conclusionsthis case demonstrates that the initial symptom of rs may involve only headache .
You are an expert at summarizing long articles. Proceed to summarize the following text: a 66-year - old male visited our clinic complaining of right knee pain and restriction in rom of the right knee , especially in flexion . he had undergone a patellectomy on the right knee for a gunshot injury 45 years ago , and he did not respond to conservative treatment , had progressive reduction in the ambulatory capability and was barely able to climb a single flight of stairs at presentation to our clinic . clinical examination of the right knee revealed a transverse surgical scar with a varus knee alignment of 3 , 0 to 15 of active rom , and severe ankylosis . there was no collateral ligament laxity and both the anterior drawer and lachman tests were negative . tka was performed through an anterior midline longitudinal skin incision , which was perpendicular to the previous patellectomy scar . arthrotomy was made medial to the scar tissue of the previously excised patella , and extensile rectus snip was performed for adequate exposure and knee joint flexion ( fig . we performed intra - articular adhesiolysis and synovectomy for hypertrophied soft tissue , and added 2 more tibial posterior slope to achieve greater rom . upon achieving balanced gaps and neutral mechanical alignment , press fit condylar posterior stabilized total knee prosthesis ( depuy mitek inc . , active rom exercises of the knee joint were performed with passive rom exercises using controlled passive motion devices to facilitate rapid rom recovery . postoperative recovery was good and he achieved satisfactory ambulatory status at 3 weeks following the surgical intervention . currently , he has been followed up for 3 years since the index surgical procedure : he does not complain of anterior knee pain or any instability symptoms ; the rom ranges from 0 to 120 ; and he is able to go up and down stairs without any aid . he had no flexion contracture or extension lag in the right knee joint , and exhibited less than 5-millimeter anteroposterior and mediolateral instability . the knee society knee score increased from 29 points preoperatively to 86 points at the last follow - up , the knee society functional score increased from 34 points preoperatively to 82 points at the last follow - up , and western ontario and mcmaster universities index score increased from 38.4 points preoperatively to 74.4 points at the last follow - up . the 3-year postoperative radiographs demonstrated well fixed implant in good position with a neutral mechanical axis and stability of the knee joint without tendency for anteroposterior subluxation and evidence of radiolucent lines ( fig . after patellectomy , a greater extensor mechanism work is required for knee joint motion , especially as the knee approaches full extension . in such a case , the strength of extension can be reduced by as much as 20% to 70% compared with that in the knee with an intact patella5 ) . even after total knee arthroplasty , the extension strength is not restored as long as the patella is absent2 ) . in addition , patellectomy may also adversely affect the stability of the knee and the force transmission vectors across the joint . the patella forms an intrinsic part of the 4-bar linkage system for knee joint stability as described by sledge and ewald6 ) , and acts to position the quadriceps muscle and patellar tendon in parallel with the anterior cruciate ligament and posterior cruciate ligament , respectively . if this relationship is disrupted after a patellectomy , anteroposterior instability of the knee can develop , which results in simultaneous compression and anteroposterior translation of the articular surfaces of the joint . bayne and cameron3 ) postulated that chronic knee pain after patellectomy could be attributed to soft - tissue tension caused by anterior displacement of the femoral component . several authors have reported poor clinical outcomes and high failure rates of tka in patellectomized patients2,7 ) . this may be the result of altered extensor mechanism function , as well as instability of the post - arthroplasty knee2 ) . posterior stabilized prosthetic designs seem to provide better clinical outcomes compared with cruciate - retaining models , with the post - and - cam design preventing anterior displacement of the femur on the tibia during flexion and mitigating instability associated with the absence of patella . paletta and laskin8 ) evaluated the outcomes of tka in 22 patellectomized patients , of which 9 were treated with a posterior - stabilized prosthesis and the remaining 13 with a cruciate - retaining prosthesis . at 5-year follow - up , patients with posterior - stabilized prostheses had significantly higher knee society knee scores ( 89 vs. 67 points ) . hungerford9 ) also stated that , if the patella is not present , either the posterior cruciate ligament must be maintained and properly tensioned to stabilize the tibio - femoral articulation in the anteroposterior plane or a posterior stabilized prosthesis should be used . in addition to providing anteroposterior stability , the posterior stabilized prosthesis also ensures that the center of rotation of the replaced knee moves toward the posterior aspect of the tibial plateau during knee flexion ( roll - back ) . this results in a greater lever arm and resultant force produced by the quadriceps on contraction , which would have increased importance in a knee that had a patellectomy . a review of the literature on primary tka after patellectomy revealed variable results . marmor1 ) reported seven excellent and three good results nine years after 3 unicompartmental knee arthroplasties and 8 bicompartmental total knee arthroplasties with preservation of both cruciate ligaments . bayne and cameron3 ) reported the results of 14 total knee arthroplasties using several different prostheses of variable constraint in patients with previous patellectomy . the results correlated with the intrinsic stability of the prosthesis , and the best results were associated with the more constrained devices . these authors recommended preservation of the cruciate ligaments or use of a hinged prosthesis in patients who had previous patellectomy . railton et al.4 ) reported the results of 7 total knee arthroplasties using an unconstrained prosthesis and sacrifice of both cruciate ligaments after patellectomy . at 4-year follow - up , 6 cases were completely pain - free and function was satisfactory in all 7 cases . he announced that an unconstrained prosthesis can be used in total knee arthropalsty after patellectomy with sacrificing of both cruciate ligaments combined with the correct soft tissue tension in knee joint flexion , and this confers anteroposterior stability on the knee joint . lennox et al.2 ) reported on 11 patients who had had a patellectomy and subsequently had a tka with a semiconstrained prosthesis : good to excellent results were noted in only 5 of the 11 patients compared with all 11 patients in the control group with the intact patella . yao et al.10 ) compared 52 patellectomized knees , 48 of which had ps implants and only four had cr prostheses , to 50 intact patellae group . in the post - patellectomy group , functional scores were worse compared to the control group , but patient 's perception of pain relief and functional improvements after tka were comparable to those of the control group . in our case report , tka with a posterior stabilized prosthesis in the patient with an ankylosed knee and a previous history of patellectomy resulted in dramatic pain relief and functional improvement . he achieved satisfactory ambulatory status at 3 weeks after the surgical intervention , and did not complain of anterior knee pain or any instability symptoms . the rom in the knee joint was improved from 15 preoperatively to 120 at 3 years after the surgical intervention . based on our findings , we believe that posterior stabilized prosthesis may present a safer and more predictably stable choice in the patient with an ankylosed knee and a previous history of patellectomy . finally , we recommend careful soft tissue tensioning in knee flexion in order to avoid anteroposterior instability . first , it reports only a single case ; preferably a case series would provide greater evidence for demonstrating the benefits of posterior stabilized total knee arthropalsty prosthesis in the patient with an ankylosed knee after a previous patellectomy . second , our report presents 3-year short - term follow - up results after surgical intervention ; a longer period of follow - up would be beneficial to evaluate any complications . this study has demonstrated the feasibility of tka with a posterior stabilized prosthesis in the patellectomized patient with knee ankylosis without the occurrence of extensor lag or instability at 3-year follow - up .	patellectomized patients may have less satisfactory clinical outcomes following total knee arthroplasty ( tka ) due to a decreased extensor mechanism efficiency and potential instability . furthermore , the existing literature does not provide concrete guidance on the expected results of tka or the type of implant that should be used in patellectomized patients . we present a case of a patient with an ankylosing knee who had undergone patellectomy due to gunshot injury 45 years ago and was treated with primary tka using a posterior stabilized prosthesis at our institution . tka using this prosthesis in the ankylosed knee with a previous history of patellectomy yielded good results in terms of postoperative clinical scores , range of motion and joint stability .
You are an expert at summarizing long articles. Proceed to summarize the following text: the unprecedented biological resource of the high quality human genome reference sequence , completed in april 2003 , created the potential to provide significant advances in human health . the field of functional genomics , where biological function is assigned to genes , has been catalyzed by this database but gene expression profiling relies heavily on data obtained from microarray platforms . microarray technologies were proclaimed as the key that would unlock a wealth of information ( gerhold et al 2002 ; tilstone 2003 ) ; however , it has become ever increasingly evident that there are many barriers to researchers in the limitation of current diagnostic options . an underlying assumption made in the application of a microarray is that thousands of probes will discriminately hybridize with target species with identical kinetics in the same environment . in the format of a microarray concerns that have arisen are related to the selection of probes which are assembled on the microarray and include poor specificity ( false positives ) ; the effect of splice variants ; incorrect probe sequences derived from inaccuracies in public sequence data ; and statistical issues in data handling ( nadon and shoemaker 2002 ; attoor et al 2004 ; rockett and hellmann 2004 ) . a separate issue relates to the reporting of data obtained from microarrays as a consequence of separate laboratories conducting their array experiments with variable numbers of steps and a variety of conditions . as a consequence , there has been a move to establish the minimum information about a microarray experiment ( miame ) to allow independent verification at a later date and , in fact , several journals will not consider papers unless they have adopted these standards ( rockett and hellmann 2004 ) . with increasing pressure to validate and corroborate microarray data , many studies now publish microarray data in combination with that obtained from separate techniques such as northern blot analysis or quantitative reverse transcription - polymerase chain reaction ( qrt - pcr ) . careful experimental design and assessment prior to commencing a procedure is recommended ( yang and speed 2002 ; armstrong and van de wiel 2004 ) . microspheres have emerged as an exciting new platform for biologists to adopt into their armory of techniques in the investigation of biomolecule interactions and cellular processes . there are numerous reports that establish that microsphere - based assays can provide reliable data in simple binding and purification applications for a wide variety of biomolecule interactions ( figure 1 ) ( braeckmanns et al 2002 ; kellar and iannone 2002 ; lawrie et al 2003 ; yingyongnarongkul et al 2003 ) . in recent years there have been increasing numbers of studies in which microspheres have been used in more diverse applications and it is evident that the range of potential applications is enormous . microsphere technology offers several improvements over existing technologies because many copies of microspheres containing identical probes are available and each micro - sphere represents a self - contained assay . the ability to multiplex ( simultaneously screen uniquely identifiable probes ) through encoding microspheres ( braeckmanns et al 2002 ; lawrie et al 2003 ) is a significant advantage and there are increasing numbers of studies demonstrating applications of this type ( carson and vignali 1999 ; xu et al 2003 ; martins et al 2004 ) . in fact , very large multiplexed libraries containing millions of different probes can potentially be assembled ( battersby et al 2002 ) . the assays are performed in a 3d liquid suspension ( hence these are sometimes termed suspension arrays ) which provides significantly better kinetics and transport phenomena to support reliability of the results , and there is flexibility to add extra probes to the library without having to make or purchase new arrays . as microsphere - based probes are randomly located in a suspension in a very small volume ( unlike the compounds in microarrays and microplates which are in a fixed , known , position on an array ) , an encoding system is required to allow the rapid identification of the probe structures or reconstruction of the target sequences . recent reports have described the application of multiplexed , microsphere - based assays in polymorphism genotyping ( ye et al 2001 ; xu et al 2003 ; bortolin et al 2004 ; pickering et al 2004 ) and gene expression profiling ( fuja et al 2004 ; kuhn et al 2004 ) . as microsphere - based diagnostics evolve , the concerns surrounding the publication of microarray data should be taken as a sign that a set of standard information should be established as a prerequisite and provided on publication of multiplexed , microsphere - based studies of gene expression profiling . in this report we propose a number of factors for consideration when reporting data obtained for gene expression analyses using microsphere - based diagnostics . in the literature a range of terminology is adopted in reporting interactions between biomolecules for analytical purposes , and in this report we will use the terminology of probe for the oligonucleotide covalently attached to the surface of the microsphere ( sometimes referred to as anti - tag ) and target for the biomolecule that is fully complementary to the probe and exists in solution . silica microspheres were synthesized from 3-mercapto - propyltrimethoxysilane ( mptms ) by an emulsion method developed in our laboratory ( johnston et al 2005 ) and subsequently sedimented to produce a narrow size distribution ( 5 1m ) . these microspheres were subsequently modified by the synthesis of a 3-aminopropyltrimethoxysilane ( aps ) shell to produce a surface containing amine functionalities . these reactions were carried out in triplicate on approximately 4 10 microspheres using 50 l of 25% ammonia solution with variable concentrations of aps ( 0.1 , 1 , 5 , and 10% v / v ) in ethanol ( spectroscopic grade , ajax chemicals ) to result in a final volume of 1 ml . the reaction vessels were shaken for 90 minutes at 1400 rpm at room temperature in the dark and the microspheres were washed 3 times and suspended in ethanol . the concentration of amines produced as a result of this modification was assessed by performing a ninhydrin test which relies on the reaction between ninhydrin and primary amines . the ruhemann s purple product adsorbs at 570 nm and the absorbance can be read using a spectrophotometer and the number of amines quantified . bifunctional carboxylic linker species , typically adipic acid , were coupled to these amine functionalities using diisipropyl carbodiimide ( dic , aldrich , mo , usa ) . 250 l of a 20 mg / ml solution of adipic acid in tetrahydrafuran ( thf , emd , usa ) was added to the particle pellet along with 5 l dic and agitated for 12 hours prior to washing first with thf and then with ethanol . the oligonucleotide probes were attached to the carboxylic acid moieties by washing and suspending 4 10 microspheres in 50 l of 0.1 m 2-morpholino ethane sulfonic acid ( mes ) . 5 l of 50 m amine modified 40-mer ( 5-nh2-ttgctggcacaggaggtgacagtggttgagggccaggaag 3 ; tm = 73c ; named csf1r ) ( geneworks , australia ) which possesses a hexamethyl ( c6 ) spacer between the amine group and the 5 end of the probes was added to the microspheres and vortexed . 50 l of carbodiimide ( edc ) solution ( 50 mg / ml in 0.1 m mes ) was added to the mixture and incubated for 20 min at 25c with continuous shaking at 1400 rpm ( eppendorf thermomixer comfort agitator and incubator 5355 ) . a second aliquot of 50 l of freshly prepared edc was then added and incubated for another 20 min at 25c with continuous shaking . the microspheres were then washed 3 times with 1 ml of a solution containing both 0.1 m mes and 0.1% sodium dodecyl sulfate ( sds , icn biomedical oh , usa ) . the oligonucleotide coupled microspheres were then resuspended in 1 ml of 4xssc ( 4 150 mm nacl , chem - supply , australia , 15 mm sodium citrate , aldrich , usa ) + 0.1% sds . oligonucleotide probes coupled to silica microspheres were incubated in a hybridization buffer 4xssc/0.1%sds with the specified concentration of complementary cy5-modified target oligonucleotide ( geneworks , australia ) . a series of variants of the csf1r sequence was examined as probes against the 40-mer complementary target including 10-mer ( gtgacagtgg ; tm = 32c ) ; 20-mer mid ( aggaggtgacagtggttgag ; tm = 55c ) ; 20-mer end ( agtg gttgagggccaggaag ; tm = 55c ) . the number of bound targets was assessed by passing the microspheres through a high - performance flow cytometer ( dakocytomation , ft collins , co , usa ) equipped with a 635 nm red diode laser to excite the cy-5 label on the target oligonucleotide . emitted photons were detected on a photomultiplier tube ( denoted fl6 ) located behind a narrow bandpass filter ( 670 15 nm ) . the data were analyzed with the summit software ( dakocytomation ft collins , co , usa ) where the median fluorescence intensity of the histogram observed for the microsphere population was used as the statistic to compare fluorescence intensities . in order to identify the factors that can vary in performing microsphere - based gene expression experiments in separate laboratories , consideration must begin with the simplest level of hybridization : a single probe species attached to a single microsphere exposed to a single fully complementary target molecule of equivalent length . assuming constant buffer conditions , the only factors influencing the efficiency of hybridization will be the proximity of the reaction temperature to the tm ( melting temperature ) of the probe sequence and the distance between the probe and target . an increase in complexity arises at the next stage , which is to introduce several variables including the number of probes on each microsphere , the concentration of target molecules , and the relative lengths of probe and target species , illustrated schematically in figure 2 . schematic representation of a microsphere - bound probe - target hybridization occurring on the surface of a microsphere . target a is significantly longer than target b. it is evident that when the target concentration is relatively low , increasing the number of probes on the surface of a microsphere will increase the number of bound targets on each microsphere and maximize the sensitivity of the reaction . the same optimization in the limit of detection can be achieved by decreasing the number of microspheres , thereby increasing the number of target molecules bound to the surface of each microsphere and increasing the relative fluorescent intensity . the impact of varying the number of microspheres ( with constant probe concentration ) exposed to a fixed target concentration demonstrated that the sensitivity of the assay could be increased by reducing the number of microspheres ( figure 3 ) . the influence of the number of microspheres on the sensitivity of an assay with a fixed target concentration 30 pm . the surface concentration of probes on a microsphere does not independently control the sensitivity of the assay ; in fact , it is a combination of the surface concentration of probes and the number of microspheres supporting the probes that are fully complementary to the target . while many studies report the number of microspheres used in an assay , very few report the average surface concentration of probes per bead . in a multiplexed assay , there may be an effect of the volume of microspheres in the hybridization mixture impacting on the accessibility of the target to the microsphere - bound probe . in identifying the level of information that should be prerequisite in reporting microsphere - based hybridizations this parameter depends on the identity of the microsphere and related chemistry reactions performed to couple the probe to the surface . microspheres developed from a range of materials have been reported as suitable for gene expression studies , but the most common are polystyrene ( carson and vignali 1999 ; ye et al 2001 ; bortolin et al 2004 ; fuja et al 2004 ; martins et al 2004 ; pickering et al 2004 ) and silica ( battersby et al 2002 ; kuhn et al 2004 ) . the surface of these microspheres is typically carboxylated to enable the covalent attachment of oligonucleotide probes . however , a range of linker molecules is adopted to optimize the interaction between the probe and target molecules , including polyethylene oxide ( to minimize nonspecific binding ) and alkyl chains to improve specificity ( shchepinov et al 1997 ) through reduction of steric hindrance . the number of probes attached to each microsphere is of highest significance in assays where the potential target concentration is very low ( < 0.1 pg/l ) , as in the case of low - abundance genes . it may be necessary to perform a microsphere number titration to optimize the mean fluorescence observed after hybridization to cdna ( fuja et al 2004 ) . the ability to control the loading of probes on the microsphere surface is critical in tailoring the microsphere - based diagnostic to potential applications . the surface loading of initial functionalities to which the probes are coupled should be provided as part of their specification or be quantified . a desirable option is the ability to select the surface concentration of probes according to the application and potential target concentration . an example is provided in figure 4 where the concentration of amine functional groups can be controlled through the modification of the surface of silica microspheres with a coat of aps . the final number of primary amines available on the surface of the microspheres was dependent on the concentration of aps and it would appear that this will translate into a potential route to controlling the surface concentration of probes . the application of the ninhydrin test to quantify the concentration of amine groups available on the surface of a silica microsphere . loading or concentration of the functional groups available on the surface of their microspheres to which their probes will be coupled , they assume a 100% efficiency of conversion into a concentration of probes on the surface after several coupling reactions . the popular application of carbodiimide chemistry to react probes onto the functionalities present on the surface of the microspheres ( xu et al 2003 ; bortolin et al 2004 ; fuja et al 2004 ) introduces a major source of variability , as this coupling reaction is well known to be inefficient with the carbodiimide required to be present in great excess initially and in some cases to be added in multiple aliquots . indeed , several coupling reactions may be adopted to add tag or linker molecules in between the microsphere surface and the probe species . it is evident that there is a need for researchers to quantify the final probe concentration that has been used in a gene expression assay . recent studies have incorporated an innovative approach to address this issue by adopting either a 18-mer poly ( dt ) linker ( xu et al 2003 ) or a luciferase tag sequence as part of the probe ( ye et al 2001 ) to determine the coupling efficiency . this strategy raises the second major issue in developing microsphere - based hybridizations : variations between the structure of the probe sequence and the target sequence including relative length and region of complementarity . several studies demonstrate the ability to discriminate single nucleotide polymorphisms using luminex microsphere - based systems ( ye et al 2001 ; bortolin et al 2004 ; pickering et al 2004 ) . specificity is critical and the ability to detect single - base mismatches ( point mutations ) should be demonstrated for the lowest abundant targets in an experiment by incorporating both complete match and single mismatch probe . a common factor in many reports of microsphere - based oligonucleotide hybridizations is that the probe sequences are often significantly shorter than the target genes . steric issues may play an important role in the hybridization efficiency ( even assuming there are no hairpin structures formed in either sequence ) . an investigation into the effect of the length of the probe sequence attached to the microsphere on the efficiency of hybridization revealed that , for a 40-base oligonucleotide target molecule , the probe of the same length gave the maximum fluorescence ( figure 5 ) . in this study , the microsphere number remained constant at 20 000 microspheres / hybridization reaction and the hybridizations temperature was slightly lower than the tm of the 40-mer sequence but above that of the shorter sequences . examination of the influence of probe length and specificity on hybridization to a 40-mer oligonucleotide target . the difference between the two 20-mer probe sequences is that one was fully complementary to the middle sequence of the target mid and the other was fully complementary to the end of the target sequence end . the maximum signal was anticipated for the equivalent length target sequence at this temperature , and discrimination in the binding of shorter sequences whose tm were lower than the hybridization temperature was observed . a comparison was made between a 20-mer probe sequence being complementary to a central region of a 40-mer oligonucleotide target sequence ( figure 5 , 20-mer , mid ) and a 20-mer probe sequence being complementary to the end of a 40-mer target sequence ( figure 5 , 20-mer end ) . it was revealed that there was increased sensitivity to the probe hybridizing to the end of the target sequence . this preliminary study demonstrated that steric effects will influence the efficiency of a microsphere - based assay even for short sequences and this effect will be magnified as the sequences are lengthened . in fact , many studies use pcr amplification to increase the target concentration in the assay and to incorporate a unique label on the target species . many factors are beyond the scope of this report to examine in depth , including optimization of the signal obtained for bound target species by amplification of targets by pcr ( xu et al 2003 ) , or the use of dendrimer labels ( fuja et al 2004 ; lowe et al 2004 ) . the optimal assay would be to achieve single molecule detection of a target by a capture probe , but there remains a substantial amount of development required in these systems to achieve this goal . in summary , from the increasing number of studies reporting the application of microspheres in gene expression studies , it is evident that microsphere - based hybridizations are a viable method for performing sensitive and specific quantification of gene abundances . however , several factors may introduce variability in the data reported in separate laboratories and we recommend statements of several parameters , including the final probe concentration ; the number of microspheres per assay ; the tm for the capture probe ; the hybridization temperature ; and , if available , the length of both the probe and the target sequence , and the mode of amplification of signal for target sequence .	microarrays have received significant attention in recent years as scientists have firstly identified factors that can produce reduced confidence in gene expression data obtained on these platforms , and secondly sought to establish laboratory practices and a set of standards by which data are reported with integrity . microsphere - based assays represent a new generation of diagnostics in this field capable of providing substantial quantitative and qualitative information from gene expression profiling . however , for gene expression profiling , this type of platform is still in the demonstration phase , with issues arising from comparative studies in the literature not yet identified . it is desirable to identify potential parameters that are established as important in controlling the information derived from microsphere - based hybridizations to quantify gene expression . as these evolve , a standard set of parameters will be established that are required to be provided when data are submitted for publication . here we initiate this process by identifying a number of parameters we have found to be important in microsphere - based assays designed for the quantification of low abundant genes which are variable between studies .
You are an expert at summarizing long articles. Proceed to summarize the following text: crohn s disease ( cd ) and ulcerative colitis ( uc ) , the two major subtypes of chronic inflammatory bowel disease ( ibd ) , cause significant morbidity in affected individuals . the prevalence ranges from 37 to 249 cases per 100,000 people for uc and from 26 to 319 cases per 100,000 people for cd in the north american population , with similar incidences in other developed countries . while the pathophysiology of ibd is not fully understood , it has been widely accepted that multiple components , including genetic , environmental , and microbiological factors , contribute to the occurrence and perpetuation of the disease . current therapeutic options consist of anti - inflammatory medications as well as corticosteroids and immunosuppressive and novel biological agents . however , some individuals fail to respond to these therapies , and these agents are associated with significant side effects . in addition , cd and uc , while sharing several similar pathologic and clinical features , do have distinct differences in prognosis and management . therefore , to minimize side effects in ibd therapy , appropriate therapeutic decision - making through accurate diagnosis and regular surveillance is crucial . currently , diagnosis relies upon clinical , endoscopic , histologic , and radiologic techniques that can be time - consuming and costly . endoscopy is a technique with risks , including a 1 in 1000 risk of bowel perforation . furthermore , differentiating between the two subtypes of disease endoscopically and even histologically may be challenging in certain situations . less invasive methods for diagnosis , such as determination of biomarkers from urine , serum , or feces , however , would be of significant advantage and useful for primary diagnosis , surveillance , and early detection of relapses . additionally , non - invasive biomarkers could be used by gastroenterologists to triage referral for patients with symptoms such as abdominal pain and diarrhea . several investigators have addressed this issue by performing non - targeted analysis of metabolites in animal models of colitis using mass spectroscopy as well as h nmr spectroscopy . the latter method has also been applied to ibd patients to characterize metabolites in urine , fecal extracts , and biopsy samples . a recent study employing ion cyclotron resonance - fourier transform mass spectrometry to discriminate between 1000 metabolites revealed differences in fecal samples collected from identical twin pairs , including healthy individuals and cd patients . another study clearly distinguished between ibd patients and healthy individuals by use of multivariate indexes established from plasma aminograms . analysis of metabolites is therefore rapidly emerging as a powerful method for characterizing ibd in experimental animal models and humans . though various markers or marker panels have been tested in clinical trials , there is no ideal marker that is able to diagnose or predict ibd . most useful markers in clinical practice include acute phase proteins such as c - reactive protein , the fecal markers calprotectin and lactoferrin , and serologic markers such as the dnase - sensitive antineutrophil cytoplasmic antibody p - anca that is present in sera of 60% of uc and 20% of cd patients . however , a recent study concluded that the predictive values of the latest serological panel for pediatric ibd screening ( prometheus inflammatory bowel disease serology 7 [ ibd7 ] panel ) were less useful than the routine laboratory tests , suggesting the use of genomic or metabolomic biomarkers for diagnosis and prediction of ibd . quantitative analysis of metabolites this approach involves analyzing a large group of compounds whose characteristics ( e.g. , nmr spectra ) are known and stored in a database library . the complex mixture of individual metabolite spectra in the biofluid can be analyzed by overlaying spectra taken from a database to identify and quantify the targeted metabolites . this approach quantifies a large number of metabolites in a single specimen in a high - throughput manner and is highly suitable for studies of polar metabolites . metabolite analysis of serum and plasma in ibd subjects has not been reported before , and so far only one study has investigated metabolite profiles in urine of patients with active uc but not in active cd . another previous urinary metabolomic study did not restrict enrolment to individuals with active disease . in the current study , we therefore aimed to investigate the correlation of intestinal inflammation with the presence or absence of specific metabolites that could potentially be used as biomarkers in serum , plasma , and urine of ibd patients . to determine the metabolites , we used h nmr spectroscopy and performed quantitative analysis of metabolites of the three biofluids from human subjects identified clinically , endoscopically , and histologically to have active cd or uc . we were specifically interested to examine all three biofluids to determine whether all of them could separate ibd from healthy subjects because it is known that urinary metabolomic profiles are more affected by environmental factors than blood metabolites and because differences in metabolite profiles between plasma and serum have been reported . the study was approved by the conjoint health research ethics board of the university of calgary ( protocol no . 18142 ) , and all participants were provided written , informed consent . serum , plasma , and urine samples were collected from adult individuals with confirmed cd ( n = 20 ) and uc ( n = 20 ) and from healthy control ( n = 40 ) subjects . all three biofluids were taken from each individual , i.e. , serum and plasma were from the same subject . for collection of serum , sst vacutainer tubes and for plasma , k2 edta vacutainer tubes from bd biosciences ( franklin lakes , nj , usa ) were used , processed according to the manufacturer s instructions and frozen at 80 c . urine was collected in sterile urine containers , pipetted into transport tubes , and also frozen at 80 c . patients included in the study were recruited from the foothills medical centre , the major tertiary care specialist center in calgary , alberta , ( population 1.2 million ) and had been diagnosed by experienced gastroenterologists according to rigorous criteria on the basis of endoscopic , histologic , and radiological findings . in addition , details of disease activity scores , based on the harvey - bradshaw index for cd and the simple clinical colitis activity index for uc , were calculated for later subgroup analysis . patients in whom there was diagnostic uncertainty ( e.g. , those with ibd type unclassified ) were excluded from the study . to avoid influence of aging and gender on metabolomic profiles , subjects in the healthy control cohort were matched each to corresponding subjects in disease cohorts by gender and age ( age matched within 5 years ) . several recent studies have elucidated the degree of variation in nmr spectroscopic profiles from urine samples of healthy subjects . analysis of serum metabolites , however , demonstrated minimal variability between subjects and study days . because different diets have been shown to influence urinary metabolic profiles , we collected fasting samples . to replicate normal circumstances , details of chemical contraceptive usage and reproductive status were obtained in females , to ensure that the groups were similar . metabolites related to medication ( e.g. , acetaminophen , acetamide ) were eliminated from the statistical evaluation . subjects with significant comorbidities and individuals with an intercurrent illness , who were pregnant , or who were taking antibiotics , biologics , prebiotics , or probiotics were excluded from the study . serum , plasma , and urine samples were thawed on ice . of each sample , 400 l was applied to 3-kda nanosep microcentrifuge filters for filtration to remove proteins and insoluble impurities . d2o ( 100 l ) was added during filtration of serum and plasma for filter washing . samples were brought to 650 l by addition of d2o , 130 l of sodium phosphate buffer ( final concentration 0.1 m ) containing dimethyl - silapentane - sulfonate ( final concentration 0.5 mm ) for nmr chemical shift reference and concentration calibration , and 10 l of 1 m sodium azide to prevent growth of bacteria . samples from the cd , uc , and healthy control cohorts were analyzed in a blinded , randomized manner . nmr spectra were acquired using an automated nmr case sample changer on a bruker avance 600 spectrometer ( bruker biospin ) operating at 600.22 mhz and equipped with a 5-mm txi probe at 298 k. regular one - dimensional proton nmr spectra were obtained using a standard pulse sequence ( bruker pulse program prnoesy1d ) that has good water suppression characteristics and is commonly used for metabolite profiling of serum or plasma samples . it utilizes the following pulse sequence rd-90-t1 - 90-tm-90-acquire fid ; where rd is a relaxation delay of 1 s , during which the water resonance is selectively irradiated ; t1 is set to 4 s , and tm has a value of 100 ms , during which the water resonance was again selectively irradiated . initial samples for each batch were shimmed to ensure half - height line width of < 1.1 hz for the dimethyl - silapentane - sulfonate peak , calibrated to 0.0 ppm . spectra were acquired with 1024 scans , then zero filled and fourier transformed to 128 k data points . for proper quantitative fitting of the nmr spectra , it is important that the spectra are collected under the same conditions as the metabolite standard spectra in the chenomx database . additional 2-dimensional nmr experiments were performed for the purpose of confirming chemical shift assignments , including homonuclear total correlation spectroscopy ( 2d h , edmonton , canada ) for quantification using the targeted profiling approach , where individual nmr resonances of interest are mathematically modeled from pure standard metabolite compound spectra stored in an internal database , and this database is then interrogated to identify and quantify metabolites in complex spectra of mixtures , such as biofluids . overall 71 compounds in urine , 44 compounds in serum , and 37 compounds in plasma spectra were detectable with sufficient signal - to - noise ( supplementary table 2s ) . each compound concentration was then normalized to a total concentration of all metabolites in the sample ( excluding glucose and lactate for serum and plasma samples and urea , creatinine , and citrate for urine samples because of excessively large volumes that otherwise would have dominated the normalization ) . to reveal patterns in metabolite concentration shifts , multivariate analysis was conducted using simca - p+ 12.0 software ( umetrics , sweden ) . orthogonal projections to latent structures discriminant analysis ( opls - da ) , a supervised pattern recognition approach , were used as a predictive model to identify differences in metabolite composition in samples of uc and cd patients and healthy controls . the objective of opls - da is to divide the systematic variation in the x - block ( an input data set of metabolite concentrations ) into two model parts : one part that models the covariation between the measured data of x variable ( metabolite concentrations ) and the response of y variable ( in our case binary variables of disease status ) within the groups , and a second part which captures systematic variation in x that is unrelated ( orthogonal ) to y. model components that are related to y are called predictive , while those that are unrelated to y are called orthogonal . for each opls - da model , 7-fold cross validation ( cv ) was used to validate the statistical significance of each model dimension . to calculate the area under the roc curve ( auroc ) , specificity and sensitivity were determined on the basis of sample class prediction during the 7-fold cross validation ( y - predcv , predictive y variables ; simca - p+ software ) . we used multiblock principal component analysis ( pca ) and hierarchical opls - da as methods for comparing several blocks ( i.e. , several pca models from multiple biofluids ) derived from the same objects ( e.g. , subject ) . the idea of hierarchical modeling is to group the variables for the purpose of improved clarity and interpretability to reveal how the different blocks ( concentration data from different biofluids ) are related , which blocks provide overlapping or unique information , and which biofluid measurements are most useful from a predictive viewpoint . this blocking leads to two model levels : the upper level where the relationships between blocks are modeled and the lower level showing the details of each block . metabolite concentrations data were divided into three blocks according to the type of sample biofluids ( i.e. , serum , plasma , and urine ) obtained from the same subject . a pca model was constructed in the lower level for the metabolite concentration data of each type of biofluid . all meaningful scores ( tb ) from each pca model were combined into a super block , t. in the higher level , a hierarchical opls - da was performed on t with tb denoted as variables and samples denoted as observations . the resulting super scores ( tt ) plot shows the relationship between observations , and the super loadings plot ( pt ) indicates which scores ( tb ) are most influential on the hierarchical opls - da model , and hence facilitates visualization of differences and/or similarities in the metabolic responses of multiple biofluids . participant demographics and disease characteristics in the ibd cohorts are summarized in table 1 . patients reported that they were taking medications including 5-aminosalicylate ( 5-asa ) drugs ( 3 cd and 15 uc ) , azathiopurine ( 7 cd and 5 uc ) , and corticosteroids ( 15 cd and 16 uc ) . as subjects from these cohorts were studied during an exacerbation of their disease , as defined by a harvey - bradshaw or simplified clinical colitis activity index 5 , all participants were on some form of medication . a1 , proctitis ; a2 , disease limit to distal splenic flexure ; a3 , disease proximal to splenic flexure ; b1 , ileal disease ; b2 , colonic disease ; b3 , ileocolonic disease ; c1 , stricturing ; c2 , penetrating ; c3 , fistula ; c4 , stenoses ; c5 , abscess ; m1 , 5-asa ; m2 , oral steroids ; m3 , iv steroids ; m4 , 6-mp / aza . inspection of the serologic and urinary nmr spectra revealed the wide variety of metabolite resonances present in the spectra . representative h nmr spectra of serum samples from uc and cd patients and healthy control subjects are shown in figure 1 . a number of metabolites , including a range of amino acids , saccharides ( glucose , maltose , galactose ) , energy metabolism related molecules ( pyruvate , succinate , citrate , lactate , creatine , creatinine ) , and others ( cholines , amines and amides ) were identified based on comparison with the chenomx metabolite database , as well as 2d h c hsqc and h h tocsy nmr experiments ( see a complete list of metabolites in the supporting information , table 2s ) . typical 600 mhz h nmr spectra of serum from patients with ulcerative colitis ( uc ) and crohn s disease ( cd ) and from a healthy control subject . aromatic region ( 5.09.5 ppm ) magnified 4 compared with the aliphatic region ( 0.74.3 p.p.m ) . metabolites : ( 1 ) 2-hydroxy - butyrate , ( 2 ) arginine , ( 3 ) citrate , ( 4 ) glucose , ( 5 ) isoleucine , ( 6 ) lysine , ( 7 ) mannose , ( 8) methanol , ( 9 ) creatinine , ( 10 ) tyrosine , ( 11 ) urea . changes in metabolites of each biofluid from uc and cd patients ( with active disease ) and from corresponding healthy control subjects were established using an opls - da strategy , comparing h nmr profiled metabolite concentrations between ibd patients and healthy subjects , as well as each disease cohort between each other . three opls - da models were built for each sample biofluid comparing metabolites between uc and matched control cohorts , cd and matched control cohorts , and between uc and cd cohorts . the quality of the models were determined by the goodness of fit in the x ( rx ) and y ( ry ) variables and the predictability based on the fraction correctly predicted in one - seventh cross - validation qycv ( see table 2 for the model summary statistics ) . clear separation was achieved between samples obtained from disease ( both uc and cd ) and healthy control subjects for all biofluids examined , as evidenced by the consistently high qy values for all models ( table 2 ) . discrimination between the two ibd groups was not clear enough in urinary spectra ; therefore no model could be built to discriminate metabolic patterns between cd and uc samples ( table 2 ) . the metabolites responsible for the separation of the disease groups ( uc and cd ) from the control groups ( figures 2 , 3 , and 5 ) , and of both disease groups ( figure 4 ) are summarized by the opls - da regression coefficients and scores plots in figures 25 . only metabolites with statistically significant differences ( p < 0.05 ) are shown . changes in opls - da coefficients of serum metabolites from patients with ( a ) ulcerative colitis ( uc ) and ( c ) crohn s disease ( cd ) as compared to control subjects . positive bars ( sem ) illustrate metabolites significantly increased in uc and cd , whereas negative bars ( sem ) denote metabolites significantly higher in control subjects . changes in opls - da coefficients of plasma metabolites from patients with ( a ) ulcerative colitis ( uc ) and ( c ) crohn s disease ( cd ) as compared to control subjects . positive bars ( sem ) illustrate metabolites significantly increased in uc and cd , whereas negative bars ( sem ) denote metabolites significantly higher in control subjects . panels b and d depict the respective scores plots demonstrating good separation of metabolites between ibd patients and control subjects . opls - da coefficients ( sem ) obtained from serum and plasma samples compared between cd and uc patients ( a ) to demonstrate significant differences in metabolites that could help differenciating between these two diseases . panels b and c show the respective opls scores plots for cd versus uc in ( b ) serum and ( c ) plasma . changes in opls - da coefficients of urine metabolites from patients with ( a)ulcerative colitis ( uc ) and ( c ) crohn s disease ( cd ) as compared to control subjects . positive bars ( sem ) illustrate metabolites significantly increased in uc and cd , whereas negative bars ( sem ) denote metabolites significantly higher in control subjects . panels b and c show the respective opls scores plots for ( b ) uc compared to control subjects and ( d ) cd compared to control subjects . apred , number of y - predictive components ; aorth , number of y - orthogonal components ; rx , explained variance of x ; ry , explained variance of y ; qycv , predicted variance of y estimated using cross - validation . rx and ry show how well the model explains the variation in x and y , respectively . serum metabolites were significantly altered in ibd . in serum of uc patients ( figure 2a ) , 21 metabolites showed significant changes in concentration versus control subjects while serum from cd patients ( figure 2c ) revealed significant changes of concentrations in 11 metabolites . in both uc and cd , the metabolite profile showed strong increases in methanol , mannose , and amino acids , such as isoleucine . common to both forms of ibd are decreases in urea ( more prominent in uc than cd ) , citrate and acetate . changes in plasma metabolites differed little from those in serum ; this particularly applies for uc patients ( figure 3a ) , whereas in cd patients ( figure 3c ) differences to serum can be seen . in plasma of uc patients , 16 metabolites showed significant changes of concentration , whereas in cd patients , 21 metabolites revealed significantly altered concentrations . as in serum from uc patients , significant increases were measured for mannose , formate , 3-methyl-2-oxovalerate , 2-hydroxybutyrate , creatine , isoleucine , and lysine , while urea , tau - methylhistidine , valine , tyrosine , choline and creatinine were decreased in both serum and plasma as compared to control subjects . unlike in serum , changes in metabolite concentrations of plasma samples from uc patients resembled more the ones from cd patients . almost all metabolites that were increased ( mannose , 3-methyl-2-oxovalerate , 2-hydroxybutyrate , creatine , isoleucine , lysine ) or decreased ( urea , tyrosine , tau - methylhistidine , valine , creatinine , choline , betaine ) in samples from uc patients were also increased and decreased , respectively , in samples from cd patients as compared to controls . however , there were differences as to the magnitude in the concentration changes in some of these metabolites ( from serum and plasma ) between samples from cd and uc patients ( figure 4a ) . urine metabolites showed a largely different profile from serum and plasma metabolites , especially in samples of cd patients ( figure 5c ) . in addition , metabolites in urine also vastly differed between uc and cd ; this applies at least to those metabolites that had increased . in urine samples from uc patients ( figure 5a ) , 23 metabolites showed changes in concentration , whereas in cd patients ( figure 5c ) , 26 metabolites had altered concentrations . only a few metabolites that were decreased in uc were also decreased in cd patients ( i.e. , citrate , succinate , betaine , hippurate , and methanol ) as compared to controls . several saccharides , such as lactose , galactose , maltose , and xylose , however , which were typically increased in cd , were not higher in uc patients . on the other hand , as compared to control subjects , uc patients showed increased levels of mannitol , allantoin , glycylproline , and tryptophan levels , which were missing from cd samples . one important aspect of the data - modeling procedures lies in the predictive ability in terms of specificity and sensitivity in distinguishing disease ( uc and cd ) from healthy controls and from each other . the multivariate opls - da modeling procedures employed here incorporated a 7-fold cross validation step . in this case , 7 models were built with exactly one - seventh of the data excluded from each model and each sample excluded a single time . the ability of the models to predict those samples not involved in the modeling provided a measure of the overall predictive ability of the metabolite profiling . using these values ( ypredcv ) , we were able to generate a receiver - operating characteristic ( roc ) curve and calculated the area under the roc curve ( auroc ; see figure 1s in the supporting information for an example ) . table 3 shows the results for the constructed models and demonstrates the ability of these modeling procedures to distinguish the cohorts . ppv , positive predictive value ; npv , negative predictive value ; acc , accuracy ; auroc , area under the roc curve . ppv ( npv ) is the proportion of samples with positive ( negative ) test results that are correctly predicted with the model . sensitivity ( specificity ) measures the proportion of actual positives ( negatives ) that are correctly predicted with the model . accuracy ( acc ) is the proportion of true results ( both true positives and true negatives ) in all results . the area under curve ( auroc ) is equal to the probability that a classifier will rank a randomly chosen positive instance higher than a randomly chosen negative one . in order to assess the nature of the metabolic response during ibd across several human biofluids , pca models were constructed individually for each disease subset in each biological matrix , and the significant scores from each model were combined into a single new matrix to include all biofluids ( the number of components and percentages of total variance in the data matrix explained by the pca models are summarized in table 1s in the supporting information ) . the scores ( tb ) values for each model were combined into a super block ( t ) , and then opls - da was performed on the super block with unit variance - scaled data , which is termed hierarchical opls - da , to maximize the separation by using class information as the y variable . the model summary statistics of hierarchical opls - da models are presented in table 2 , and their predictive abilities are in table 3 . the hierarchical opls - da scores plots ( figure 6a and b ) showed clear discrimination between inflammatory ( uc and cd ) and healthy control cohorts ( qy = 0.685 and 0.635 , respectively , table 2 ; auroc = 0.9925 for both models , table 3 ) and weak discrimination between two inflammatory cohorts ( qy = 0.230 , table 2 ; auroc = 0.7675 , table 3 ; figure 6c ) . notably , the predictive power of hierarchical uc : cd opls - da model was superior to any similar model for single biofluid ( the corresponding loading plots are shown in figure 2s in the supporting information ) . hierarchical orthogonal projection to latent structure - discriminant analysis ( hierarchical opls - da ) scores plots ( a , b , c ) obtained from scores of sub - pca models that were separately derived from corresponding disease cohorts in the three different biofluids from patients with crohn s disease ( cd , red ) , ulcerative colitis ( uc , blue ) , and matched healthy individuals ( control , green ) . quantitative metabolite analysis of biofluids on a large scale offers two important opportunities : first , the chance to discover metabolites associated with the disease that may eventually serve as biomarkers and second , the profile obtained may provide us with an invaluable insight into the pathogenesis of the disease . in the present study approach to investigate differences in metabolite concentrations of patients with active ibd in comparison to healthy control subjects . we collected serum , plasma , and urine from each patient with either acute uc or cd and from healthy individuals and determined a set of metabolites in each sample by nmr spectroscopy to discover differences in metabolite concentration . multiblock principal component analysis ( pca ) and hierarchical opls - da were used as statistical methods to discriminate between diseased and non - diseased . as several articles have already described metabolites from urine and colonic mucosal extracts in ibd patients , we included metabolites from serum and plasma in our study in addition to urinary metabolites . contrary to plasma , urinary metabolites are highly prone to environmental factors , such as diet , resulting in great intersubject variability . for instance , changes in the bacterial composition of the gut in mice after treatment with antibiotics may alter urinary metabolites . we therefore reasoned that testing serum and plasma metabolites may prove as a more reliable approach of quantitative metabolite analysis . we were able show that opls - da analysis was sufficient to discriminate between healthy subjects and ibd patients . the qy values of the cd and uc versus control models for serum , plasma , and urine metabolites were between 0.53 and 0.84 , which indicates high reliability and strong predictive power of the models . the predictability of the models to distinguish between cd ( or uc ) and health was also extremely high and showed an area under the curve ( auroc ) of around 0.99 . however , our model only discriminated weakly between cd and uc on the ground of plasma or serum metabolites , and for urine , in contrast to other groups , no model could actually be created . the reason for this discrepancy could lie in the application of different spectral analysis methods but may also highlight that ibd is a multifactorial disease of unknown etiology with a high variation in phenotypes and severity , suggesting that the pathogenesis of active cd is similar to that of active uc on the metabolomic level . as a matter of fact , colonic cd and indeterminate colitis on the other hand , the small sample size in our study may have accounted for the failure to create a model . there were slight differences in the metabolite composition between serum and plasma samples in our ibd patients . this was not unexpected because studies have already shown that metabolites may differ depending on whether they are measured in serum or plasma . serum derives from coagulated blood , whereas plasma is treated with an anticoagulant such as edta or heparin before removal of blood cells . one reason for the differences therefore could be , for example , the release of mediators from platelets during the coagulation processes . a recent study by yu et al . suggests that serum may be more sensitive for biomarker detection compared to plasma , whereas measuring metabolites in plasma may be more reproducible . nevertheless , despite some differences between serum and plasma metabolite concentrations , both our serum or plasma metabolite - based statistical models were able to separate well between ibd and non - diseased subjects revealing a higher qy for uc in plasma than in serum , but a higher qy for cd in serum than in plasma . both uc and cd have an impact on amino acid metabolism showing increased levels of isoleucine ( and its first degradation product 3-methyl-2-oxovalerate ) , methionine , lysine , glycine , arginine , and proline and decreased levels of valine , tyrosine , and serine as compared to the control cohort . some of the increased amino acids were also reported to be increased in fecal extracts and extracts of colon mucosa with the exception of isoleucine , which has apparently low concentrations in colonic mucosa of active cd and uc . methionine is an essential amino acid and a precursor of homocysteine , a metabolite also shown highly elevated in plasma and colonic mucosa from uc and cd patients . interestingly , 2-hydroxybutyrate showed significant increases in serum and plasma of both uc and cd patients as compared to control subjects . 