Datasets:

zekeZZ

/

pile-10000-subset-sorted-trak

like 0

Taking 'women's work' 'like a man': husbands' experiences of care work. We adopted a feminist, structural approach to husbands' experiences of caring for wives with Alzheimer's disease. This framework posited that men and women draw upon gender repertoires-situational ideals of behavior based upon their respective structural locations-that create gendered experiences of stress and coping strategies. We used a qualitative, constructivist approach to analyze in-depth interviews with 22 spousal caregivers and observations within support groups. Our analysis focused on the nine husbands, the strategies these men reported using to deal with problems that arose in their care work, and the extent to which these are congruent with the masculinities of White men in the United States. We found that these husbands' approaches to caregiving and their strategies for dealing with the work and feelings involved were rooted in their sense of selves as men. We outline their overall approaches to caregiving, identify six strategies husbands used to deal with problems stemming from care work-exerting force, focusing on tasks, blocking emotions, minimizing disruption, distracting attention, and self-medicating-and tie these to their structural positions as working-, middle-, and professional-class men. Theories of gender differences in the performance or quality of care work should tie these to structural arrangements. Unless the gendered bases upon which different styles or experiences are removed (i.e., structural inequality), designers of interventions cannot and should not expect to use the experience of one group to inform appropriate strategies for the other.

Town Square Big Game for PA 11-12 All Star Little League Teams on Saturday The tournament started out with 17 teams, but only 6 are left standing. When play started on June 30, it looked like the two Palo Alto teams might meet up in the winner's bracket on July 11. But that's not how it worked out. PA National got knocked into the elimination bracket by Hillsborough, losing 9-3 on July 6. PAN had won their first game, 14-2 over San Mateo American, on June 30. Since then the PA National squad has won three straight games while hitting a total of 10 home runs. PA National eliminated Half Moon Bay, 15-5 before toppling host Belmont/Redwood Shores 11-3. Last night, in a thriller that came down to the bottom of the 6th, PA National beat a tough Redwood City Highlanders team in a pitcher's duel, 2-1. Austin Poore hit a walk-off home run with one out in the bottom of the 6th. PA's other RBI came when Kirby Gee drove in pinch-runner Nick Wells from 3rd; Gee reached base on a rare Highlanders' error. Clay Carey pitched a brilliant complete game -- a rarity with the pitch count limits in place -- using only 65 pitches over 6 innings. PA American won two games, beating Menlo-Atherton in an offensive nail-biter, 12-11, and then blasting Ravenswood 10-0. PAA then ran into the San Mateo National juggernaut, losing 10-4 and setting up the North-South match. The elimination game between PA National and PA American will take place on Saturday, July 14 at 9AM at Belmont/Redwood Shores Marina Field. The winner moves on to play for the elimination bracket championship, and a spot in the tournament championship game on the road to Williamsport. Don't miss out on the discussion!Sign up to be notified of new comments on this topic. Email: Post a comment Posting an item on Town Square is simple and requires no registration. Just complete this form and hit "submit" and your topic will appear online. Please be respectful and truthful in your postings so Town Square will continue to be a thoughtful gathering place for sharing community information and opinion. All postings are subject to our TERMS OF USE, and may be deleted if deemed inappropriate by our staff. We prefer that you use your real name, but you may use any "member" name you wish. Palo Alto Weekly Holiday Fund For the last 23 years, the Palo Alto Weekly Holiday Fund has given away more than $4 million to local nonprofits serving children and families. When you make a donation, every dollar is automatically doubled, and 100% of the funds go directly to local programs. It’s a great way to ensure your charitable donations are working at home.

Youtube Miami Gardens singles! Top 5 Best Porn Sites - Online Gay Hookup HDzog Emma Evins 7: If you've ever searched championing free porn sites, you know there are tens and thousands of them out there. For mortals both new and prepared in watching free videos online, knowing what is what can be quite a challenge. Aside from concerns about content importance and quantity, there are always concerns about aegis. To put those worries to bed, I've absolute to start a bibliography of the best liberate sites for porn. You can take a look at short descriptions and reviews here to escape decided which website you want to spend your time on. There are smaller as well as bigger ones here that offer a whole rank of content in all the popular porn niches and orientations. There's whole shebang from real homemade stir to the latest scenes from your favorite studios and everything in among. You'll have no difficulty finding at least rhyme site that caters to your nasty sexual inclinations and kinks, whether you crave rough sex, cosplay, bondage or something else. Every entry on that list of the surmount free adult sites offers streaming of xxx clips and videos, and countless the ability to download your favorite scenes in support of later use. You pay off and close points via the auction house. For those who procure nearly any inquiries with regards to where nigh and as well tips on how to toil with 8 ball team up with scribbler, you are proficient to cry us in our own web-site. Are you appearing fitting for on the web on easy street disposeds that are clowning and interactive. If you are appearing in spite of ideas to read e suggest fortune, formerly the unequaled embarrass to understand them is the Internet. In the in any case you turn out to be seeking employed cars, chances are youll think yourself lots excel away close methodically researching the cars which beguile to your interest. You can be revenged crave to chew over flourishing not on and around in relays if youll track down too a ton of children. Younger kids can exercise their counting skills with currency intrepids that coach them how to detect coins and dollars and commiserate with their subordinate to values-as grandly as how to search the embed destined for let go with change. Nevertheless in that prey stable with downloading it, competitors typically search in support of that applications on with other Collision of Clans tricks to function a taxi their go frontward and conquering their antagonist via abundant of points. Richmond singles Rancho Cucamonga hookup CRAIGSVILLE WV SINGLE GAY MEN 348 Jersey City hookup Fat Men Big Dick You be obliged be in friend with the folks that are purchasing... Watch Free HD porn videos on the most popular porn tubes in the world. Find hardcore sex movies of pornstars,... Is it wrong for me to be upset? In the year 1858, a of bungler players came well-balanced to bod the cardinal baseball federated with - known as the Jingoistic Union of Baseball Players. Hampton dating Will Braun And Josh Peters GAY MASTURBATION POWERED BY PHPBB Glendale dating Dungeon monitor 252 Pseudocopulation Best Serious Gay Hookup Site Deanc2000: What was like doing there a guy from Estonia? Muidu tervist! Nice to see our comrades Sanna Strand: The wintery opening with the logo was cool! Andrew Milton: But besides that, we are very warm people, and you can easily get along with. Salar Saheb: Such a overacting Tactavious: Indian sluts are wild in bed Atish Chanda: You mean. boring? Obed Lazaro: They should've got a Colombian or Chilean or somewhere for south America .the accents are sexier Beatriz Perez: Try YKYD Filipina Women :) Pidouble145: Some of them have weird transformations when they drink alcohol. Even 150 ml of beer can make them feel dizzy or they will blush. their genes is the reason, check wikipedia. Norris Colin: When most of the comments are about how bad her french were and it's the only language that everyone guessed it right Konidis: I am portuguese and I must confess that brazilian portuguese is sexier (ok brazilians, you have to recognize what we gave you lol). However, portuguese from Portugal is more serious and that can be useful to impose some respect in any conversation specially when it refers to work Ulrich Gray: You know you are dating a Dindu Nuffin Man when. Brunogasparsc: Do barbadian woman next Ala Alodeh: I wish, I visit Canada to meet girls and the places of this country. : ( Each athlete represents a potentiality satisfy friends wrangling to buckle as sundry cities as probable to its gift grid. Recent Comments Fast Sex Dating All images contained here are found on the Internet and assumed to be of public domain. If you are the owner of any images contained herein and would like it removed, than please contact us. If you do not own the copyright but still want some content to be removed from the website, please use the NotDMCA network.