2-hydroxybutyrate is mainly found in the liver and is highly expressed during oxidative stress when it is needed for the synthesis of the cell antioxidant glutathione . serum of uc and plasma of uc and cd patients had elevated levels of creatine but lower levels of creatinine than in control subjects . the relatively increased creatine levels that were also seen in our previously described dss mouse model of uc may indicate the need of atp and fatty acids as energy supply during the states of the disease . creatine may be degraded by intestinal bacteria ; therefore , it is conceivable that the elevated creatine levels may even result from reduced bacterial degradation associated with microbial dysbiosis . we could also see high lactate levels in plasma samples of cd patients , although high lactate levels have been rather connected with severe uc . the decrease in krebs cycle intermediates ( such as succinate and citrate ) and molecules involved in energy metabolism ( such as acetate ) in ibd patients may indicate the demand and rapid utilization of metabolites that feed energy producing pathways . many similarities exist between serum and plasma from uc patients , but few in samples from cd patients with regard to downregulated metabolites . urea showed strong decreases in uc as well as in cd patients , which is in contrast with previous findings of urea production in ibd patients . in plasma from cd patients , we detected decreased levels of ornithine , which is also part of the urea cycle . the decrease in urea and ornithine in cd patients as compared to the control cohort may indicate disturbances in the urea cycle . in addition , these patients had a higher level of arginine , another component of the urea cycle , than the control individuals . high serum arginine levels that correlate with disease severity have been recently described for uc . among monosaccharides , higher levels of mannose and glucose were detected in ibd patients as compared to control subjects . increased mannose was also observed in our dss colitis mouse model , while another group has found high levels of glucose in extracts of macroscopically uninvolved colonic mucosa of ibd patients . in both cd and in uc , we noticed , relative to control subjects , a decrease in choline and its oxidized product betaine . also other metabolomic studies of ibd have revealed a downregulation of choline , which is an essential nutrient . it may be produced in reasonable amounts in the colon through degradation of fiber pectin ( which is contained in fruit , vegetables , jellies , milk products , etc . ) and taken up by the circulation . the human colonic flora is able to degrade pectins , and methanol is released into the blood upon this degradation . since populations of the colonic microflora are deranged in ibd , either as a cause or a consequence , it is possible that an overgrowth of pectin - degrading bacteria may contribute to an increased methanol content . on one hand , increased formate levels ( compared to control subjects ) in serum of uc patients are in accordance with increased methanol levels . methanol is converted into formate in the liver via formaldehyde by alcohol dehdroxygenase , a process that also leads to the production of free radicals . on the other hand , formate may be formed by intestinal bacteria , such as enterobacteria . we have previously used a metabolite analysis approach and performed h nmr spectroscopy to determine whether mice , which had developed an experimental form of colitis following dss administration , could be discriminated from healthy controls . by multivariate statistical evaluation as we have already observed in this mouse model of ibd , the metabolite profile of urine is different to that of serum / plasma and revealed different sets of metabolites . the origin of many urine metabolites in uc and cd patients may be related to the intestinal microflora . in our present study , urine metabolites showed some differences between cd and uc , however , it was not enough to create a model for distinguishing between these two forms of ibd . similar to serum and plasma of uc and cd patients , krebs cycle intermediates ( such as citrate and succinate ) , betaine and urea levels were lower than in the control cohort . we also observed low hippurate levels in uc and cd , which is well in accordance with a study by williams et al . the gut microbiome structure and the urinary metabolite profile have been recently investigated by li et al . , and these authors were able to correlate the presence of clostridia with hippurate levels . some similarities of the urine metabolome also exist with our dss mouse model . as in the dss model , we found , relative to the control cohort , higher levels of allantoin and tryptophan in uc and higher levels of lactate and carnitine in uc and cd . allantoin is a metabolite of uric acid and it is regularly detected in human urine . it correlates with dietary purine uptake , indicating disturbances in the purine metabolism in ibd . tryptophan , which is the precursor of serotonin , is a widely expressed metabolite and transmitter throughout the gut . tryptophan hydroxylase is decreased in rectal biopsies from patients with uc , highlighting the possibility that tryptophan levels have gone up because of the reduced levels of its metabolizing enzyme . high levels of tryptophan could contribute to the role of serotonin as a pathogenic mediator in ibd . unlike in serum and plasma , we noticed a decrease in methanol in both cd and uc relative to controls , which could be explained by the fact that most methanol was taken up by the circulation as already shown . finally , cd patients exhibited an increase in sugars , such as xylose , maltose , galactose , and lactose compared to the control cohort . xylose , for instance , can be broken down in the gut from dietary fiber ( e.g. , hemicellulose and cellulose ) by cellulolytic microflora in the colon including enterococcus sp . as a fact , enterococcus sp . is found in great abundance in cd patients and could thus contribute to higher xylose production and urine levels seen in our cd patients . our study shows that quantitative metabolite analysis of serum , plasma , and urine from cd and uc patients can be used to discriminate between healthy and diseased subjects . we were additionally able to confirm the detection of metabolites described by other groups , suggesting that these overlapping results may be very important in the future for the determination of biomarkers ( an overview of metabolite differences in experimental ibd models and human ibd is given by lin et al . ) . in order to discriminate between cd from uc , use of serum and plasma this points to a possible limitation of this study , which may have been the small sample size . in summary , however , our study indicates that metabolic profiling is a powerful tool to identify intestinal inflammation and may be useful in the management of ibd and in clinical studies exploring disease pathogenesis .	serologic biomarkers for inflammatory bowel disease ( ibd ) have yielded variable differentiating ability . quantitative analysis of a large number of metabolites is a promising method to detect ibd biomarkers . human subjects with active crohn s disease ( cd ) and active ulcerative colitis ( uc ) were identified , and serum , plasma , and urine specimens were obtained . we characterized 44 serum , 37 plasma , and 71 urine metabolites by use of 1h nmr spectroscopy and targeted analysis to differentiate between diseased and non - diseased individuals , as well as between the cd and uc cohorts . we used multiblock principal component analysis and hierarchical opls - da for comparing several blocks derived from the same objects ( e.g. , subject ) to examine differences in metabolites . in serum and plasma of ibd patients , methanol , mannose , formate , 3-methyl-2-oxovalerate , and amino acids such as isoleucine were the metabolites most prominently increased , whereas in urine , maximal increases were observed for mannitol , allantoin , xylose , and carnitine . both serum and plasma of uc and cd patients showed significant decreases in urea and citrate , whereas in urine , decreases were observed , among others , for betaine and hippurate . quantitative metabolomic profiling of serum , plasma , and urine discriminates between healthy and ibd subjects . however , our results show that the metabolic differences between the cd and uc cohorts are less pronounced .
You are an expert at summarizing long articles. Proceed to summarize the following text: light - cured composite resins ( lccrs ) have been studied extensively in recent years . the formulation proposed by bowen ( 1963 ) , which is still in use today albeit with slight modifications , consists basically of a resin matrix , filler particles , monomers and a photo absorbing compound . the latest development in this field has been the introduction of low shrinkage monomers and nanofiller particles . lccr ( polymerase chain reaction ) materials are present in filtec z350 ( 3m / espe , saint paul , mn , usa ) , which combines nanometric particles and nanoclusters in a conventional resin matrix , and in admira ( voco , cuxhaven , germany ) , whose resin matrix contains ormocer , an organically modified ceramic . the light - curing units ( lcus ) equipped with a light - emitting diode ( led ) , which produces cold light at 450 nm wavelength , is a promising device of costs and efficiency . however , the lcu operating with a halogen lamp is still the first choice of clinicians and extensive research has been dedicated to testing its efficiency . the present research focused on one of the important properties of lccrs - surface free energy ( sfe ) , to study the interaction between the forces of cohesion and the forces of adhesion that determine the occurrence of surface wetting . the wetting performance of etched enamel is important in all types of adhesive restorations because of the close interaction between the surface free energy of the etched enamel and the wettability of the luting and bonding material . the contact angle measurement method is probably the most definite way to determine cell surface hydrophobic . the angle is very high for water if substrata are hydrophobic . if the surface is hydrophilic , the droplet quickly dissipates and the measured angle is low . contact angles values vary with surface topography , surface tension of the liquid , surface energy of the substrate and the level of interaction between the liquid and solid . hydrophobic materials are more color - stable and stain - resistant than hydrophilic materials . gaps formed at the tooth / restoration interface may be caused by inadequate wetting of the tooth surface by the restorative material along the preparation walls during placement . surfaces with a low surface free energy minimize plaque formation . to calculate de sfe , the first step consists of measuring the contact angle ( ca ) between the solid under study and the test liquid , using a contact angle goniometer . the ca which is the macroscopic expression of the micro and macroscopic phenomena occurring between the solid , the test liquid . the acid - base theory involves the multicomponent approach , whereby the sfe occurs through dispersive interactions or lifshitz - van der waals ( lw ) and lewis acid - base ( ab ) interactions . the second approach involves the equation - of - state theory , which is highly criticized from the thermodynamic standpoint . although these theories are based on different concepts , they share the same basic idea , i.e. , they attempt to express the reverse work of adhesion of some of the components of the interfacial tension between liquids and solids . the aim of this work was to evaluate the variations in the surface energy of various composite resins after curing by led and halogen curing devices , based on contact angles and surface free energy . thirty - six test specimens of composite resins ( admira - voco , cuxhaven , germany ; filtec z350 - 3m / espe , saint paul , mn , usa ; grandio - voco , cuxhaven , germany ) were prepared in a 10 mm diameter , 2-mm thick articulated brass matrix . the specimens were finished with sof - lex discs ( 3m / espe ) and polished with kota diamond paste ( kota dental products , so paulo , brazil ) . the lcus employed were a led device ( elipar freelight ii -1000 mw / cm , 3m / espe ) and a halogen device ( vip tm 500 mw / cm and 600 mw / cm , bisco , inc . , schaumburg , il , usa ) . the light emission control was preset with a radiometer ( demetron 100p / n ; demetron research corp . , the materials ( shade a2 ) were inserted into the matrix in two portions and pressed with two microscope slides to achieve a smooth flat surface , after which they were light - cured in the specimens center for 20 s on each side . twelve samples of each composite were prepared , 6 were light - cured wit a led lcu and 6 with a halogen lamp . all specimens were stored in dark vials at 8c for 1 week , after which they were finished and polished before testing . the static contact angles were measured with a goniometer ( ram - hart 100-fo , netcong , nj , usa ) using deionized water and glycerol as test liquids ( table 1 ) . the 36 samples were divided into 12 groups of 6 test specimens each , and 6 drops of each liquid were used for the measurements . the computer was set to record 10 contact angle measurements of each drop , so 360 measurements were made for each group , making a total of 4,320 measurements . =relative equilibrium pressure , =interface tension , =interation forces ( london dispersive - debye dipole and keeson dipole - dipole ) =acidic part -acceptor , =basic part - donor the sfe was determined based on the harmonic mean method described by wu ( 1995 ) . because two test liquids are required to calculate the sfe by this method , the samples were divided into 6 groups of 6 test specimens each . a different lcu and test liquid the contact angle values determined for each group were stored in the computer , and the surface energy was calculated using dropimage standard software , netcong , nj , usa . the values were done by the soft but the calculations can be done by youngs equation : 2=12+1 cos and with the acid - base theory . statistical inter- and intra - group analyses of the data were made using anova and tukey 's test at 0.05 significance level . thirty - six test specimens of composite resins ( admira - voco , cuxhaven , germany ; filtec z350 - 3m / espe , saint paul , mn , usa ; grandio - voco , cuxhaven , germany ) were prepared in a 10 mm diameter , 2-mm thick articulated brass matrix . the specimens were finished with sof - lex discs ( 3m / espe ) and polished with kota diamond paste ( kota dental products , so paulo , brazil ) . the lcus employed were a led device ( elipar freelight ii -1000 mw / cm , 3m / espe ) and a halogen device ( vip tm 500 mw / cm and 600 mw / cm , bisco , inc . , schaumburg , il , usa ) . the light emission control was preset with a radiometer ( demetron 100p / n ; demetron research corp . , the materials ( shade a2 ) were inserted into the matrix in two portions and pressed with two microscope slides to achieve a smooth flat surface , after which they were light - cured in the specimens center for 20 s on each side . twelve samples of each composite were prepared , 6 were light - cured wit a led lcu and 6 with a halogen lamp . all specimens were stored in dark vials at 8c for 1 week , after which they were finished and polished before testing . the static contact angles were measured with a goniometer ( ram - hart 100-fo , netcong , nj , usa ) using deionized water and glycerol as test liquids ( table 1 ) . the 36 samples were divided into 12 groups of 6 test specimens each , and 6 drops of each liquid were used for the measurements . the computer was set to record 10 contact angle measurements of each drop , so 360 measurements were made for each group , making a total of 4,320 measurements . =relative equilibrium pressure , =interface tension , =interation forces ( london dispersive - debye dipole and keeson dipole - dipole ) =acidic part -acceptor , =basic part - donor the sfe was determined based on the harmonic mean method described by wu ( 1995 ) . because two test liquids are required to calculate the sfe by this method , the samples were divided into 6 groups of 6 test specimens each . a different lcu and test liquid the contact angle values determined for each group were stored in the computer , and the surface energy was calculated using dropimage standard software , netcong , nj , usa . the values were done by the soft but the calculations can be done by youngs equation : 2=12+1 cos and with the acid - base theory . statistical inter- and intra - group analyses of the data were made using anova and tukey 's test at 0.05 significance level . table 2 shows the mean values and standard deviations of the interactions among the various types of lccrs , lcus , and test liquids , as well as the statistically significant differences among the groups as indicated by the tukey 's test . mean values of contact angles ( meansd ) tukey 's multiple comparisons- ( same letters = not statistically significant p>0.05 ) sd = standard deviation the resin admira ( 74.45 ) , using glycerol as the test liquid and the halogen lamp as the lcu , yielded the highest mean ca value , while grandio ( 59.19 ) resin tested with glycerol , using led as the light source , yielded the lowest ca value . the inter- and intra - group ca values showed no significant difference ( p>0.05 ) for the filtec z350 resin , but all values obtained for the resin grandio showed significant differences ( p<0.05 ) . the sfe results listed in table 3 were subjected to tukey 's test , which indicated the absence of statistically significant differences among the groups . mean , standard deviation and standard error for surface free energy ( mj / m ) p>0.05 - not statistically significant the main controllable variables involved in ca measurements are the light - curing process , the test liquids and the chemical composition of the resin under study . all samples ( shade a2 ) were subjected to 40 s of light incidence upon the center of the sample , which according to lindberg , peutzfeldt and van dijken ( 2004 ) is sufficient to cure the entire surface of such samples . although the intensity of the vip tm ( bisco ) halogen lamp varied from 500 to 600 mw / cm , we do not believe this variation impaired the polymerization of the test specimens of the 3 resins . the intensity of light emitted by a halogen lamp is lower than that emitted by a led unit , but its values still exceed 280 to 300 mw / cm , according to caughman , rueggeberg and curtis ( 1995 ) . in view of the lack of information about the surface energy of these materials , it is difficult to compare our results to those of other author . the test liquids used here had different polarities , in spite of similar values which explains the mean ca values ranging from 59.19 to 74.45 obtained in this study . the degree of purity and the numerous measurements yielded reliable results and low standard deviations . although zisman ( 1964 ) stated that the volume of the drop does not influence ca values , this volume , as well as room temperature and humidity , were standardized in this study in order to reduce the number of variables . the organic matrix of admira resin is composed of ormocer , siloxane organic / inorganic polymer , bis - gma , hema , udma , fe2o3 , tio and 4-tert - butylcatechol ( tbc ) , and its inorganic matrix contains ba - al borosilicate , a silicon dioxide ( 0.04 - 0.7 m ) - 78% in weight and 56% in volume . the presence of these high surface energy particles , which in some samples may have been located close to the surface , could cause a decrease in measured ca values . light curing of the organic material , which closes the carbon chains , also probably interferes in the expression of these particles even in the deepest layers . the diameters of the inorganic particles of filtec z350 and grandio resins are nanometric . wu ( 1973 ) argues that the homogeneous dispersion of inorganic particles in the polymeric matrix is critical , a statement confirmed by von werne and patten ( 2001 ) . hydrophobic polymers and inorganic hydrophilic particles are physically difficult to mix , and phase separation or agglomeration is common in such mixtures , resulting , according to the aforementioned author , in alterations in their mechanical , optical and electrical properties . these particles can be treated chemically used to produce a more hydrophobic or hydrophilic surface . as shown in table 2 , the ca values of the filtek z350 resin showed no major variations in any of the combinations . in view of these results , it is reasonable to assume that the components of the resin in these test specimens were distributed more homogeneously . the ca values of the admira resin revealed greater variations in the two test liquids and the two lcus . among the 3 resins of this study , table 3 lists the mean values of the total sfe calculated for each lccr with respective sd , indicating no significant differences among the groups . the admira resin showed the highest sfe value when light - cured with the led unit ( 40.17 mj / m ) , while the grandio resin displayed the lowest sfe when photo - activated by the conventional halogen lamp ( 34.74 mj / m ) . the statistical analysis of the resins ' sfe data confirmed that the different types of lcu employed to polymerize the resins did not influence these results . this finding is congruent with that reported by glantz and larsson ( 1971 ) , although the resins tested by these authors belong to another generation of composites , whose chemical compositions differ considerably from those used in our study . milosevic ( 1992 ) who studied the adhesion of saliva films on composite resins , stated that polymers are usually known as low - sfe materials with values of about 40 mj / m , and that the particles of their inorganic load have high sfe values . all the results obtained in the present research ( table 3 ) are in agreement with those of this author . the contact angles of the 3 polymers studied here did not differ significantly , as did their wettability . the research recommends the material that showed the highest contact angle ; 2 . polymerization with led or halogen units did not alter the surface free energy of the composite resins .	objectivesthis study evaluated the surface energy and wettability of composite resins polymerized by different light - curing units to ascertain the good wetting of tooth surfaces to achieve adhesion . material and methodfiltek z350 ( 3 m espe ) , admira ( voco ) and grandio ( voco ) resins were selected for the testing procedures . the resins were light cured using led and halogen devices . contact angles were measured goniometrically ( ram - hart f100 ) using water and glycerol as test liquids . surface energy values were calculated with a software program ( dropimage standard ) that uses the harmonic mean method applied to the acid - base theory . the data were analyzed statistically by anova and tukey 's test with a significance of 0.05 . results and conclusionsno statistically significant differences were found between the values of surface energy . the measured wettability differed statistically in most combinations as a function of the type of composite resin , type of light - curing unit , and the test liquid .
You are an expert at summarizing long articles. Proceed to summarize the following text: schizophrenia and related psychoses are chronic disorders with an onset usually in early adulthood that affect patients all over their life and generally have moderate prognosis . several previous [ 1 , 2 ] and more recent [ 3 , 4 ] studies have suggested that early intervention is crucial for the improvement of the prognosis and outcome of these disabling disorders both medium- and long - term . however , the results of such studies have been criticized by others , and it is supported that the effectiveness of current protocols of early intervention is not superior to standard care [ 5 , 6 ] . moreover , it has been recently proposed that adequate funding and good clinical governance are critical in ensuring service quality and maintaining continuity of care , whether the early intervention in psychosis service is specialized or integrated within a generic mental health team . despite the ongoing debate about the effectiveness of specialized early intervention services , at recent years several such services have been developed worldwide for the early detection , intervention and comprehensive care of people who experience a first episode of psychosis ( fep ) . the first step for the establishment of new services is the estimation of the needs of a defined area . this study aimed to explore the needs and provide epidemiological data on fep patients in the prefectures of ioannina and thesprotia in greece . this is the first greek study on the rates of first episode of psychosis in a defined catchment area . the epidemiologic survey was performed in the context of the recently established , early intervention service ( eis ) of the university hospital of ioannina . the catchment area of the prefectures of ioannina and thesprotia belongs to the epirus region , north - western greece , and has a population of about 220000 inhabitants . mental health services of the area comprise the inpatient and outpatient psychiatric department of the university hospital of ioannina , the outpatient psychiatric department of the general state hospital , the outpatient department of the social insurance organization ( ika ) , and the mobile mental health unit ( mmhu i - t ) which delivers services in rural and remote areas . although in greece care is public , a large proportion of patients prefer to be examined by private practice physicians . there is no registration system for the first diagnosed psychotic patients , so for the performance of a reliable epidemiological survey data should be obtained from all those who may have examined and treated such patients . data for first episode psychotic patients during a two - year period ( 2008 and 2009 ) were obtained by reviewing the medical records of the patients examined in the two hospitals , ika and the mmhu i - t . for patients treated in the private sector , data was obtained by personal communication with the 12 treating psychiatrists of the area for the aforementioned period . all diagnoses were made by treating clinicians according to icd-10 criteria , as this classification is officially used in the country . however , only clinicians of the eis regularly use a standardized assessment interview , while their private sector colleagues rely only on usual clinical assessment . however , there is evidence that stability of icd-10 psychotic - disorder diagnoses over time is high . duration of untreated psychosis ( dup ) was calculated by the first author ( vp ) with the retrospective application of the principles of the symptom onset in schizophrenia ( sos ) inventory to the patients information as recorded at their charts ( public sector ) , or as provided by treating psychiatrists ( private sector ) . for the determination of patients socio - economic status we used an adapted form of the uk classification system , which has been used in previous research . more specifically , three social classes were defined , namely upper ( corresponding to the class i ) , middle ( comprising classes ii and iii ) and lower ( comprising classes iv and v ) , respectively . this adaptation was based on economic criteria of the patients families rather , than on their working status , since a large proportion of patients were very young , were still students and may have never worked . the statistical package of the social sciences ( spss 19.0 ) was used t perform all analyses . analysis was made with the use of the student t - tests and the statistical level for significance was chosen at p<0.05 . a total of 132 fep patients were examined in the 2-year period in the catchment area . most of the patients ( 81 or 61.4% ) were diagnosed and treated by private practicing psychiatrists . the majority of patients examined in the public sector ( 45 out of 51 , 88.2% ) were referred to the eis . data regarding base - line symptom severity were not available for private sector patients , because private practice psychiatrists do not regularly use assessment tools . statistical analysis showed no differences between the two sectors in terms of patients age , gender , family and social status , profession and dup . education was associated with the treatment setting selection , and college education was predictive of the use of the public sector ( p<.001 ) . first episode patients who had a history of alcohol / substance abuse were more likely been treated in the private sector ( p=.021 ) . a positive family history of a psychiatric disorder was associated with treatment in the public sector ( or 0.43 , 95% ci 0.20 - 0.92 , p=0.028 ) . there was an interaction of the variables substance abuse and family history . logistic regression showed that treatment setting was determined by the combination of these two variables , and that patients who were abusing alcohol or substances and had no family psychiatric history were less likely been treated in the public sector ( or 0.19 , 95% ci 0.04 - 0.90 , p=0.036 ) . the acquisition of data on the rates on fep in a defined area is essential for planning and providing mental health services . we were able to identify 132 fep cases who received treatment in every available setting in our catchment area in a 2-year - period this makes an annual incidence rate of 30 new cases per 100000 which is within the range reported in previous research in different countries . in our study this may reflect patients attitudes toward hospital psychiatric treatment ; or it may be that the eis unit , where most public sector cases were referred had just been established at the time of the study . moreover , at that time financial crisis in greece was in the beginning and more patients could afford treatment in the private sector . however , this is a relevant finding , because most patients did not receive the comprehensive multidisciplinary care delivered by the eis unit of the university hospital of ioannina . moreover , it has been suggested that specialized first - episode psychosis services may effectively address the issues of involving and educating families about psychosis as well as stigma . it is not known whether this is the case in the private sector in our country . on the other hand , preference for the psychiatric private sector is widespread in western countries , and there is evidence that , with the exception of some university centers , the quality of treatment in the public sector is poor [ 14 , 15 ] . notably , there was not a single case of first episode patient treated by the mmhu , but patients from rural areas would be rather examined by outpatient hospital services or private practicing psychiatrists . the mmhu delivers services since 2007 and has contributed significantly to the reduction of hospitalizations of chronic psychotic patients living in rural and remote areas of the prefectures of ioannina and thesprotia . we assume that perceived stigmatization of fep patients and their families in these rural areas prevents them from seeking help by a local mental health service . immigrants comprised only a small proportion of the patients ( 8 cases , 6% ) . the immigrant population in our catchment area is estimated at 4.4% , mostly at working age . it has been demonstrated , that migration is associated with high incidence rates of psychosis . in a recent study at a socioeconomically deprived area of inner london immigrants were over - represented among fep cases . from a total of 484 fep patients , only 23.1%% were british , while the proportion of british in the population at risk was as high as 41.6% . recent evidence in our country suggests that immigrants experienced higher degrees of inequity in primary health care that is possibly caused by their restricted access to social insurance health care . this may be the case of some fep cases which go unrecognized in this population . we assume that fep immigrant patients may have problems of access to the mental health system , resulting from socioeconomic reasons , insurance issues and barriers within the system , i.e. difficulties in language and little appreciation of the culture and adversities of this population by mental health staff and primary care physicians . conceivably , efforts should be made for the identification of such cases by the mental health system . duration of untreated psychosis was not significantly different for patients been treated in the private or the public sector ( mean duration 18.2 and 22.5 months , respectively ) . the interval between the onset of psychotic symptoms and treatment initiation has been shown to be a predictor of outcome , and shorter dup has been associated with better chance for recovery [ 21 , 22 ] . it is unknown whether private sector care providers can make efforts to reduce dup , but public health services should arrange initiations for facilitating access to mental health care and educating the public regarding psychotic illness in young persons . according to statistical analysis , education was associated with treatment setting selection , and having or being studied in college predicted treatment in the public sector . this finding is not easy to be interpreted and it is not known whether this level of education contributes to the development of a positive attitude toward the public health system . another finding of statistical and probably clinical significance was that patients with a history of alcohol or substance abuse were more likely to be treated in the private sector . it may be possible that the public sector physicians tend to underestimate the role of alcohol or substance abuse in psychopathology . this is supported by the relatively low rates of 11.8% of alcohol / substance abuse recorded for public sector patients , compared to previously reported , much higher rates . or , that dual diagnosis patients would prefer the perceived less restricted context of the private sector . no matter the explanation , dual diagnosis patients , who are a particular challenging subgroup , would not receive a more intensive and comprehensive care provided by the multidisciplinary eis team . the selection of the private sector as treatment setting was found merely to be determined by the combination of having a history of alcohol or substance abuse and a negative family psychiatric history . this means that patients with a positive family history for mental disorder would prefer to be treated in the public health system . perhaps the families of those fep patients , who were familiar with mental illness , were aware of the early intervention service of the university hospital , where most public sector cases were treated . however , there is evidence that families with a past history of psychiatric hospitalization of a family member were less likely to recommend other family members to mental health services , as indicated by the long delay between onset of psychotic symptoms and first admission which was found to be independently predicted by a family history of psychiatric hospitalization [ 24 , 25 ] . regarding illness severity at baseline , we have to note that panss scores were not available for patients treated in the private sector . our data are supposedly complete because we obtained data from every resource in the area patients could seek mental health care . a small number of cases may have been missed if they have been examined in other cities , such as the capital of greece , athens or the second large city , thessaloniki . other cases may have been missed if they were hospitalized in private hospitals in other cities , as in our region there is no private inpatient facility . a possible explanation for such a preference may be the perception that in those large cities with well - organized private facilities , fep patients would receive better care ; or it was the perceived stigmatization that led patients and families to seek care in other cities . we believe that the number of such cases is small , and we also assume that these patients were difficult to receive optimal long term care due to distance from their treating service which would render regular follow - up difficult . it should be mentioned that the structure of the health system in greece which is largely based on private practice physicians makes any epidemiologic survey performance a difficult task . for example , in the large population cities of athens and thessaloniki where there are many psychiatrists working in private practice , an effort to collect epidemiological data would be extremely difficult . patients diagnoses at the private sector were made according to usual clinical examination and history of the patients , without the use of a diagnostic interview , or other instrument . moreover , dup was calculated retrospectively , by applying the principles of sos to the information at patients charts , without interviewing the patients and other informants . in our catchment area most first episode patients are been treated by private sector clinicians . the selection of the private sector as treatment setting was found merely to be determined by the combination of having a history of alcohol or substance abuse and a negative family psychiatric history . immigrants comprised a small proportion of the patients , despite evidence of higher rates of psychotic disorders in this population . the results of this first greek study on the rates of first episode of psychosis in a defined area are relevant and may inform clinical practice and mental health policy .	this is the first greek study presenting epidemiologic data on first - episode psychosis ( fep ) patients in a defined catchment area . data for first episode psychotic patients during a two - year period ( 2008 and 2009 ) were obtained by all the mental health providers in the area , public or private . a total of 132 fep patients were examined in the 2-year period in the catchment area . most of the patients ( 61.4% ) were diagnosed and treated by private practicing psychiatrists . statistical analysis showed no differences between the two sectors in terms of patients age , gender , family and social status , profession and duration of untreated psychosis ( median duration 6 months ) . patients who were abusing substances and had no family psychiatric history were less likely been treated in the public sector . immigrants comprised only a small proportion of the patients , probably because they have difficulties in accessing the mental health system .
You are an expert at summarizing long articles. Proceed to summarize the following text: the pathogenesis and long - term natural history of glaucomatous optic neuropathy is still under active investigation . many clinical trials have confirmed the key role intraocular pressure ( iop ) plays in the development and progression of open - angle glaucoma [ 114 ] . such studies have shown that lowering iop reduces the risk of developing open - angle glaucoma and slows its progression . according to the ocular hypertension treatment study ( ohts ) [ 1 , 2 ] , the risk of developing glaucoma is reduced from 9.5% to 4.4% when a mean iop reduction of 22.5% was achieved with topical medications . treatments that reduce iop also reduced the proportion of patients with progression of clinically apparent glaucoma from 62% to 45% in the early manifest glaucoma trial ( emgt ) [ 36 ] , and from 27% to 12% in the collaborative normal - tension glaucoma study ( cntgs ) [ 79 ] . the current treatment strategy for glaucoma is to lower iop in order to suppress the progression of glaucomatous optic neuropathy . tonometry is one of the most important examinations in glaucoma management . with more accurate tonometry , more precise evaluation of reductions in iop or the effects of glaucoma management the goldmann applanation tonometer ( gat ) is one of the most commonly accepted instruments to measure iop . despite the benefits of noncontact tonometers , they have a larger coefficient of variation than that of gat and can result in larger measurement errors in patients with iop < 10 mmhg or > 25 mmhg . the tono - pen ( medtronic solan , jacksonville , fl , usa ) is more likely to have higher variability than gat and produces lower readings in patients with ocular tension 20 mmhg . gat is widely adopted as the gold standard in tonometry due to its accuracy and excellent reproducibility . however , the standard goldmann applanation tonometer ( sgat ) has 2 mmhg markings on the drum , which can lead to disadvantages such as variability due to reading or digit preference [ 17 , 18 ] . at900d ( haag - streit international , koeniz , switzerland ) is a new digital goldmann applanation tonometer ( dgat ) . the principles and basic methods for iop measurement are the same as those of sgat ; however , the measurements are shown to the 0.1 mmhg level on the display ( figure 1 ) . in this study , measurements obtained with sgat and dgat were compared to assess the accuracy and possible advantages of dgat . this study included 116 eyes of 60 subjects , including 15 eyes of 8 healthy subjects and 101 eyes of 52 patients with glaucoma . the sgat employed in this study was the at900 ( haag - streit international ) . although the instrument has 2 mmhg markings on the drum ( figure 1 ) , measurements were made to the 1 mmhg level . digital measurements were obtained to the 0.1 mmhg level ( figure 1 ) . for iop measurement , the eye was anesthetized with 0.4% oxybuprocaine . fluorescein was applied to the inferior fornix using a standard fluorescein paper strip . a single examiner ( y.s . ) first measured iop in triplicate for each eye using either sgat or dgat , which was randomly chosen . after a 5-minute interval , the mean iop in the right eye of the 60 patients as determined by sgat and dgat were compared using pearson 's correlation analysis . a bland - altman plot was constructed to evaluate agreement and calculate confidence intervals ( cis ) . for each eye , differences in iop measurements ( maximum minimum ) based on sgat and dgat were compared to study the dispersion in measurements using student 's t - test . a p value < 0.05 was considered to indicate statistical significance . the second of the three sgat and dgat readings for each eye was used to evaluate differences between iop in the left and right eye . the left - right difference in iop measured by dgat the mean iop of the 60 eyes measured using sgat was 16.27 6.68 mmhg and that for dgat was 16.35 6.69 mmhg . pearson 's correlation analysis revealed a significant positive correlation between sgat and dgat measurements of iop ( table 2 and figure 2 : r = 0.998 , p < 0.01 ) . when the subjects were divided into three groups based on the mean sgat iop value ( 14 mmhg , 30 eyes ; 1420 mmhg , 21 eyes ; or 20 mmhg , 9 eyes ) , sgat and dgat measurements within each stratum showed strong positive correlation ( table 2 : r = 0.935 , p < 0.01 ; r = 0.972 , p < 0.01 ; and r = 0.997 , p < 0.01 ; resp . ) . according to bland - altman analysis , dgat measurements showed no skew compared to sgat measurements ( figure 3 , n = 60 ) . the mean difference ( sgat - dgat ) in iop readings for each eye was 0.09 0.44 mmhg ( n = 60 ) . the difference ( maximum minimum ) within each set of three dgat measurements was 0.72 0.34 mmhg , which was significantly smaller than that for sgat ( 0.92 0.42 mmhg , p < 0.01 , n = 60 ) . the second reading in each set of sgat or dgat measurements was used to analyze differences between left and right eyes , because it was closest to the mean of the three tonometry measurements . of 60 patients examined , 30 patients had equal iop in both eyes based on sgat ( i.e. , zero left - right difference ) . the mean left - right difference detected by dgat in these 30 patients with no left - right difference on sgat was 0.47 0.31 mmhg ( range : 0 - 1.0 mmhg ) . new tonometers such as the rebound tonometer and dynamic contour tonometer have been developed recently . however , it is likely to show higher iop measurements than those of gat [ 19 , 20 ] . the dynamic contour tonometer is less influenced by central corneal thickness and is also more likely to show higher iops than gat [ 21 , 22 ] . therefore , while further studies have been investigating the characteristics of these tonometers , gat is still considered as the gold standard because of its clinically proven accuracy and availability . measurements with gat are usually made to the 1 mmhg level with a sgat 's scale marked at every 2 mmhg . if a measurement lies between the lines on the scale , the measurement is subjectively judged by the examiner . iop measurements by dgat are displayed to the 0.1 mmhg level , resulting in more objective measurements . another benefit of dgat is that iop data on the display can be easily read in a dark room ( figure 1 ) . previous studies have reported that dgat yields highly reproducible results and there is a significant positive correlation between sgat and dgat measurements [ 23 , 24 ] . similarly , in the present study , we observed significant positive correlation between sgat and dgat measurements ( figure 2 and table 2 ) . furthermore , we observed a positive correlation between sgat and dgat results even when the subjects were divided into groups based on the mean tonometry reading ( table 2 ) . before the present study , the dispersion in measurements based on differences ( maximum minimum ) has not been investigated . this study demonstrated that dgat yields significantly smaller differences ( maximum minimum ) when sets of three consecutive tonometry readings are analyzed . we also found that there was no trend for skew in the sgat and dgat readings based on the bland - altman plot ( figure 3 ) . these results may be a reflection of the fact that sgat and dgat are based on the same principles to measure iop . even in patients with equal iop ( zero left - right difference ) with sgat , although the differences were small ( 0.47 0.31 mmhg ) , this result indicates that even small differences in iop that could not be detected by sgat can be detected by dgat . this characteristic of dgat may be useful when evaluating the effects of medications , especially in patients with normal - tension glaucoma or those who achieved low iop with treatment . in such patients , changes in iop too small to be detected by the 1 mmhg resolution with sgat can be observed with dgat with 0.1 mmhg resolution . in conclusion , dgat , which shares the same principles for iop measurement with sgat , can provide more accurate iop data with high reproducibility and less dispersion due to its 0.1 mmhg scale . thus , dgat will enable the more refined iop evaluation required for clinical management of patients with normal - tension glaucoma and patients with progressive visual field loss despite low iop .	purpose . to compare a new digital goldmann applanation tonometer ( dgat ) that measures intraocular pressure ( iop ) in 0.1 mmhg increments to a standard goldmann applanation tonometer ( sgat ) . methods . this study included 116 eyes of 60 subjects . a single examiner first measured iop in triplicate using either sgat or dgat , which was randomly chosen . after a 5-minute interval , the next set of three consecutive iop was measured using the other gat . results . the mean iop measured with sgat was 16.27 6.68 mmhg and 16.35 6.69 mmhg with dgat . pearson 's correlation coefficient was 0.998 ( p < 0.01 ) . the subjects were divided into three groups based on the mean iop : iop < 14 mmhg , 1420 mmhg , or > 20 mmhg . the pearson 's correlation coefficient within each group was 0.935 , 0.972 , and 0.997 ( p < 0.01 ) , respectively . the difference within the three consecutive iop measurements ( maximum minimum ) for dgat ( 0.72 0.34 mmhg ) was significantly smaller than those with sgat ( 0.92 0.42 mmhg , p < 0.01 ) . even in patients with equal iop ( zero left - right difference ) with sgat ( n = 30 ) , dgat detected iop differences between the left and right eyes ( 0.47 0.31 mmhg ) . conclusion . compared to sgat , dgat measurements are highly reproducible and less variable .