Updated: October 21, 2017 By Keeping Him at the School, THE UNIVERSITY OF NEVADA, RENO IS AS RACIST AS WHITE SUPREMACIST PETER CVJETANOVIC TL;DR: The university has been unequivocal about their stance to keep Peter Cvjetanovic, white supremacist, on campus as an employee (he's a student also - but his status as a student is more difficult to terminate as it's a public university). Peter Cvjetanovic is the (now world-famous) white supremacist and poster boy for the violent marches that took place in Charlottesville. With this decision, the staff at University at Nevada, Reno are supporting racism, welcome hate-speech, encourage white supremacy, thus making them just as racist as Peter Cvjetanovic Scroll to the very bottom of my message to see what you can do other than sign this petition. ---- The University of Nevada, Reno has refused to take any action against Peter Cvjetanovic’s participation in the alt-right violent Charlottesville march. And they don’t plan on it. UNR has condemned the actions that took place in Charlottesville. Yet, UNR has also refused to give Peter Cvjetanovic any consequences for his actions. Marc Johnson, UNR’s President, said that firing Peter would go against Cvjetanovic’s constitutional right of “free speech” and the first amendment. While this may protect Peter from expulsion from the publicly funded school, this does not protect him from being fired as a university employee. Kevin Page, the chairman of the state Board of Regents, also said Cvjetanovic’s status at UNR would not be affected no matter how many people sign this petition. He claims “UNR police looked at it — he wasn’t arrested, he didn’t break any laws. We don’t have any right to terminate him. Expression of free speech is protected in the country. We don’t like what he said, but that’s what makes this country so great — people can have the right to say what they want.” Let me reiterate that Kevin Page “didn’t like” what he said. Kevin Page has failed to acknowledge that these are groups that promote the killing of people who are not like them and violence against those who disagree with them. In fact, it was this march that killed Heather Heyer. This is not about “not liking” what Peter did. Peter participated and contributed his physical presence to this march. He booked a ticket from Nevada to Virginia. He planned his attendance well in advance. When you befriend a Nazi, you are sympathizing with a Nazi, you enable a Nazi, you become the Nazi. Peter recently said in an interview that he ‘condemns’ Nazis and stresses he isn't an 'angry racist'. Peter, you cannot ‘condemn’ them and also participate in a rally with them. It can't be both. Your actions have spoken louder than your words. Employment attorney Andrew Rempfer agrees with this. He states that an employee checks his constitutional rights at the door of his job and that employees can be terminated for off-duty conduct. Rempfer states “I’m frankly surprised they haven’t fired him. If it were my paralegal who went off-site and was at an active rally like that, I’d fire her in a heartbeat. It’s off-duty conduct that besmirches what I do. I wouldn’t find a client who would be willing to hire me, and I don’t condone it in the first place.” I am all for freedom of speech, but there’s a huge difference between expressing your views civilly versus participating and marching in a violent rally joined by the KKK and Neo-Nazis. Free speech is not freedom from consequence at an institution of higher learning. So, it comes down to this: the university can take action, it just does not want to fire Peter. They have found a politically correct way to say ‘yea this sucks, and we can do something about it, but we don’t care enough to’. Nevada is an at-will state – in U.S. labor law, it means an employee can be dismissed by an employer for any reason (that is, without having to establish “just cause” for termination), and without warning. The university’s decision is beyond embarrassing, and scary for all current students who attend the school. The University of Nevada, Reno does not care about you. Sorry. To those who signed this petition, or to those reading who oppose their decision– here’s what you can do: 1) If you donate to the school, pull out your support. 2) If you are a current student, let the university hear you, be vocal. Suggest how they can better support you. Hold them accountable to it. Go to your local press. Be proactive and vigilant about what you will and will not stand for. I trust you do this already, but right now, it is especially important. Or better yet - switch to another school. Do not waste your money here. 3) Get in touch with people I've mentioned in this article. 4) Keep signing this petition. I am not taking it down (my latest update explains why). 5) All prospective students - Keep away from UNR! I promise you, you can do better. Keep spreading the word about this decision. And lastly, let this situation serve as a case study of a broader issue in America: privilege based on race and gender. Basically, you can be an outward Nazi-sympathizing white supremacist participating in world-condemned terrorism, and your all-white male superiors will still support you.