You are an expert at summarizing long articles. Proceed to summarize the following text: in the case of alzheimer s dementia , cognitive disorders such as disorders in attention , start , plans , organization , problem solving ability , reasoning power , calculation ability , and memory appear before vascular dementia symptoms , such as motor or behavior disorders1 . dementia patients characteristics are impairment of the explicit memory necessary to obtain and maintain new information and decline in memory which inhibits subjects ability to perform daily living activities2 , 3 . cognitive rehabilitation intervention methods for dementia patients generally implemented at clinics include computer - assisted cognitive rehabilitation ( comcog ) , memory rehabilitation , cognitive stimulation , and psychological therapy2 . among them , comcog is currently used at clinics widely , and has the advantages of being easily adjusted to individual patients cognitive levels and accurate results and immediate feedback for judging the performance of patients2 . in a study that conducted comcog for alzheimer s dementia patients , delay in the progress of cognitive function disorders was identified4 . in another study , it was reported that after conducting comcog for alzheimer s dementia patients for four weeks , the number of errors in task performance decreased5 . however , studies that have conducted comcog for alzheimer s dementia patients and examined its memory improvement effects have been are in south korea . the purpose of the present study was to conduct comcog for alzheimer s dementia patients to examine its effects on memory and to provide basic data for the effects of comcog on alzheimer s dementia patients at clinics . the present study was conducted with 35 in patients diagnosed with alzheimer s dementia . criteria for selection of subjects for the present study were : a clinical dementia rating ( cdr ) in the range of 0.52 , a mini - mental state examination - korea ( mmse - k ) score of 23 points or lower , and no history of neurological disease . participants who met the inclusion criteria and agreed to participate in the study received a general explanation of the procedures , and gave their written informed consent . all procedures were reviewed and approved by the institutional ethics committee of cheongju university . the tester provided education before the intervention so that the subjects could learn to use computers and manipulate the mouse by themselves . the comcog program consists of items such as simple recognition memory , simple spatial memory , sequential recall memory , language recall memory , combined recall memory , language categorization memory , and language integration memory , and is intended to improve memories . this program was conducted for 30 minutes per day , five times per week for four weeks . the cognitive assessment reference diagnosis system ( cards ) is a cognitive test tool that includes individual tests consisting of seven memory test items and five non - memory test items . the five memory test items consist of recognition of 10 words , delayed 10-word list , recent memory , delayed 10-object list , and recognition of 10 objects . in the present study , to measure memories , memory - related tests of five items were conducted . the test - retest reliability and inter - rater reliability were very high at 0.740.992 . mmse - k is the korean version of a standardized cognitive evaluation tool and is a dementia screening tool used to evaluate elderly persons cognitive disorders and whether they have dementia . it consists of a total of 12 questions with a maximum possible score of 30 points : 24 points or higher indicates a normal state , 2023 points indicates suspected dementia , and 19 points or lower indicates dementia . the inter - rater reliability of this test tool is very high at 0.995 . in the present study , data were analyzed using spss 18.0 and the paired t - test was conducted to test average differences in memories between before and after intervention . thrity - five subjects participated in the present study , 14 males and 21 females . the subjects ages were distributed as follows : 6069 years 5 ( 14.3% ) , 7079 years 18 ( 51.4% ) , 8089 years 11 ( 31.4% ) , 90 years or older 1 ( 2.9% ) . the number of subjects with cdr class 0.5 was 7 ( 20% ) , with class 1 was 17 ( 48.6% ) , and with class 2 was 11 ( 31.4% ) . the subjects dementia duration was 20.949.66 months and their average mmse - k score was 16.634.35 points . after conducting comcog , among cards items , the scores of recognition of 10-words decreased significantly ( p<0.01 ) , while the scores of all the other variables increased significantly ( p<0.01 ) . among mmse - k items , orientation , registration , and recall showed significant increases ( p<0.05 ) ( table 1table 1.pre- and post- intervention values of the cards and mmse - k ( n=35)prepostcardsdelayed 10-word list10.28 14.6423.71 21.15*delayed 10-object list2.00 5.3122.00 19.37recognition of 10 words34.00 33.9714.00 22.90recognition of 10 objects34.57 19.3052.00 24.22recent memory36.85 28.5949.42 26.22mmse - korientation4.71 1.585.48 2.68registration2.48 0.912.68 0.79recall1.00 1.691.62 2.01language6.97 1.527.00 1.59attention and calculation1.45 1.551.85 1.68meansd , p<0.05 , * * p<0.01 * * * p<0.001 , cards : cognitive assessment reference diagnosis system ; mmse - k : mini - mental state examination - korea ) . meansd , * p<0.05 , * * p<0.01 * * * p<0.001 , cards : cognitive assessment reference diagnosis system ; mmse - k : mini - mental state examination - korea in the present study , after conducting comcog , alzheimer s dementia patients cards scores of the delayed 10-word list , the delayed 10-object list , recognition of 10 objects , and recent memory items significantly increased . these results are consistent with the results of previous studies in which alzheimer s dementia patients memories were improved through comcog6 . however , in the present study , the scores of recognition of 10 words , that is understanding the meanings of words , significantly decreased after intervention unlike the other items and it is our assumption that the characteristics of alzheimer s dementia are reflected in this result . these results are similar to the results of previous studies indicating that in the results of cognitive rehabilitation intervention , alzheimer s dementia patients scores in the recognition of 10 words item were shown to be lower than those of the general elderly persons or groups with other kinds of dementia , as alzheimer s dementia patients ability to distinguish between words and to accurately understand the meanings of words is impaired7 . in the results of the present study , the scores of the delayed 10-word list item were increased by the intervention while the scores of the recognition of 10 words decreased . recognition of 10 words requires an understanding of the relevant words to re - recognize the words , whereas in the delayed 10-word list only recall of words that were heard even if the words may not be properly understood8 . based on the results of previous studies of the characteristics of alzheimer s dementia patients , it is thought that the effects of comcog on alzheimer s dementia patients recognition of 10 words ability is lower than those on other kinds of memories . in a study conducted by cipriani et al . , it was reported that when comcog was conducted to 10 alzheimer s dementia patients , their mmse scores significantly increased6 . the results of the present study are similar and among the mmse - k items , the memory item showed a significant increase . these results provide evidence that comcog is effective at improving memories of alzheimer s dementia patients . based on these results , when in the deterioration of memories can be expected comcog is conducted for alzheimer s dementia patients showing declines in cognitive functions .	[ purpose ] the purpose of the present study was to conduct computer - assisted cognitive rehabilitation ( comcog ) to examine the effects of comcog on alzheimer s dementia patients memories . [ subjects ] thirty - five patients diagnosed with alzheimer s dementia received comcog for 30 minutes per day , five days per week for four weeks . [ methods ] before and after the comcog intervention , subjects cognitive functions were evaluated using the cognitive assessment reference diagnosis system ( cards ) and mini - mental state examination - korea ( mmse - k ) test . [ results ] according to the results of the evaluation , among the cards scores of the subjects who received comcog , the scores of the delayed 10-word list , delayed 10-object list , recognition 10-object , and recent memory significantly increased while the scores of recognition 10-word significantly decreased after intervention compared to before intervention . in addition , among the mmse - k items , the orientation , registration , and recall showed significant increases . [ conclusion ] based on these results , delay in the progress of memory deterioration can be expected when comcog is conducted for alzheimer s dementia patients who show declines in cognitive functions .
You are an expert at summarizing long articles. Proceed to summarize the following text: internal disk disruption ( idd ) has been found to be the most prevalent cause of chronic low back pain ( lbp ) , surpassing facet joint and sacroiliac joint pain.1,2 even in the absence of nerve root involvement , idd can cause pain in the back and leg.3 though somatic lbp is the major presentation , referred thigh pain or leg pain , when present , may be misleading in diagnosis and treatment.4,5 idd is regarded as an early event of disk degeneration.6 the associated pain is believed to be related to ingrowth of nerves and blood vessels through an annular fissure.710 such lbp tends to be chronic and persistent over time.6 despite the fact that idd has been identified as a common cause of disabling lbp in young patients,9 there is little consensus as to what the best treatment is.8 because mechanical strains and elevated intradiskal pressure ( idp ) have been shown to be closely associated with the progression of lumbar disk degeneration,1012 unloading a painful disk in its early stage of degeneration would theoretically alleviate pain and even stop or slow down the degenerative process . a recent development in the surgical treatment of lumbar degenerative diseases is the application of interspinous process devices ( ipds).1315 however , little is known about the feasibility and efficacy of ipds in the treatment of symptomatic idd . the aim of this retrospective study was to evaluate the efficacy of implanting an ipd , the device for intervertebral assisted motion ( diam , medtronic inc . , memphis , tn , usa ) implant , as the surgical treatment for patients suffering from refractory symptomatic idd , with at least 3 years of follow - up . between november 2008 and december 2012 , 52 patients with symptomatic idd were selected as candidates for diam implantation . before considering surgery , all patients had received at least 3 months ( mean 9 months , range 360 months ) of failed nonsurgical treatments , which included lifestyle and work load modifications , bracing , and continuous physical therapy . twenty - six patients had also received one or more sessions of injection or radiofrequency therapy . the treated sites were sacroiliac joints in 17 , disks in eight , facet joints in five , and unknown in three patients . all patients felt that their quality of life was significantly affected by the symptoms , and they actively sought for more aggressive measures . none of them had history of malignancy , psychiatric disorders , or previous spinal trauma , infection , or surgery . the major symptom was axial low back / buttocks pain with or without leg pain . the axial pain / leg pain ratios according to patients own perceptions were 100/0 in six , 90/10 in seven , 80/20 in six , 70/30 in eight , 60/40 in three , and 50/50 in four cases . corresponding neurologic deficits were detected in 13 cases , manifested as motor weakness with or without sensory impairment . none of the patients had intermittent claudication typical of lumbar spinal stenosis or symptoms and physical findings suggestive of hip joint or sacroiliac joint arthropathy . the diagnosis of idd was based on imaging studies and provocative discography . excluding five patients who refused discography and nine who showed negative discographic findings or reported no concordant pain on provocative tests , a total of 34 patients ( 14 men and 20 women ) with a mean age of 38 years ( range 2451 ) were included in this retrospective study ( table 1 ) . the study protocols were approved by the institutional review board of the e - da hospital . mr findings of dark signal with a high - intensity zone in the posterior annulus were regarded as diagnostic of idd.16 meanwhile , the pfirrmann classification was used for assessing the severity of disk degeneration.17 according to the pfirrmann criteria , five cases were classified as grade ii and 29 as grade iii . excluded were patients who showed image findings of disk extrusion or sequestered herniation , advanced disk degeneration with modic changes , disk space collapse ( pfirrmann grades iv or v ) , defects of pars interarticularis , spondylolisthesis , lumbar stenosis , or disease at the l5-s1 level . after midline skin incision , the paraspinal muscles were dissected and retracted to expose the target rostral and caudal spinous processes and laminae . the interspinous and the interlaminar ligaments were removed , while the supraspinous ligament was preserved . the diam implant was placed between the two spinous processes and laminae under the supraspinous ligament . the implant size was determined by insertion trials ( 8 mm , 10 mm , 12 mm , and 14 mm ) . the implant was firmly anchored in place by the two tethers passed around the two adjacent spinous processes , and fixed with crimps . idp was measured intraoperatively in the first 14 cases using an intracranial pressure monitoring device ( codman microsensor icp transducer ; codman & shurtleff , inc . written informed consent was obtained from patients to participate in the study . after removing the interlaminar ligament , a small puncture of the annulus fibrosus was made with an 18 g needle or a no . the tip of the microsensor was inserted through the annulus into the center of the disk . a baseline resting idp reading was obtained first , and then subsequently at three different time points , including distracting between the spinous processes and laminae with a distractor , inserting trial templates , and after diam implantation ( figure 1 ) . all patients were followed up at 3 weeks , 3 months , 6 months , 12 months , and then annually after surgery . back and leg pain intensity was assessed with the visual analog scale ( vas ) and severity of functional impairment with the oswestry disability index ( odi ) . radiographs were obtained at each follow - up to evaluate the implant position , status of the disk , segmental mobility at the diam - implanted level , and the proximal and distal adjacent disk levels . preoperative and postoperative data of vas and odi were compared using the paired t - test . between november 2008 and december 2012 , 52 patients with symptomatic idd were selected as candidates for diam implantation . before considering surgery , all patients had received at least 3 months ( mean 9 months , range 360 months ) of failed nonsurgical treatments , which included lifestyle and work load modifications , bracing , and continuous physical therapy . twenty - six patients had also received one or more sessions of injection or radiofrequency therapy . the treated sites were sacroiliac joints in 17 , disks in eight , facet joints in five , and unknown in three patients . all patients felt that their quality of life was significantly affected by the symptoms , and they actively sought for more aggressive measures . none of them had history of malignancy , psychiatric disorders , or previous spinal trauma , infection , or surgery . the major symptom was axial low back / buttocks pain with or without leg pain . the axial pain / leg pain ratios according to patients own perceptions were 100/0 in six , 90/10 in seven , 80/20 in six , 70/30 in eight , 60/40 in three , and 50/50 in four cases . corresponding neurologic deficits were detected in 13 cases , manifested as motor weakness with or without sensory impairment . none of the patients had intermittent claudication typical of lumbar spinal stenosis or symptoms and physical findings suggestive of hip joint or sacroiliac joint arthropathy . the diagnosis of idd was based on imaging studies and provocative discography . excluding five patients who refused discography and nine who showed negative discographic findings or reported no concordant pain on provocative tests , a total of 34 patients ( 14 men and 20 women ) with a mean age of 38 years ( range 2451 ) were included in this retrospective study ( table 1 ) . the study protocols were approved by the institutional review board of the e - da hospital . mr findings of dark signal with a high - intensity zone in the posterior annulus were regarded as diagnostic of idd.16 meanwhile , the pfirrmann classification was used for assessing the severity of disk degeneration.17 according to the pfirrmann criteria , five cases were classified as grade ii and 29 as grade iii . excluded were patients who showed image findings of disk extrusion or sequestered herniation , advanced disk degeneration with modic changes , disk space collapse ( pfirrmann grades iv or v ) , defects of pars interarticularis , spondylolisthesis , lumbar stenosis , or disease at the l5-s1 level . after midline skin incision , the paraspinal muscles were dissected and retracted to expose the target rostral and caudal spinous processes and laminae . the interspinous and the interlaminar ligaments were removed , while the supraspinous ligament was preserved . epidural fat , if present , was kept as intact as possible . the diam implant was placed between the two spinous processes and laminae under the supraspinous ligament . the implant size was determined by insertion trials ( 8 mm , 10 mm , 12 mm , and 14 mm ) . the implant was firmly anchored in place by the two tethers passed around the two adjacent spinous processes , and fixed with crimps . idp was measured intraoperatively in the first 14 cases using an intracranial pressure monitoring device ( codman microsensor icp transducer ; codman & shurtleff , inc . , raynham , ma , usa ) . written informed consent was obtained from patients to participate in the study . after removing the interlaminar ligament , a small puncture of the annulus fibrosus was made with an 18 g needle or a no . the tip of the microsensor was inserted through the annulus into the center of the disk . a baseline resting idp reading was obtained first , and then subsequently at three different time points , including distracting between the spinous processes and laminae with a distractor , inserting trial templates , and after diam implantation ( figure 1 ) . all patients were followed up at 3 weeks , 3 months , 6 months , 12 months , and then annually after surgery . back and leg pain intensity was assessed with the visual analog scale ( vas ) and severity of functional impairment with the oswestry disability index ( odi ) . radiographs were obtained at each follow - up to evaluate the implant position , status of the disk , segmental mobility at the diam - implanted level , and the proximal and distal adjacent disk levels . preoperative and postoperative data of vas and odi were compared using the paired t - test . the reasons for aborting pressure monitoring included failure to pass the sensor through the annulus and mechanical problems of the sensors or monitors . distraction between spinous processes with the distractor caused an abrupt drop of pressure ( mean 81.534.0 mmhg ) . the pressure rebounded on replacing the distractor with a template ( mean 0.657.7 mmhg ) . the mean final pressure after securing the diam implant was 91.938.7 mmhg . compared to the initial resting idp , the readings recorded on distraction , template insertion , and diam implantation were all significantly lower ( p<0.0001 ; figure 2 ) . as the pattern of intraoperative idp changes was so distinctive and constant , pressure monitoring was not performed in the rest of the cases . a 28-year - old woman presented with lbp with radiation to buttocks for 3 years . her perception of pain distribution was 80% on the low back and buttocks , and 20% on the legs . she had received radiofrequency therapy twice at two other hospitals , 1 year and 2 months prior to her visit , respectively . radiographs showed that she had a sixth lumbar vertebra , and that there was a loss of l56 disk height ( figure 3a c ) . mri showed dark signal in the disk with a posterior high - intensity zone ( figure 3d and e ) . as the l6 level possessed lamina and spinous process that were large enough , a diam implant was secured between l5 and l6 . postoperative dynamic radiographs showed preserved flexion / extension mobility and enlarged neuroforamen ( figure 3f h ) . all 34 patients reported improvement of pain and functional status at the first follow - up 1 week after surgery . thirty - one cases ( 91% ) remained free of symptoms and of any requirement for medications until the last follow - up . mean preoperative vas and odi were 7.81.5 and 24.63.5 , while values at the last follow - ups were 1.32.2 and 6.37.6 , respectively ( p<0.0001 ) ( figure 4 ) . three patients reported recurrence of back and/or leg pain during follow - ups despite an initial improvement after surgery . mri was repeated in these patients , which unequivocally revealed resolution of the posterior annular high - intensity zone and widened neuroforamens ( figure 5 ) . the back pain in the first case , a 45-year - old man who underwent l34 , l45 diam implantations , started after a fall in a motor vehicle accident . it soon subsided with medical treatment . the second case , a 40-year - old man , suffered new right leg pain caused by l5-s1 disk herniation after relief of lbp following l45 diam implantation . microdiskectomy had to be performed 4 months after the initial operation to relieve his symptoms . the third case , a 42-year - old woman , despite initial pain relief after surgery , suffered from recurrence of back and leg pain 3 months later . meanwhile , she had sleep disorder and menstrual irregularity and visited other specialists for narcotics frequently . overall , based on the odom s criteria , the final clinical outcomes were excellent in 24 cases , good in seven , fair in two , and poor in one case . at the diam - implanted segments , follow - up radiographs showed no progression of disk height loss , endplate changes , appearance of vacuum clefts , or segmental instability . before surgery , obvious segmental flexion / extension mobility was present in 30 cases . at the final follow - up , this was preserved in 27 cases , but restricted in two , and lost in one case . there was no radiographic evidence of degeneration at any proximal or distal adjacent segments next to the diam - implanted segments . consistently , all the mr images showed increased neuroforaminal widths and resolution of annular fissures at the diam - implanted segments ( figure 5 ) . all patients were ambulatory in a lumbar corset on the day of surgery or the next day . the reasons for aborting pressure monitoring included failure to pass the sensor through the annulus and mechanical problems of the sensors or monitors . distraction between spinous processes with the distractor caused an abrupt drop of pressure ( mean 81.534.0 mmhg ) . the pressure rebounded on replacing the distractor with a template ( mean 0.657.7 mmhg ) . the mean final pressure after securing the diam implant was 91.938.7 mmhg . compared to the initial resting idp , the readings recorded on distraction , template insertion , and diam implantation were all significantly lower ( p<0.0001 ; figure 2 ) . as the pattern of intraoperative idp changes was so distinctive and constant , pressure monitoring was not performed in the rest of the cases . a 28-year - old woman presented with lbp with radiation to buttocks for 3 years . her perception of pain distribution was 80% on the low back and buttocks , and 20% on the legs . she had received radiofrequency therapy twice at two other hospitals , 1 year and 2 months prior to her visit , respectively . radiographs showed that she had a sixth lumbar vertebra , and that there was a loss of l56 disk height ( figure 3a c ) . mri showed dark signal in the disk with a posterior high - intensity zone ( figure 3d and e ) . as the l6 level possessed lamina and spinous process that were large enough , a diam implant was secured between l5 and l6 . postoperative dynamic radiographs showed preserved flexion / extension mobility and enlarged neuroforamen ( figure 3f h ) . all 34 patients reported improvement of pain and functional status at the first follow - up 1 week after surgery . thirty - one cases ( 91% ) remained free of symptoms and of any requirement for medications until the last follow - up . mean preoperative vas and odi were 7.81.5 and 24.63.5 , while values at the last follow - ups were 1.32.2 and 6.37.6 , respectively ( p<0.0001 ) ( figure 4 ) . three patients reported recurrence of back and/or leg pain during follow - ups despite an initial improvement after surgery . mri was repeated in these patients , which unequivocally revealed resolution of the posterior annular high - intensity zone and widened neuroforamens ( figure 5 ) . the back pain in the first case , a 45-year - old man who underwent l34 , l45 diam implantations , started after a fall in a motor vehicle accident . the second case , a 40-year - old man , suffered new right leg pain caused by l5-s1 disk herniation after relief of lbp following l45 diam implantation . microdiskectomy had to be performed 4 months after the initial operation to relieve his symptoms . the third case , a 42-year - old woman , despite initial pain relief after surgery , suffered from recurrence of back and leg pain 3 months later . meanwhile , she had sleep disorder and menstrual irregularity and visited other specialists for narcotics frequently . overall , based on the odom s criteria , the final clinical outcomes were excellent in 24 cases , good in seven , fair in two , and poor in one case . at the diam - implanted segments , follow - up radiographs showed no progression of disk height loss , endplate changes , appearance of vacuum clefts , or segmental instability . before surgery , obvious segmental flexion / extension mobility was present in 30 cases . at the final follow - up , this was preserved in 27 cases , but restricted in two , and lost in one case . there was no radiographic evidence of degeneration at any proximal or distal adjacent segments next to the diam - implanted segments . consistently , all the mr images showed increased neuroforaminal widths and resolution of annular fissures at the diam - implanted segments ( figure 5 ) . all patients were ambulatory in a lumbar corset on the day of surgery or the next day . different from more advanced lumbar disk degeneration , idd lacks obvious image findings to justify any aggressive treatment . even if a patient suffers from severe symptoms , many would not view them as candidates for surgery . however , idd may cause chronic disabling symptoms , and may progress to more advanced degeneration.6 the idea of easing a patient s symptoms , making their quality of life better , and halting the process of degeneration in its early stage is appealing . we selected only those who presented with predominantly axial low back / buttock pain with no or relatively mild leg symptoms as candidates for stand - alone diam implantation . our results indicate that diam implantation is an effective and durable surgical option for idd . we excluded patients with advanced disk degeneration ( pfirrmann grades iv and v ) , overt lumbar stenosis , spondylolisthesis , and instability . the rationale was the belief that the diam implant provides axial distraction but does not relieve anteroposterior or circumferential compression from hypertrophic ligamentum flavum and facet joints present in advanced disk degeneration and lumbar stenosis . moreover , such cases often have associated disk space collapse and ankylosis of the facet joints , which would significantly limit the applicability of the diam implant and its mobility after implantation . it is arguable whether an intervertebral disk in its early stage of degeneration should not be treated surgically at all . one of the major findings of this study is that in idd , the symptoms can be severe enough to affect quality of life badly , even though the disk may appear only mildly degenerated.9 while waiting for a longer period for conservative treatment to work is always an option , the patient may have to continue tolerating the symptoms and futile therapy . in addition , there is the risk of progressive degeneration and dysfunction of the disk and facet joints over time to a state where dynamic stabilization with a diam implant would no longer be optimal , and fusion might become the only choice . distraction between two adjacent spinous processes and laminae , whether from a distractor , a trial template , or a diam implant , unequivocally reduced idp ( figure 2 ) . degeneration,11,12 our findings imply disk unloading as a mechanism for the clinical benefits of diam implantation . the maintenance of disk height on follow - up radiographs suggests that the diam implant was effective in preventing the progression of disk degeneration . besides , its limitation on flexion / extension mobility appears minimal , provided such mobility is present before surgery . this might have been due to the relatively young age of our patients , as well as the elastic and compressible property of the silicon - based material of the diam implant . the absence of any adjacent segment degeneration , either proximal or distal , suggests that diam implantation has little adverse impact on adjacent segments . this is in accordance with previous reports showing that ipds do not alter the loading at the adjacent segments.15,18,19,2125 even in the four patients with no preoperative segmental flexion / extension mobility , and the three cases who lost normal mobility after surgery , radiographic changes of adjacent segment degeneration were not observed . it is likely that even if a segment is immobilized by a diam implant , it does not become fixed . therefore , the impact on its adjacent segments should be quite different from that caused by rigid fusion . according to a recent review , placement of ipds is associated with relatively high complication and failure rates.26 common complications included spinous process fractures and dural tears . reasons for revision surgery were lack of improvement , worsening of pain , or implant dislocatioin.26 in contrast , none of these adverse events occurred in our patients . second , an operating microscope was routinely used for removal of the interspinous and interlaminar ligaments , while preserving the epidural adipose tissue if present . first , the number of cases was relatively small . however , the small case number actually reflects our stringency in patient selection . second , even though mri and discographic evidence was available for diagnosis , other sources of pain , such as the facet joints and the sacroiliac joints , might have probably existed in some patients third , we are unable to provide data concerning facet status before and after surgery . in this regard , even though we have provided evidence of disk unloading ( idp reduction ) as underlying the diam - mediated symptom relief , we can not be sure whether facet joint unloading also played a role , though it has been demonstrated in cadavers that ipds reduce facet loading.25 finally , postoperative mri was done in only the three patients who had recurrence of pain . the national health insurance administration of our country dictates that mri done without a just cause is liable to be denied reimbursement or even fined . as the causes of recurrent pain were proved to be unrelated to the initial disk degeneration , the mr findings of resolution of annular fissure and enlargement of neuroforamens can be regarded as image evidence supporting the benefits of diam implantation for idd , even though the number of cases was small . in idd with intractable symptoms , diam implantation provides pain relief , functional improvement , and satisfactory clinical outcomes . such dynamic stabilization appears effective in resolving annular fissures and preventing progression of disk degeneration . these beneficial effects , together with disk unloading and increased neuroforaminal dimensions , may be the mechanisms for the observed satisfactory clinical outcome .	background / objectiveinternal disk disruption ( idd ) , an early event of lumbar disk degeneration , is the most common cause of low back pain . since increased intradiskal pressure ( idp ) is associated with symptoms and progression of disk degeneration , unloading a painful disk with an interspinous process device ( ipd ) is a rational treatment option . the goal of this study was to evaluate the effectiveness of dynamic stabilization with an ipd in the treatment of symptomatic idd of the lumbar spine.patients and methodspatients with symptomatic idd were treated with implantation of an ipd , the device for intervertebral assisted motion ( diam ) . diagnosis of idd was based on typical mri finding of posterior annular high - intensity zone and positive provocative test on discography . idp was analyzed intraoperatively . axial back and leg pain was evaluated with visual analog scale , functional status with oswestry disability index , and final clinical outcomes with odom criteria . data from 34 patients followed up for at least 3 years were collected.resultsdiam implantation significantly reduced idp ( n=11 , p<0.0001 ) . all 34 patients reported symptom relief . thirty - one patients ( 91% ) remained symptom free until the last followups . three patients ( 9% ) experienced recurrence of pain , of which the causes were unrelated to the idd or surgery . disk status at the diam - implanted segments remained stable . segmental flexion / extension mobility was preserved in 27 of 30 patients with preoperative mobility . no proximal or distal adjacent segment degeneration was observed . the final clinical outcomes were excellent / good in 31 and fair / poor in three patients.conclusionfor patients with symptomatic idd , dynamic stabilization with diam provides pain relief and functional improvement . the implantation maintains disk status and prevents progression of disk degeneration , without compromising segmental flexion / extension mobility or causing adjacent segment degeneration .
You are an expert at summarizing long articles. Proceed to summarize the following text: nowadays , along with increased life span , mortalities caused by chronic diseases such as cancers have also increased . cancer is a pathogenic process that is caused by increase and multiplication of abnormal body cells . according to the information provided by world health organization ( who ) in 2005 , 7.6 million out of all the 58 million cases of death all around the world were caused by cancer ( 13% ) . in iran blood cancer or different types of leukemia comprise about 8% of all human population cancers and are known as the fifth common cancers all around the world . two main types of these cancers are acute myeloid leukemia ( aml ) and acute lymphocytic leukemia ( all ) . american association of cancer has estimated that 31500 individuals are diagnosed with one type of leukemia each year and approximately 21500 of them will die . iran s cancer registry center also reported 4393 new cases of blood malignancies in 2008 , 805 ( 18.3% ) and 432 ( 9.8% ) cases who were diagnosed with all and aml , respectively . although the prevalence of acute leukemia is estimated to be 3% lower than that of other cancers , this group of cancers is the main cause of death in individuals below 39 years old . chemotherapy is one of the most common treatments for cancer and consists of the use of cytotoxic drugs to cure the disease . chemotherapy is the first line therapy of leukemia and lymphomas and is a systematic therapy compared to topical treatments , such as surgery and radiation therapy . yet , it has numerous side effects , the most common of which being stomatitis or oral cavity mucositis . in general , 40% of patients under chemotherapy , 70% of patients under bone marrow transplantation , and stomatitis is an inflammatory reaction in the oral cavity along with intermediate redness and swelling and can be painful . it can also lead to problems , such as infection , mucosal hemorrhage , food intake and nutritional disturbance , and restlessness . studies have shown that based on the patients opinions , pain was the most annoying sign of stomatitis . overall , 76 - 86% of patients with stomatitis have pain , which can cause malnutrition . clinically , the effect of chemotherapy on the oral mucosa begins shortly after administration , peaks on days 7 - 10 , and can last for 14 days . the best way to overcome stomatitis is its prevention . to date , in most hematology units , normal saline and sodium bicarbonate are used as mouthwash before the occurrence of signs and solutions , such as diphenhydramine syrup , nystatin droplet , lidocaine , and cholorhexidine which are used after appearance of oral signs . each of these solutions has some side effects and , thus , may not satisfy the patients completely . herbal drugs have been increasingly used since the last decades because of their appropriate effects and low side effects . aloe vera or sabr - e - zard has been used for 2000 years as a topical drug for skin disorders . up to now , no clinical trials have assessed the effect of aloe vera on chemotherapy - induced stomatitis in iran . considering the increase in the prevalence of cancer and the number of patients undergoing chemotherapy and effects of aloe vera on wound healing , the present study aimed to evaluate the effectiveness of aloe vera in the intensity of stomatitis and its pain . it was hypothesized that receiving aloe vera solution would decrease the intensity of stomatitis and its pain in the patients undergoing chemotherapy . this randomized controlled clinical trial aimed to assess the effect of aloe vera solution on the intensity of stomatitis and its pain between august 11 and october 23 , 2014 . according to the study objectives and the previous studies conducted on the issue and considering the power of 80% and =0.05 , a 64-subject sample size ( 32 in each group ) was determined for the study using ncss software and the following formula : the study participants were between 18 and 88 years old , suffered from all and aml , and had referred to nemazee educational hospital and chemotherapy unit of shahid motaharri clinic . the inclusion criteria of the study were the patients willingness to cooperate , age above 18 years , confirmation of aml and all , and being under chemotherapy . on the other hand , the exclusion criteria were suffering from any other underlying diseases ; being addicted to cigars , tobacco and opioid drugs ; having a history of sensitivity to aloe vera ; developing any kind of sensitivity to any material during the study ; developing any acute condition during the study ; and unwillingness to continue participation in the study . the participants were selected through convenience sampling . in so doing , any patient who met the inclusion criteria and signed the written informed consent then , the participants were divided into intervention ( n=32 ) and control ( n=32 ) groups through block randomization ( figure 1 ) . flow diagram of the participants this study was approved by the ethics committee of shiraz university of medical sciences ( ethic code : ct-9374 - 7114 ) . at the first step , they were also reassured about the voluntary nature of the study and confidentiality of their information . then , written informed consents for taking part in the study were obtained from all the participants . a demographic data sheet was used to gather the participants demographic information , including age , sex , occupation , marital status , education level , and type of disease . in addition , who stomatitis intensity survey checklist was used to assess the intensity of stomatitis and visual analog scale ( vas ) was used to evaluate the intensity of pain in the patients . who stomatitis intensity survey checklist is a 5-point scale in which zero is considered as no stomatitis , 1 represents pain and erythema without wounds , 2 refers to the case where wound and erythema exist but the patient is able to eat solid food , 3 is existence of extensive wound and erythema and inability to eat solid food , and 4 is the most severe condition with mucosal bleeding , extensive inflammation , and complete inability to eat and drink . this checklist was provided by who and its reliability and validity were confirmed in several investigations . in iran , brahimi et al . performed an investigation entitled the effect of honey on stomatitis recovery of patients undergoing chemotherapy in hospitals affiliated to shaheed beheshti medical university and determined the validity of this scale using content validity method . besides , they confirmed the reliability of the scale by r=0.81 . this instrument is a 10 cm ruler in which zero shows no pain and 10 represents intolerable pain . vas is a quick , simple , stable , and valid tool that has been used in many investigations and medical clinics . the validity and reliability of this instrument have also been confirmed in many previous studies . in the intervention group , this solution was prepared by barij essance co. , kashan , iran and delivered to the researcher . the patients were asked to wash their mouths with 5 ml of the solution for 2 minutes 3 times a day and avoid eating and drinking for 30 minutes after that for 2 weeks . in the control group , on the other hand , routine mouthwashes , including normal saline , cholorhexidine , and nystatine , were used according to the physician s prescription . the control group patients were also asked to use the routine mouthwashes 3 times a day and avoid eating and drinking for the next 30 minutes for 2 weeks . the patients mouths were examined for stomatitis by two assistants on days 1 , 3 , 5 , 7 , and 14 . the intensity of stomatitis in both groups was evaluated using who stomatitis intensity survey checklist . also , the patients were asked to report their pain intensity between 0 and 10 in these 5 visits . all data analyses were performed using spss statistical software , version 18 and p<0.05 was considered as statistically significant . at first , kappa coefficient between the two assistants in the 5 visits was measured by kappa test , revealing agreement between the two assistants ( p=0.001 ) . in addition , mann - whitney non - parametric test , independent t - test , and friedman test were used to compare the two groups regarding the intensity of pain and stomatitis . the study participants demographic information is presented in table 1 . accordingly , no significant difference was found between the two groups regarding the mean age . also , the results of chi - square test indicated no significant difference between the intervention and control groups in terms of sex , marital status , education level , and type of disease ( p>0.05 ) . however , the results of fisher s exact test revealed a significant difference between the two groups concerning occupation ( p=0.01 ) . yet , due to randomization , this could not affect the main variables . comparison of the control and intervention groups regarding the demographic variables note : significant at =0.05 based on table 2 , no significant difference was found between the two groups with respect to the mean intensity of stomatitis and pain on day 1 . however , a significant difference was observed in this regard on days 3 to 14 . comparison of the two groups regarding the mean intensity of pain and stomatitis on days 1 , 3 , 5 , 7 , and 14 note : significant at =0.05 the results of friedman test are presented in table 3 . in this test , the effect of passage of time on the intensity of stomatitis was assessed regardless of the study groups . comparison of the mean intensity of pain and stomatitis during the study according to the results of friedman test note : significant at =0.05 according to table 4 , a significant difference was found between the two groups regarding the intensity of stomatitis between days 3 and 14 ( p<0.05 ) . the results also showed a significant difference between the two groups concerning pain intensity between days 3 and 14 ( p=0.013 ) . comparison of the two groups regarding the mean intensity of stomatitis and pain on days 3 and 14 note : significant at =0.05 stomatitis or oral mucositis is a side effect of chemotherapy and requires medical and nursing interventions . unfortunately , oral care standards have been used incorrectly in these patients and may not even exist in many organizations . on the other hand , therefore , in the present study , the intervention method was designed based on stomatitis development process and standard tools were used to survey the intensity of stomatitis and its pain . the findings of this study showed higher levels of stomatitis and pain in the control group compared to the intervention group . this implies that safe and simple methods can be used to decrease the intensity of stomatitis and its pain during chemotherapy . one of the most important spiritual responsibilities that has always been suggested in moral medicine is avoiding causing harm and pain to individuals . the present study findings also showed that aloe vera was significantly effective in reducing the intensity of stomatitis and its pain in the intervention group compared to the control group . according to the results , no significant difference was found between the intervention and control groups at the first visit ( p>0.05 ) , but a significant difference was observed between the two groups in the next visits ( p=0.001 ) . these results were in line with those of many studies performed on aloe vera as a wound healer and oral mucosal protector . however , no investigations have been performed on the effect of aloe vera on chemotherapy - induced stomatitis . in a double - blind clinical trial on 40 patients with recurrent oral aphthous - induced stomatitis , aloe vera gel was used in one group , while lubricant gel containing 2% normal saline was used in the other group . the patients mouths were examined on days 0 , 3 , 7 , and 10 and the lesions width and pain were recorded . the results indicated that aloe vera significantly reduced the intensity , width , and pain of stomatitis . another trial compared the effects of aloe vera and triamcinolone acetonide 1% mouthwashes on oral lichen planus disease in 46 patients . the patients were examined on days 8 and 16 and after completing the course of treatment . the results of that study demonstrated that aloe vera was as effective as triamcinolone in treatment of oral lichen planus disease , which is compatible with the findings of the current study . one other research evaluated the effect of aloe vera gel on cesarean section wound healing . in that study , 90 women undergoing cesarean section were divided into two groups receiving either aloe vera gel or routine treatment for dressing their wounds . wound healing was assessed 24 hours and 8 days after the cesarean operation and the results revealed the positive effect of aloe vera gel on healing the wounds , which is in agreement with the results of our investigation . one other research was performed on 58 patients with head and neck cancer undergoing radiotherapy to compare the effects of aloe vera solution and placebo on radiotherapy - induced mucositis . the findings revealed that the intensity of mucositis was lower in the aloe vera group , but the difference was not statistically significant . according to the researchers , the main limitations of that study were its small sample size , patients heterogeneity , and large distribution of the primary sites . in the present study , the researchers tried to eliminate those limitations and the results indicated a significant difference between the intervention and control groups concerning the intensity of stomatitis and its pain . another study assessed the effect of chamomile on stomatitis intensity in 42 cancer patients undergoing chemotherapy . in that research , the control group patients were asked to wash their mouths with water 4 times a day for 16 days , while the intervention group had to do so using chamomile solution . the results showed no significant difference between the control and chamomile groups in the first period . however , chamomile was significantly effective in healing and preventing stomatitis between the second and the fourth period . considering the above mentioned points , the study hypothesis was confirmed . thus , it can be concluded that aloe vera could be effective in reducing stomatitis intensity and pain . this study showed that aloe vera solution was effective in decreasing stomatitis intensity and pain . hence , besides other methods , aloe vera mouthwash can be useful in preventing and treating stomatitis in patients with chemotherapy - induced stomatitis without any side effects . thus , it is recommended to be used in order to achieve appropriate oral hygiene in patients undergoing oral toxic treatments and chemotherapy .	background : stomatitis is the most common complication of chemotherapy . this study aimed to assess the effect of aloe vera solution on stomatitis and its pain intensity in patients undergoing chemotherapeutic procedures.methods:in this randomized controlled clinical trial , 64 patients with acute myeloid leukemia and acute lymphocytic leukemia undergoing chemotherapy were randomly divided into a control and an intervention group . the intervention group patients were asked to wash their mouths with 5 ml of aloe vera solution for two minutes three times a day for 14 days . the control group patients , however , used only the ordinary mouthwashes recommended in hematologic centers . the patients mouths were examined by two assistants on days 1 , 3 , 5 , 7 , and 14 . the intensity of stomatitis was recorded according to who stomatitis intensity checklists and pain was evaluated using visual analog scale . the data were analyzed by spss statistical software , version 18.results:the results showed that aloe vera solution mouthwash significantly reduced the intensity of stomatitis and its pain in the intervention group compared to the control group . on the first day , no significant difference was found between the two groups regarding the mean intensity of stomatitis ( p=0.178 ) and pain ( p=0.154 ) . however , a significant difference was observed between the two groups in this regard on other days ( days 3 - 14 : p=0.001 for stomatitis intensity , p=0.001 for pain).conclusions : aloe vera solution can improve the patients nutritional status , reduce stomatitis and its pain intensity , and increase the patients satisfaction.trial registration number irct2014092819318n1
You are an expert at summarizing long articles. Proceed to summarize the following text: a 34-year - old female ( g2p2a0l2 ) visited our hospital with an eight - month history of a palpable abdominal mass . normal beta - human chorionic gonadotropin with increased alpha - fetoprotein ( 22.7 ng / ml ) , cancer antigen ( ca ) 125 ( 61.7 u / ml ) , and ca19 - 9 ( 553.7 u / ml ) were observed . contrast - enhanced computed tomography showed a large solid and cystic mass in the left lower abdomen and pelvis . a huge left ovarian tumor filling the peritoneal cavity was found during laparotomy , and yellow - colored ascites ( 200 ml ) was expelled . the external surface of the tumor was pinkish - tan , transparent , smooth , and intact . multiple firm , gray - white nodules measuring 0.1 to 0.3 cm were observed on the omentum , uterine serosa and posterior cul - de - sac peritoneum . left salpingo - oophorectomy , right wedge resection , partial omentectomy , and biopsy of the uterine serosal nodules were performed . under the impression of ovarian malignant tumor , for staging , pelvic lymph node sampling , partial omentectomy and posterior cul - de - sac peritoneal resection were performed . grossly , the excised left ovarian mass measured 21.0 cm in diameter and weighed 2,350 g. a predominantly solid mass with multicystic changes , which were filled with clear watery fluid , was observed on the cut surface ( fig . thirty sections were taken from the ovarian tumor , and various mature tissues of tridermal lineage were demonstrated ( fig . 1b ) ; the mass was comprised predominantly of mature glial tissue ( 90% ) with focal immature neuroepithelial cells forming rosette - like structures with few mitosis ( fig . these immature neuroectodermal foci , including primitive mesenchyma , led to the diagnosis of an immature teratoma , grade 1 , according to the classification of robboy and scully.3 there were no other germ cell tumor components , including a yolk sac tumor . the peritoneum , cul - de - sac and uterine serosa , as well as the opposite ovarian surface , showed involvement of glial peritonei ( grade 0 ) . nodules of the right ovary , peritoneum and omentum were composed of glial tissue ( grade 0 ) ( fig . 1d ) . out of 32 dissected lymph nodes , one left hypogastric lymph node showed one mature glial implant , i.e. , nodal gliomatosis ( grade 0 ) ( fig . 1d , inset ) . some scattered psammoma bodies were observed in peritoneal and nodal gliomatosis , as well as brain tissue in the ovarian immature teratoma . immunohistochemically , glial fibrillary acidic protein ( prediluted , polyclonal , dako , glostrup , denmark ) ( fig . the endometrial stroma of endometriosis was stained with cd10 ( 56c6 , prediluted , dako ) ( fig . three cycles of chemotherapy of bleomycin , etoposide and cisplatin ( bep ) were performed . after the surgery , alpha - fetoprotein , ca125 , and ca19 - 9 levels reached the normal range . during the nine - month post - operative follow - up period , gp is a rarely encountered complication of ovarian teratomas and is characterized by peritoneal implants of glial tissue usually of a low world health organization grade , although cases of malignant evolution or high grades have also been described.16 about 100 cases have been retrieved in the literature . to our best knowledge , nine cases of nodal gliomatosis ( including the present case ) were demonstrated in the pelvic or paraaortic lymph nodes;1 - 8 eight cases were associated with both gp and ovarian teratomatous tumors , while the remaining case was without gp.6 another interesting phenomenon is the rare combination of gp and endometriosis , as was seen in the present case . to date , seven cases of endometriosis combined with gp have been published in the world literature.9 - 15 a summary of peritoneal gliomatosis coexisting with nodal gliomatosis or endometriosis is shown in tables 1 and 2 . lymphangeneous glial implants or direct spillage of the glial foci of an ovarian teratoma have been suggested by the previous articles.2 - 7 another viewpoint proposed that gp is a metastasis of glial tissue to a focus of pre - existing endometriosis because these endometrial foci are more vascular and therefore are more receptive . however , this concept contradicts the fact that endometriosis is rare in the pediatric population , and it is unlikely because despite extensive sampling , there were only mixed endometrial and glial cells but no pure endometriosis . originally , the presence of gp indicated that these lesions were shared by implantation metastases of an ovarian teratomatous tumor with varying maturation.7,10 - 12 metaplasia of pluripotent coelomic or mullerian stem cells has also been suggested , but the most scientifically supported and widely accepted mechanism of endometriosis is retrograde effluent flow through the lumen of the fallopian tubes into the pelvic - peritoneal cavities during menstruation.9 metaplasia may be induced by unknown stimuli in other uncommon peritoneal lesions , such as melanosis peritonei , etc.17 dworak et al.11 suggested that gp temporally predisposes a patient to the development of endometriosis . a recent assay for loss of heterozygosity revealed that normal tissues and gp showed a heterozygous pattern in the microsatellite loci , whereas the associated ovarian teratomas had a homozygous pattern.18 these findings suggest that gp with or without nodal involvement is genetically unrelated to the associated teratoma but may be stimulated by these teratomas . other rare locations such as intrathoracic gliomatosis , isolated gp independent to ovarian teratoma or one occurring after ventriculoperitoneal shunt operations also support this theory . the peritoneal mesothelium that modulates the cytoskeleton and shape is explained as subserosal multipotential subserosal cells that can replicate and differentiate diversely under unspecified stimuli.19 mesothelial hyperplasia is commonly found when it is stimulated by pleural and peritoneal effusion.19 this mesothelial hyperplasia may be rarely seen in lymph nodes , and in these cases it would be mimicking metastatic tumors.18 gliomatosis affecting the lymph node can be explained by this unusual location of mesothelial hyperplasia , although the present case showed no peritoneal mesothelial hyperplasia . a frequent association between gp and effusion was found ; about 35 cases of gp were accompanied by ascites , and 3 cases involved pleural effusion.1,4,6,8 the frequent association with ascites or pleural effusion and co - existing nodal or gp , as shown in table 1 , may provide supporting evidence of this unusual location of gliomatosis.1,19 however , although the common association of gp with ovarian teratoma is indisputable , the reason why subperitoneal cells develop into glial islands in the presence of these ovarian tumors remains to be investigated . another explanation of the occasionally present ascites or pleural effusion is that the pressure on the lymphatics in the tumor of the peritoneum as well as the ovary causes the fluid to escape through the superficial lymphatic vessels of the tumor or induces increased vascular permeability.19 clinically , intraoperatively encountered widespread , grayish tan - colored , firm , tiny nodules can be mistaken as peritoneal carcinomatosis or disseminated tuberculosis , especially in cases showing calcification or psammoma bodies like the present patient.10,11 despite the rarity of ovarian immature teratomas with gp data and limitations , the prognosis of gp has long been regarded as good compared to that of immature teratoma without gp.14 however , the application of cisplatin - based chemotherapy regimens has dramatically improved the prognosis of immature teratomas of high grades and stages.16 recent studies suggested that the poor prognosis in immature teratoma is correlated with incomplete resection , tumor rupture , younger age , higher stage and grade , and gp , but not with cyst spillage , enucleation , nodal gliomatosis , or microfoci of yolk sac tumor , i.e. , heifetz lesions.16 to the best of our knowledge , peritoneal and nodal gliomatosis as well as combined endometriosis are rare phenomena that have not yet been described in the english literature .	gliomatosis peritonei ( gp ) indicates the peritoneal implantation of mature neuroglial tissue and is usually accompanied by ovarian mature or immature teratoma . here , we report a case of ovarian immature teratoma associated with gliomatosis involving the peritoneum , lymph nodes and douglas ' pouch , where gliomatosis coexisted with endometriosis . as far as we know , only seven cases of gp have been reported as coexisting with endometriosis . eight cases with mature glial tissue in the lymph nodes , i.e. , nodal gliomatosis , have been published either in association with gp or in its absence . metaplasia of pluripotent coelomic stem cells has been suggested to be responsible for the pathogenesis of endometriosis and gp rather than implantation metastases of ovarian teratomatous tumor with varying maturation . this theory is also applied to gp independently of ovarian teratomatous tumors . to the best of our knowledge , nodal gliomatosis coexisting with gp and also involving endometriosis has not yet been reported .
You are an expert at summarizing long articles. Proceed to summarize the following text: abdominal aortic aneurysms ( aaa ) can be repaired with an aortic bifemoral bypass graft , which is considered an ideal procedure for aortic aneurysms , aorto - iliac disease or aortic atherosclerosis . though rare , infections involving the graft can happen , typically , two to five years following implantation . anaerobic , non - sporulating , gram - positive bacilli from the normal human gut flora can occasionally be implicated in invasive diseases . notably , eggerthella lenta , formerly known as eubacterium lentum , often causes clinically significant bacteremia with a significant mortality rate . herein we report a case of an aortobifemoral bypass graft with an aortoenteric fistula , giving rise to a very rare bacteremia caused by the species eggerthella lenta . a 75-year - old male with a past medical history significant for type 2diabetes mellitus , hypertension , chronic thrombocytopenia and chronic kidney injury underwent resection of a ruptured aaa and placement of an aortobifemoral bypass graft . his postoperative course was eventful for renal failure , which required four cycles of dialysis with improvement . twenty - nine months later , the patient was seen in the emergency department with a two - day history of rigors , dysuria , polyuria and burning micturition complicated by fever , weakness and lethargy observed by his family on the day of admission . blood pressure upon examination was 70/35 mmhg , rising to 90/48 mmhg after a fluid bolus ; temperature was 101 degrees fahrenheit ; heart rate 90/min ; and respiratory rate was 20/min . blood work was significant for a white blood cell count of 18,000 ; lactic acid of 4.1 , 20 percent bands and platelet count of 20,000.urinalysis was remarkable for white blood cells , red blood cells and moderate leukocyte esterase . physical examination revealed diffuse abdominal tenderness , and peri - umbilical tenderness with deep palpation without peritoneal signs.the patient was admitted to the intensive care unit with a diagnosis of severe sepsis secondary to urinary tract infection with high anion gap metabolic acidosis secondary to lactic acidosis . blood cultures and urine cultures were drawn , which demonstrated eggerthella lenta septicemia and escherichia coli extended spectrum beta - lactamase ( esbl)-positive urinary tract infection . a subsequent abdominal computed tomography ( ct ) with contrast demonstrated induration with inflammatory changes around the aortobifemoral bypass graft . furthermore , the graft showed stranding around the aorta near the iliac components with presence of an air bubble between these components [ figure 1 ] . this finding raised the possibility of gas producing infection or an aortoenteric fistula communicating with an adjacent loop of bowel , either of which could have feasibly contributed to the aortic graft harboring eggerthella lenta . the patient was recommended to have graft replacement surgery with repair of the fistula in order to remove the source of infection ; however , he refused , preferring to be treated with iv antibiotics instead , despite the considerable risk . repeated blood cultures after treatment with antibiotics were negative and the patient was discharged home on antibiotics as an outpatient with the possibility of requiring chronic suppression with antibiotics . ct scan of the abdomen and pelvis showing an induration with inflammatory changes around the aorto - iliac graft and an small air bubble ( yellow arrow ) between the two legs of the graft , possibly caused by a fistulous communication with the bowel aortoenteric fistulas can involve any part of the small or large bowel , but it is more common to find them in the third and fourth portions of the duodenum . mucosal bleeding can be one of the signs as erosions of the graft into the intestines can precede massive gastrointestinal bleeding from an established aortoenteric fistula . staphylococcus aureus and gram - negative bacilli , accompanied by fever , signs of infection and leukocytosis , typically cause early infections ( less than four months after repair ) . the presentation of late - onset infections can be subtle without any specific signs or symptoms with an absence of fever being common . in fact , in few studies , the absence of fever and stay in the intensive care unit ( icu ) , was associated with an increased risk of mortality . they can also present with complications of the graft infection , such as a pseudoaneursym , sepsis or bleeding . our patient did have fever , leukocytosis and hypotension , but thiscould have been caused by his concurrent urinary tract infection with e. coli . it is possible that had this patient not had symptoms from his urinary tract infection , his bacteremia may have been missed . the use of graft devices for repair of an aaamay require a complex , open - air procedure with exposure of the compromised vessel . this , of course , increases the risk of an infectionfrom the device as well as the wound . the incidence of aaa graft infection is low ( 0.4% to 3% ) , with one - third of those infections manifesting as aortoenteric erosions / fistula . the management of an aortoenteric fistula has typically required replacement of the affected graft and repair of the fistulae , a surgery with a mortality risk of 20 to 30 percent . bacteremia associated with the aortoenteric fistula has also been reported to have a high mortality risk . in our case , the ct scan of the patient raised the possibility of an aortoenteric fistula that was likely to be the source of the patient 's infection with eggerthella lenta . after being explained the risk of the surgery , as well as the possibility of not being able to resolve the infection without surgery , the patient declined to move forward with the procedure . although lactobacillus , clostridium and propionibacterium species are more commonly encountered , many other lesser known anaerobic gram - positive bacilli can be involved in clinical infections as well . members of this genus are anaerobic , non - sporulating , non - motile , gram - positive bacilli that grow singly , as pairs or in short chains . classification and identification of this bacterium is reliably achieved through specialized cultured blood samples identifying the gram - positive bacilli as eggerthella lenta with 94% and 99% probability and confirmed by 16srna pcr gene sequencing . eggerthella lenta can be found in many different parts of the body , most commonly in the colon and feces . bacteremia associated with this bacterium carries a high mortality rate ( 20 - 40% ) especially if it is found to be the only pathogen in the blood . eggerthella lenta has been linked with many conditions such as ulcerative colitis , crohn 's disease , sinusitis , abscesses , pelvic inflammatory disease , malignancy and pancreatic abscesses among others . nearly all infections with anaerobic bacteria originate from the patient 's own microflora ; therefore , we can conclude that this patient 's bacteremia was from his own flora , with the likely source to be the aortoenteric fistula . due to the fastidious nature of these organisms , it can be exceedingly difficult to isolate these anaerobes from the site of an infection and easy to miss . isolating them requires the appropriate method of collection , transportation and cultivation of specimens , which requires a laboratory capable of performing 16s rrna gene analysis . , it took three days in order to get a positive blood culture and another three days to identify the organism and get antibiotic susceptibility . treatment with etrapenem proved to be successful as repeat cultures were negative . though bacteremia caused by eggerthella lenta is rare , if it is present , it is almost always clinically significant and requires prompt diagnosis and treatment . we believe that patients , who have had repair of an aaa and present with abdominal pain with or without fever , should have their blood appropriately cultured for anaerobic bacteria . it should be noted that patients who undergo this procedure are recommended to have yearly ct scans performedto rule out infections or fistulas that can lead to dangerous bacteremia .	the presence of an aortoenteric fistula following aortobifemoral graft repair of an abdominal aortic aneurysm is associated with a high probability of infection leading to clinically significant bacteremia . we report a case of an aortoenteric fistula that developed two years after initial aortic grafting resulting in colonization with the anaerobe , eggerthella lenta . this dangerous bacterium is difficult to culture , associated with high mortality and the patient may have mild symptoms on presentation .
You are an expert at summarizing long articles. Proceed to summarize the following text: the name is thought to come from the similarity between fruiting heads of this particular fungus and the brush or aspergillum , used for sprinkling of holy water . the spores of the aspergillus fungus are ubiquitous , usually introduced by inhalation and are frequent inhabitants of the human upper respiratory tract . aspergillus fumigatus is the species most frequently isolated from patients with invasive or disseminated infections . the hyphal forms show regular , progressive , dichotomous branching at acute angles from parent hyphae . the anamorphic ( asexual ) form produces conidial ( fruiting ) heads in situations of high oxygen tension such as pulmonary cavities , skin , bronchial mucosa etc . the finding of anamorph of aspergillus in histopathology sections is however rare with only very few case reports in the literature . a 62-year - old female patient who was an agriculturist presented to us in a critically ill - condition and had complaints of cough and hemoptysis since 3 months and also had respiratory distress at presentation . a chest x - ray was performed , which showed a left sided hilar mass . a computed tomography scan of the thorax revealed a moderately enhancing soft - tissue density lesion measuring 6 cm 4.9 cm 4 cm . in the left hilar region extending to apicoposterior segment of left upper lobe . a bronchoscopy was performed , which revealed a mass lesion in the left main bronchus . with a clinical and radiological diagnosis of lung carcinoma , a biopsy was carried out . the specimen obtained for histopathological examination consisted of greywhite , friable soft - tissue aggregate measuring 0.5 cm 0.5 cm . examination of hand e stained sections revealed mainly necrotic tissue and clusters of tumor cells with crush artefact [ figure 1 ] . amidst the necrotic material were seen branching septate hyphae of aspergillus . apart from hyphal forms , many fruiting bodies of aspergillus were also seen [ figure 2a ] . a methenamine silver stain was carried out , which highlighted the fungi [ figure 2b ] . on immunohistochemistry , the tumor cells were positive for cytokeratin and synaptophysin . a diagnosis of small cell carcinoma of lung with co - existent aspergillosis was made . our patient was then lost to follow - up and hence culture and species identification could not be carried out . hyphal form as well as fruiting bodies of aspergillus species along with cluster of tumor cells ( h and e , 100 ) higher power view of hyphae and fruiting bodies of aspergillus ( h and e , 400 ) methenamine silver stain highlights the fungi ( h and e , 400 ) though classically hyphae of aspergillus are described as acute branching septate hyphae , sometimes it becomes difficult to differentiate them from hyphal forms of other fungi such as pseudallescheriaboydii , the fusarium spp . and occasionally with the candida spp . thus , a microbiological isolation by culture is often required for confirmation , which considering the ubiquitous nature of aspergillus is difficult to get . however when fruiting bodies of aspergillus is seen diagnosis can be considered and even species sub typing can be attempted at the histopathology level . fruiting bodies ( conidia ) of aspergilli develop from mycelia in areas of high oxygen tension , or severe infections . the fruiting body is composed of a vesicle and either 1 or 2 layers of phialides that produce conidia , and the morphology of the fruiting body may allow aspergillus species to be subtyped insitu . the presence of a single row of phialides over the upper one - third of the vescicle is seen in a. fumigatus while a. flavus and a. niger have two rows of phialides covering the entire vescicle . other species of aspergillus may also show bi or mono - seriate heads ; hence , species sub typing based on the number of row of phialides may not be accurate . secretion of a toxic substance by fungi that penetrates into tissues under appropriate conditions and secondly the induction of tissue necrosis caused by an immune mechanism . most recent clinical classification of aspergillosis has been put forth by rowe - jones and moore - gillon in 1994 . these include non - invasive , invasive and destructive non - invasive types of aspergillosis . destructive non - invasive type has been further classified into aspergilloma , fungus ball and mycetoma . it is difficult to isolate aspergillus in culture because of the ubiquitous nature of its spores . no skin sensitivity or serum reactivity tests are useful because most of the affected patients are immunodeficient . early diagnosis of invasive aspergillosis may be possible in high - risk patients by using galactomannan ( gm ) test . serial screening of circulating gm , an epitopic determinant of several antigens secreted by the aspergillus early in its growth , has been shown to be sensitive and specific in the diagnosis of invasive aspergillosis . this test helps to spare febrile patients without evidence of fungal infection other than prolonged fever from unnecessary and potentially toxic therapy . the diagnosis of aspergillosis in humans is made after taking into consideration the clinical , radiological and microscopic findings . our patient had two predisposing factors one of which was the underlying malignancy , which caused an immune compromised state and secondly her profession as an agriculturist , which offered a damp environment favorable for fungal growth . early recognition of aspergillosis is mandatory since it is a potentially life - threatening infection requiring an immediate intervention and treatment with toxic drugs . there is a case report of detection of aspergillus including the fruiting bodies in routine cervical pap smear in a non - symptomatic lady . this case on further investigation and follow - up was found to be due to contamination . this report once again underlines the need for clinical correlation and ruling out contamination before labeling a case as aspergillus infection . pulmonary aspergillosis is a saprophytic infection caused by colonization of pre - existing cavitary lesions . the cavitary lesions may result from treated tuberculosis , bronchiectasis , sarcoidosis , cysticfibrosis , emphysematous bullae and other necrotizing infections . there are case reports in the literature of aspergillosis co - existing with lung cancer . the co - existence of these two pathologies is thought to be due to colonization of aspergillus in bullous airspaces that were obstructed or contained within the tumor . our case is that of small cell carcinoma of lung with co - existent aspergillosis . unlike other cases were the hyphal forms of the fungus were noted , in our case many fruiting bodies were noted in the histopathologic sections which is a rare finding .	a-62-year - old lady presented with complaints of cough , dyspnea and hemoptysis of 3 months duration . a radiological evaluation revealed a mass lesion in the left lung along with significant lymphadenopathy . with a clinical and radiological diagnosis of carcinoma of the lung , the patient was taken up for biopsy . the specimen consisted mainly of grey - white friable soft - tissue , which on histopathological evaluation showed small cell carcinoma , which was confirmed with immunohistochemistry . apart from the carcinomatous component , many hyphae and fruiting bodies of aspergillus were also seen . we are reporting this case because , though the finding of hyphal forms of aspergillus is not so uncommon in lung biopsies , detection of fruiting bodies of aspergillus in histopathological section is an extremely rare finding . the hyphal forms of aspergillus can be confused with the hyphal forms of other fungi , but when fruiting bodies are present a definite diagnosis is possible at the histopathology level itself . we would also like to highlight that contamination should be excluded before labeling a case as aspergillosis because of the potentially toxic medication implicated in the treatment .
You are an expert at summarizing long articles. Proceed to summarize the following text: despite advances in insulin therapy , hypoglycaemia remains a significant concern and limits optimization of insulin dosing to achieve glycaemic targets.1 hypoglycaemia is associated with increased morbidity and cardiovascular risk.1 patients / caregivers may be fearful of nocturnal hypoglycaemia , which may affect sleep and wellbeing.2 basal insulin peglispro ( bil ) is pegylated insulin lispro and has a flat pharmacokinetic profile with a 23 day halflife.3 bil has an hepatopreferential action versus glargine as a result of a reduced peripheral action rather than an enhanced effect on the liver 4 . the primary objective of the bil phase iii studies was to demonstrate the noninferiority of glycated haemoglobin ( hba1c ) for bil versus glargine . the three doubleblind studies were also powered for the key secondary objective of superiority of bil versus glargine for reduction in nocturnal hypoglycaemia rate . in five phase iii imagine trials , bil treatment met the primary objective of noninferiority to glargine for hba1c.5 , 6 , 7 , 8 , 9 the five imagine trials also resulted in 0.20.5% greater hba1c reduction versus glargine over 26 , 52 and 78 weeks in patients with type 1 diabetes ( t1d ) and those with type 2 diabetes ( t2d ) , meeting the key secondary objective of statistical superiority ( with multiplicity adjustment ) , with higher basal insulin doses.5 , 6 , 7 , 8 , 9 the present report summarizes prespecified pooled hypoglycaemia analyses from the imagine studies with a glargine comparator . table 1 provides an overview of the five phase iii imagine studies of bil versus glargine that were included in the prespecified pooled analyses of : patients with t2d receiving basal insulin only ; patients with t2d receiving basalbolus insulin ; and patients with t1d receiving basalbolus insulin . entry criteria , study design , dosing algorithms and results , including individual study glycaemic / hypoglycaemia data , have been previously reported.5 , 6 , 7 , 8 , 9 all were treattotarget trials with the same basalbolus insulindosing algorithms applied to both treatments and with a fasting / premeal selfmonitored blood glucose ( smbg ) target of 5.6 mmol / l . overview of imagine studies , patient clinical characteristics , glycated haemoglobin and insulin dose gl , insulin glargine ; ls , least squares ; oam , oral antihyperglycaemic medication ; s.d . , standard deviation ; s.e . 52 weeks for t2d basal only ; 26 weeks for t2d basalbolus ; 52 weeks for t1d . nocturnal hypoglycaemia was an event between bedtime and waking for t2d basalonly studies ( imagine 2 and 5 ) . for studies using electronic diaries ( imagine 1 , 3 and 4 ) with direct transfer of time / date stamped smbg values,10 nocturnal hypoglycaemia severe hypoglycaemia was investigatordetermined and defined as episodes accompanied by neurological impairment requiring medical assistance to administer carbohydrates , glucagon or other resuscitative actions . for the pooled analyses of patients with t2d on basal insulin only ( imagine 2 and 5 ) and patients with t1d ( imagine 1 and 3 ) , 52week data were included , as this was a consistent time point . blinded continuous glucose monitoring ( cgm ) was performed in patient subsets in the three doubleblind studies ( imagine 2 , 3 and 4 ) to assess duration ( min ) with glucose values 3.9 mmol / l from 00:00 to 06:00 hours and over 24 hours and duration of individual hypoglycaemic episodes . the medtronic cgms ipro continuous glucose recorder ( imagine 3 ) or the ipro2 professional cgm ( imagine 2 and 4 ) were used over 3 or 6 days , respectively . cgm data were centrally collected ( phase v technologies , wellesley , massachusetts ) at baseline / prespecified time points during treatment . the 52week data are presented for imagine 2 and 3 and 26week data for imagine 4 ( table s1 , appendix s1 ) . analyses ( sas 9.1 , cary , north carolina ) were conducted on the modified intentiontotreat population of all randomized patients who received 1 study insulin dose . all tests were conducted at a twosided value = 0.05 and 95% confidence intervals ( cis ) were calculated . total / nocturnal hypoglycaemia frequencies were analysed using negative binomial regression and a modelbased rate for each treatment was estimated.11 the rate of severe hypoglycaemia was analysed using an empirical method ; hypoglycaemia incidence was assessed using a logistic regression model or cochran mantel haenszel test ( if < 10 patients with events ) . a total of 4927 patients randomized to bedtime bil ( n = 2949 ) or glargine ( n = 1978 ) were included . 4972% of patients with t2d and 6471% of patients with t1d were previously treated with glargine . the pooled analyses were consistent with the individual study results , with a 0.210.33% greater reduction in hba1c with bil versus glargine ( table 1 ) . basal insulin doses were 1024% higher with bil versus glargine across phase iii studies ( table 1).5 , 6 , 7 , 8 , 9 bolus insulin doses were 27% lower with bil versus glargine in t1d ( table 1 ) , but not statistically significantly different in patients with t2d receiving basalbolus insulin ( table 1).6 nocturnal hypoglycaemia rates were reduced by 36% in patients with t2d on basal insulin only , 45% in patients with t2d on basalbolus insulin , and 43% in patients with t1d with bil versus glargine ( figure 1a ) . nocturnal hypoglycaemia incidence was statistically significantly lower with bil versus glargine in all patient populations ( figure 1b ) . the nocturnal hypoglycaemia rate and incidence sensitivity analyses were consistent with the primary results including : prespecified analyses of the alternative nocturnal hypoglycaemia definition for basal only and basalbolus ediary studies and post hoc analyses including events between 00:01 and 05:59 hours ( figure s1 , appendix s1 ) . nocturnal , total , daytime and severe hypoglycaemia . a , nocturnal hypoglycaemia rate per patientyear standard error ( s.e . ) . values are aggregated rate , calculated using the total number of severe hypoglycaemia episodes divided by the cumulative days on treatment from all patients within that treatment , then times 36 525 days ( for rate per 100 years ) . weeks of study data included : t2d basal only ( 052 weeks ) , t2d basalbolus ( 026 weeks ) , t1d ( 052 weeks ) . b , basal only ; bb , basalbolus ; gl , insulin glargine ; rr , relative rate . * the total hypoglycaemia rate was not significantly different in patients with t2d on basal insulin only , there was a 10% higher trend in patients with t2d on basalbolus insulin ( p = .053 ) , and the rate was 15% higher in patients with t1d ( p < .001 ) with bil versus glargine ( figure 1c ) . the total hypoglycaemia incidence was not different between treatments in any population ( figure 1d ) . in patients with t1d or t2d on basalbolus insulin , daytime hypoglycaemia was significantly higher with bil versus glargine ( figure 1e ) from 0 to 52 and 0 to 26 weeks , respectively . in t1d patients , during the maintenance period of 2652 weeks , the total hypoglycaemia relative rate ( bil / glargine ) was 1.07 ( 95% ci 1.00 , 1.14 ; p = .062 ; figure s2 , appendix s1 ) . there were no significant differences in the rate or incidence of severe hypoglycaemia between treatments in all three patient populations ( figure 1f and g ) . in the three doubleblind studies , cgm was performed in patient subsets ( bil , n = 313 , glargine , n = 215 ) . in patients with t1d or t2d , there were no significant treatment differences in duration with glucose level 3.9 mmol / l ( 00:0006:00 hours or over 24 hours ) or in the average duration of individual hypoglycaemic episodes with bil versus glargine ( table s1 , appendix s1 ) . the present analyses provide a summary of prespecified and pooled hypoglycaemia analyses from the five imagine studies with glargine comparator . bil treatment resulted in a 3645% reduction in nocturnal hypoglycaemia rate versus glargine , despite greater reduction in hba1c and higher basal insulin dosing . there was a 15% increase in total hypoglycaemia in t1d with an associated increase in daytime hypoglycaemia with basalbolus therapy in t1d and t2d . cgm in patient subsets showed no evidence of prolongation or shortening of hypoglycaemic episodes with bil versus glargine . nocturnal hypoglycaemia was also reduced with morning dosing of bil versus glargine in t1d and t2d phase ii studies12 , 13 and nocturnal / total hypoglycaemia were similar with bedtime versus 840hours variabletime dosing of bil in a t1d phase iii study.14 the significant reduction in nocturnal hypoglycaemia was achieved simultaneously with greater improvements in hba1c with bil versus glargine . in contrast , significant reductions in nocturnal hypoglycaemia rates were reported in clinical studies of insulin degludec15 and glargine u30016 versus glargine u100 , but with noninferiority of hba1c . this may reflect the hepatopreferential action of bil as well as longer duration of action , lower peaktotrough ratio , and reduced glucose variability versus glargine u100 seen across the bil phase iii trials.5 , 6 , 7 , 8 , 9 a study in the conscious dog has shown that peripheral insulin delivery increased hypoglycaemia risk versus portal vein insulin delivery , suggesting that hepatopreferential insulin analogues may be associated with a lower risk of hypoglycaemia.17 glucose variability has also been independently associated with the risk of hypoglycaemia.18 , 19 increased daytime hypoglycaemia with bil versus glargine in basalbolus therapy may also reflect the hepatopreferential action and longer duration of action of bil . in t1d , the adjustment of basalbolus dosing occurred gradually during the titration period and resulted in significantly reduced bolus insulin requirements with bil compared with glargine . during the maintenance period of 2652 weeks and after basalbolus dose adjustment and stabilization , total hypoglycaemia decreased in t1d and was not significantly different between groups ( figure s2 , appendix s1 ) . the strengths of the present pooled analyses of five bil phase iii studies include the doubleblind design of three trials , which were also powered to detect differences in nocturnal hypoglycaemia , the large sample size of > 4900 patients , as well as the global nature of the studies . the use of an ediary in three basalbolus studies10 allowed wireless , direct capture of smbg values and hypoglycaemic events . limitations include the ability to translate the findings outside of a clinical trial setting and exclusion of patients with t1d with > 1 and patients with t2d with 1 severe hypoglycaemic episode within 6 months of screening . in addition , it is unknown from these studies if other basalbolus insulindosing algorithms , including algorithms different from those used with conventional basal insulins , could more rapidly optimize bolus insulin dosing with bil . in conclusion , across five phase iii trials , bil treatment resulted in greater hba1c reduction with less nocturnal hypoglycaemia in all patient populations compared with glargine despite higher basal insulin doses . basalbolus treatment with bil versus glargine resulted in higher daytime hypoglycaemia in t1d and t2d , with an associated increase in total hypoglycaemia in patients with t1d . as assessed by continuous glucose monitoring ( cgm ) in three doubleblind imagine studies . figure s1 . sensitivity analyses for nocturnal hypoglycemia between 00:00 and 05:59 hours . a , nocturnal hypoglycemia rate per patient year se . weeks of study data included : t2d basal only ( 052 weeks ) , t2d basalbolus ( 026 weeks ) , t1d ( 052 weeks ) . abbreviations : b , basal only ; bb , basalbolus ; bil , basal insulin peglispro ; ci , confidence interval ; gl , insulin glargine ; pt , patient ; rr , relative rate ; se , standard error ; t1d , type 1 diabetes ; t2d , type 2 diabetes ; yr , year . * p < .05 for between treatment group comparisons . figure s2 . abbreviations : bil , basal insulin peglispro ; gl , insulin glargine ; se , standard error ; t1d , type 1 diabetes . * p < .05 for between treatment group comparisons . click here for additional data file . j. r. has served on scientific advisory boards and received honoraria or consulting fees from eli lilly , novo nordisk , sanofi , merck , daiichi sankyo , janssen , boehringer ingelheim , astrazeneca and intarcia . he has received grants / research support from merck , pfizer , sanofi , novo nordisk , bristolmyers squibb , eli lilly , glaxosmithkline , takeda , astrazeneca , hanmi , janssen , daiichi sankyo , asahi , mannkind , boehringer ingelheim , intarcia and lexicon . m. m. has served on advisory boards for abbott , intarcia , merck sharpe & dohme , novo nordisk , sanofi and servier , has received honoraria or speaking fees from abbott , eli lilly and company , merck sharpe & dohme , novo nordisk , sanofi and servier and has received research grants from merck sharpe & dohme , novartis , novo nordisk , sanofi and servier . e. j. b. was an employee of eli lilly and company during these clinical trials and is currently a consultant to viacyte , inc . , san diego , california . y. q. , s. z. and a. m. c. are employees and shareholders of eli lilly and company . j. r. and m. m. participated as trial investigators and in the discussion / interpretation of the research , and reviewed / edited the manuscript . e. j. b. and m. j. p. participated in study design , the conduct of the studies , the data analysis / interpretation of the research , and reviewed / edited the manuscript . y. q. and s. z. contributed to the study design , designed and conducted the statistical analyses , and participated in the interpretation of the research and reviewed / edited the manuscript . a. m. c. contributed to the study design , the conduct of the studies , the data analysis / interpretation of the research and in writing the manuscript .	basal insulin peglispro ( bil ) is a novel basal insulin with hepatopreferential action , resulting from reduced peripheral effects . this report summarizes hypoglycaemia data from five bil phase iii studies with insulin glargine as the comparator , including three doubleblind trials . prespecified pooled analyses ( n = 4927 ) included : patients with type 2 diabetes ( t2d ) receiving basal insulin only , those with t2d on basalbolus therapy , and those with type 1 diabetes ( t1d ) . bil treatment resulted in a 3645% lower nocturnal hypoglycaemia rate compared with glargine , despite greater reduction in glycated haemoglobin ( hba1c ) and higher basal insulin dosing . the total hypoglycaemia rate was similar in patients with t2d on basal treatment only , trended towards being higher ( 10% ) in patients with t2d on basalbolus treatment ( p = .053 ) , and was 15% higher ( p < .001 ) with bil versus glargine in patients with t1d , with more daytime hypoglycaemia in the t1d and t2d groups who were receiving basalbolus therapy . in t1d , during the maintenance treatment period ( 2652 weeks ) , the total hypoglycaemia rate was not significantly different . there were no differences in severe hypoglycaemia in the t1d or t2d pooled analyses . bil versus glargine treatment resulted in greater hba1c reduction with less nocturnal hypoglycaemia in all patient populations , higher daytime hypoglycaemia with basalbolus therapy in the t1d and t2d groups , and an associated increase in total hypoglycaemia in the patients with t1d .
You are an expert at summarizing long articles. Proceed to summarize the following text: symptomatic cerebral air embolism ( cae ) is a rare complication associated with cerebral angiography with a reported incidence of 0.08%.2 ) clinical manifestations of symptomatic cae may include decreased level of consciousness , hemiparesis , seizures , and neuromonitoring changes while under anesthesia.6 ) early recognition , diagnosis , and treatment of cae can minimize irreversible neurological deficits and avoid potential mortality . we report on a rare case of cae , which highlights that symptomatic cae should be considered in differential diagnoses when abnormal neuromonitoring signals are observed during cerebral angiography and prompt treatment can minimize neurological deficits . a 69-year - old female presented for elective stent - assisted coiling of a 7 mm , unruptured right middle cerebral artery ( mca ) bifurcation aneurysm . she was started on aspirin 325 mg and clopidogrel 75 mg daily seven days prior to undergoing the elective procedure . neuromonitoring with electroencephalography ( eeg ) and somatosensory evoked potential ( ssep ) were set up with good quality baseline signals prior to starting the procedure . a 6-french neuron guide catheter ( penumbra inc . , alameda , ca , usa ) was advanced over a 5-french berenstein catheter for selection of the patient 's right common carotid artery . using a roadmap technique and over - the - wire technique , the diagnostic catheter was used for selection of the patient 's right internal carotid artery . a microcatheter ( excelsior sl-10 , stryker neurovascular , fremont , ca , usa ) and a wire ( synchro-14 , stryker neurovascular ) were then used for selective catheterization of the mca and coiling of the mca aneurysm was started . during coiling of the aneurysm however , the neurophysiologist reported severe attenuation of sseps in the bilateral upper and lower extremities along with near flatlining of the eeg . there was no change in anesthetics , blood pressure , or body temperature prior to the ssep and eeg change . an intraoperative dynact was then obtained and showed multiple , hypodense cortical vessels consistent with cerebral air embolism ( fig . , it was noted that the pressure bag was depleted and a small amount of air was present in the drip line tubing . the fio2 was increased to 100% on the ventilator , intravenous levetiracetam was administered , mean arterial blood pressure was increased , and intra - arterial verapamil infusion was administered in order to facilitate vasodilatation and to maximize cerebral perfusion . the ssep and eeg signals showed gradual improvement approximately 30 minutes after the initial change . given the patient 's improvement on neuromonitoring and risk of coil migration , an enterprise stent ( 4.5 22 mm ; cordis , bridgewater , nj , usa ) was deployed successfully across the aneurysm for completion of the procedure . the catheter was retracted out of the body . a 6-french angio - seal closure device ( st . jude medical , st . magnetic resonance imaging ( mri ) of the brain showed only a small focal area with restricted diffusion in the right parietal region ( fig . the patient 's left hemiparesis showed gradual improvement over the next few days and she was eventually discharged with near baseline strength . follow - up angiogram at four weeks showed raymond grade 1 occlusion of the right mca aneurysm ( fig . cerebral air embolism is known to occur in a number of clinical settings , including cranial surgeries in the sitting position , trauma , decompression sickness , and cardiopulmonary bypass procedures.6 ) in many of these situations , air first enters into the venous circulation and subsequently migrates to the arterial side from either a patent foramen ovale or other cardiopulmonary shunts ( paradoxical embolism ) . during cerebral angiography , however , air can be introduced directly into the arterial circulation and therefore is more likely to cause neurological symptoms . fortunately , the overall incidence of symptomatic cae associated with cerebral angiography is extremely low . in a study examining more than 4,500 cerebral angiographies , only four cases of symptomatic cae of particular interest , all four cases of cae occurred during interventional cases and conferred a risk of 0.2%.2 ) several sources for air emboli in the setting of cerebral angiography have been reported in the literature , including air bubbles in the flush syringe , air bubbles in improperly primed flush tubing , non - degassed pressure bag , accidentally opened 3-way stopcock during an episode of hypotension , and rupture of an inadequately degassed angioplasty balloon.2)4 ) in our case , air was introduced from the pressure bag , which had been inadequately degassed prior to the procedure ; when the pressure bag was depleted , the small amount of residual air in the bag subsequently moved into the drip line , the guide wire , and eventually into the cerebral vasculatures . when cae is suspected during cerebral angiography , a quick angiogram can be helpful in assessment for any large vessel occlusion . computed tomography ( ct ) or dynact , if available , is a quick way to look for intracranial air , which can often demonstrate the outline of affected cerebral vasculature as the air emboli serve as a negative contrast medium . mri can also demonstrate intracranial air as hypointensity on t1-weighted sequence , however , the time requirement and patient transport often limit its role in acute diagnosis of cae ; however , mri is valuable in assessing the extent of ischemic changes due to cae . once the diagnosis of cae has been established , several measures can be taken to minimize potential neurological deficits . first , 100% o2 can be used to dilute nitrogen in the air emboli ( same composition as the earth 's atmosphere , ~ 78% n2 and 21% o2 ) and facilitate absorption of air . second , mean arterial pressure can be raised to increase cerebral blood flow , which helps to increase perfusion of the affected area from collateral vessels and to increase the rate of air absorption . third , as in our case , intra - arterial verapamil infusion can potentially increase cerebral vessel dilation to maximize cerebral perfusion and to facilitate more distal migration of air emboli . another important treatment option for cae is placing the patient in a hyperbaric chamber , where increased pressure can decrease air emboli size and increase the amount of gas molecules dissolved in the blood stream . however , the utilization of hyperbaric chambers is limited by availability . finally , early prophylactic anticonvulsants should also be considered , given that many patients with cae are prone to having seizures . prevention of cae is paramount in every neurointerventional case and all potential sources for introduction of air into the drip line should be checked carefully prior to starting any procedure . the prognosis of cae depends on a combination of several factors , including the amount of air present , collateral circulation , time of diagnosis , time of intervention , and treatment strategies utilized . many patients with cae can have complete recovery ; however , permanent neurological injuries and mortality can also occur if diagnosis and proper intervention is delayed.1)2)3)4)5)6 ) symptomatic cerebral air embolism is a rare but important complication associated with cerebral angiography which all neurointerventional surgeons should bear in mind . with prompt diagnosis and appropriate management , major permanent neurological deficits and mortality can often be avoided .	symptomatic cerebral air embolism during cerebral angiography is extremely rare . we report on the case of a 69-year - old woman undergoing elective stent - assisted coiling of an unruptured right middle cerebral artery ( mca ) bifurcation aneurysm , who was found to have severe attenuation of somatosensory evoked potential ( ssep ) and electroencephalography ( eeg ) during the procedure . intra - operative dynact showed hypodense cortical vessels consistent with cerebral air embolism . diagnostic and management strategies for this rare complication are reviewed .