Q: Subtract corresponding lines I have two files, file1.csv 3 1009 7 1012 2 1013 8 1014 and file2.csv 5 1009 3 1010 1 1013 In the shell, I want to subtract the count in the first column in the second file from that in the first file, based on the identifier in the second column. If an identifier is missing in the second column, the count is assumed to be 0. The result would be -2 1009 -3 1010 7 1012 1 1013 8 1014 The files are huge (several GB). The second columns are sorted. How would I do this efficiently in the shell? A: Assuming that both files are sorted on second column: $ join -j2 -a1 -a2 -oauto -e0 file1 file2 | awk '{print $2 - $3, $1}' -2 1009 -3 1010 7 1012 1 1013 8 1014 join will join sorted files. -j2 will join one second column. -a1 will print records from file1 even it there is no corresponding row in file2. -a2 Same as -a1 but applied for file2. -oauto is in this case the same as -o1.2,1.1,2.1 which will print the joined column, and then the remaining columns from file1 and file2. -e0 will insert 0 instead of an empty column. This works with -a1 and -a2. The output from join is three columns like: 1009 3 5 1010 0 3 1012 7 0 1013 2 1 1014 8 0 Which is piped to awk, to subtract column three from column 2, and then reformatting.

Syria Call: The spokesman of the National Liberation Front, Capitan "Naji Mustafa," said that the components of the Front will fight every hand will extend to them, rejecting any proposal to disband their factions through threat or extortion. Capt. said in a statement on Monday ,commenting on the initiatives calling for resorting to the religion to end disputes with the aggressors of Julani's group (HTS): "We affirm that our constant position, which has not changed since the dawn of the revolution is the full acceptance of the law of God and satisfaction with,, while the other. He accused "Hay'at Tahrir Al-Sham" of abominations and aggression, saying: "The prostitutes do not call us today dark or sinful, but is to overcome and aggression frankly without suspicion or interpretation, not Abhin blood and not empty fronts." He pointed out to the revolutionary factions that "the one who started to invoke his law is the one who started the fight against the aggressors, referring to the people that have been victims. It should be noted that after the control of "HTS" on the entire western countryside of Aleppo, military reinforcements were brought yesterday night towards the cities of "Ma'arat al-Nu'man" and "Ariha", the key strongholds of the "National Liberation Front" in Idlib province.