You are an expert at summarizing long articles. Proceed to summarize the following text: this randomized clinical trail study was performed on 150 patients in ophthalmic research center of labbafinejad medical center ( tehran , iran ) during two years ending in 2007 . considering 90% power for detection of a 0.2-logmar difference ( equal to 2 snellen lines ) in visual acuity and being significant at the two - sided 5% level with an assumed standard deviation ( sd ) of 0.33 , 50 eyes in each group were required.15 we selected 103 patients eye with complete information from these 150 eyes . the informed written consent was obtained from all patients and the protocol was approved by the ethical committee of ophthalmic research center of labbafinejad medical center ( tehran , iran ) . in this study , patients were randomly allocated into three following groups : 1 ) the ivb group , patients who received 1.25 mg ivb ( 32 subjects ) ; 2 ) the ivb / ivt group , patients who received 1.25 mg of ivb and 2 mg of ivt ( 32 subjects ) ; and 3 ) the mpc group , patients who underwent focal or modified grid laser ( 33 subjects ) . to decrease the side effect of ivb , half doze was used instead of normal 4 mg injection . in the case of two eyes examination , each eye was studied separately and the best corrected visual acuity ( bcva ) and central macular thickness ( cmt ) of each patient were measured during the survey . bcva was measured by the snellen chart and was recorded in logarithm of the minimum angle of resolution ( logmar ) scale . retinal thickness was measured in a circle ( 3.5 mm in diameter ) centered on the fixation point . mean thickness on the 1 mm circle centered on the fovea ( cmt ) was considered for statistical evaluation . exclusion criteria were previous panretinal or focal laser photocoagulation , prior intraocular surgery or injection , history of glaucoma or ocular hypertension , va of 20/40 or better or worse than 20/300 , presence of iris neovascularization , high - risk proliferative diabetic retinopathy , and significant media opacity . monocularity , pregnancy , serum creatinine 3 mg / dl , and uncontrolled diabetes mellitus were also among the exclusion criteria.15 the experiment was conducted in a triple - blind manner that patients , experimenters and data analyzers were not aware of the specific diagnostic methods . for this reason , a non - therapeutic light was shed on the patients macula for 20 sec in ivb and ivb / ivt groups . the injection was also simulated for mpc group.16 statistical modeling was based on the data recorded in weeks 6 , 12 , 24 , 36 , and 48 which the patient 's data was complete at these times . bcva as a continuous variable and cmt as an ordinal variable were the response variables and the duration of diabetes ( > 10 years ) ( dd ) as the number of years having diabetes , sex and the baseline values of bcva and cmt were considered as confounder variables . it should be noted that the cmt variable was ordered in three following groups:16 < 300 m , 300 - 399 m and > 400 m . since the bivariate distribution of the recorded data was shown to be asymmetric or heavy - tailed based on the bivariate mardia 's skewness and kurtosis coefficients16 of 0.88 and 6.7 , asymmetric modeling was crucial . after fitting different symmetric and skew - symmetric distribution and running the model , dics ( goodness of fit criteria of the models ) were compared in different models . the results of comparing these criteria showed that the skew - symmetric models fitted better than the symmetric models . in addition , among asymmetric models , the distribution with more kurtosis was the best one . the bivariate mixed linear model is shown in eq.1 and eq.2 . in this model , the constant random variable ( crv ) was used to compensate intra - subject variability while the bivariate model was chosen because of the relative correlation between cmt and bcva . skew - symmetric distributions used in this model were either those that had more kurtosis in comparison with the normal one or those that had right skewness1517 such as skew - normal1 or skew - t.2 although the density functions of the skewed distributions are complicated , they are of interest for researchers because of the lower error variance and higher precision.17 in these models , traditional methods are not used to compute the coefficients . instead , bayesian methods are used . statistical modeling and inference 14.18 selection of the best fitted asymmetric model among different distributions was based on deviance information criteria ( dic ) which is a goodness of fit measure in bayesian methods . data were reported as frequency ( percent ) for qualitative variables and mean standard deviation ( sd ) for quantitative variables . odds ratios ( or ) and their 95% confidence intervals ( cis ) were presented as the measure of association and p - values < 0.05 were considered as statistically significant . their average diabetic duration was 10.24 1.2 years ( mean sd ) . among the patients , twelve percent of the whole data were asymmetric or outlier based on some primary statistical method like z - score ( table 1 ) . the summary statistics of best correlated visual acuity and central macular thickness at the beginning and during the follow - ups ( n=103 ) all confounders were significant in our model ( p < 0.05 ) ( table 2 ) . these results are presented based on the best fitted model using dic . using this criterion , it was identified that the mixed asymmetric model of skew - t was the best model among the fitted models . this distribution is one of the important asymmetric distributions that can cover more outliers than the normal distribution . there was no significant difference between ivb and ivb / ivt groups for the treatment of dme ( p > 0.05 ) while these two groups showed significantly better therapeutic effect in comparison with the pmc group ( p < 0.05 ) ( table 2 ) . considering the regression coefficients and the p - values , patients with longer diabetic duration showed better response to the treatment . in other words , the rate of decreasing cmt and increasing bcva was higher for patients whose diabetic duration was higher in comparison with those with lower diabetic duration . it was also shown women showed better response to the treatment . taking into account the baseline values , patients with lower bcva and higher cmt showed better response to the treatment . it should be noted that since the cmt variable is ordinal , the odds ratio and its confidence interval was reported ( table 2 ) . the regression results of the bivariate mixed linear asymmetric model for predictors of correlated visual acuity and central macular thickness in diabetic patients using the specific design method in the analysis of clinical trials , it is possible not only to control the confounding variables but also to investigate the possible variation of the outcomes during time.19 non - normal data usually exists in medical records and it is rare to have normal data all the time . by removing asymmetric data that are non - normal data or outliers , it is possible to reduce the sample size so much that makes it difficult to analyze the data and correctly interpret the parameters.20 other proposed statistical methods used to analyze non - normal data , for example non - parametric analysis , have lower power in comparison with the parametric methods.15 therefore , in recent years , incorporating statistical methods that not only take into account the data correlation in repeated measurements but also tolerate the non - normality , has been of great interest among investigators . longitudinal data analysis is recently used to more accurately analyze the clinical trials . in these methods , since there is a correlation between repeated measures , it is important to use approaches that take into account the data correlation as well as time - dependent effects of the treatment methods . according to the results of the current study , intravitreal bevacizumab injection alone or in combination with intravitreal triamcinolone acetonide improved the bcva and significantly reduced the cmt that the association was not strictly proven to be significant in the previous researches using primary statistical methods.16 these improvements are much clearer up to the week 24 . similar studies showed that the effect of bevacizumab injection is retained up to two weeks.21 in the literature , other investigators showed that intravitreal bevacizumab injection improves the vision in diabetic patients but intravitreal bevacizumab injection in combination with intravitreal triamcinolone acetonide does not improve the patients vision or reduce the cmt.2223 statistical analysis using repeated measurement on the same data set also showed intravitreal bevacizumab injection alone or in combination with intravitreal triamcinolone acetonide improved only the patients vision.15 the significancy of the patient 's sex and diabetic duration ( > 10 years ) on the patient 's responses to the treatment is in line with the previous studies.156 however , unlike the previous researches in which the effect of sex was not directly declared , we proved that women showed better responses to the treatments . we also showed that the patient 's response to the treatment is better if the diabetic duration is higher which is in agreement with the previous researches.524 therefore , according to our statistical analysis , intravitreal bevacizumab injection alone or in combination with intravitreal triamcinolone acetonide was a suitable substitute to macular laser photocoagulation as a primary treatment for diabetic macular edema . in addition , the aforementioned treatment methods had more positive effect on the patients that had lower bcva and higher cmt as the baseline values . in this paper , we not only modeled clinical outcomes in the presence of confounding parameters including disease duration and sex , but we also did not remove any asymmetric data or outliers that enabled to increase the power of tests in comparison with other similar studies . considering the bivariate analysis , two outcomes of bcva and cmt were analyzed simultaneously that indeed gave the opportunity to analyze their relationship that increased the accuracy of the inference in comparison with the previous investigations . in spite of all aforementioned advantages , this updated statistical analysis has a lot of computational difficulties and requires programming software which is hard to use . no significant difference was observed in this research between intravitreal bevacizumab injections alone or in combination with intravitreal triamcinolone acetonide . however , both of these methods significantly showed better improvement in comparison with that of macular laser photocoagulation as a traditional treatment of diabetic macular edema . this improvement was shown in increasing the bcva and decreasing the cmt during one year clinical follow - up . this research showed that when we have non - normal data in clinical trials , skew - symmetric mixed effect models may lead to different results compared to symmetric mixed models . with regard to the advantages of this updated statistical method mm carried out the design and coordinated the study , and run all modelling studies and prepared the manuscript . ak and ik provided assistance in the design of the study , technical advice on modelling and revised the manuscript . fz provided assistance for all statistical results . ms coordinated and carried out all the experiments and provided the technical advice on medical discussion .	background : diabetic macular edema ( dme ) is one of the major causes of visual loss and increase in central macular thickness ( cmt ) . the aim of this study was to determine the efficacy of a single intravitreal injection of bevacizumab ( ivb ) alone or in combination with intravitreal triamcinolone acetonide ( ivb / ivt ) versus macular laser photocoagulation ( mpc ) as primary treatment for dme when confounders were considered.methods:skew-symmetric bivariate mixed modeling according to best corrected visual acuity ( bcva ) and cmt was done on the data of 103 diabetic patients from ophthalmic research center of labbafinejad medical center ( tehran , iran ) to determine the best dme treatment by adjusting the effect of confounders.results:although there was no significant difference between ivb / ivt ( p > 0.05 ) , these two treatments increased bcva and decreased cmt better than mpc ( p < 0.05 ) . the following three groups showed better treatment responses : 1 ) women , 2 ) patients with more diabetes duration , 3 ) patients whose cmt were higher and va were lower at the beginning of the clinical trial.conclusions:using skew - symmetric mixed effect model as updated statistical method in presence of asymmetric or outlier data , we received different results compared to the same investigation on this study by analyzing bcva and cmt simultaneously . this research demonstrated the effect of ivb alone or in combination with intravitreal ivb / ivt on visual power and decreasing cmt during follow up .
You are an expert at summarizing long articles. Proceed to summarize the following text: hepatitis c virus ( hcv ) is a small positive sense single - stranded rna virus that causes acute and chronic hepatitis c in humans [ 1 , 2 ] . hcv is one of the major causative agents of liver disease worldwide , with more than 180 million people infected [ 2 , 3 ] . it is estimated that 3 - 4 million people are newly infected each year . in the united states , hepatitis - c - related chronic liver disease is a leading cause of liver transplantation and causes thousands of deaths annually . although therapeutic options are improving , viral clearance fails in about 80% of infected patients , resulting in a chronic viral disease . in 420% of patients with chronic hepatitis c , liver cirrhosis develops within 20 years , with 15% of these patients developing hepatocellular carcinoma ( hcc ) . persistent hcv infections are facilitated by the ability of virus to incorporate adaptive mutations in the host and exist as genetically distinct quasispecies . moreover , the persistent infection may also result from the ability of the virus to disrupt host defense by blocking phosphorylation and function of interferon regulatory factor-3 ( irf-3 ) , an antiviral signaling molecule . unlike for hepatitis a and b , there is no vaccine to prevent hcv infection ; therefore , current treatment is a combination therapy of pegylated interferon - alpha ( ifn- ) and ribavirin , which results in sustained clearance of serum hcv - rna . however , this treatment is only efficacious in approximately 50% of patients [ 79 ] . several host factors , such as age , stage of liver fibrosis , body mass index ( bmi ) , liver steatosis , insulin resistance , ethnicity , and il28b single nucleotide polymorphisms , as well as viral genotype , can potentially influence the treatment outcome [ 10 , 11 ] . for instance , patients with hcv genotypes 2 and 3 respond more favorably to treatment than patients with genotype 1 and 4 . therefore , new antiviral compounds that are more efficacious and better - tolerated need to be developed . one of the biggest challenges in developing and implementing therapy for hcv infection is finding the appropriate models to examine the translational capability . the focus of this review emphasizes the biological importance of the virus and discusses a number of relevant in vitro and in vivo small animal models that are used for preclinical evaluations prior to translating to clinical trials in humans . hcv was originally referred to as non - a non - b hepatitis ( nanb ) . in 1989 , a major breakthrough in hcv research was discovered in which the complete sequence of the viral genome was identified and cloned by choo and collaborators . hcv is the only member of the hepacivirus genus that belongs to the flaviviridae family [ 14 , 15 ] . structural analysis of the virus revealed that the genetic material is surrounded by a protective nucleocapside , composed mainly of the protein core ( c ) , and further protected by a lipid envelope . the lipid envelope contains two major glycoproteins , envelope protein 1 ( e1 ) and e2 , that are embedded in the envelope . the genome consists of a single open - reading frame ( orf ) , that is , ~9,600 nucleotides long , which is made into a single polyprotein ( 3,010 or 3,033 amino acids ) product ( figure 1 ) [ 18 , 19 ] . the hcv genome is flanked by two nontranslated regions ( ntrs ) , which are essential in the replication and synthesis of viral proteins . viral and cellular proteases mediate the processing of the polyprotein into structural ( core , e1 , e2 , and p7 ) and nonstructural proteins ( ns2 , ns3 , ns4a , ns4b , ns5a , and ns5b ) as illustrated in figure 1 [ 2022 ] . the hcv life cycle is entirely cytoplasmic and replication occurs mainly in hepatocytes , but the virus may also replicate in peripheral blood mononuclear cells ( pbmcs ) . the virus enters the host cells through a complex interaction between virions and cell surface molecules cd81 , ldl receptor , scavenger receptor class b type 1 ( sr - b1 ) , claudin-1 , and occludin [ 2326 ] . have identified niemann - pick c1-like 1 ( npc1l1 ) cholesterol absorption receptor as a new hcv entry factor [ 27 , 28 ] . due to its high - mutation rate caused by the virus ' rna - dependent rna polymerase ( ns5b ) , which lacks 3-5 exonuclease activity , hcv is considered a quasispecies composed of 6 genotypes with several subtypes . the eleven genotypes have differences in geographic distribution , disease progression , and response to therapy . genotypes 1 , 2 , and 3 are distributed worldwide , with genotypes 1a and 1b accounting for 60% of global infections . in the united states , genotypes although the virus was discovered more than 20 years ago using molecular biological methods and the entire genome of the virus sequenced , acquiring further knowledge of the virus has been hampered by the lack of a small animal model . much of the understanding of hcv replication has been based on subgenomic and genomic replicon systems developed by bartenschlager and colleagues , described below . viruses are obligate intracellular parasites that require a permissive host cell in order to study replication . therefore , development of a suitable small animal is critical in understanding the pathogenesis of the virus , establishing a relevant translational platform for therapeutic methods , and developing effective vaccines . the following describes various models used to study the pathogenicity of hcv and its applicable progression into in vivo models , which are summarized in table 1 . viral infection and propagation requires specific host factors that are mainly expressed in highly differentiated cells . to mimic the host factors in an in vitro system , development of a cell - based model a number of cell - based models have been established ; however , most of them have yielded limited success . poor reproducibility and low levels of hcv replication mainly contribute to the shortfall of these models . strand - specific real - time - polymerase chain reaction ( rt - pcr ) was used to detect minus - strand rna intermediates during hcv replication ; however , due to false priming , this technique is not reliable . as a result , several other genetic and biological indicators are refined and employed to show viral replication such as detection of plus - strand rna , inhibition of viral replication using ifn- or antisense oligonucleotides , transmission of cell culture grown hcv to nave cells , detection of viral antigens by immunofluorescences , and the long - term propagation of hcv . primary cell lines obtained from humans and chimpanzees have been used to study hcv infection . in which primary fetal human hepatocytes were injected with sera isolated from patients with hcv . although , these studies demonstrated an increase in copy number of the minus - strand rna [ 32 , 33 ] , the total efficiency after 24 days was low , expressing a maximum of 20,000 copies of rna in 10 cells . following a similar strategy as used by iacovacci , lanford et al . demonstrated a rapid increase in positive - strand rna from days 1 to 4 and sustained constant levels of transcripts using primary hepatocytes from chimpanzees . using strand - specific rt - pcr , the authors detected minus - strand rna replication intermediates , which indicate that the virus is undergoing replication within the hepatocytes . in addition , they showed that primary liver cells obtained from baboons could not be used to cultivate the virus . this observation supports the concept that hcv is quite species selective and has a narrow range of hosts . in 1999 , rumin et al . developed specific tissue culture conditions that could support the culturing of primary human hepatocytes for 4 months , without any morphogenic changes . although they were able to detect increasing levels of rna during the 3 months of culturing , the efficiency had many uncontrollable parameters such as the infectivity of the sera and the quality of the hepatocytes . in addition to the potential to infect hepatocytes , hcv has also been shown to replicate in pbmcs , indicating its ability to replicate in extrahepatic cells . consistent with this observation , hcv has been reported to replicate within pbmcs isolated from chronically infected patients . reported detection of viral rna 28 days after infecting a mixture of white blood cells ( obtained from 10 donors ) that were infected in vitro with high - titer serum . however , the levels and quality of rna were similar to those reported in hepatocytes . the most critical shortfalls in culturing primary cell lines have been the availability and the technical challenges associated with culturing these cells in vitro . as a result , tremendous efforts have been made in developing a nonprimary cell line that is able to mimic physiological hepatocytes . although a number of cell lines have been tested to show persistent replication , the most extensive studies have been conducted with the non - neoplastic cell line ph5ch , which was obtained from a human hepatocyte immortalized with the simian virus 40 large t antigen . have shown that hcv plus - strand rna can be detected more than 100 days after infection with hcv [ 37 , 38 ] . in addition , they determined that only certain variants , variants in the hypervariable region 1 ( hvr1 ) of the e2 protein , could infect and replicate in ph5ch cells . more importantly , these two groups demonstrated that infected ph5ch cells treated with ifn- showed significant loss of plus - strand rna of the virus ; thereby , it can serve as an ideal in vitro platform to examine potential therapeutic molecules . in addition to nonneoplastic cell lines , human b- and t - cell lines have been used as in vitro model to study hcv infection . mizutani et al . using the t - cell line mt2 isolated a clone containing hcv rna after 200 days postinfection moreover , t- and b - cell lines ; hpb - ma and daudi , respectively , have been shown to sustain virus propagation lasting for more than one year . a study by shimizu et al . has demonstrated that supernatant from hcv infected daudi cells exhibited remarkable infectious capacity in chimpanzee . hcv rna was detected in the chimpanzee serum after 5 weeks postinfection , however , the levels of hcv replication in the infected animal were low and gradually disappeared after 25 weeks postinfection . generation of clones from the hcv genome has permitted the genetic analysis of a variety of different aspects in the hcv life cycle . introduction of cloned virus genome is superior to infection using hcv infected patient serum because the clone is well defined and can be generated in high quantities . studies by dash et al . and yoo et al . have shown that transfecting hepg2 and huh-7 , respectively , with truncated hcv genomes that lacked the 3 ntr were able to maintain extended culture infected with hcv [ 42 , 43 ] . however , the usage of this truncated genome contradicts the finding that the 3 ntr is essential for replicating in vivo [ 44 , 45 ] . in addition , this method is not useful in infecting chimpanzee with hcv producing cells , unlike other transfected cell methods . in 1999 , bartenschlager et al . developed a system that consisted of subgenomic replicons of hcv that could replicate autonomously in hepatic cell cultures [ 31 , 46 ] . to obtain the subgenomic replicons , they isolated sera from patients infected with hcv and purified the viral genome . complementary dna was synthesized and amplified ; therefore , the final clones selected contained the complete genome including the 5 and 3 ntr , which was stably expressed in the pcr2.1 expression vector containing a t7 promoter . the final replicon contained a gene resistant to neomycin and the region encoding the structural proteins was eliminated . the structural proteins were removed from this replicon because it was previously observed that for several plus - strand rna viruses did not require the structural proteins for rna replication [ 4749 ] . this replicon was able to replicate itself within the cell ; however , it was not capable of producing infectious viruses . in addition , this replicon was able to reproduce in huh-7 cells with high efficiency and for an extended period of time . it was determined that mutations in the ns5a region and in the ns4b region increase replication more than 1,000 times [ 51 , 52 ] . subgenomes of other genotypes of hcv have been shown to be efficient in maintaining high infectious potential and long - term in vitro culture , for example , genotype 2a clone isolated from a japanese patient with a rare case of fulminant hepatitis c , designated as jfh-1 ( japanese fulminant hepatitis c ) . the data have indicated the isolate could replicate in huh-7 cells without the requirements for adaptive mutations that were required for previous isolates . huh-7 cells infected with cloned jfh-1 genomes produced viruses ( designated as hcvcc for cell culture derived hcv ) that were capable of infecting nave huh-7 cells . in addition , the virus particles could be neutralized with a monoclonal antibody against the viral glycoprotein e2 . the study was the first in vitro experiment that showed the complete lifecycle of hcv . more importantly , virus obtained from the cell culture was highly infectious in vivo by readily infecting chimpanzees [ 54 , 56 ] as well as immunodeficient mice with partial human livers ( chimeric mice ) described later . in addition to huh-7 cells supporting propagation of hcvcc , additional cell lines have been developed . human hepatoma li23-derived cells were found to possess the necessary components required for hcv rna replication and persistent production of infectious hcv . similar expression levels of hcv entry factors were observed between li23- and huh-7-derived cells , suggesting that certain factors are necessary for infectivity and propagation of hcvcc . recent studies have shown that expression of a liver - specific microrna , mir-122 , in hep3b cells can propagate hcvcc . a lentiviral vector expressing mir-122 was placed in hep3b cells at comparable levels with huh-7 cells , which lead to the production of infectious particles . have shown that mir-122 forms a complex with ago2 to protect and stabilize hcv rna from 5 exonuclease activity of the host mrna decay machinery . this finding may explain why expression of mir-122 in hep3b cells can support hcv propagation . the chimpanzee animal model ( pan troglodytes ) is currently the only established animal or primate model for hcv infection . the chimpanzee model for hcv infection was instrumental in the initial studies of non - a , non - b hepatitis , including observations on the clinical course of infection , determination of the physical properties of the virus , and eventual cloning of the hcv nucleic acid . the chimpanzee model has been invaluable in demonstrating that the cdna clones of hcv developed from hcv strains of genotypes 1a , 1b , and 2a were infectious . in addition , using this primate model that is evolutionarily close and associated with humans has provided important insight regarding the etiology of liver disease caused by hcv . the chimpanzee has provided evidence that infection with hcv did not provide complete protective immunity when challenged with homologous or heterologous viral strains [ 61 , 62 ] . as a result , it has been difficult to design effective vaccines against the virus , even though chimpanzees have allowed for the identification of important viral genetic elements . several studies have identified the importance of the active sites of various enzymatic functions as well as the role of the p7 protein . thus , chimpanzees are certainly one of the ideal models to study the pathogenesis of the hcv and serve as a great model for translation research ; however , it is quite a challenge to work with this model due to limited availability , the costs associated with acquiring and maintaining the animal for scientific research , and public resistance . the tree shrew , tupaias ( t. belangeri chinensis ) , was previously shown to be susceptible to the hepatitis b virus [ 63 , 64 ] . however , persistent hcv infection could not be established and only 25% of infected animals developed transient or intermittent viremia . in addition , tupaia must undergo severe immunosuppression before they can be infected with hcv . however , sera or plasmas obtained from patients with hcv were able to infect primary tupaia hepatocyte cultures . the authors demonstrated that the hepatocytes could produce infectious viruses that were capable of infecting nave hepatocytes . sequence analysis of cloned tupaia cdna revealed a high degree of homology between tupaia and human cd81 large extracellular loops ( lels ) , suggesting cd81 aids in viral entry . in addition , the study indicated that viral entry can also occur through receptors other than cd81 since cellular binding of e2 and anti - cd81 antibodies or soluble cd81-lel could not inhibit hcv infection . by genetically manipulating the upa transgenic mouse , mercer et al . this was done by transplanting normal human hepatocytes into severe combined immunodeficiency ( scid ) mice carrying a plasminogen activator transgene . the human hepatocytes transplanted were able to integrate into the parenchyma and repopulate the diseased mouse liver without losing their metabolic functions . successfully generated chimeric mice exhibited prolonged infection with high viral titers following inoculation with hcv and hbv isolated from human serum . in addition , the authors have demonstrated that the model was able to exhibit horizontal transmission in which hcv can be transmitted from one infected animal to another . since the mice were immunodeficient , they were not appropriate models to study hcv pathogenesis , although they were useful in assessing the activity of antiviral compounds , specifically the effect of ifn- , hcv protease inhibitors and cyclophilin inhibitor debio-025 on virus propagation and infectivity . moreover , this chimeric mouse model has been used to show that neutralizing antibodies can prevent an hcv infection in vivo . have previously shown that cd81 and occludin ( ocln ) were the minimum human factors required for hcv uptake by rodent cells . to determine these human factors for efficient hcv infection , the authors constructed recombinant adenovirus expressing human cd81 , scavenger receptor type b class 1 ( scarb1 ) , claudin 1 ( cldn1 ) , and ocln . inoculating mice with these human factors expressed in adenoviral vector was sufficient for hcv infection . furthermore , the authors employed a bicistronic hcv genome expressing cre recombinase ( bi - nlscre - jc1flag2 , abbreviated hcv - cre ) , which activates a loxp - flanked luciferase reporter in rosa26-fluc mice . the mice were infected with the hcv - cre and the mice that were expressing all four transgenes had luciferase signal that peaked at 72 hours postinfection . interestingly , only animals that expressed both human cd81 and ocln displayed 610 fold increase in virus infection . in addition , they were also able to show that scarb1 is a legitimate hcv entry factor . this system allows for the studies of hcv coreceptor biology in vivo and evaluation of passive immunization strategies . although , great strides in small animal models for the study of hcv have been made in the past decades , hcv remains a global public health issue . in past years , advancements have been made in vitro and in vivo models for the study of hepatitis c , in particular , the chimeric and genetically humanized mouse models , which have provided a platform to study new antiviral treatments and evaluate immunization strategies . with the advent of autoantibodies recognizing structural proteins found in hcv patients , both in vitro and in vivo models could provide an important foundation for the discovery of novel biomarkers for prognosis and treatment [ 72 , 73 ] . with new insights on hcv biology obtained from in vitro models and the ability to infect animals with active immune systems , it should be possible to develop new therapies and possibly a vaccine for hcv .	hepatitis c virus ( hcv ) is a pandemic disease affecting an estimated 180 million individuals worldwide and infecting each year another ~3 - 4 million people making hcv a global public health issue . hcv is the main cause for chronic hepatitis , cirrhosis , and hepatocellular carcinoma . in the united states , hcv - related chronic liver disease is a leading cause of liver transplantation . despite significant improvements in antiviral drugs , only ~50% of treated patients with hcv have viral clearance after treatment . showing unique species specificity , hcv has a narrow range of potential hosts infecting only chimpanzees and humans . for decades , the chimpanzee model has been the only and instrumental primate for studying hcv infection ; however , availability , economic , and ethical issues make the chimpanzee an unsuitable animal model today . thus , significant research has been devoted to explore different models that are suitable in studying the biology of the virus and application in the clinical research for developing efficient and tolerable treatments for patients . this review focuses on experimental models that have been developed to date and their findings related to hcv .
You are an expert at summarizing long articles. Proceed to summarize the following text: polycystic ovary syndrome ( pcos ) is a common endocrine disorder in women at reproductive age ( 1 , 2 ) . pcos is diagnosed with oligomenorrhea and/or anovulation as well as clinical and/or biochemical hyperandrogenemia with / without ultrasonographic evidence of polycystic ovaries . the diagnosis is made after exclusion of other disorders including thyroid dysfunction , hyperprolactinemia , nonclassical adrenal hyperplasia , cushing syndrome , and androgen producing tumors ( 3 ) . according to androgen excess society ( aes ) , pcos phenotypes including phenotype of hyperandrogenism and oligomenorrhea had a higher prevalence of metabolic syndrome when matched with the control subjects ( 4 , 5 ) ; moreover , recent data support an increased incidence of cardiovascular events in women with pcos , which are related to androgens level ( 6 - 8 ) . pcos is also associated with an increased risk of insulin resistance ( ir ) , type 2 diabetes mellitus , dyslipidemia , and atherosclerosis ( 9 - 13 ) . ir is also a risk factor for metabolic abnormalities and increases the risk of cardiovascular events . high mean platelet volume ( mpv ) might contribute to the endothelial injury by platelet activation and higher plasma concentrations of thromboxane a2 ( 14 ) . several reports have demonstrated that there is an association between mpv and cardiovascular risk factors ( 15 ) such as obesity ( 16 ) , diabetes mellitus ( 17 ) , hypertension ( 18 ) , acute coronary syndrome ( 19 ) , and stroke ( 20 ) . according to aes , ir and hyperandrogenemia are risk factors for cardiovascular diseases in patients with pcos ( 4 , 5 ) . regarding the current evidences , it is reasonable to investigate the association of mpv with androgens as well as ir in patients with pcos . to our knowledge , just one study investigated the association of mpv with androgen levels in patients with pcos ( 20 ) ; however , the mentioned study included overweight and obese patients . therefore , our study was designed to determine whether there was any association between androgens / ir and mpv in nonobese patients with pcos . a total of 136 patients with newly diagnosed reproductive - age pcos ( regarding to criteria of new pcos phenotypes , based on the rotterdam criteria ) ( 3 ) who were nonobese ( body mass index [ bmi ] , 20 - 25 kg / m ) were included . for control group , 59 healthy subjects ( bmi , 20 - 25 kg / m ) were recruited . all patients completed a standard questionnaire regarding their detailed history of menstrual cycles , acne , hirsutism , and medications . oligomenorrhea was defined as menstrual cycles occurring at intervals > 35 days , with only four to nine periods in a year . bmi ( kg / m ) was calculated by dividing weight in kilograms by the square of height in meters . the presence of terminal hair growth was scored using ferriman gallwey method ( 21 ) ; hirsutism was defined as a score > 8 ( 22 ) . the presence or absence of acanthosis nigricans and acne were noted . individuals with hyperprolactinemia , congenital adrenal hyperplasia , cushing 's syndrome , and those who had taken hormonal treatment for at least three months prior to their evaluation were excluded . furthermore , patients with hypertension and a history of angina or myocardial infarction , obesity , diabetes mellitus , diagnosed coagulation abnormalities or abnormal results of hematological parameters , any systemic disease , vascular or thyroid disorders , infection or inflammatory diseases , and malignancy were excluded . the control group consisted of healthy women with regular menstrual cycles , normal bmi , and no medication during preceding three months . venous blood samples for assessing fsh and lh ( miu / ml ) , estradiol ( pg / ml ) , prolactin ( ng / ml ) , total testosterone ( ng / ml ) , androstenedione ( ng / ml ) , and dehydroepiandrosterone - sulfate ( dheas ) ( g / dl ) were obtained from all participants in the morning between 08:00 a.m. and 09:00 a.m. after an overnight fast . serum fsh , lh , total testosterone , estradiol , progesterone , and dheas levels were measured by the chemiluminescent microparticle immunoassay ( paramagnetic particle , chemiluminescent immunoassay ) using a unicel dxi 800 system immune - analyzer ( beckman coulter ireland inc . , radioimmunoassay ( ria ) with commercial kits was employed to assess serum free testosterone ( biosource , nivelles , belgium ) and androstenedione levels ( radim , roma , italy ) . insulin ( iu / ml ) was analyzed by electrochemiluminescence immunoassay ( eclia ) and via roche htach cobalt 600 device . fasting blood glucose ( mg / dl ) levels were measured by the roche hitachi t800 device . ir was calculated by the ir index as determined by homeostasis model assessment ( homa - ir ) with the following formula : fasting blood glucose ( mg / dl ) fasting insulin ( iu / ml)/405 ; values > 2.7 were considered as ir . ovarian volume was calculated by the following formula : v = ( /6 ) length ( mm ) width ( mm ) thickness ( mm ) . the presence of polycystic ovaries was diagnosed by the presence of 12 or more follicles in each ovary with 2-mm to 9-mm diameter and/or increased ovarian volume ( > 10 cm ) . data analysis was performed using pasw 18 ( ibm , armonk , ny , usa ) . when comparing the continuous variables student s t test was used for the normally distributed subset and mann - whitney u test was used for the otherwise distributed subset . the approval of the study protocol was obtained from institutional review board and each participant signed an informed consent regarding the principles in the declaration of helsinki . a total of 136 patients with newly diagnosed reproductive - age pcos ( regarding to criteria of new pcos phenotypes , based on the rotterdam criteria ) ( 3 ) who were nonobese ( body mass index [ bmi ] , 20 - 25 kg / m ) were included . for control group , 59 healthy subjects ( bmi , 20 - 25 kg / m ) were recruited . all patients completed a standard questionnaire regarding their detailed history of menstrual cycles , acne , hirsutism , and medications . oligomenorrhea was defined as menstrual cycles occurring at intervals > 35 days , with only four to nine periods in a year . bmi ( kg / m ) was calculated by dividing weight in kilograms by the square of height in meters . the presence of terminal hair growth was scored using ferriman gallwey method ( 21 ) ; hirsutism was defined as a score > 8 ( 22 ) . the presence or absence of acanthosis nigricans and acne were noted . individuals with hyperprolactinemia , congenital adrenal hyperplasia , cushing 's syndrome , and those who had taken hormonal treatment for at least three months prior to their evaluation were excluded . furthermore , patients with hypertension and a history of angina or myocardial infarction , obesity , diabetes mellitus , diagnosed coagulation abnormalities or abnormal results of hematological parameters , any systemic disease , vascular or thyroid disorders , infection or inflammatory diseases , and malignancy were excluded . the control group consisted of healthy women with regular menstrual cycles , normal bmi , and no medication during preceding three months . venous blood samples for assessing fsh and lh ( miu / ml ) , estradiol ( pg / ml ) , prolactin ( ng / ml ) , total testosterone ( ng / ml ) , androstenedione ( ng / ml ) , and dehydroepiandrosterone - sulfate ( dheas ) ( g / dl ) were obtained from all participants in the morning between 08:00 a.m. and 09:00 a.m. after an overnight fast . serum fsh , lh , total testosterone , estradiol , progesterone , and dheas levels were measured by the chemiluminescent microparticle immunoassay ( paramagnetic particle , chemiluminescent immunoassay ) using a unicel dxi 800 system immune - analyzer ( beckman coulter ireland inc . , radioimmunoassay ( ria ) with commercial kits was employed to assess serum free testosterone ( biosource , nivelles , belgium ) and androstenedione levels ( radim , roma , italy ) . insulin ( iu / ml ) was analyzed by electrochemiluminescence immunoassay ( eclia ) and via roche htach cobalt 600 device . fasting blood glucose ( mg / dl ) levels were measured by the roche hitachi t800 device . ir was calculated by the ir index as determined by homeostasis model assessment ( homa - ir ) with the following formula : fasting blood glucose ( mg / dl ) fasting insulin ( iu / ml)/405 ; values > 2.7 were considered as ir . ovarian volume was calculated by the following formula : v = ( /6 ) length ( mm ) width ( mm ) thickness ( mm ) . the presence of polycystic ovaries was diagnosed by the presence of 12 or more follicles in each ovary with 2-mm to 9-mm diameter and/or increased ovarian volume ( > 10 cm ) . data analysis was performed using pasw 18 ( ibm , armonk , ny , usa ) . when comparing the continuous variables student s t test was used for the normally distributed subset and mann - whitney u test was used for the otherwise distributed subset . the approval of the study protocol was obtained from institutional review board and each participant signed an informed consent regarding the principles in the declaration of helsinki . there were no significant differences between patients and controls with respect to age ( p = 0.07 ) and bmi ( p = 0.312 ) ( table 1 ) . abbreviations : bmi , body mass index ; and pcos , polycystic ovary syndrome . total testosterone , free testosterone , androstenedione , dheas , lh , and estradiol levels and lh / fsh ratio were significantly higher in patients than in controls ( p < 0.05 ) ( table 2 ) . abbreviation : pcos , polycystic ovary syndrome ; n , number of the all subjects , sd , standard deviation ; dheas , dehydroepiandrosterone - sulfate ; lh , luteinizing hormone ; and fsh , follicular stimulating hormone . homa - ir was significantly higher in patients than in controls ( 44.9% and 19% , respectively ; p = 0.001 ) . when patients were divided into two group regarding their homa - ir status , patients with ir showed no significant differences with those without ir in bmi ( p = 0.117 ) and levels of total testosterone , androstenedione , and dheas ( p = 0.514 , p = 0.602 , p = 0.484 , and p = 0.502 , respectively ) . no significant differences were observed in mean mpv value between patients and controls ( mean , 9.02 fl ( 8.5 - 10.1 ) and 8.9 fl ( 7.7 - 9.1 ) , respectively ; p = 0.777 ) . mpv values were also similar between controls and patients without ir ( p > 0.05 ) . there was difference in mpv values between patients with high androgen levels ( mean , 8.7 fl ( 7.1 - 11.9 ) and patients with normal levels ( mean , 9.5 fl ( 6.9 - 13.2 ) , p = 0.012 ) as well as between patients with high androgen levels and controls ( mean , 8.9 fl ( 7.7 - 9.1 ) , p = 0.04 ) . no difference was observed between patients with normal androgen hormones levels and controls in mvp values ( p > 0.05 ) . there was a negative correlation between total testosterone and dheas with mpv ( p = 0.016 , r = -0.229 ; and p = 0.006 , r = -0.261 , respectively ) ( table 3 and figures 1 and 2 ) . r , correlation coefficient ; n , number of the patients with pcos ; and dheas , dehydroepiandrosterone - sulfate . abbreviations : dheas , dehydroepiandrosterone - sulfate . many recent studies have demonstrated the close relationship between atherosclerosis and increased mpv ( 8 - 12 ) . our study revealed that mpv did not differ between nonobese women with pcos and controls . in contrast , a previous study reported an increased mpv in women with pcos in comparison to non - pcos controls ( 20 ) . the discrepancy between the findings of two studies could be due the inclusion of obese patients with pcos in the previous study and increased mpv in this population might occur as a consequence of obesity , which is known to causes increased mpv ( 15 ) . a recent study including nonobese and obese patients with pcos demonstrated that mpv did not correlate with pcos except in patients with obesity ( 23 ) . according to aes ( 4 , 5 ) and a review ( 24 , 25 ) , growing evidence links androgens with pathophysiology of pcos and metabolic derangements . moreover , a recent study has announced that hyperandrogenism might be the progenitor of inflammation , which is independent of obesity in the patients with pcos . the authors declared that further studies are needed to evaluate the effect of androgen hormones on metabolic abnormalities in patients with pcos ( 26 ) . in this regard , a recent study has reported a positive correlation between mpv and dheas levels in pcos ( 20 ) . in contrast , our study showed that high levels of androgens were associated with the low mpv values in the nonobese patients with pcos . this contrast might be due to enrolling obese patients and a smaller sample size of the former study . thus , we suggest that the studies that aim to investigate the association between mpv and any hormonal / metabolic parameters in patients with pcos must exclude the patients with risk factors of atherosclerotic such as obesity , which may affect mpv . in addition , recent studies support an increased incidence of cardiovascular events related to ir and/or obesity in patients with pcos ( 27 ) . in our study , ir was higher in nonobese women with pcos than in healthy controls . all these findings suggest that ir might not be an independent risk factor for mpv changes in nonobese patients with pcos . finally , if the result of our study could be confirmed by prospective studies including four groups , namely , obese women with pcos , nonobese women with pcos , nonobese healthy women , and obese healthy women , the effect of obesity on mpv could be better understood . additionally , ir , which is one of the most common features of pcos , was not related to mpv in nonobese patients with pcos . lastly , we showed that elevated androgen levels caused a decrease in mpv in the same population .	background : mean platelet volume ( mpv ) is generally accepted as a new marker of cardiovascular disease risk in several studies.objectives:this study aimed to determine the association of mpv with androgen hormones and insulin resistance ( ir ) in nonobese patients with polycystic ovary syndrome ( pcos).patients and methods : a total of 136 patients with newly diagnosed reproductive - age pcos ( regarding the criteria of new pcos phenotypes , based on the rotterdam criteria ) who were nonobese with the mean age of 25 years ( 25.39 5.51 ) and mean body mass index ( bmi ) of 21 kg / m2 ( 22.07 2.13 ) were included . in addition , 59 healthy subjects with mean age of 26 years ( 22.07 2.13 ) and mean bmi of 22 kg / m2 ( 21.52 3.84 ) were recruited as control . total blood count ( including mpv ) , total testosterone , free testosterone , dehydroepiandrosterone - sulfate ( dheas ) , and androstenedione levels were recorded . ir was calculated from blood chemistry measurements of fasting insulin and glucose according to updated homeostasis model assessment.results:no differences were observed in mean mpv values between patients and control group ( 9.02 fl ( 8.5 - 10.1 ) and 8.9 fl ( 7.7 - 9.1 ) , respectively ; p = 0.777 ) . mpv values were similar among nonobese patients with and without ir and control subjects ( p > 0.05 ) . we detected significantly lower values of mpv in patients with hyperandrogenemia in comparison to patients with normal androgen levels ( 8.7 and 9.5 fl , p = 0.012 ) . there was a negative correlation between total testosterone , dheas , and mpv ( p = 0.016 , r = -0.229 ; and p = 0.006 , r = -0.261 , respectively ) . multiple logistic regression analyses confirmed the independence of these associations.conclusions:our study revealed that nonobese women with and without pcos have similar mpv values . while ir does not have any effect on mpv , elevated androgen levels are associated with a low mpv in nonobese patients with pcos .
You are an expert at summarizing long articles. Proceed to summarize the following text: dermatophytosis is a group of skin fungal infections caused by dermatophytes ( or ring worms ) , which invade and attack keratinized tissues . typical symptoms of these infections include inflammation or redness of the infected part , brittleness and fissures of the nails , and loss of hair from the affected parts . a large number of antifungal agents such as griseofulvin , azole derivatives , allylamines and morpholines are used in the treatment of dermatophyte infections . however , they have been shown to exhibit adverse side effects such as gastrointestinal disturbances , cutaneous reactions , hepatotoxicity and leucopoenia . in addition to such adverse effects , the acquired resistance to certain antifungals , and the high cost of synthetic drugs limit the treatment of dermatophytosis . because of their biodegradable nature , the demand for natural drugs has been increasing , and therefore , the development of antifungal agents from local raw material is still a necessity . this is particularly true in the cases developing countries , which have high levels of their populations . coula edulis bail ( olacaceae ) , locally known as african walnut , is a commonly occurring medicinal plant in africa . it can be found in the top canopy of forests as well as the lower story , and has no special soil requirements . ethnobotanical studies indicate that the stem and fruits of c. edulis are commonly used in west africa for the treatment of stomach ache and skin diseases . the bark of the plant is used to produce rinses or enemas for loin pains or kidney problems . moreover , antibacterial and anti - yeasts activities of c. edulis extracts have been shown in previous studies . to the best of our knowledge this study , therefore , was undertaken to first evaluate the antidermatophytic activity of the ch2cl2-meoh ( 1:1 v / v ) extract , fractions and compound isolated from the stem bark of c. edulis , and then to assess the toxicological risk of its extract upon consumption . general experimental procedures for structure elucidations melting points ( uncorr ) were determined on a kofler apparatus . ultra - violet ( uv ) spectra were measured with a uv-210 pc , uv - vis scanning spectrophotometer ( analytikjena ) . proton nuclear magnetic resonance ( h - nmr ) spectra were recorded in cdcl3 using a bruker avance 500 mhz nmr spectrometer and trimethylsilyl ( tms ) as an internal standard . thin layer chromatography ( tlc ) were carried out either on silica gel gf254 pre - coated plates ( analytical tlc ) or on silica gel 60 pf254 containing gypsum ( preparative tlc ) , with detection accomplished by spraying with 50% h2so4 followed by heating at 100c , or by visualizing with a uv lamp at 254 and 366 nm . gas chromatography - mass spectrometry ( gc - ms ) data were obtained with an agilent 6890n network gc system/5975 inertl mass selective detector at 70 ev and 20c . the gc column was a cp - sil 8 cb lb , fused silica capillary column ( x , film thickness 0.25 m ) . the initial temperature was 50c for 1 min , and was heated at 10c / min to 300c . the carrier gas was helium at a flow rate of 1.2 ml / min . the stem bark of c. edulis was collected from buea ( south - west region of cameroon ) in january 2008 . the plant material was identified at the cameroon national herbarium in yaound where a voucher specimen ( 19357/hnc ) was conserved . extraction , fractionation and isolation previously dried and powdered stem bark of c. edulis ( ) was extracted with dichloromethane - methanol ( 1:1 ) ( ) for 48 hours . the filtrate was concentrated under reduced pressure at 40c using rotary vacuum evaporator to give a brown paste crude extract ( ) . one hundred and four grams ( ) of this extract was then subjected to fractionation as previously described . briefly , the crude extract was subjected to a column chromatography with silica gel 40 ( particle size 0.2- ) as stationary phase . the column was successively eluted with hexane , hexane - ethyl acetate and ethyl acetate - methanol gradients . one hundred and seventy one ( 171 ) fractions of 250 ml each were collected and combined on the basis of their thin layer chromatography ( tlc ) profiles to afford eight main fractions : f1 ( 1 - 59 ) , f2 ( 60 - 122 ) , f3 ( 123 - 124 ) , f4 ( 125 - 126 ) , f5 ( 127 - 138 ) , f6 ( 139 - 149 ) , f7 ( 150 - 156 ) and f8 ( 157 - 171 ) . fraction f2 ( ) was purified on a silica gel 60 ( 0.063- , ) column ( ) to give glucosterol ( 28 mg ) . fraction f3 ( ) was rechromatographed on a silica gel 60 ( 0.063- , ) column giving a mixture of sterols and fatty acids ( 32 mg ) . identification of the compounds the structure of the isolated compound was established on the basis of spectroscopic analysis ( ir , uv , h nmr ) and by comparison of the data with those reported in literature . the mixture of sterols and fatty acids was identified by gas chromatography - mass spectrometry ( gc - ms ) after saponification and methylation of fatty acids . the separated compounds were identified by comparisons of their mass spectra to those of compounds registered in nist 89 and wiley 237 spectral libraries of gc - ms instrument . the microorganisms used in this study included four strains of dermatophytes , namely : trichophyton mentagrophytes e1425 , trichophyton terrestre e1501 , microsporum gypseum e1420 and epidermophyton floccosum e1423 obtained from ( france ) , and one clinical isolate of microsporum audouinii characterized in our laboratory . these fungi were grown at room temperature ( 252c ) and maintained on sabouraud dextrose agar ( sda , biomerieux ) . in vitro antidermatophytic test the antidermatophytic activities of the crude ch2cl2-meoh ( 1:1 v / v ) extract , fractions and pure compound from c. edulis were evaluated using the agar dilution method as reported by kuiate and co - workers . stock solutions of the test samples ( 100 mg / ml ) were prepared using a 10% solution of dimethylsulfoxide ( dmso , mehr ) . from these stock solutions , dilutions ( in melted sabouraud dextrose agar , sda , biomerieux ) were made to give serial two - fold dilutions with concentrations ranging from 0.312 to 5 mg / ml . the petri dishes ( diameters ) were filled with samples containing sda to a final volume of 10 ml . the petri dishes were then inoculated at their centre with a disk ( diameters ) cut from the periphery of 10 days - old cultures . the test and the negative control petri dishes were incubated at room temperature for 10 days . the radial growth of each fungus was recorded every day at the same time and the percentages of inhibition were calculated using the following formula : where dc was the diameter of colony of negative control culture and dt was the diameter of colony of test culture . each assay was repeated trice . the minimum inhibitory concentration ( mic ) was defined as the lowest concentration that prevented a visible growth of fungal strain . the inhibited fungal discs from the extract treated dishes were sub - cultured in a fresh medium , and revival of their growth indicated fungistatic effect , while absence of any growth indicated fungicidal effect . experimental animals in this study , 72 swiss albino mice ( 36 males and 36 females ; 78 weeks old ; 20 ) and 50 wistar albino rats ( 25 males and 25 females ; 68 weeks old ; 120 ) were used . they were bred in the animal house of the department of biochemistry , university of dschang , cameroon . the animals were housed two or three per cage in elevated wire mesh cages , and were provided with standard animal food , grower s mash ( grand cereals ltd , jos - nigeria ) and water ad libitum . acute toxicity study this study was carried out on swiss albino mice ( males and females ) as described by emerson and co - workers . stock solution of crude extract ( 0.8 g / ml ) was prepared using 1% aqueous solution of dmso . mice in subgroup 1 ( control ) were given ( oral gavage ) 1% aqueous solution of dmso ( 1 ml per bw ) while those of subgroups 2 , 3 , 4 , 5 and 6 were administrated 2 , 8 , 16 , 24 and 28 g / kg bw of crude extract , respectively . all the animals were fasted for 18 hours prior to the extract administration . after a single dose administration , the survived mice were closely observed for two weeks , and were monitored daily for behavioral changes , signs of toxicity and the latency of death . the median lethal dose ( ld50 ) sub - acute toxicity study fifty wistar albino rats ( 25 males and 25 females ) were used . rats in subgroup 1 ( control ) were given daily administration of 1% dmso ( 1.5 ml per bw ) by oral gavage , while those of subgroups 2 , 3 , 4 and 5 were given 25 , 50 , 100 and 200 mg / kg bw of the crude extract , respectively for four weeks . the body weight of each rat was determined during the acclimatization period , once before the commencement of vehicle or extract administration , once every day during the administration period , and once on the day of the sacrifice . the relative body weight ( rbw ) of each animal was calculated as follows : rbw = absolute body weight of one time interval ( g)100bw of raton the first fay of administration ( g ) food and water consumptions the amounts of food and water consumed ( ac ) were measured daily from the quantity of food and water supplied and the amount remaining after 24 hours as followed : ac ( in g or ml)=total amount of food / water given amount of food / water remaining . twenty - four hours after the last administration , rats were anesthetized with chloroform vapor , and blood samples were collected through cardiac punctures using heparinized and non heparinized centrifuge tubes . the heparinized blood was used for the total red blood cell ( rbc ) and white blood cell ( wbc ) counts , and heamatocrit . the non heparinized blood samples were allowed to clot before centrifugation ( 4000 rpm at + 4c for 10 min ) to obtain serum samples , which were assessed for alanine aminotransferase ( alt ) , aspartate aminotransferase ( ast ) , glucose , creatinine , total cholesterol and protein levels by standard methods using relevant kits ( biosystem reagents and instruments ) . immediately after the blood collection , the liver , lung , heart , spleen and kidneys were carefully dissected out , blotted , observed macroscopically and weighed immediately using a sartorius electronic balance . the relative organ weight ( row ) of each animal was then calculated as follows : row = absolute - organ weight g100body weight of rat on day of sacrifice ( g ) organs tissues were thawed and homogenized 20 times ( w / v ) by homogeniser in ice - cold tris - hcl kcl buffer ( ph 7.4 ) . the homogenate samples were centrifuged at 6000 rpm for 30 min , and the supernatants were then used for enzyme and total protein assays using the method cited above . statistical analysis statistical analysis was carried out using statistical package for social science ( spss , version 12.0 ) . group comparisons were performed using one way anova followed by waller - duncan post hoc test . the experiments were carried out observing the welfare of animals as recommended by world health organization ( who ) . moreover , all procedures involving animals were carried out in strict compliance with the rules and regulations of local ethics committee . one known compound : 3-o--d - glucopyranoside of sitosterol ( 1 ) , and a mixture of -sitosterol , stigmasterol and n - hexadecanoid acid ( 2 ) were isolated from ch2cl2 : meoh ( 1:1 ) extract of c. edulis stem bark ( figure 1 ) . antidermatophytic activity the results of the antidermatophytic activities of the crude extract , fractions and compounds from c. edulis are presented in tables 1 and 2 . it appeared that the extract and fractions f2 and f3 were able to prevent the total growth of all studied microorganisms at the concentrations examined ( table 1 ) . fraction f3 showed the best antidermatophytic activity ( mic=0.621.25 mg / ml ) , as compared to that of the crude extract ( mic=1.25 - 5 mg / ml ) or other fractions ( mic=1.25->5 mg / ml ) . however , none of the samples tested was as active as the reference antibiotic , griseofulvin ( mic=0.001 - 0.020 mg / ml ) ( table 2 ) . chemical structures of 3-o--d - glucopyranoside of sitosterol ( 1 ) and a mixture of -sitosterol , stigmasterol and n - hexadecanoid acid ( 2 ) the percentage inhibitions ( % ) of fungal growth by the crude extract of stem bark of coula edulis and the fractions from the extract at the concentration of 5 mg / ml against the tested dermatophytes . values signified by different letters ( a - f ) are significantly ( p < 0.05 ) different from each other . minimum inhibitory concentration / minimum fungicidal concentration ( mic / mfc ) ( in mg / ml ) of the crude extract of coula edulis stem bark and fractions and compounds isolated from the extract against the tested dermatophytes . m ; microsporum , t : trichophyton , e : epidermophyton.1 : 3-o--d - glucopyranoside of sitosterol ; 2 : -sitosterol , stigmasterol and n - hexadecanoid acid . nt ; not tested the results of the acute toxicity study indicated that female mice were more tolerant than male ones to oral administration of the crude extract . for doses up to 16 g / kg bw , the animal s reaction to pinch and noise were reduced . all animals developed diarrhea within 3 hours after the administration of doses 16 g / kg bw . none of the treated mice survived within 48 hours after the administration of 24 and 28 g / kg bw in males and females , respectively . the calculated ld50 values were 16.80 and 19.60 g / kg bw for male and female mice , respectively . variation of relative body weight of rats as a function of the duration and dose of coula edulis ch2cl2/meoh ( 1:1 ) stem bark extract . daily amounts of food and water consumed as affected by doses of coula edulis ch2cl2/meoh ( 1:1 ) stem bark extract during sub - acute toxicity study . for the same parameter and sex , values bearing asterisk ( * ) are significantly different ( p<0.05 ) to the control and other groups . general symptoms , body and organ weight changes no death did occur following daily administration of vehicle or the extract for 28 days in control or extract treated group , respectively . however , there were significant dose - dependent decreases in animals ' body weight gain as well as food and water consumptions . these reductions were most pronounced ( p<0.05 ) in the animals that were administered the extract at the highest dose ( 200 mg / kg bw ) . moreover , the macroscopic observation of livers of animals revealed the presence of white vesicles on the surface of this organ at the dose of 200 mg / kg bw ( figure 4 ) . also , significant decreases ( p<0.05 ) were recorded in the relative liver , heart , lung and kidney weights at the same dose irrespective of the sex ( figure 5 ) . none of the screened organ showed significant ( p0.05 ) variation in the parameters evaluated above at doses 100 mg / kg bw ( figure 5 ) . livers from rats treated with the ch2cl2/meoh ( 1:1 ) extract of coula edulis stem bark ( a ) or vehicle ( dimethylsulfoxide , dmso ) ( b ) . they can be differentiated by the presence of white vesicles on liver from rats receiving the extract . relative organ weights ( as a percent of body weight ) of rats after sub - acute treatment ( 28 days ) with different doses of coula edulis ch2cl2/meoh ( 1:1 ) stem bark extract . * indicate significant ( p < 0.05 ) difference from the control group for the each organ and gender . hematological and biochemical observations there was no gender - dependent differences in rbc and wbc , but a significant decrease in hematocrit ( p<0.05 ) was observed in males at the dose of 200 mg/ kg bw as compared to that of the control ( table 3 ) . this dose also induced a significant ( p<0.05 ) increase in serum creatinine in both sexes . also , a significant ( p<0.05 ) decrease in serum total cholesterol levels , and a significant ( p<0.05 ) increase in serum and liver levels of proteins as well as serum levels of alt and ast were observed in both male and female rats compared to the control group ( tables 4 - 5 ) . antidermatophytic activity the antidermatophytic activities of the ch2cl2-meoh ( 1:1 v / v ) extract from stem bark of c. edulis may be attributed to the presence of various classes of compounds of biological interest , namely alkaloids , terpenoids , flavonoids , tannins and anthraquinones as shown by tamokou and co - workers . differences observed in the antidermatophytic activities of crude extract and its fractions can be linked to the differences in chemical composition of these test samples . fraction f3 was more active than the crude extract , indicating that fractionation increased its antidermatophytic activity . this could be due to the exclusion , by fractionation , of some constituents of the extract , which may tend to dilute the active principle and reduce its activity . on the other hand , fractionation may have increased the concentrations and the activities of antidermatophytic principles in this fraction . a keen look of the mfc results , indicated that none of the noticeable values obtained with many samples were more than 4 fold their corresponding mic , postulating a fungicidal effect of the studied samples . compounds 1 and 2 displayed antidermatophytic activities . these results reveal the potential of c. edulis as a source of antidermatophyte drugs and support its use in folk medicine for the treatment of fungal skin infections . peripheral blood changes observed in rats after 82 days treatment with different doses of c. edulis ch2cl2/meoh ( 1:1 ) stem bark extract . doses are expressed in mg / kg body weight ( bw ) , wbc : white blood cells ; rbc : red blood cells . for the same sex and in the same column , values bearing different superscript letters are significantly ( p < 0.05 ) different from each other . serum levels of different parameters in rats treated for 28 days with different doses of c. edulis ch2cl2/meoh ( 1:1 ) stem bark extract . for the same sex and in the same column , values bearing different superscript letters are significantly ( p < 0.05 ) different from each other . the concentrations of different parameters in the liver of the rats treated for 28 days with different doses of stem bark crude extract of c. edulis . for the same sex and in the same column , values bearing different superscript letters are significantly ( p < 0.05 ) different from each other . in developing countries , phytotherapy often represents the main , if not the lone , therapeutic approach to which a majority of the people are referred to for their primary health care . the increase in the number of users medicinal plants in the face of the scarcity of scientific evidences on their safety have raised concerns regarding the toxicity and detrimental effects of these remedies , and the same applies for c. edulis . this plant , like most others , contains several bioactive principles which are able to induce beneficial and/or detrimental effects . to optimize its safety use as a plant - based medicine , one should , beside the historical documentation on c. edulis , have a toxicity assessment of this medicinal plant . thus , the evaluation of the acute and sub - acute toxicities of c. edulis in the present study appears to be biologically essential . with the ld50 of 16.8 and kg in male and female mice respectively , the crude extract of c. edulis may be considered fairly toxic . these result indicate that female mice are more tolerant to the c. edulis extract than males after oral administration . this is in contrary to the observation of drici and clement , and liechti and co - workers , who showed that the adverse effects of drugs and toxic substances were more pronounced in women than in men . a reduced reaction to noise was observed suggesting that the extract may have a depressant or sedative effect on the central nervous system . this decreased sensitivity may be due to the action of the extract on the nociceptors or to the inhibition of the production of algogenic substances ( e.g. prostaglandins or histamines ) , or to the inhibition of the painful message transmission at the central level . changes in body weight are used as an indicator of adverse effects of drugs and chemicals . in the sub - acute toxicity study , significant decreases in total weight gain were observed in the rats , which received the extract at the dose of 200 mg / kg bw as compared to the control . the reduction in total weight gain may be due to less food and water intake , after the administration of c. edulis extract . this growth retardation may also be due to the antilipidaemic effect of c. edulis extract as shown by the decrease of serum total cholesterol . the hematopoietic system is one of the most sensitive targets for toxic compounds , and is an important index of physiological and pathological status in man and animal , in this study , a significant decrease in hematocrit values was also observed in male from the dose of 200 mg / kg bw as compared to that of the control group , suggesting that the extract at high doses may have some effect on the red blood cells . this was confirmed by the decrease , though not significant , observed in red blood cells count of rats treated with the same doses . however , the normal values for hematocrit range from 34% to 48% in wistar albino rats . in the present study , hematocrit value ( 45.01.2 ) of the male rats receiving the extract at the dose of 200 mg / kg bw was within the normal range . the biochemical parameters ( i.e. serum levels of alt , ast and creatinine ) also showed significant increases in the group receiving the highest dose as compared to that of the control group . indeed , the transaminases ( ast and alt ) are well - known enzymes used as good indicators of liver function , and as biomarkers predicting possible toxicity . generally , any damage to the parenchymal liver cells results in the elevations of both transaminases in the blood . in addition , ast , found in the serum , is of both mitochondrial and cytoplasmic origins and any rise can be taken as a first sign of cell damage that leads to the outflow of the enzyme into the serum . thus , the significant increases observed in alt and ast activities strongly suggest that the sub - acute oral administration of c. edulis extract did affect the hepatocytes , and consequently the metabolism of the rats . equally , there was also a significant rise in creatinine in group receiving the highest dose when compared to that of the control group . any rise in creatinine level is only observed , if there is a marked damage at the nephrons . therefore , the results recorded in this study similarly suggest that c. edulis extract might have altered the renal function . clearly , this only serves as a preliminary test , and for a better estimation of renal function a creatinine clearance test is required . at last , significant decreases were recorded in the relative liver , heart , lung and kidney weights at the dose of 200 mg / kg bw indicating that the sub - acute oral administration of c. edulis extract had a detrimental effect on the normal growth of these organs . this corroborates with the white vesicles observed on the liver surface indicating damages at the level of this organ . endogenous proteins ensure not only the transportation of xenobiotics in blood toward target organs , but also their biotransformation in the liver in order to activate , excrete or detoxify them . the increased protein levels in the serum and liver could be due to the response of hepatic cells to the toxic substances . this study is the first to show that c. edulis , which is claimed to be a cure for stomach ache and infectious diseases , is a medicinal plant with detrimental biological properties . if an extrapolation of the above results is to be made to humans , it might be possible to suggest that precautions during its use is necessary , especially when used at high doses ( 200 mg / kg bw ) or over a long period of time this study provides valuable data on the antidermatophytic activity as well as acute and sub - acute oral toxicity profiles of c. edulis extract that might be very useful for any future in vivo and clinical studies of this medicinal plant . fraction f3 is the most active fraction , and microsporum audouinii and epidermophyton floccoseum are the most sensitive microorganisms to the plant fractions . the c. edulis ch2cl2-meoh ( 1:1 ) extract at high doses ( 200 mg / kg bw ) had significant hepatotoxic and nephrotoxic activities . further studies to determine the effects of this plant on animal fetuses , and pregnant animals and their reproductive capacity are necessary to complete the safety profile of this plant	background : coula edulis bail ( olacaceae ) , is an evergreen tree growing to a height of 25 . this study aimed at evaluating the antidermatophytic and toxicological properties of the stem bark of c. edulis extract as well as fractions and compounds isolated from it . methods : the plant extract was prepared by maceration in ch2cl2-meoh ( 1:1 v / v ) . the fractionation of this extract was done by silica gel column chromatography . antidermatophytic activities were assayed using agar dilution method . the acute and sub - acute toxicities of oral administrations of the extract were studied in rodents . results : the crude extract of c. edulis displayed antidermatophytic activity against the tested microorganisms with highest activity against microsporum audouinii and trichophyton mentagrophytes . the fractionation enhanced the antidermatophytic activity in fraction f3 ( mic=0.62 - 1.25 mg / ml ) compared to the crude extract ( mic=1.25 - 5 mg / ml ) . further fractionation and purification of the fractions f2 and f3 gave respectively 3-o--d - glucopyranoside of sitosterol ( mic=0.20 - 0.40 mg / ml ) and a mixture of -sitosterol , stigmasterol and n - hexadecanoid acid ( mic=0.80 mg / ml ) . the median lethal doses ( ld50 ) of the crude extract were 16.8 and 19.6 g / kg body weight ( bw ) in male and female mice , respectively . at 200 mg / kg bw , there was a decrease in body weight gain , food and water consumptions . gross anatomical analysis revealed white vesicles on the liver of the rats treated with the extract at 200 mg / kg bw . this dose also induced significant ( p<0.05 ) changes on hematological and biochemical parameters in rats after 28 days of treatment . conclusion : these data suggest that the ch2cl2-meoh ( 1:1 v / v ) extract of c. edulis stem bark possesses antidermatophytic properties . they also show that at high doses ( 200 mg / kg bw ) , the extract has significant hepatotoxic and nephrotoxic activities .
You are an expert at summarizing long articles. Proceed to summarize the following text: the world health organization ( who ) has had control of the international spread of infectious diseases as one of its core functions since the first world health assembly ( wha ) in 1948 . the priorities over the ensuing decades have changed , as new diseases have emerged and others have been controlled , and even eradicated as in the case of smallpox . a fundamental , core responsibility of who to provide disease alert and response assistance to countries , and for the global community , has never wavered . who has always depended on its network of collaborating centres and disease experts to assist in responding to outbreaks of specific diseases or unusual events , as well as working actively with member states and donors to provide support whenever and wherever required . at the turn of the century , who 's role and support newly emerging diseases and resurging epidemic - prone diseases continually threaten the health and the economic well - being of the international community . in addition , greater awareness and concern about infectious disease outbreaks and their impacts on health and other sectors were happening against the backdrop of an information revolution , which allowed unprecedented broad access to information that was sometimes unverified and sometimes inaccurate . who recognised that alert and response activities could be better organised and more effectively coordinated . framework for global outbreak alert and response was developed by the department of communicable diseases surveillance and response , and regional offices . this framework introduced inter alia the concept of a global network of technical institutions and networks , coordinated by who , to better focus global resources and relevant expertise to respond to outbreaks which threaten to overwhelm the national capacity of countries , or to contain novel , emergent diseases about which little or nothing is known ( who , 2000a ) . the concepts put forward in this framework document formed the basis for further discussion at a meeting convened by who in geneva in april 2000 . the meeting brought together 121 representatives from 67 partner institutions to address the challenges of disease outbreaks at the start of the twenty - first century and specifically the need for a coordinated approach to address these threats . it was recognised that no single organisation or institution had all the capacity to meet these challenges effectively . not only were outbreaks too numerous and geographically distributed , but also only an effective technical partnership of national and international institutions and networks could operate effectively in the complex political , economic and environmental circumstances that are often significant factors in disease outbreaks . the meeting participants agreed that a new approach was necessary to meet these challenges and that the solution was a global network of partners able to bring the resources of many organisations to bear on the problem . the participants agreed to establish the global outbreak alert and response network ( goarn ) as a network of technical partners and other networks with the capacity and expertise to contribute to an international , coordinated response to outbreaks of epidemic - prone and novel infectious diseases ( who , 2000b ) . goarn would complement the existing outbreak alert and early warning systems , who collaborating centres , disease - specific surveillance networks and coordination mechanisms , national and international surveillance , and laboratory networks for emerging and re - emerging infectious diseases , related training initiatives and programmes and strengthen existing coordination of international response , particularly for outbreak alert and response in emergencies ( heymann , rodier , & the who operational support team to the goarn , 2001 ) . the partner institutions agreed to work together to ensure that appropriate technical assistance would rapidly reach affected countries and populations and would lead to reduced morbidity and mortality and prevent further disease spread . goarn 's functions would be to work as a network of networks to combat the international spread of outbreaks by supporting who 's activities in rapid identification , verification and communication of threats and by ensuring a coordinated mechanism for outbreak alert and response . partners recognised the opportunity presented by improved international support for outbreak response to contribute also to long - term outbreak preparedness and response capacity at all levels . it was also agreed that the structure of the network would be supported by a steering committee consisting of about 20 representatives of network partners , and an operational support team based in who ( who , 2000b ) . participants at the meeting agreed on a series of guiding principles and core functions for the proposed network . the meeting discussed the next steps in setting up the network and agreed that a small interim committee would work together with who in identifying and implementing initial activities . these activities included finalisation of the framework document for a goarn , establishment of a code of practice for network operations , for field operations and for conflict resolution , and agreeing on the guiding principles for international outbreak alert and response ( who , 2000c ) . in addition , and in collaboration with who , a number of essential components were developed to support deploying people in the field and improving coordination , including linkages to the who event management system for epidemics , development of field logistics capability , including field kits and tools , and a mobile communications system the latter an important component to ensure the safety and security of personnel in the field . in may 2001 , the wha adopted a resolution and report on global health security : epidemic alert and response that recognised who 's leadership and efforts in creating goarn as a cost - effective , coordinating mechanism for epidemic alert and response and as a partnership to ensure that the best expertise is harnessed wherever and whenever it is needed . in addition , it recognised that acute responses may lead to longer - term technical assistance and preparedness for outbreaks ( who , 2001 ) . in its original conception , goarn is a network of technical partners and other surveillance networks which would be coordinated and supported by who , and with a steering committee reflecting the make - up of technical institutions and disciplines needed for comprehensive outbreak response . thus the participating technical institutions and networks comprise the membership of goarn , not individuals . the original concept of goarn was that it was to be a partnership of major technical institutes with who . it was also agreed that who would provide the secretariat to support the steering committee and provide operational support to develop the network , and in collaboration with staff in relevant who departments , programmes and offices , to provide communications support and advocacy for the network , and to coordinate and support field missions and response activities . in addition , who would mobilise and provide much of the financial support for goarn . these activities place who at the centre of the core functioning of the network , and thus questions could be raised about the relative independence of the network , and specifically whether who 's role is as one of the partners in the network , or whether goarn should be considered as a more formal initiative of who . the majority of partners , when approached during an external review of goarn , believed that the balance between integration into who 's operations and network independence was about right , and most recognised who as the dominant partner . goarn is thus recognised by who as the body able to provide the broad technical expertise necessary to enable it to assist member states with outbreak response , and more recently , as the operational arm of the new international health regulations ( ihr ; 2005 ) . these issues have been discussed elsewhere by ansell , sondorp , and stevens ( 2012 ) . the initial interim committee was established to develop and propose governance mechanisms , rules and procedures to reflect the make - up and guiding principles of the network . since then , the steering committee has provided direction to the network through monitoring the implementation of the network 's work plan , setting up technical working groups , and approving new member institutions in the network . in early meetings , the steering committee monitored the operation and outcomes of field missions and used these reviews to provide important suggestions for future deployments . as the number of missions increased , and financial pressures made it difficult to maintain the frequency of meetings , the steering committee has focused primarily on providing advice on the development of the network . over the past 13 years , the number of technical partners and participating networks has grown substantially and now numbers 153 institutions and 37 additional networks ( figure 1 ) , the latter encompassing a further 355 members , which together provide a wide geographic reach and broad representation of technical skills and disciplines . partners include government agencies , universities , research institutes , training programmes and networks , non - governmental organisations ( ngos ) , international organisations and a range of related specialist networks , especially those concerned with laboratory investigations , infection prevention and control , clinical management , and who networks managing chemical , environmental and food safety events . the figures in boxes provide the number of partners and network hubs in each who region ( amro = regional office of the americas ; afro = african regional office ; euro = european regional office ; emro = eastern mediterranean regional office ; searo = south - east asian regional office ; wpro = western pacific regional office ) . as goarn established a reputation for competency in major outbreak responses through the provision of technical , multi - disciplinary expertise and grew in recognition ( lazcano - ponce , allen , & gonzlez , 2005 ) , it became increasingly important to ensure access to additional capacity in specific areas of expertise and to individuals with the requisite language skills and to incorporate a wider geographic representation of partners . there has therefore also been a concerted effort over recent years to ensure that the network 's composition is as broad as possible , through engaging technical partners in more countries and regions . this is both consistent with the principle of bringing the most proximate resources to bear as rapidly as possible and leveraging network activities to develop as well as employ partner institutional capacity . while this has been generally successful , there are still gaps that need to be filled over coming years . there has been a continual emergence and resurgence of epidemic - prone infectious diseases and of novel , previously unrecognised emerging diseases that threaten global health and economic stability , many of which have resulted in goarn missions to affected member states and regions ( breiman et al . , 2003 ; formenty et al . , 2005 ; mackenzie , 2011 ; mackenzie et al . , 2004 ) . since 2000 , who has supported and coordinated the network activities to provide an operational framework for goarn partners to respond to major outbreaks of cholera , dengue , encephalitis , influenza , meningitis , nipah , plague , severe acute respiratory syndrome ( sars ) , viral haemorrhagic fevers ( vhf ) , yellow fever and other emerging and epidemic - prone pathogens . partners have also provided experts for deployment to assist in addressing infectious disease impacts of major humanitarian crises , including natural disasters . overall , goarn partners have been deployed on 137 missions , comprising 1471 deployments and 31,629 person days ( table 1 ) in 79 countries , territories or areas ( table 2 ) . in keeping with the guiding principles agreed by partners , all missions have been to support national health authorities and were initiated at the invitation or request of the affected who member state(s ) . however , these missions have also influenced the development of local , national and international capacities and supported more long - term initiatives and relationships . alerts , requests for assistance , operational updates , offers of technical support and details of deployments ( in clinical management , epidemiology , infection control , laboratory support , social mobilisation , risk communications and logistics ) are posted on the goarn sharepoint website , which also provides a mechanism to assist in communications between the operational support team and goarn partners . partner institutions able to respond to requests for assistance nominate expert staff members for deployment , based on a number of factors including expertise in the areas specified by the health authorities in the affected country and appropriate language skills . in most instances terms of reference for field missions and individual deployments are negotiated and agreed in advance with the responsible health authorities in affected countries and the framework . the number of deployments of who and non - who personnel and their fields of expertise are shown in figure 2 . in the first years of goarn operation , field missions were largely in response to outbreaks of disease in single countries , particularly outbreaks of vhf in african countries . these missions sometimes required significant numbers of deployments before the outbreak ended , as occurred during the 2000 outbreak of ebola in gulu , uganda ( lamunu et al . other outbreaks focused on unusual manifestations , such as the high death rate from an outbreak of influenza in madagascar ( who - goarn investigation team , 2002 ) . the first major test of the resilience of the network came in 2003 with the multi - country response to the emergence of sars , the first global threat by a novel agent in the new millennium . goarn played a significant role in the rapid deployment of international teams for missions to china , hong kong sar , vietnam and singapore , as well as supporting the participation of a large number of experts from partner institutions in virtual networks which were rapidly established to investigate the novel , previously unknown infectious agent as well as its epidemiology , infection control and clinical course of disease . the role of who and the contribution of goarn partners has been discussed in detail elsewhere ( heymann , 2004 ; mackenzie et al . , 2004 ; who , 2006 ) . the sars global response provided important lessons for the teams at who regional offices , particularly the regional office for the western pacific ( wpro ) , and at who headquarters , as well as goarn partners . sars highlighted the technical and operational challenges of identifying and deploying international teams to respond simultaneously to requests for assistance from multiple countries . the contribution of goarn partners to controlling sars was recognised by the wha , which urged the member states to continue to collaborate with and , when appropriate , provide assistance to who 's goarn as the operational arm of the global response , and requested the director general to strengthen the functions of who 's global outbreak alert and response network ( who , 2003 ) . additional multi - country and/or prolonged responses have occurred in the past few years , including for highly pathogenic avian influenza ( h5n1 ) ( dinh et al . , 2006 ; who , 2007 ) , for pandemic h1n1 influenza and for cholera outbreaks in zimbabwe ( who , 2009 ) and haiti ( who , 2010 ) . goarn partners also provided assistance to health authorities in indonesia and sri lanka following the asian tsunami . in indonesia , this assistance was provided to support the aceh provincial health office to develop a surveillance / early warning and response network system for the detection of epidemic - prone diseases ; to investigate outbreaks , with confirmation of potential pathogen , mode of transmission and individuals at risk , and appropriate control measures ; and to prepare for outbreak management and control ( ministry of health , indonesia , who assisted by goarn partners , unicef , 2005 ) . increasingly , who regional offices play a critical role in the coordination and deployment of goarn teams , in close collaboration with the operational support team at who headquarters . important disease outbreaks , including leptospirosis in the philippines , cholera in papua new guinea , viral haemorrhagic fevers ( vhf ) outbreaks in african countries and outbreaks of h1n1 in mexico and central and south america have been important catalysts for this change . one important outcome from goarn deployments has been the successful development of field laboratories for haemorrhagic fever outbreaks . the use of a field laboratory to provide rapid diagnosis was first successfully employed by the centers for disease control and prevention ( cdc ) during the ebola outbreak in gulu , uganda , in 20002001 , using antigen capture and reverse transcription - polymerase chain reaction ( rt - pcr ) to diagnose infection in suspect patients and based in one of the two major hospitals in gulu ( centres for disease control and prevention [ cdc ] , 2001 ; okware et al . , 2002 the same laboratory also assisted in the rapid diagnosis of patients in a secondary outbreak in masindi , 170 km south of gulu ( borchert et al . , 2011 ) . the success of the laboratory in gulu prompted further developments in truly mobile laboratories for the diagnosis of haemorrhagic fever cases and to assist epidemiological surveillance , and two novel mobile laboratories were subsequently employed successfully during the marburg virus outbreak in angola in 2005 , with one laboratory in uige , the epicentre of the outbreak , operated by the public health agency of canada ( grolla et al . , 2011 ) using quantitative real - time pcr , and a second laboratory operated by cdc in the capital , luanda , using a new , safe , rapid and reliable high - throughput protocol for rna extraction and quantitative rt - pcr analysis ( towner , sealy , ksiazek , & nichol , 2007 ) . there was a high concordance in test results between the two laboratories , strongly suggesting that field capacity should be enhanced and expanded and be an essential component in future outbreak investigations . a large , shipping container - sized mobile laboratory was developed by members of the universiti malaysia sarawak and successfully deployed to meulaboh , aceh province , during the tsunami relief activities . among the early initiatives of the steering committee was the recognition that while the network 's partners represented a large body of expertise in epidemiology , microbiology or clinical management , there was relatively limited expertise in team leadership and overall coordination of response . to address this gap , the goarn partners and who developed training courses in international outbreak response leadership . subsequently , who regional offices and headquarters provided further training courses , primarily to develop regional capacity for international response . a faculty drawn from goarn partners and from across who has developed and adapted training material , and provided training on field team leadership , management of complex international outbreak response , disease - specific scenarios and rapid containment operations . in the western pacific region , goarn partners and who have collaborated in innovative training approaches and pilot courses . these activities have supported the development of a goarn training faculty and provided a cadre of trained experts in different technical areas of outbreak response . this resource represents an important asset on which to build future response capacity and improve performance in the field . the revised ihr ( 2005 ; who , 2008 ) came into force in mid-2007 and have a number of implications for goarn operations and activities . the purpose and scope of the ihr 2005 are to prevent , protect against , control and provide a public health response to the international spread of disease in ways that are commensurate with and restricted to public health risks , and which avoid unnecessary interference with international traffic and trade ( art . the revised regulations require the states parties to develop specific minimum core public health capacities for surveillance and response , and specifically with regard to surveillance , reporting , notification , verification , response and collaboration activities ( ihr annex 1 ) . the ihr also reaffirmed the central role of who in assisting countries in controlling the international spread of infectious diseases , stating that who shall , at the request of a state party , provide technical guidance and assistance including the mobilisation of international teams of experts for on - site assistance ( art . 13.3 , ihr 2005 ) , and the offer to mobilise international assistance in order to support the national authorities in conducting and coordinating on - site assessments ( art . 13.4 , ihr 2005 ) , both of which would be largely undertaken through goarn . for goarn partners , the revised ihr have resulted in a significant change with respect to the increased sensitivity about rapid information sharing on acute public health events . confidentiality requirements implicit in the revised ihr led to the discontinuation of the who outbreak verification list ( ovl ) . prior to the ihr ( 2005 ) , the ovl was published weekly as a source of information on disease outbreaks provided by who . the ovl was disseminated to subscribers , including who staff worldwide , un agencies , national health authorities , who collaborating centres , field epidemiology programmes and ngos , many of which were also goarn partners at the time ( grein et al . , 2000 ) . to reinforce information flows among goarn and to ensure the network 's capacity to respond rapidly to requests for assistance , the operational support team developed a sharepoint website to provide partners with alerts and details of requests for assistance , together with information on mission planning and deployments , and to support coordination and information sharing on the involvement of partners in ongoing outbreak response . goarn partners do not have privileged access to confidential information that who shared with national focal points for the ihr ( 2005 ) . the sharepoint site is also used to share relevant information on goarn activities not related to specific events , such as meetings of the steering committee and its working groups . as countries make progress towards attaining core national capacities in detection , verification and surveillance , there is an expectation that this increasing self - sufficiency to respond to disease outbreaks and public health events ( art.13.1 , ihr 2005 ) will impact the type and nature of future requests for international assistance to who , the nature of international collaboration to address emerging disease threats and the support of goarn partners . in may 2012 , the wha discussed progress on implementation of the ihr 2005 . in light of the gaps which remain in core capacities and the continuing concern about epidemic and pandemic prone diseases and public health events of international concern , the member states and who renewed their commitment to the full implementation of the regulations . the performance of goarn has recently been subject to an external independent review and evaluation commissioned by the steering committee ( sondorp , ansell , stevens , & denton , 2011 ) . it concluded that over its initial 9 years , goarn had proved to be a capable and effective mechanism for multilateral responses to disease outbreaks through improving field coordination and by rapidly deploying experts when and where needed . in addition , the report of the review committee on the functioning of the ihr ( 2005 ) in relation to influenza a ( h1n1 ) pandemic ( who , 2011 ) also concluded that network partners play a vital role in enabling who to fulfil its international alert and response responsibilities . the findings of these two review processes and their recommendations have been supportive of goarn 's core activities with respect to outbreak responses and in humanitarian crises where there was a potential for outbreaks of disease . they also recognise that the network provides important capacity to address aspects of ihr ( 2005 ) implementation . they clearly demonstrate that goarn has been a major asset to who , and the partners have supported who in fulfilling its role of assisting the member states in containing and controlling epidemic - prone and emerging diseases , as well as providing a response mechanism to assist in other public health emergencies . these reviews have suggested that the goarn partnership consider developing new directions and strategies that leverage the assets of partner institutions to ensure the network remains relevant and effective . the core activities concerned with outbreak response will continue , with support for increased regional response activities coordinated by who regional offices and with a greater use of regional partners in deployments . to support this , further partner institutions will be sought to expand the broad geographic range . in addition , partner institutions will be encouraged to assist the member states in capacity - building in order to fully develop core capacities required for compliance in the revised ihr . the breadth of expertise will be expanded to incorporate the capacity to respond to chemical events or toxic additions to food or accidental release into the environment .	the global outbreak alert and response network ( goarn ) was established in 2000 as a network of technical institutions , research institutes , universities , international health organisations and technical networks willing to contribute and participate in internationally coordinated responses to infectious disease outbreaks . it reflected a recognition of the need to strengthen and coordinate rapid mobilisation of experts in responding to international outbreaks and to overcome the sometimes chaotic and fragmented operations characterising previous responses . the network partners agreed that the world health organization would coordinate the network and provide a secretariat , which would also function as the operational support team . the network has evolved to comprise 153 institutions / technical partners and 37 additional networks , the latter encompassing a further 355 members and has been directly involved in 137 missions to 79 countries , territories or areas . future challenges will include supporting countries to achieve the capacity to detect and respond to outbreaks of international concern , as required by the international health regulations ( 2005 ) . goarn 's increasing regional focus and expanding geographic composition will be central to meeting these challenges . the paper summarises some of network 's achievements over the past 13 years and presents some of the future challenges .
You are an expert at summarizing long articles. Proceed to summarize the following text: anterior cervical discectomy and fusion ( acdf ) has been the standard treatment method for a cervical disc disease5 ) . however , there are several problems associated with bone graft and instrument ; subsidence , collapse of graft and mechanical failure . recently , the stand - alone cage is used mostly due to its technical simplicity and comparable fusion rate to that of autologous iliac bone grafting with or without anterior plating7,30,31 ) . moreover , there is no need to spend time in harvesting autologous bone and applying anterior plate . however , problems associated with subsidence and local kyphosis at the index level ( segmental kyphosis ) still persist with standalone cage and a standard method would be beneficial in some cases1,2,8,9,10,11,13,14,20,26,29 ) . it seems that harvest of autologous bone and anterior plating procedure are time consuming ones , but such comparison has not been performed . the aim of this retrospective study was to compare the operating time between patients who underwent acdf with stand - alone cage and with a standard method . from june 2009 to april 2011 , patients who had acdf for treatment of single - level cervical disc disease causing radiculopathy or myelopathy were included in the study . these patients were included in clinical trial ( www.clinicaltrials.gov , nct01011569 ) to compare clinical and radiological efficacy of stand - alone cage versus anterior plating with autologous iliac bone graft for single - level cervical disc disease . two surgeons participated in the clinical trial and a random number table assigned the method of fusion ( stand - alone cage or anterior plating with autologous iliac bone graft ) . patients with radiculopathy or myelopathy due to disc herniation , osteophyte formation , or hypertrophied posterior longitudinal ligament were recruited for this study . patients who had surgery in neck area , radiotherapy , severe myelopathy ( nurick grade poorer than3,17 ) , severe osteoporosis ( t < -3.0)24 ) , risk factors for osteoporosis ( e.g. , history of long - term steroid usage or renal failure ) , ossified posterior longitudinal ligament in any cervical spine level , previous history of surgery for the cervical spine , or systemic infection or malignancy were excluded from the clinical trial . the surgeon was informed on the day of the operation as to what fusion method was to be used by the physician assistant ( registered nurse ) , who did not participate in the operation and analysis of data . finally , twenty - nine patients , performed acdf by a single surgeon ( kch ) from incision to closure , were selected in this retrospective study . seventeen patients ( m : f=9:8 ; age , 55.711.8 years ; ranges 35 - 85 ) had operated on with stand - alone cage ( group i ) and twelve patients ( m : f=9:3 ; age , 62.212.6 years ; ranges 48 - 77 ) had with anterior plating with autologous iliac bone graft ( group ii ) . the operated levels were c3 - 4 in 4 patients , c4 - 5 in 5 , c5 - 6 in 5 and c6 - 7 in 3 patients in group i and c3 - 4 in 3 , c4 - 5 in 2 , c5 - 6 in 4 and c6 - 7 in 3 in group ii . unfortunately , neck thickness , which may be correlated with neck thickness and prolong operative time , was not measured . instead preoperative work - ups included plain x - rays ( standing anterior - posterior , lateral neutral , lateral flexion , and lateral extension view ) , computed tomography ( ct ) , and magnetic resonance ( mr ) imaging . after the operation , the patients were scheduled to visit an outpatient clinic at 1 , 3 , 6 , and 12 months and yearly thereafter . the patients had plain x - rays taken ( standing anterior - posterior , lateral neutral view , lateral flexion , and lateral extension view ) at every visit . the average follow - up period was 10.66.3months and 11.35.9 months in group i and ii , respectively . clinical outcome was assessed by odom 's criteria ( excellent , good , fair and poor)32 ) . operative time , estimated blood loss , cervical curvature ( ca ) , segmental angle at the operated level ( sa ) , fusion rate and subsidence rate was compared between groups . the anesthetic record was reviewed to calculate operative time from incision to closure and estimated blood loss . as mentioned , all operative procedures were performed by a single surgeon from incision to closure including iliac bone harvest . estimated blood loss was assessed by anesthesiologist 's recording . the angle of the cervical curvature ( ca ) between c2 and c7 was measured in the plain x - ray by using tangential method2,14 ) . the segmental angle at the index level ( sa ) was measured in the plain x - ray by using cobb 's method between the superior endplate of the cephalic and inferior endplate of the caudal vertebra of the operated segment13,14 ) . subsidence was defined as a decrease of the vertical anterior or posterior height by more than 3 mm1,12,25,27,30 ) . the operated segment was deemed to be fused if there was less than 2 of motion at the operated segment on a dynamic view6 ) . additionally , the radiological images of group i were evaluated - using the classification of anterior fusion proposed by vavruch et al28 ) . in this classification ; type 1a is defined as bridging bone anterior and through the disc space ; 1b as bridging bone anterior but not through the disc space ; 2a as bridging bone not anterior but through the disc space ; and 2b as no bridging bone at all . the radiological outcomes were classified as ' non - fusion ' if 2b healing was observed and as ' fusion ' if 1a , 1b , or 2a healing was observed at the levels subjected to the surgery6,28 ) . bony fusion of group ii was defined as ' fused with remo deling and trabeculae present'18 ) or ' graft intact , not fully remodeled and incorporated , but no lucency present ' , according to the bridwell criteria ( criteria i or ii).3 ) if lucency or collapse / resorption of the graft was present , this was regarded as indication no fusion ( criteria iii or iv)3 ) . the institutional review board at our hospital approved this study ( d-0804 - 044 - 004 ) . a standard anterior - medial approach was used in all 29 cases . after applying caspar screws at the index level then the anterior longitudinal ligament ( all ) and annulus were cut and the disc was removed with pituitary forceps and curette . the posterior longitudinal ligament was removed in all cases and decompression of the spinal cord and nerve root was confirmed . for fusion with stand - alone cage , the size of the cage ( mc+ , ldr medical , france or solis , stryker , usa ) was determined after inserting a trial cage . the cage was filled with allomaterial ( a type 1 collagen / hydroxyapatite matrix ; healos , depuy spine , usa ) soaked with autologous bone marrow aspirated from the iliac crest . an adequate - sized implant was inserted into the disc space with gentle tapping . for fusion with anterior plating and autologous bone graft , tri - cortical autologous iliac bones was harvested from left or right anterior superior iliac spine with a 1.5 cm incision of the skin , using an oscillating saw . a semi - constrained type of anterior plate ( atlantis , medtronic sofamor danek , usa ) was applied with variable angled screws . after finishing the instrumentation , the wound was closed in a layer - by - layer fashion after inserting a closed drain . mann - whitney 's u test was used for comparison of continuous and non - parametric values , and chi - square test and fisher 's exact test were used for categorical data or values respectively . all statistical analyses were done using spss ( version 17.0 , spss , chicago , il , usa ) , and statistical significance was defined as p<0.05 . from june 2009 to april 2011 , patients who had acdf for treatment of single - level cervical disc disease causing radiculopathy or myelopathy were included in the study . these patients were included in clinical trial ( www.clinicaltrials.gov , nct01011569 ) to compare clinical and radiological efficacy of stand - alone cage versus anterior plating with autologous iliac bone graft for single - level cervical disc disease . two surgeons participated in the clinical trial and a random number table assigned the method of fusion ( stand - alone cage or anterior plating with autologous iliac bone graft ) . patients with radiculopathy or myelopathy due to disc herniation , osteophyte formation , or hypertrophied posterior longitudinal ligament were recruited for this study . patients who had surgery in neck area , radiotherapy , severe myelopathy ( nurick grade poorer than3,17 ) , severe osteoporosis ( t < -3.0)24 ) , risk factors for osteoporosis ( e.g. , history of long - term steroid usage or renal failure ) , ossified posterior longitudinal ligament in any cervical spine level , previous history of surgery for the cervical spine , or systemic infection or malignancy were excluded from the clinical trial . the surgeon was informed on the day of the operation as to what fusion method was to be used by the physician assistant ( registered nurse ) , who did not participate in the operation and analysis of data . finally , twenty - nine patients , performed acdf by a single surgeon ( kch ) from incision to closure , were selected in this retrospective study . seventeen patients ( m : f=9:8 ; age , 55.711.8 years ; ranges 35 - 85 ) had operated on with stand - alone cage ( group i ) and twelve patients ( m : f=9:3 ; age , 62.212.6 years ; ranges 48 - 77 ) had with anterior plating with autologous iliac bone graft ( group ii ) . the operated levels were c3 - 4 in 4 patients , c4 - 5 in 5 , c5 - 6 in 5 and c6 - 7 in 3 patients in group i and c3 - 4 in 3 , c4 - 5 in 2 , c5 - 6 in 4 and c6 - 7 in 3 in group ii . unfortunately , neck thickness , which may be correlated with neck thickness and prolong operative time , was not measured . instead preoperative work - ups included plain x - rays ( standing anterior - posterior , lateral neutral , lateral flexion , and lateral extension view ) , computed tomography ( ct ) , and magnetic resonance ( mr ) imaging . after the operation , the patients were scheduled to visit an outpatient clinic at 1 , 3 , 6 , and 12 months and yearly thereafter . the patients had plain x - rays taken ( standing anterior - posterior , lateral neutral view , lateral flexion , and lateral extension view ) at every visit . the average follow - up period was 10.66.3months and 11.35.9 months in group i and ii , respectively . clinical outcome was assessed by odom 's criteria ( excellent , good , fair and poor)32 ) . operative time , estimated blood loss , cervical curvature ( ca ) , segmental angle at the operated level ( sa ) , fusion rate and subsidence rate was compared between groups . the anesthetic record was reviewed to calculate operative time from incision to closure and estimated blood loss . as mentioned , all operative procedures were performed by a single surgeon from incision to closure including iliac bone harvest . the angle of the cervical curvature ( ca ) between c2 and c7 was measured in the plain x - ray by using tangential method2,14 ) . the segmental angle at the index level ( sa ) was measured in the plain x - ray by using cobb 's method between the superior endplate of the cephalic and inferior endplate of the caudal vertebra of the operated segment13,14 ) . subsidence was defined as a decrease of the vertical anterior or posterior height by more than 3 mm1,12,25,27,30 ) . the operated segment was deemed to be fused if there was less than 2 of motion at the operated segment on a dynamic view6 ) . additionally , the radiological images of group i were evaluated - using the classification of anterior fusion proposed by vavruch et al28 ) . in this classification ; type 1a is defined as bridging bone anterior and through the disc space ; 1b as bridging bone anterior but not through the disc space ; 2a as bridging bone not anterior but through the disc space ; and 2b as no bridging bone at all . the radiological outcomes were classified as ' non - fusion ' if 2b healing was observed and as ' fusion ' if 1a , 1b , or 2a healing was observed at the levels subjected to the surgery6,28 ) . bony fusion of group ii was defined as ' fused with remo deling and trabeculae present'18 ) or ' graft intact , not fully remodeled and incorporated , but no lucency present ' , according to the bridwell criteria ( criteria i or ii).3 ) if lucency or collapse / resorption of the graft was present , this was regarded as indication no fusion ( criteria iii or iv)3 ) . the institutional review board at our hospital approved this study ( d-0804 - 044 - 004 ) . a standard anterior - medial approach was used in all 29 cases . after applying caspar screws at the index level fluoroscopic image was taken to confirm operated level . then the anterior longitudinal ligament ( all ) and annulus were cut and the disc was removed with pituitary forceps and curette . the posterior longitudinal ligament was removed in all cases and decompression of the spinal cord and nerve root was confirmed . for fusion with stand - alone cage , the size of the cage ( mc+ , ldr medical , france or solis , stryker , usa ) was determined after inserting a trial cage . the cage was filled with allomaterial ( a type 1 collagen / hydroxyapatite matrix ; healos , depuy spine , usa ) soaked with autologous bone marrow aspirated from the iliac crest . an adequate - sized implant was inserted into the disc space with gentle tapping . for fusion with anterior plating and autologous bone graft , tri - cortical autologous iliac bones was harvested from left or right anterior superior iliac spine with a 1.5 cm incision of the skin , using an oscillating saw . a semi - constrained type of anterior plate ( atlantis , medtronic sofamor danek , usa ) was applied with variable angled screws . after finishing the instrumentation , the wound was closed in a layer - by - layer fashion after inserting a closed drain . mann - whitney 's u test was used for comparison of continuous and non - parametric values , and chi - square test and fisher 's exact test were used for categorical data or values respectively . all statistical analyses were done using spss ( version 17.0 , spss , chicago , il , usa ) , and statistical significance was defined as p<0.05 . there were no differences in sex distribution ( p=0.28 , fisher 's exact test ) and age ( p=0.08 ; mann - whitney 's u test ) . the bmi of group i was 24.63.3 kg / m and the bmi in group ii was 24.22.7 kg / m ( p=0.97 ; mann - whitney 's u test , table 1 ) . in terms of surgical complication , there was no case of instrumentation associated problem during the operation and there was no case of malposition of instrument ( cage , plate and screws ) , surgical infection , and mechanical failure , such as cage migration or screw pull - out / breakage during the follow - up period . operation took 96.128.7minutes ( range , 55 - 165 ) in group i and 112.431.7 minutes ( range , 65 - 170 ) in group ii . the operation time was not statistically different between groups ( p=0.13 , mann - whitney 's u test ) ( table 2 and fig . ebl was 65.065.1ml ( range , 10 - 200 ) in group i and 80.065.6 ml ( range , 10 - 200 ) in group ii without statistical difference ( p=0.45 , mann - whitney 's u test ) ( table 2 , fig . clinical and radiological outcome were assessed for patients followed up more than 3 months and oen patient was excluded in each group . by odom 's criteria , excellent or good outcome was achieved in 11/16 and 7/11 patients of group i and ii , respectively without statistical difference between groups ( p=1.00 , fisher 's exact test , table 2 ) . preoperative and postoperative ca and sa were not different between groups ( p>0.05 , table 2 ) . solid bony fusion was observed in 15/16 and 10/11 patients of group i and ii , respectively ( table 2 ) . recent studies showed that clinical results were similar in comparative studies between the stand - alone cage and anterior plating9,12,20,22,30,31 ) . however , radiological outcome was not similar and a number of studies have pointed out the occurrence of subsidence and kyphosis after the use of a stand - alone cage in up to 45% of patients , although those were not correlated with poor clinical outcomes during their follow - up periods4,6,7,12,15,16,19,30,31 ) . taking those results together , probably , there may be some patients who need a standard surgical method . actually , harvesting iliac bone and supplemental anterior plating may not be preferred method for some surgeons , due to donor site complication and mechanical problem associated with plating2,22,23 ) . we performed retrospective study to compare surgical time of two different acdf methods for single - level cervical disc disease ; stand - alone cage vs. a standard method ; autologous iliac bone graft with anterior plating . in the present study , the clinical outcome and radiological outcome , which was assessed by odom 's criteria , cervical curvature , segmental angle , fusion rate and subsidence rate , were not different between groups . however , this result , obtained in a small group , harbors a great chance of bias . for the surgical time , it may be meaningful because the operation method was randomized and all surgeries were performed by a single surgeon from incision to closure . the mean operation time was longer in group ii than group i without statistical difference . although , there was no statistical difference , it seemed that 16 minutes was used for anterior plating and bone harvesting . however , we should admit that measuring ebl by anesthetic record would be error - prone due to unmeasured insensible loss . at least , it seemed that a standard surgical method is not a time - consuming procedure . first , the result was obtained in small groups and there was a chance of type i ( alpha ) error . second , fluoroscopic image was not taken during anterior plating . the length of screws was measured before operation and fluoroscopic image was usually taken once to confirm operation level . if screws were inserted under fluoroscopic guidance , the operation time would be increased . although malposition of screw or plate did not observed in the present study , fluoroscopic guidance may be necessary for multi - level instrumentation . moreover , additional bleeding of 15ml occurred during bone harvest and it may significantly increase with long - bone harvest for multi - level fusion . therefore , for multi - level surgery , autologous bone harvest and anterior plating may be less time - efficient and more bleeding - prone procedure . moreover , we did not considered short - term surgical morbidity such as donor site pain and dysphagia , because those were not the point of interest in the present study . acdf with a standard method for single - level cervical disc disease was not a time - consuming procedure comparing standalone cage . when standard method seems to be beneficial in some cases , there may be no need to hesitate due to timeefficiency .	objectiveautologous bone graft with anterior plating had been a standard method for anterior cervical discectomy and fusion ( acdf ) . drawbacks of a standard method were donor site problem and problem associated with anterior plate . the stand - alone cage was introduced to reduce such problems . however , problems associated with subsidence and local kyphosis at the index level ( segmental kyphosis ) still persist with stand - alone cage and a standard method would be required in some cases . it seems that harvest of autologous bone and anterior plating procedure is time consuming , but this has not been verified . the aim of this study was to compare the operating time between patients operated on with stand - alone cage versus a standard method for single - level cervical disc disease.methodsconsecutive 29 patients ( m : f=18:11 ; mean age , 58.412.4 years ) , who had undergone acdf for single - level disc disease by a single surgeon from incision to closure during 2009 - 2011 , were selected for this retrospective study . seventeen patients were operated with stand - alone cage ( group i ) , and twelve patients were with a standard method ( group ii ) . operating time ( from incision to closure ) , estimated blood loss , clinical and radiological outcomes were compared . follow - up period was 11.46.3 months.resultsoperating time was not different between groups longer ; group i ( 96.128.7 minutes ) and group ii ( 112.431.7 minutes ) ( p=0.13 ) . there was no surgery related complication . excellent or good outcome was achieved in 11 and 10 patients of group i and ii , respectively . bony fusion was achieved in 15 and 10 patients of group i and ii respectively , while one subsidence occurred in each group . postoperative segmental angle at the index level and cervical curvature was not different between groups . no patient complained donor site pain at the last follow-up.conclusionsacdf with a standard method for single - level cervical disc disease was not a time - consuming procedure comparing stand - alone cage .
You are an expert at summarizing long articles. Proceed to summarize the following text: acinetobacter baumannii is a non fermentative gram - negative coccobacillus that is emerged as opportunistic nosocomial pathogen . a variety of human infections caused by acinetobacter species have been reviewed including pneumonia ( most often related to endotracheal tubes or tracheostomies ) , endocarditis , meningitis , skin and wound infections , peritonitis ( in patients receiving peritoneal dialysis ) and urinary tract infections ( 1 ) . multidrug - resistant ( mdr ) a. baumannii is increasingly held responsible for nosocomial infections ( 2 ) and plays a significant role in colonization and infection of hospitalized patients and can transmit from patient to patient with direct and indirect contact . the main risk factors of acinetobacter baumannii bacteremia are invasive procedures such as central venous catheterization , mechanical ventilation and surgical procedures . other risks include previous antimicrobial treatment , number of antimicrobial agents prescribed , treatment with carbapenems , cephalosporins or aminoglycosides , prolonged hospital stay , previous icu stay , enteral nutrition ( 3 ) . a. baumannii can develop multiple antimicrobial resistance extremely quickly what is in contrast to other clinical bacteria , which require greater time to acquire resistance , usually in response to therapeutic strategies . general mechanisms of resistance are enzyme - mediated resistance , genetic adaptation , efflux pump and changes in the structure of the outer membrane ( 4 ) . the ability to chronically colonize patients and cause outbreaks which are usually hard to eradicate poses significant challenges to infection control and increases healthcare costs ( 5 ) . the selection and spread of resistant bacteria in hospitals is the biggest threat to patient safety . the consequences of inappropriate antimicrobial treatment are increasing mortality and morbidity , adverse effects , prolonged hospital stay , secondary infection , the emergence of resistant microorganisms and increase of health care costs . effective supervision is cornerstone of national and international efforts to control antimicrobial resistance . monitoring the use of antibiotics , the occurrence and spread of resistant strains of bacteria provides the information and tools that are needed to promote appropriate use of antibiotics at all levels , from local to global . in bosnia and herzegovina there is no established antimicrobial resistance surveillance system and there is no monitoring the influence of antibiotic consumption on development of bacterial resistance . the aim of this study was to examine the impact of antibiotic consumption on development of antimicrobial resistance in acinetobacter baumannii . the study was conducted in university clinical center of sarajevo , isolates of acinetobacter baumannii in period from july 1 2009 to december 31 2012 . isolates were detected from different clinical samples including urine , wound swab , blood , bronchial aspirate and other samples which were collected from patients situated on various hospital wards . identification of acinetobacter baumannii isolates was done on the basis of morphological , cultural and biochemical characteristics . in addition , automated vitek 2 compact system ( biomrieux , marcy ltoile , france ) was used to aid in confirmation of the a. baumannii isolates ( 8) . antimicrobial resistance profile was determined by automated vitek 2 compact system ( biomrieux , marcy ltoile , france ) for : ceftriaxone , ceftazidime , cefotaxim , amikacin , gentamycin , imipenem , meropenem , ciprofloxacin , levofloxacin , trimetoprim - sulfametoksazol , cefepime , piperacilin / tazobactam , colistin , tobramycin . consumption of above mentioned antibiotics was given in standard units ( pill , capsule , or ampoule ) and analyzed according to the recommendations of the esac - net and current atc classification . to better demonstrate the statistical data analysis , the research period is divided into 14 quarterly periods , respectively . results were given as total numbers , proportions , meanssd , and medians with ranges , where appropriate . over the study period , a total consumption of tested antimicrobials was 865,904 pieces , of which quinolones 285601 ( 33% ) , cephalosporin s 3 and 4 generation with 208765 ( 24,1% ) , aminoglycosides 103227 ( 11,9% ) , carbapenems 107092 ( 12,36% ) . antibiotic consumption on quarter ( qtr ) level between 2009 and 2012 , consumption of all antimicrobials increased by 50% ( from 65835 in 2009 to 98272 in 2012 ) . 275316 pieces ( 31,8% ) , then trimethoprim / sulfamethoxazol 155882 ( 18% ) , while the lowest consumption had colistin with 777 ( 0,08% ) pieces , cefotaxime 2155 ( 0,24% ) and piperacillin / tazobactam 4560 ( 0,52% ) pieces , respectively . highest consumption was during 11 quarter ( qtr ) , while the lowest was during 7 quarter ( table 1 ) . over the studied period the highest rate of resistance was to the 3 generation of cephalosporins ( ~96% ) and ciprofloxacin ( 91,87% ) , while there was no resistance to colistin . resistance to imipenem and meropenem increased from 27% and 34% in 1 qtr to 80% in 11 qtr . for piperacillin / tazobactam the increase was from 33% in 1 to 88% in 11 qtr . resistance to amikacin increased from 48,53% in 3 qtr to 86% in 11 qtr , while there was an increase of resistance to tobramycin from 8,5% in 3 qtr to 16% in 13 otr . there was slightly derease of resistance to gentamicin from 85,9% in 3 qtr to 64% in 13 qtr respectively ( table 2 , figure 1 and 2 ) . an overall resistance of acinetbacter baumannii to antimicrobials during the observed period percentage of a.baumannii isolates resistant to particular antibiotics in the observed period . pearson s correlation test showed no significant correlation between the resistance of acinetobacter baumannii and consumption of antimicrobials , except with gentamicin . the positive , statistically significant correlation was demonstrated between gentamicin consumption and emerging of resistance ( p = 0.023 ) ( table 3 ) . correlation between the incidence of resistant a.baumannii forms and consumption of certain antibiotics in the examined period our results showed that acinetobacter baumannii is among the most resistant bacteria and antimicrobial ssusceptibility testing pointed that it is a multidrug - resistant bacteria . this was confirmed and similar by results of authors from italy ( 10 ) , slovakia ( 11 ) , greece ( 12 ) . resistance to imipenem and meropenem increased from 27% and 34% in 1 quarter to 80% in 11 qtr . according to information from the croatian committee for antibiotic resistance surveillance of the cams , resistance of clinical isolates of abc to carbapenems in croatia from 2006 to 2011 ranged from 2% for imipenem and 11% for meropenem in 2006 , to 64% in 2011 ( 13 ) , and in larger hospitals is 90% ( 13,14 ) . the resistance of acinetobacter baumannii to carbapenems , mostly to imipenem , has been the topic of various papers , and the published data on the resistance rates to imipenem have reported from 21% up to 100% of the tested isolates of a. baumannii ( 15 , 16 , 17 ) . among the european countries the resistance rates to carbapenems are highest in the countries in southern europe , such as greece and croatia ( 14 , 19 ) . over the study period we observed increased consumption of carbapenem antibiotics what resulted in increasing resistance on carbapenems in acinetobacter baumannii . highest consumption of imipenem and meropenem was in 11 quarter and in the same period the highest resistance to carbapenems was observed , but there was no correlation between resistance and consumption by pearson correlation test . carbapenem justified use in esbl isolates ( eng . extended spectrum -lactamase ; esbl ) reflected to the resistance of nonfermentative bacteria primarily a. baumannii ( 18 ) . if we compare the resistance of imipenem and meropenem we can find that through all 14 quarters greater resistance was to meropenem . this is similar to the data of committee for antibiotic resistance surveillance in the republic of croatia for the period 2002 - 2008 , where the difference in sensitivity within the carbapenem antibiotics group was observed and almost all microbiological laboratories had a higher percentage of resistant isolates of a. baumannii to meropenem over imipenem ( 13 ) . average resistance to the 3 generation of cephalosporins is ~ 95% , 97% to ciprofloxacin and to cefepime 76% . medic et al . found that the resistance to cephalosporins third and fourth generations as well as ciprofloxacin was greater than 93% ( 19 ) . acinetobacter baumannii isolates are often susceptible only to colistin or tigecycline . over the study period sentry antimicrobial surveillance from 2001 to 2011 , which includes different centers in usa , europe , south america and asia , showed that colistin resistance was on low level ( 0.9%3.3% ) ( 20 , 21 ) . according to data collected by the european regional branch of study monitoring resistance in 2011 , followed by the antimicrobial resistance in 21 countries of europe including belgium , bulgaria , croatia , czech republic , france , germany , etc , acinetobacter was less susceptible to all antibiotics except colistin . in the european component of the regional resistance surveillance study for 2011 , a total of 21 countries were monitored for antimicrobial resistance patterns including belgium , bulgaria , croatia , czech republic , france , germany , greece , ireland , italy , poland , portugal , russia , slovenia , spain , sweden , united kingdom etc . acinetobacter was generally less susceptible , except against col ( 99.299.6% s ) and tig ( 95.0% inhibited at 2 g / ml ) ( 22 ) . application of pearson s correlation to the resistance of acinetobacter baumannii compared to consumption of certain antibiotics not found a significant correlation between these two variables in all tested antibiotics , except with to gentamicin where a positive , statistically significant correlation ( p = 0.023 ) was proven . pearsons correlation test showed no significant correlation between the resistance of acinetobacter baumannii and consumption of antimicrobials , except with gentamicin . the positive , statistically significant correlation was demonstrated between gentamicin consumption and emerging of resistance ( p = 0.023 ) . there are a lot of studies about relationship between consumption of antimicrobial agents and developing of resistance . found a positive correlation between aminoglycoside consumption and resistance to gentamicin in escherichia colli and klebsiella pneumonia ( 23 ) . h jin et al . found that gentamicin usage was significantly correlated with resistance in acinetobacter baumannii to this drug ( 24 ) . increase in the antimicrobial use in university clinical center of sarajevo was followed with an increase in resistance of acinetobacter baumannii isolates . the fastest development of resistance has been to carbapenems , while there was no resistance to colistin . monitoring of antibiotic resistance and consumption is of a great importance in order to reduce the emergence and spread of antimicrobial resistant organisms in the health care settings .	aim : the aim of this study was to examine the impact of antibiotic consumption on development of antimicrobial resistance in acinetobacter baumannii.material and methods : the study was conducted in university clinical center of sarajevo . in our retrospective study acinetobacter baumannii isolated in period from july 1st 2009 to december 31st 2012 . isolates were detected from different clinical samples including urine , wound swab , blood , bronchial aspirate and other samples which were collected from patients situated on various hospital wards . clinical isolates belonged to one per patient in a given period of time.results:antimicrobial resistance was interpreted according to clsi breakpoints . consumption of antibiotics was analyzed according to recommendations of the esac - net and current acinetobacter baumannii classification . pearson s correlation showed a positive correlation between gentamicin consumption and emerging of resistance ( p = 0.023).conclusion : increase in the antimicrobial use was followed with an increase in resistance of acinetobacter baumannii isolates . monitoring of antibiotic resistance and consumption is of a great importance in order to reduce the emergence and spread of antimicrobial resistant organisms in the health care settings .
You are an expert at summarizing long articles. Proceed to summarize the following text: motor and cognitive - perceptual disability could occur in patients who have suffered brain damage from a stroke , which could undermine their capacity to perform daily activities1 . carr and shepherd suggested task - oriented training as a treatment method to help improve deteriorated motor skills of stroke patients and their capacity to perform daily activities , and diverse functional activities properly applied to patients can help improve their actual motor skills and capacity to perform daily activities2 . task - oriented training refers to programs that focus on special functional tasks that unite the muscular skeletal system and nervous system3 and treatments that encourage active participation and focus on functional tasks rather than simple , repetitive training of normal motion patterns4 . research on task - oriented training has been active lately , but application of new research results in the clinical environment is impractical because most patients are hospitalized for short periods and programs often have long application periods , which are usually longer than three weeks5 . thus , the aim of this research was to determine the treatment effect of a short period of task - oriented training ( two weeks ) on upper extremity function and performance of daily activities in chronic stroke patients . the subjects of this research were two patients diagnosed with hemiparalysis from stroke and hospitalized in k korean hospital . the general characteristics of the subjects are noted in table 1table 1.general characteristics of the subjectsagegenderdiagnosisaffected sidedominant handmonths from stroke onsetmmse - kparticipant 138maleischemiclt.rt.2438participant 254maleischemiclt.rt.3654 . subject one was a 38-year - old male who was diagnosed with middle cerebral artery infarction and left hemiparalysis and had been hospitalized for 24 months . subject two was a 54-year - old male who was diagnosed with middle cerebral artery infarction and left hemiparalysis and had been hospitalized for 29 months . subjects one and two were both naturally right - handed before their strokes and receiving conservative physical therapy and work treatment for 30 minutes a day , five times a week . the patients volunteered to participate and understood the objectives and contents of this study , and both showed a willingness to actively participate in the study . the patients and their guardians signed an informed consent form after receiving information about the purpose and methods of the study . also , the study was approved by the inje university faculty of health science human ethics committee . the inclusion criteria for the research subjects were as follows : diagnosis of cerebral infarction , reasonable communication skills and 24 points or more on the mini - mental status examination for koreans ( mmse - k ) , no hemineglect phenomenon , and a brunnstrom recovery stage of four or higher . this study used an interrupted time series ( its ) design to determine whether task - oriented activity had an effect greater than that of natural recovery on impairment of the hemiplegic arm and hand of the subjects after a stroke . its designs are characterized by the collection of multiple observations over time that are interrupted by an intervention or treatment6 . evaluation was performed four times , that is , once a week for three weeks before the intervention and once after the intervention . easily accessible and most - often - used tools in the clinical environment were chosen as evaluation tools . the functional independence measure ( fim ) was used for assessment of subjects capacity to perform daily activities , and the manual function test ( mft ) was used for assessment of the level of upper limb function . the fim is a tool for assessing the capacity of disabled patients to perform daily activities objectively ; it is widely used and has a reliability level of 0.830.96 among inspectors7 . the mft is a tool for assessing the functional level of upper limbs in the area of daily activity performance and the recovery process . its reliability level among inspectors and by repeated evaluation is indicated by a cronbach s alpha coefficient of 0.95 or higher , and its inner consistency validity is 0.95 or higher8 . task - oriented training was provided to each patient for 30 minutes a day , five times a week for two weeks . the task - oriented training provided to the patients included six different types of training that could be performed by the patients themselves . the activities were as follows : changing hospital gowns , throwing a tennis ball into a basket , stacking cones , moving pegs , wiping tables with a towel , and passing rings along curved rods . data analysis included descriptive analysis of mean differences to test whether the task - oriented training had a larger positive effect on impairment than natural recovery . for each participant , individual pre - intervention data points were used to determine the mean pre - intervention score for each measure ; the same procedure was followed to obtain mean post - intervention scores . table 2table 2.mean pre- and post - intervention scores and mean differencesmeasurepre - intervention meanpost - intervention meanmean differencemftparticipant 118.020.02.0participant 222.224.01.8fimparticipant 1121.0122.01.0participant 2124.0124.00.0mft : manual function test ; fim : functional independence measure shows the upper extremity function and adl scores before and after the task - oriented training . the before , after , and mean difference scores for all measures are presented in table 2 . improvements were shown for most items of the subjects , and only the fim in subject two showed no difference between the pre - intervention and post - intervention scores . the primary purpose of this study was to evaluate whether task - oriented training has a positive effect on upper extremity function and adl compared with natural recovery of people in the chronic phase after a stroke . the results of this study confirmed the positive effect of task - oriented training on all items except the fim results of subject two . the subjects in this research participated in the task - oriented training for thirty minutes a day , five times a week for two weeks , which is a relatively short application period compared with most previous studies , which have applied long task - oriented training periods of three weeks or more5 . however , this research method is more suitable for a clinical environment with short periods of hospitalization . nevertheless , consistent with the results of previous studies of task - oriented training , the present study also observed a positive effect on the affected side upper extremity . this indicates the possibility that even a short period of task - oriented training can produce positive treatment effects . also , task - oriented training had a positive effect on the affected upper extremity even though the subjects in this research were chronic stroke patients this corresponds with the results of kim s research , in which electrical stimulation of the dermatomes combined with task - oriented movements was applied to chronic stroke patients and resulted in improvement of hand functions9 . however , there was no improvement in subject two s capacity for daily activity after the intervention in the present study . possible explanations for this include the fact that subject two was older than subject one and the possibility that subject two s capacity to perform daily activities was already high . the clinical significance of this research is the introduction of a more easily applicable form of task - oriented training for chronic stroke patients in a clinical environment compared with many other previous studies that also employed task - oriented training and confirmation of the possibility that it is an effective treatment . however , there are some limitations to this research : generalizing the results of this research is difficult due to the small number of subjects , and since the two subjects were not treated simultaneously , the possible influence of external treatment variables can not be excluded .	[ purpose ] the aim of this study was to determine the effects that task - oriented training has on upper extremity function and performance of daily activities by chronic stroke patients . [ subjects and methods ] task - oriented training was applied to two chronic hemiplegic patients in this research . the training was provided to each patient for 30 minutes a day , five times a week for two weeks . the treatment program included six different types of training that could be performed by the patients themselves . evaluation was performed four times , that is , once a week for three weeks before the intervention and once after the intervention . the change in upper extremity function was measured with the manual function test , and the change in performance of daily activity was measured with the functional independence measure . [ results ] the upper extremity function of both subjects was improved after application of task - oriented training . however , in the performance of daily activities , subject one showed improvement compared to with before the intervention , whereas subject two showed the same results . [ conclusion ] this research confirmed that two weeks of task - oriented training for chronic stroke patients is effective for improvement of upper extremity function and performance of daily activities by chronic stroke patients .
You are an expert at summarizing long articles. Proceed to summarize the following text: compartment syndrome is a rare but devastating condition that can result in permanent neuromuscular injury , skin loss , and limb amputation1 ) . it is most commonly associated with trauma , although cases of nontraumatic and iatrogenic origin are increasing2 ) . there are many iatrogenic causes , including the use of a tourniquet2 ) , pressurized infusion pumps3 ) , extravasation of various kinds of medications24 ) , and anticoagulation therapy2 ) . one of the iatrogenic causes of compartment syndrome , extravasation injuries , occurs under a wide variety of circumstances in the inpatient setting2 ) . among the accidental extravasation injuries , those associated with total parenteral nutrition ( tpn ) are the most commonly reported in newborns in the intensive care unit setting5 ) . tpn is commonly used for nutritional support in the management of critically ill children who can not be adequately fed . tpn can be categorized as a vesicant , which is a hyperosmolar , acidic , and polar solution with a high concentration of ionic substances4 ) . because of these characteristics the veins of pediatric patients are short , small in vascular caliber , and fragile6 ) , which makes extravasation occurs more often . and extravasation is usually detected later than in adults because of the inability to communicate clearly , and because of several layers of bandages covering the catheter insertion site to secure the catheter in place6 ) . in the present study , we report a rare case of compartment syndrome and skin necrosis due to extravasation requiring emergency fasciotomy and skin graft in a 7-month - old boy who was treated with peripheral parenteral nutrition via a pressurized infusion pump , which had not been reported in korea before . pediatric clinicians and medical teams should carefully examine the site of insertion of the intravenous catheter , especially in patients receiving parenteral nutrition via peripheral intravenous catheter with a pressurized infusion pump . a 7-month - old boy who had undergone surgery for a tracheoesophageal fistula and esophageal atresia at 1 day of age was admitted to our hospital for treatment of respiratory syncytial viral pneumonia . results of respiratory specimen analysis were positive for respiratory syncytial virus , and the chest radiograph showed increased peribronchial infiltration and air bronchogram . after admission , cough and posttussive vomiting became more severe with chest physiotherapy and oral feeding . because oral feeding in the presence of severe coughing or vomiting can increase the likelihood of aspiration pneumonia , oral feeding was discontinued and parenteral nutrition was administered via the peripheral venous route . we decided to start tpn via peripheral route which was less invasive than central tpn requiring central line insertion , expecting the period of non per os would not be long . the peripheral tpn was a readytouse formula , containing 22.5 g of protein per liter , 60 g of dextrose per liter , and 279 kcal in 1 bag of 533.1 ml . it was hyperosmolar averaging 900 mosm / l , had a ph of 6.5 , and consisted of a polar solution containing a large amount of ionic substances , including 37 meq of sodium per liter , 30 meq of potassium per liter , 20 meq of calcium per liter , 51 meq of acetate per liter , 10 meq of phosphate per liter . the pn solution was infused through a 24-gauge intravenous silicon catheter on the first day of admission , and the catheter was replaced with a new one every 1 or 2 days . on day 1 , tpn was infused by 11 ml / hr , and 20% smoflipid was infused by 1 ml / hr . from second day of admission , the pn solution had been infused by 20 ml / hr , and 20% smoflipid was infused by 2 ml / hr . on day 6 , a 24-gauge intravenous catheter was newly inserted into the dorsal cephalic vein at the dorsum of the patient 's right hand . after 8 hours since iv insertion , the patient showed signs of irritability , and the obstruction alarm of the infusion pump was triggered . after confirming that there were no focal signs such as erythema , edema , or tenderness indicating extravasation around the iv insertion site , the nurse on duty repositioned the intravenous catheter , fixed the site with tape , and put several bandages for firm fixation . approximately 9 hours after the repositioning of the intravenous catheter , without any alarm sign , the patient 's right hand and arm appeared severely swollen , and capillary refill was absent . at the catheter insertion site , the patient 's skin was pale and dark red with several blisters observed under the catheter ( fig . 2 ) . an orthopedic surgeon sutured the fascia after irrigating the area several times with saline solution . delayed primary skin closure was performed 8 days after the fasciotomy , at which point a black and thick eschar had developed because of skin necrosis extending from the back of the patient 's hand to the forearm area ( fig . a skin graft was scheduled for treatment of the skin necrosis after melting and debriding the necrotic tissue with a moist dressing . because the extent of necrosis was from the back of the patient 's hand to the forearm , including the wrist joint , there was a high chance of wrist joint contracture before the planned skin graft . therefore , the patient was assessed for sensory and motor function , and subjected to rehabilitation treatment consisting of wrist articulation exercises . skin graft surgery was delayed because of pneumonia , which was diagnosed during his regular wound dressing and rehabilitation treatment . , skin engraftment had been successfully completed , and the patient was receiving continued rehabilitation treatment ( fig . acute compartment syndrome is a potentially severe and devastating condition in which increased pressure within a limited space impedes circulation and disrupts the function of the tissues within that space13 ) . extravasation injuries , which are among the iatrogenic causes of compartment syndrome , occur under a wide variety of circumstances in the inpatient setting2 ) . extravasation injury occurs when fluid from an intravenous line leaks into the extravascular space6 ) . in the present case , the extravasation of tpn resulted in compartment syndrome and skin necrosis , decreasing local blood flow and perfusion . in the pathophysiology of compartment syndrome , the arteriovenous pressure gradient theory proposed by matsen and krugmire7 ) , which was published in 1978 , is the most widely accepted hypothesis . increased pressure in a limited space impairs microcirculation , resulting in an ischemic state7 ) . once the ische mia is triggered , neural injury begins after 30 minutes of ischemia and becomes irreversible after 12 hours37 ) . the permeability of the capillary endothelium increases after approximately 3 hours of ischemia , and muscle changes begin after approximately 2 hours , becoming irreversible after 4 hours of ischemia37 ) . in our case , the extent and degree of the wound suggest that the ischemic insult was prolonged , lasting for several hours , although we can not estimate the exact time of extravasation . in the present case , several factors adversely affected the local blood flow and tissue perfusion , resulting in compartment syndrome and massive skin necrosis that extended from the dorsal side of hand to the forearm . first , the risk of extravasation is higher when tpn is administered via a peripheral intravenous catheter than via a central venous catheter5 ) . peripheral parenteral nutrition is commonly used for nutritional supportive therapy in patients who can not eat well in a short period of time5 ) . it does not require a complex procedure in pediatric patients for accessing a central venous catheter such as sedation or ultrasonography , and is not usually accompanied by complications associated with the use of the central vein catheter such as central catheterinduced sepsis , central venous thrombosis , or complications associated with the procedure itself ( bleeding , pneumothorax , local infection , etc.)5 ) . because of these advantages , the indications for peripheral nutritional support are increasing in the clinical field5 ) . however , when it is administered via the peripheral intravenous route , there is a high likelihood of phlebitis or extravasation , and replacement of the catheter is required every 2 to 3 days , which makes it unavoidable to puncture the veins repeatedly6 ) . it is possible that the worsened vein condition caused by the repetitive insertion of the intravenous catheter may have increased the risk of extravasation in the present case . extravasates are divided into irritants and vesicants based on their potential for local toxicity2 ) . an irritant can cause an inflammatory reaction , characterized by warmth , erythema , and tenderness ; however , it is not directly toxic to the tissue2 ) . vesicants are agents that have the potential to cause blistering , sloughing of the skin , and varying degrees of deep tissue damage because they are inherently toxic8 ) . extravasation of parenteral nutrition , which is a type of vesicant , can itself aggravate soft tissue injury independently of the presence of compartment syndrome2 ) . the soft tissue injury that occurs as a result of the extravasate is linked to 4 factors : the osmolarity of the extravasate , the inherent cytotoxicity of the extravasate , the infusion pressure , and possible vasoconstrictive properties of the extravasate8 ) . in our case , the parenteral nutrition , a complex mixture of substances including nitrogen , dextrose , lipids , elec trolytes including potassium and calcium , vitamins , and trace elements , was hyperosmolar ( averaging 650 mosm / l ) . it had a ph of 6.5 and consisted of a polar solution containing a large amount of ionic substances . the proposed mechanism of local tissue toxicity is suggested to be a combination of the toxic effects of the local ions , hyperosmolarity , and the acidic ph of the solution2 ) . the fact that we were unable to avoid a skin graft , despite immediate fasciotomy and massive irrigation to eliminate the extravasate , supports that the damage was caused by one of the abovemen tioned factors . third , the use of a pressurized infusion pump contributes to the development of compartment syndrome when extravasation occurs3 ) . the pressurized infusion pump is a medical device that applies pressure at a consistent speed to inject fluid , and measures the fluid collected from the chamber of the intravenous infusion set9 ) . the pressurized infusion pump is currently used extensively for pediatric patients whose volume of distribution is small and who require a more precise adjustment of the rate of fluid injection9 ) . despite this advantage , it has a risk of infusing fluid continuously even when the internal pressure increases because of extravasation in an enclosed space3 ) . when intracompartmental pressure is elevated , a pressurized infusion pump would be able to infuse a predetermined amount of fluid by increasing the pressure of infusion , even without triggering the obstruction alarm , whereas intravenous drip injections that act by gravity would not be able to continue to inject in normal capacity or fourth , pediatric patients are vulnerable to both extravasation and compartment syndrome because these can remain undetected or be detected late without a warning6 ) . in younger children who can not clearly communicate regarding pain at the local site , edema , or heat sensations , and can only express via nonspecific whining or crying , a distinction between extravasation and common irritability is difficult10 ) . and the veins of pediatric patients are short , small in vascular caliber , and fragile , which makes extravasation occurs more often10 ) . moreover , younger children have a larger amount of subcutaneous fat than adults , which makes it difficult to detect local edema until a lot of fluid is extravasated . furthermore , in pediatric patients , it is common to place several layers of tape , bandages , or even splints on the catheter insertion site to secure the catheter in its place because it is not easy to access the peripheral venous route and to maintain it because of poor cooperation . the several layers of bandages could mask the extravasation , making the detection of extravasation late . the characteristics of the present case reflect the progress and consequences of extravasation and compartment syndrome . although muscular necrosis and loss of motor function could be prevented by immediate fasciotomy , delayed complications such as skin necrosis and wrist joint contracture could not be avoided . as a result , the patient required a skin graft , rehabilitation , and prolonged assessment of sensorineural and motor function , which would be otherwise unnecessary . in addition to parenteral nutrition , several intravenous infusion medications can act as irritants and vesicants including chemotherapeutic agents , intravenous immunoglobulin , contrast media , and vasopressor drugs such as dopamine , arginine , and phenytoin210 ) . early detection and prevention of extravasation is the best way to avoid soft tissue injuries during infusion irritants and vesicants2 ) . for reducing the extravasation injuries , we recommend to puncture the proper vein once when making an intravenous route6 ) . puncturing the veins small vessels can not endure the velocity of intravenous drugs and the pressure of infusion pump , so large and straight vessels are preferred in the side of extensor , such as dorsum of hand6 ) . pediatric doctors and medical teams should specifically check the site of insertion of the intravenous catheter carefully , especially when infusing irritants and vesicants via the peripheral intravenous catheter using a pressurized infusion pump . and if extravasation occurs , immediate catheter removal and rapid decision for the treatment are important for minimizing the extravasation injuries .	compartment syndrome is a rare but devastating condition that can result in permanent neuromuscular or soft tissue injuries . extravasation injuries , among the iatrogenic causes of compartment syndrome , occur under a wide variety of circumstances in the inpatient setting . total parenteral nutrition via a peripheral route is an effective alternative for the management of critically ill children who do not obtain adequate nutrition via the oral route . however , there is an inherent risk of extravasation , which can cause compartment syndrome , especially when detected at a later stage . herein , we report a rare case of compartment syndrome and skin necrosis due to extravasation , requiring emergency fasciotomy and skin graft in a 7-month - old boy who was treated with peripheral parenteral nutrition via a pressurized infusion pump . although we can not estimate the exact time at which extravasation occurred , the extent and degree of the wound suggest that the ischemic insult was prolonged , lasting for several hours . pediatric clinicians and medical teams should carefully examine the site of insertion of the intravenous catheter , especially in patients receiving parenteral nutrition via a peripheral intravenous catheter with a pressurized infusion pump .
You are an expert at summarizing long articles. Proceed to summarize the following text: the environmental determinants of diabetes in the young ( teddy ) study was formed to investigate environmental factors that trigger type 1 diabetes in genetically at - risk children ( 1 ) . the gut microbiome is of interest , as several studies ( 26 ) have shown that dysbiosis of the microbiome is associated with type 1 diabetes autoimmunity . the composition of the fecal microbiome is dependent on numerous external factors , including geographical location ( 711 ) . this work presents the first geographical assessment of the gut microbiome in these genetically higher - risk children . the teddy study prospectively observes children at six clinical centers in europe ( finland , sweden , and germany ) and the u.s . ( colorado , washington state , and georgia / florida ) ( 1 ) . a total of 1,129 stool samples from 90 children , 15 from each study site , were collected monthly starting , on average , at 151.1 days after birth ( se 5.5 days after birth ) until the average last sampling at 537 days after birth ( se 4.5 days after birth ) . samples were collected at home and mailed to a teddy repository within 72 h , with ice packs during the summer months ( 1,12 ) . fecal sample storage at room temperature for up to 72 h does not affect bacterial composition by > 10% ( 13 ) . subjects were determined to have the highest risk hla class ii genotype ( dr4-dqa1 * 030-dqb1 * 0302/dr3-dqa1 * 0501-dqb1 * 0201 ) by genotyping of cord blood ( 1 ) , but neither autoantibodies nor disease developed during the sample collection period . clinical data were collected on gestational age , delivery mode , sex , and early feeding practices ( age at first introduction to formula , and duration of exclusive and any breastfeeding ) , and later on diet ( age at first introduction to oats , gluten , milk products , cow milk , and solid food ) ( 1 ) . extracted dna was purified using the powerclean dna kit ( mo bio laboratories , inc . , 16s rrna amplification , sequencing using a barcoded illumina approach , sequence analysis , read trimming , and taxonomic classification were performed as previously described ( 14 ) . samples with < 10,000 reads and any operational taxonomic units with < 50 reads in at least one sample were removed from the data set . this resulted in an average of 102,147 reads per sample ( se 1,151 reads per sample ) , of which on average 43.9% ( se 0.1% ) were successfully classified at the genus level . sequences that did not map to known genera were clustered to each other at 95% similarity . the bacterial diversity of each sample was determined by calculating the shannon diversity index ( sdi ) . data analysis was performed using r statistical software version 3.0.0 ( 15 ) or sas version 9.3 ( sas institute inc . , cary , nc ) . continuous variables were tested using the one - way anova or kruskal - wallis test for differences in means . generalized estimating equations for longitudinal correlated data were used to assess the association between geographical location and bacterial abundance and diversity adjusting for demographic , clinical , and dietary variables . the f statistic were used to determine whether sdi differed among the six teddy study sites , as previously described ( 16 ) . sex ( p = 0.0092 ) and age at first introduction to oats ( p = 0.0042 ) , gluten ( p = 0.0001 ) , and milk products ( p < 0.0001 ) were the only clinical characteristics significantly different by geographical location . to characterize the development of the gut microbiome over time , 16s rrna sequencing read values of bacterial genera were grouped according to age of subject ( in months ) at the time of sample collection ( fig . bacteroides was the predominant genera at all sites ( average abundance 22.7% , se 0.7% ) . the abundance of bifidobacterium ( p = 0.0172 ) , veillonella ( p = 0.0048 ) , faecalibacterium ( p = 0.0122 ) , streptococcus ( p = 0.0003 ) , and akkermansia ( p = 0.0196 ) was significantly different by geographical location after adjusting for significant clinical and dietary variables . although bacteroides abundance was not significantly different ( p = 0.0530 ) by site , colorado had a significantly higher abundance than all other sites ( p = 0.0126 ) , except finland . a : a heat map of the relative abundance of the most abundant bacterial genera shows a distinct pattern of development at each study site . 16s rrna read values were grouped according to age of subject ( in months ) at the time of sample collection . if a subject had more than one sample within 1 month , the read values were averaged to prevent over - representation of a single individual . bacterial genera denoted in black font are represented in the top 10 most abundant genera at all sites , and those denoted in blue font represent genera from the 10 most abundant at only some sites . symbols indicate a statistically significant difference in bacterial abundance by geographical site after adjusting for age at stool collection and other significant covariates , as follows : * p < 0.05 , * * p < 0.01 , * * * p < 0.001 , + p = 0.053 . b : changes in the sdi of genus - level microbial communities over time differ significantly at each site ( p < 10 ) . diversity remains significantly different after adjusting for mode of delivery and age at first introduction to milk products ( p = 0.0045 ) . the left panel depicts a histogram of 10,000 f statistics obtained after randomly permuting the site labels . the blue line indicates the 95% quartile of this f statistic , and the arrow indicates the observed f statistic . the right panel depicts , for every site , a polynomial of degree 3 adjusted to the observed sdi , days after birth . the permutation test of the sdi of bacterial genera identified at each site showed that all sites differ from each other across time ( fig . furthermore , the difference remained significant after adjustment for delivery mode and age at first introduction to milk products ( p = 0.0045 ) . colorado and finland had a significantly lower sdi than all other sites ( p = 0.0258 ) . georgia / florida and germany had a more diverse profile , characterized by a relative abundance of clostridium , bifidobacterium , and veillonella of > 8.0% each ( fig . the fecal profile was dominated by bifidobacterium until 8 and 10 months of age , respectively , and the overall abundance was significantly higher than in colorado and finland ( p = 0.0199 ) . this study highlights the great variability in the composition and diversity of gut microbiomes among the six teddy study sites . so far , studies examining the association between the gut microbiome and type 1 diabetes autoimmunity have focused on small geographical regions ( 26 ) . country- and lifestyle - specific factors are a major player in shaping the composition of the gut community ( 711 ) , but the extent to which they affect the microbiome of infants at high risk for type 1 diabetes was previously unknown . our study is the first to investigate the fecal microbial profile of high - risk children across two continents and multiple countries . our data suggest that children at high risk for type 1 diabetes have study site specific patterns of gut colonization showing intercontinental similarities but intracontinental differences . geographical origin significantly associated with the diversity of bacterial communities and the relative abundance of numerous bacterial genera ( fig . previous studies have reported similar reductions in microbiome diversity in northern european infants compared with infants from southern european countries ( sweden vs. spain and finland vs. germany , respectively ) ( 9,10 ) . while finland has the highest incidence of type 1 diabetes in children ( 17 ) , it remains to be seen whether sdi is associated with disease incidence . perplexing differences , not explained by clinical characteristics , exist between the neighboring countries sweden and finland . compared with their swedish neighbors , finnish subjects had a significantly higher abundance of bacteroides ( p = 0.0508 ) and veillonella ( p = 0.0160 ) , and a lower abundance of bifidobacterium ( p = 0.0199 ) , akkermansia ( p = 0.0014 ) , and ruminococcus ( p = 0.0248 ) . the fecal profile of swedish subjects was more similar to those from washington state ( both groups of subjects were dominated by bifidobacteria at early time points ) , suggesting a more typical colonization pattern of the infant gut ( 18 ) . clearly , microbiome diversity varies with geographical location , even in a population of homogenous hla class ii genotypes . geography represents a culmination of underlying environmental and cultural factors that , on their own , are difficult to account for . the prime source of variability in these data remains unknown because significant differences in microbiome composition exist even after adjusting for numerous early - life and dietary variables . future studies must carefully consider the impact of geographical location on the microbiome of children who are genetically at higher risk for type 1 diabetes as location may confound analyses of disease - associated microbiome states . furthermore , whether the microbiome is causative or merely an indicator of underlying type 1 diabetes etiology , these microbiome differences suggest a geographically tailored approach to diagnostics or preventative therapies .	objectivegut microbiome dysbiosis is associated with numerous diseases , including type 1 diabetes . this pilot study determines how geographical location affects the microbiome of infants at high risk for type 1 diabetes in a population of homogenous hla class ii genotypes.research design and methodshigh - throughput 16s rrna sequencing was performed on stool samples collected from 90 high - risk , nonautoimmune infants participating in the environmental determinants of diabetes in the young ( teddy ) study in the u.s . , germany , sweden , and finland.resultsstudy site specific patterns of gut colonization share characteristics across continents . finland and colorado have a significantly lower bacterial diversity , while sweden and washington state are dominated by bifidobacterium in early life . bacterial community diversity over time is significantly different by geographical location.conclusionsthe microbiome of high - risk infants is associated with geographical location . future studies aiming to identify the microbiome disease phenotype need to carefully consider the geographical origin of subjects .
You are an expert at summarizing long articles. Proceed to summarize the following text: exercise is recognized as an important health - related behavior conducive to good mental and physical health and well - being . regular physical activity ( pa ) has many health benefits , including reduced risk of cardiovascular disease , ischemic stroke , noninsulin - dependent diabetes ( type 2 ) , colon cancers , osteoporosis , and depression . despite these benefits , a large proportion of the population in many countries fails to participate in sufficient pa to achieve these outcomes . pa among us adults is lower than of recommended level for health promotion and this issue determines as a target of public health intervention . today , many jobs have been created with advances in technology ; unfortunately , these jobs are associated with the inactivity or sedentary lifestyle . employees health will be affected by their depriving of the benefits of pa . in finland , more than one - third of the working population engages in pa less than recommended for health one study in female japanese showed a high percentage of japanese women are not regularly active . in iran , a study conducted by robabi et al . in bank employees ( iranshahr ) have shown that a high percentage of employees did not have enough pa . also in jalilian et al . study , on employees women in hamadan university of medical sciences , indicated that 65% of women employees did not have sufficient pa . based on our knowledge , there are no any available data regarding the pa levels and its relevant affecting factors in isfahan university of medical sciences employees . nowadays , health educators use health education models to explore health promotion behaviors and behavior change . the transtheoretical model ( also called the stages of change model ) , developed by prochaska and diclemente in the late 1970s . the ttm model has four constructs ; stages of change , self - efficacy , decisional balance , and processes of change . the ttm consists of five stages of exercise behavior change : ( 1 ) precontemplation , ( 2 ) contemplation , ( 3 ) preparation , ( 4 ) action , and ( 5 ) maintenance . processes of change cognitive processes are consciousness raising , dramatic relief , self - reevaluation , environmental reevaluation , and self - liberation and behavioral processes are social liberation , counter - conditioning , stimulus control , reinforcement management , and helping relationships . another construct of the model is decisional balance that focuses on the importance of perceived positive ( pros ) and negative ( cons ) outcomes of a behavior change . self - efficacy is one 's perceived confidence in the ability to carry out a specific behavior successfully ; and thus have different levels of confidence in their ability to maintain exercise benefits and to overcome exercise barriers . study in japanese female employees and showed that 90% of subjects were in inactive stages ( precontemplation to preparation ) . in iran also , study showed 45.7% of employees women placed in precontemplation , contemplation and preparation stage and a significant relationship was found between the benefits , barriers , self - efficacy and stages of change . study also stated that more than70% of the people in yazd were investigated in preaction stages . the aim of this study was to determine the pa among employee women in isfahan university of medical sciences based on the transtheoretical model . this cross - sectional study was conducted in 100 female employees of isfahan university of medical sciences in 2013 . all participants were informed about the details of the study and were asked to read and sign a consent form . the following are criteria for inclusion of women to the study : ruled employment as employees for more than 6 months , the desire to participate in the study , and not being pregnant . data collected by self - administered questionnaire . the demographic information ( age , weight , height , number of child , level of education ) were obtained . for measuring exercising behaviors , weekly pa was used . in order to measure exercise behavior , the stage of exercise behavior change questionnaire developed by marcus and forsythused in this study . this structure was measured by the process of change questionnaire developed by nigg et al . this questionnaire contains 30 items that measure the 10 process of change ( cognitive and behavioral process ) . in this questionnaire , participants were asked to determine the frequency of occurrence of each item on a five - point likert scale ( ranging from 1 , never to 5 , repeatedly ) . the decision balance scale for exercise , developed by plotnikoff et al . with 10 items based on lickert scale was used to assess pros and cons participants were asked to determine , on a five - point likert scale ( ranging from 1 , not at all important to 5 , extremely important ) . the perceived self - efficacy scale consisted of 6 items with four point scale ranging from 1 ( can not do ) to 4 ( certainly can do ) . all the questionnaires were translated using forward translation , back - translation in farmanbar et al . finally , content validity of questionnaires was assessed by an expert panel ( five expert in health education and pa ) . the reliability was determined by cronbach 's alpha , and the scores of alpha for the process of change , self - efficacy , and decisional balance were 0.94 , 0.81 , and 0.78 continuously . we used descriptive ( mean and frequency ) and analytical statistics ( independent t - test and one - way anova test ) . anova test was used to compare the mean of processes of change construct and self - efficacy with stages structure . the results showed that the average age was 37.61 7.99 , and there was no any significant relationship between age and level of pa . the relationship between physical activity and demographic information distribution of people in stages of change was as follows : 26% precontemplation , 22% contemplation , 20% preparation , 13% action , and 19% maintenance . there were significant differences between consciousness raising , dramatic relief , counter - conditioning , stimulus control , helping relationships , reinforcement management , and self - liberation with stages of change constructs [ table 2 ] . the relation between stages of change and processes of change furthermore , anova test showed there was no significant difference between environmental reevaluation , self - reevaluation , and helping relationship with stages of change constructs [ table 2 ] . the mean of self - efficacy in stages of change the mean of pros are , respectively , as follows : precontemplation 58.15 22.29 , contemplation 70.73 22.81 , preparation 73.00 19.59 , action 75.69 16.93 , maintenance 86.10 18.40 . the statistical test showed there were significant differences between pros and stages of change ( f = 5.304 , p = 0.001 ) . in relation to cons , anova do not show differences between cons and stages of change . while , the mean of cons was in precontemplation 82.00 11.66 , contemplation 77.82 13.11 , preparation 76.00 15.41 , action 70.15 14.11 , maintenance 75.58 17.17 ( f = 1.645 , p = 0.169 ) . this study was conducted with the aim of determining the pa among women employees in isfahan university of medical sciences based on the transtheoretical model . in this study , 26% of women were in contemplation , 22% in contemplation , 20% in preparation , 13% in action , and 19% in maintenance . indeed , 68% of subjects were inactive , and 32% were active . it consist with this study , and this matter could be due to cultural similarities between people in two city ( isfahan and yazd ) . there were significant differences between consciousness raising , dramatic relief , counter - conditioning , stimulus control , helping relationships , reinforcement management , and self - liberation with stages of change construct , also with progressing to maintenance , the mean of constructs is increasing . study , all structures of the model were significantly different in stages of change . in kirk et al . study , helping relationships , self - liberation , and consciousness raising increased from precontemplation to maintenance . it seems that special attention needed to environmental reevaluation , self - reevaluation , and helping relationship for women . based on the findings , the mean of self - efficacy is increasing from precontemplation to maintenance and the mean of action and maintenance stage is more than other stages . in marcus study , finding show that people who were physical active had higher self - efficacy than inactive people . other studies such as nishida et al . and gorely and bruce stated that those who have high self - efficacy for pa , they are more physically active . purath and miller also showed women have more self - efficacy with an increase in the stages of change . results indicated that in the movement from precontemplation to maintenance pros are increasing , and cons are decreasing . this study has been done among the women , so there was no chance for inter gender comparison of pa in staff and also this limitation led to the small sample size . long questionnaire and impossibility of assessing pa in different jobs were other limitations of this study . this study has been done among the women , so there was no chance for inter gender comparison of pa in staff and also this limitation led to the small sample size . long questionnaire and impossibility of assessing pa in different jobs were other limitations of this study . because of a significant relationship between cognitive and behavioral processes and pa in this group , designing and implementing an educational program based on the transtheoretical model may be useful in promoting pa of a female employee	introduction : today , many jobs are associated with the inactivity or sedentary lifestyle . employees health will be affected by their depriving of the benefits of physical activity ( pa ) . therefore , the present study was undertaken to determine the pa among employee women in isfahan university of medical sciences based on the transtheoretical model.materials and methods : this is a cross - sectional study has been performed in isfahan university of medical sciences employee women ( 2013 ) . a convenience sample of 100 women was selected . data were collected by validated and reliable questionnaire in three parts ( demographics information , pa scale , and ttm constructs ) . data were analyzed by spss spss ( version 16.0 ; spss , ibm , inc , chicago , il , usa ) and descriptive and analytical statistics such as anova and independent t - test were used . a two - tailed p < 0.05 was considered statistically significant.results:the mean of pa was 21.17 27.30 min in a day . weekly heavy , moderate , and light exercise mean was 0.72 1.81 , 0.89 1.87 and 0.57 1.57 days , respectively . in this study , 26% of women were in contemplation , 22% in contemplation , 20% in preparation , 13% in action , and 19% in the maintenance stage . furthermore , there were significant differences between consciousness raising , dramatic relief , counter - conditioning , stimulus control , helping relationships , reinforcement management , and self - liberation with stages of change constructs.conclusion:because of a significant relationship between cognitive and behavioral processes and pa in this group , designing and implementing an educational program based on the transtheoretical model may be useful in promoting pa of a female employee .
You are an expert at summarizing long articles. Proceed to summarize the following text: the boston keratoprosthesis ( b - kpro ) is an artificial cornea that offers a viable solution for corneal transplant candidates who are at high risk for graft failures such as those with a prior history of graft rejection , dry eyes , and severe neurotrophic and autoimmune diseases . it is the most widely used corneal prosthesis in the united states and in the rest of the world . the b - kpro has a collar - button design with a front plate , stem , and back plate of poly[methyl methacrylate ] ( pmma ) or titanium . the device is implanted into a corneal graft and then sutured into the patient 's cornea as in standard penetrating keratoplasty ( figure 1 ) . the boston type i procedure is favored in eyes with adequate tear secretion , whereas the type ii b - kpro ( with an added anterior nub ) is reserved for near - hopeless cases with severe destruction of the ocular surface , such as end - stage dry eye conditions and cicatricial diseases . from a global perspective , the need for human corneas far exceeds supply . although corneal tissue is readily available in many regions of the developed world with established eye bank systems , this is not the case for other populations . in many developing countries , furthermore , healthcare and financial restrictions can be a major barrier : for example , a donor cornea from an eye bank in the united states can cost about $ 3,000 due to the need for microbial testing , administration , and transport alone . thus , the lack of human donor tissue at a reasonable cost is one of the largest barriers to reducing blindness through either standard pk or kpro implantation . a long - term , safe , and inexpensive alternative is clearly needed for the developing world . why is it necessary to use a corneal graft as a vehicle for the b - kpro ? after all , several other artificial corneas , proposed from other centers throughout history , have been designed to be implanted directly into the recipient 's diseased cornea without using a graft as a carrier . the answer lies in our experience that a double - plated ( collar - button ) keratoprosthesis design has advantages over designs where the optical stem is anchored by a horizontal haptic ( plastic , metal , tooth , etc . ) placed within or in front of the patient 's cornea . according to our results , positioning of the b - kpro 's back plate entirely behind the corneal tissue , with its intact descemet 's membrane , provides better long - term retention than other arrangements . accepting this principle of positioning , we have in the past tried to work out practical techniques for direct insertion into the patient 's cornea without using a graft but without success . therefore , we have used a corneal graft as a vehicle for the device since the mid-1960s , with improved retention . we are therefore exploring alternatives to fresh corneal tissue for use as a keratoprosthesis carrier . this includes physical alterations to increase storage time , such as deep - freezing , glycerol - dehydration , gamma irradiation , or cross - linking of tissue . other substitutes may include corneal autografts , xenografts , skin , cartilage , and tissue constructs . this review identifies alternative tissue carriers suitable for the developing world in terms of safety , practicality , and cost effectiveness . in the developed world with high levels of health expenditures and established eye banks , standard fresh corneal allografts ( preserved from 1 to 14 days ) are preferred . additionally , allografts allow assembly with the b - kpro on a side table before opening the patient 's eye . this minimizes the time the eye is open and risk of vitreous protrusion or choroidal hemorrhage . but , in the developing world , issues with cost , logistics , and administration of the donor graft are very substantial . one alternative is to modify the donor tissue in order to lengthen storage time prior to use . it is known that an allograft can be stored deep - frozen ( thus nonviable ) and still be usable as a lamellar graft . as a carrier for the b - kpro , there was no demonstrable difference in clinical outcomes between fresh and frozen donor materials in a recent large series . storing human allogenic corneas in a hospital freezer is practical for the b - kpro surgery locally , but transport remains a problem . a second alternative may be to use dehydrated rather than frozen corneal tissue , where shipment in a small vial is easy and practical see table 1 . dehydration is performed simply by replacing corneal water with glycerol and has long been a standard technique in biology . glycerol - preservation of donor corneal tissue has for many decades been used in lamellar keratoplasty with satisfactory outcomes . this method extends the time that a cornea can be stored and can thereby allow the use of tissue that would otherwise be discarded on the basis of prolonged death - to - preservation time . in 2008 , the eye bank association of america estimated that the united states harvested over 92,000 corneas , including 30,000 that were deemed unsuitable for optical grafting . of these , approximately 25% could have been preserved with glycerol and eventually used , increasing the cornea donor pool by 7,0008,000 tissues annually . our experience with glycerol - stored corneas in b - kpro surgery has been favorable but the corneas need to be rehydrated in saline for 3060 minutes before use ; otherwise their leathery consistence makes suturing difficult . corneas dehydrated by freeze - drying , rather than by glycerol , would be expected to have similar qualities , but preparation and shipment would be more cumbersome . implantation , graft necrosis , melt , and subsequent leak can occur postoperatively , particularly in autoimmune diseases , leading to calamities like retinal detachment or infection . pretreatment aimed at increasing resistance to enzymatic digestion might help reduce the incidence . cross - linking corneas with the help of riboflavin plus uv - a light has been shown to reduce corneal susceptibility to digestion with collagenases . whether such modified corneal grafts show increased long - term stability is presently the subject of a clinical study . gamma irradiated human corneas , such as visiongraft sterile cornea , available from tissue banks international , have recently been used in place of fresh donor corneas for lamellar patch grafts . they have also been used successfully as carriers for the b - kpro . in our experience , these grafts are thinner than a fresh graft but are still functional . in addition , these corneas can be easily transported in a vial at room temperature . however , as long as testing for residual viruses is required , the cost remains high , and it is questionable whether gamma irradiated corneas have any advantage over glycerol - dehydrated tissue . for countries with limited resources and no eye bank administration , the b - kpro assembly will have to take place on a side table with the patient 's eye open , which should take a maximum of five minutes . in spite of such relatively minor disadvantages , the benefits of low cost and easy a recent pilot keratoprosthesis program was initiated in ethiopia and sudan that successfully used patients ' own corneas as carriers for the b - kpro . while these results are promising , widespread adoption is limited by the health of the presurgical cornea which must not have any stromal melt , perforation , or infection . often , the cornea is too damaged and thin to be used . complications are apt to occur if corneas are unable to swell and fill the space between the b - kpro plates , compounded by a heightened sensitivity to necrosis and melt in corneas severely damaged from disease . therefore , we recommend the patient 's own cornea as a carrier only when it is still capable of swelling and is not too scarred , inflamed , or thin . a thin and scarred cornea can be used as an autograft , however , if covered by a large conjunctival flap . such a flap should be mobilized vertically , from the temporal sclera , with intact bases above and below . it should be moderately thick and wide enough to fit loosely over the entire cornea . it is important that all corneal epithelium be removed before the flap is sutured down ( with 10 - 0 nylon ) to the limbus , so that a pure connective tissue interface is created . a small central opening can be made in the flap at the end of surgery and will result in gradual retraction of the conjunctival edge to the edge of the b - kpro front plate . such a flap is an effective way of covering the carrier cornea with a much needed barrier of conjunctival epithelium and subepithelial blood vessels , ideally preventing any subsequent tissue melt . a thick flap has the added benefit that it can make soft contact lens wear unnecessary . the downside of such a vertical conjunctival flap is that it makes the procedure more complex by adding surgery time . also , there are situations where the conjunctiva is too thin and scarred down to be mobilized . a hypothetical carrier possibility would be to use an extracorneal autologous tissue , such as skin . likely a basement membrane ( e.g. , amnion ) between the graft and the back plate will be needed in order to block cells and large proteins from entering the eye through the plate holes . also , various forms of cartilage in the body are being explored as carrier graft substitutes shaped into suitable diameter and thickness as either autografts , allografts , or xenografts . in prior studies , cartilage from sternum or ears has been implanted in animal corneas [ 18 , 19 ] . it is important to acknowledge that not only availability and safety but also low cost is a requirement for b - kpro carrier tissue in the developing world . for many patients , neither autografts nor allografts gamma irradiated porcine and bovine heart valves , pericardium , and so forth have been successfully used in humans for years . if corneas from such animals , ubiquitous in barnyards all over the world , could be tolerated in human eyes , the search for a suitable carrier material would be over . gamma irradiation reduces antigenicity and sterilizes the tissue , making xenografts a real possibility for humans . xenotransplantation from pigs is appealing with respect to the cornea , as there are many similarities to humans with regards to refractive power , size , and tensile strength . recent genetic manipulation of pigs has led to the prospect that the remaining immunological barriers will be overcome . though there is less risk of rejection from genetically manipulated pigs , the cost is still high and availability is complex . the question of sterility is also of high importance and whether gamma irradiation ( 2535 kgy ) can kill not only bacteria but also all viruses that can pose a potential threat to the new host . if the surface of such a xenograft would still be vulnerable to necrosis and melt , a conjunctival flap as described above , should be protective . sheets of collagen fibrils , moderately cross - linked , have been successfully used as lamellar grafts in humans with keratoconus [ 23 , 24 ] . recent studies on the safety and functionality of a biosynthetic cornea found that it supported the ingrowth of endogenous cells and nerves , as well as functions such as touch sensation , development of tear film , and normal eye pressure [ 23 , 25 ] . theoretically , the use of such constructs would be very attractive as costly microbiological testing would not be necessary , manufacturing costs would likely decline over time once mass produced , and shipping would be easy . the present difficulty seems to be making the constructs biocompatible , thick , and cohesive enough for suturing into a recipient cornea . in addition to expanding available options for b - kpro carrier tissue , efforts are under way to make the b - kpro device more readily available for the developing world and the postoperative care less expensive . new designs of the b - kpro that are more cost - effective are under current development . low - cost bandage contact lenses of variable diameters are recommended to be used with the b - kpro . although antibiotic prophylaxis is needed for life in a patient with a b - kpro , simple and affordable antibiotic combinations are suggested such as polymyxin b + trimethoprim sulfate daily to diminish the financial burden of this approach . of the estimated worldwide 410 million people with corneal blindness needing surgical rehabilitation , at least 80% live in the developing world [ 5 , 26 ] . for this underserved population the present surgical technique of implantation requires corneal tissue as a carrier for the device however , the high cost and lack of availability constitute a severe hurdle in many countries . there is therefore an urgent need to find alternative carrier tissues that must be inexpensive , readily available , and safe . in this review , we have presented a number of alternative options and their advantages and disadvantages are discussed .	the boston keratoprosthesis ( b - kpro ) , currently the most commonly used artificial cornea worldwide , can provide rapid visual rehabilitation for eyes with severe corneal opacities not suitable for standard corneal transplantation . however , the b - kpro presently needs a corneal graft as a tissue carrier . although corneal allograft tissue is readily available in the united states and other developed countries with established eye banks , the worldwide need vastly exceeds supply . therefore , a simple , safe , and inexpensive alternative to corneal allografts is desirable for the developing world . we are currently exploring reasonable alternative options such as corneal autografts , xenografts , noncorneal autologous tissues , and laboratory - made tissue constructs , as well as modifications to corneal allografts , such as deep - freezing , glycerol - dehydration , gamma irradiation , and cross - linking . these alternative tissue carriers for the b - kpro are discussed with special regard to safety , practicality , and cost for the developing world .
You are an expert at summarizing long articles. Proceed to summarize the following text: the medical physicist in radiology is essential for enabling the practice of safe , state - of - the - art medical imaging . medical physicists in radiology are members of the multi - disciplinary clinical teams that are responsible for radiology services to patients . their role is to provide critical scientific input on the physical processes and technology that underpin the whole radiology service . generally , the medical physicists in radiology design and develop the framework of medical imaging , image processing , image distribution , image storage , radiation dosimetry , quality assurance of the imaging equipment , information and communication technology ( ict ) aspects of the imaging process , and radiation protection of the patient and operator . specifically , the medical physicists in radiology provide expert advice on the development , implementation , and improvement of imaging techniques and processes . medical physicists in radiology have a leading role in the strategic planning , testing , safe use , and optimization of advances in medical imaging technologies and techniques . both initial and continuing education and training are necessary in order to acquire and maintain sufficient knowledge and an appropriate level of knowledge and competence . the objective of our work was to develop a core curriculum for the education and training of european medical physicists in radiology . this core curriculum for medical physicists in radiology is issued jointly by the european federation of organisations for medical physics ( efomp ) and the european society of radiology ( esr ) . these recommendations accommodate the contemporary requirements for the knowledge and competency needs in this rapidly evolving field of medicine . in 2004 , a european expert group published the first european core curriculum for medical physicists in radiotherapy , and they recently finalized a revised and updated version of this curriculum . the curriculum for medical physics in radiotherapy was developed and revised jointly by efomp and the european society for radiotherapy and oncology ( estro ) . another expert group for the development of a european core curriculum for medical physicists in radiology was initiated and installed by the efomp with participation of esr . the radiology medical physics group represents experts in general projection radiography , mammography , diagnostic fluoroscopy , interventional radiology , computed tomography , magnetic resonance imaging , ultrasound imaging , and radiation protection . the basis for a draft curriculum on radiology medical physics was laid during meetings of the expert group , and in a later phase written feedback from the experts was used to finalize the curriculum . it was decided to develop a curriculum that was consistent in structure and format with the revised radiotherapy medical physics curriculum . it was also decided that the curriculum should define general competencies ; specific knowledge , skills , and competencies in medical physics ; and a research project . the medical physicist in radiology must be able to work together with the multi - disciplinary team in the clinical application of medical imaging and participate in the organizing and structuring of the medical imaging process . the physicist should also ensure that the well - being , interests , and dignity of patients are promoted and safeguarded at all times . to support these requirements , the first part of the curriculum presents general competencies , subdivided into two sections : organization and professionalism . the second part defines specific knowledge , skills , and competencies in medical physics required to operate clinically in a department of radiology . a medical physicist requires clinical and analytical skills and is also expected to remain abreast of developments in medical imaging . both aspects of the job can be trained through the development of research skills . these need not necessarily be acquired through abstract academic research but can equally likely be developed through applied clinical problems . thus , the third and final part of the curriculum describes a research project where these skills are developed . table 1 gives an overview of the structure of the curriculum.table 1the structure of the core curriculum for medical physicists in radiologyi . computed tomography 13 magnetic resonance imaging 14 ultrasound imaging 15 radiation protection 16 diagnostic image display and image processingiv . the european core curriculum for medical physicists in radiology can be used when national curricula are being developed . the core curriculum supports the harmonization of education and training of european medical physicists in radiology , it may help to improve their mobility within europe , and it provides the basis for improved implementation of articles in european medical exposures directives that are related to the medical physics expert . the core curriculum aims at bringing the medical physicist in radiology up to the level of a qualified medical physicist . a qualified medical physicist is an individual who is competent to practice independently and to register as a medical physicist , in one or more of the subfields of medical physics . to act as an expert , further experience is required , and an involvement in a program for continuing professional development radiology involves many subspecialties including radiography , mammography , computed tomography , x - ray guided interventions , and pediatric radiology but also magnetic resonance imaging ( mri ) and ultrasound imaging . the medical physicist in radiology who is recognized as a medical physics expert must have a high level of expertise in x - ray imaging . in addition , but depending on local conditions , it may also be desirable or even required that the medical physicist in radiology acquires a certain level of expertise in mri , ultrasound imaging , and nuclear medicine .	some years ago it was decided that a european curriculum should be developed for medical physicists professionally engaged in the support of clinical diagnostic imaging departments . with this in mind , efomp ( european federation of organisations for medical physics ) in association with esr ( european society of radiology ) nominated an expert working group . this curriculum is now to hand . the curriculum is intended to promote best patient care in radiology departments through the harmonization of education and training of medical physicists to a high standard in diagnostic radiology . it is recommended that a medical physicist working in a radiology department should have an advanced level of professional expertise in x - ray imaging , and additionally , depending on local availability , should acquire knowledge and competencies in overseeing ultrasound imaging , nuclear medicine , and mri technology . by demonstrating training to a standardized curriculum , medical physicists throughout europe will enhance their mobility , while maintaining local high standards of medical physics expertise . this document also provides the basis for improved implementation of articles in the european medical exposure directives related to the medical physics expert . the curriculum is divided into three main sections : the first deals with general competencies in the principles of medical physics . the second section describes specific knowledge and skills required for a medical physicist ( medical physics expert ) to operate clinically in a department of diagnostic radiology . the final section outlines research skills that are also considered to be necessary and appropriate competencies in a career as medical physicist .