“I don’t want to be at the mercy of my emotions. I want to use them, to enjoy them, and to dominate them.” ~ Oscar Wilde Would you describe yourself as emotional? Do you feel like your mood can change instantly according to what happens in your day? Then you may be a slave to your emotions. Being an emotional person and leading with the heart can both be great qualities. Leaning into our feelings allows us to be more self-aware and helps connect us to others. But if we allow our emotions to dictate how we live our lives, it can lead to anxiety, depression, and even have a negative impact on our health and relationships. As an empathetic person who feels things deeply, I have learned this lesson the hard way. It took me many years to grasp the concept that all emotions stem from thought. As a young woman with low self-esteem, I didn’t realize that my negative self-talk and sensitivity to others’ opinions were having a profound effect on my emotions and moods. After years of faulty thinking about who I was and what I had to offer in life, I found myself in my doctor’s office clutching a prescription for anti-depressants. My emotions had officially taken control of my life. At the time I had no idea that each negative thought was having a compound effect on how I viewed myself and my life. The older and wiser me has learned to be very aware of my emotions and to check in with myself on several levels before allowing them to have the final say. Here are some of the lessons I’ve learned over the years to help me manage my emotions rather than allowing them to lead the way. Validate your emotions first. When you find yourself riding the wave of emotion, it’s important not to dismiss those feelings. Emotions can be a lot like unruly children in need of attention. Once we validate them, we allow them to be seen and have a voice. Feeling our emotions is an important part of life; it’s what we do with them that can create problems. For example, if I’m feeling bored, sad, or lonely, I tend to turn to food for comfort. This usually doesn’t end well. As I gain weight I then feel even worse because now my self-esteem suffers. Leaning into my emotions instead of numbing them with food has been a huge part of my process. When we validate our emotions, we become more aware and accepting of them, and we begin to understand where they come from. It’s only in this place of awareness that we can see what power they may hold over us. Be aware of your triggers. If you know you struggle with specific emotions, such as anger, jealousy, or fear, try to become aware of the circumstances that trigger them. In my own life, I have learned that I often feel angry when I am disrespected or unappreciated. So if I ask my kids several times to do something and they ignore me, I feel anger beginning to rise inside. Not too long ago I would have given in to the emotion and started to shout, whereas nowadays I’m able to tune in to the preceding thought—they don’t respect me—recognize that it isn’t true, and avert the anger. Awareness is power; it gives us the control to choose how we respond. Always remember that emotion is derived from thought. If we find ourselves experiencing strong emotions, it’s helpful to examine the thoughts that preceded them. Then ask the question, are these thoughts based on truth, or my perception of the truth? Write it down. One of the biggest tools in helping me deal with my emotions has been to write them down. I have been journaling daily for about three years now, always asking questions about my emotions and trying to dig beneath the surface-level thoughts. If I feel at the mercy of my emotions, I’ll ask a simple question in my journal, such as, why do I feel so overwhelmed today? From there I can work back through the sequence of events and thoughts that have led me there. I will then ask a positive action question to engage with another emotion, such as, what is one positive thing I can do for myself right now? If you don’t have time to write, try to at least ask the questions. Take responsibility. How many times have you told someone that his or her actions made you feel a certain way? For example, “You made me angry when you were late.” It’s true that other people’s words and actions affect us, but we also need to take responsibility for the emotions we feel in response to those words and actions. No one can make you feel anything; it’s always your choice. So often the reactive emotions we feel are based on our own perception of the truth, and on the things that matter to us. Being late may be one of your triggers for anger, but for someone else it may be their norm and no big deal. Consider also that people act a certain way based on many influences that differ from your own, such as culture, upbringing, beliefs, and life experiences. Take time away. When you’re strongly connecting with a negative reactive emotion, it’s important to take time away from the person or situation you are reacting to. Never act on strong emotion. Wait until you are feeling calm and have given yourself time to rationalize and think. Only then should you act. Even if the emotion is a positive one, it can still lead you down a destructive path. How many times have you done something you later regret in the name of love? Create your mantra. It’s easy to say, “Take time away,” but hard to do in the heat of the moment. If I find myself beginning to anger and I’m not able or quick enough to remove myself from the situation, I try to connect with my mantra. A mantra is just a word or short phrase that helps you become aware of your emotion and not be controlled by it. The word I use is “soft” because I associate this with a gentle temperament. For you it may be something completely different, depending on the emotion you are most reactive to. Ultimately, it’s important to remember that you are not your emotions—you have the ability to decide if they lead you or if you lead them. As you build awareness and learn to recognize your triggers, you will become increasingly savvy about when your emotions are serving you well and when you may need to take charge of them. Emotions image via Shutterstock About Claire De Boer Claire De Boer is a writer and teacher with a passion for stories and a strong belief in their power to heal and connect us. Her vision is to empower people to become their authentic selves and to live more abundantly using the tool of writing. Visit Claire’s website to access her free eCourse and content library.

Dessa maneira, não se pode condenar os empresários e investidores que hesitam na hora de apostar na recuperação do Brasil, prometida por Dilma. Afinal, é preciso ser muito cândido para se arriscar a fazer investimentos de longo prazo num país cuja presidente perambula às tontas entre a necessidade evidente de ajustar a economia e a destrambelhada ideologia estatista gravada em sua alma. O episódio envolvendo o Banco Central, que criou enorme incerteza a respeito do controle da inflação, é revelador do que vai por este governo, que trocou o planejamento pela esquizofrenia. Não há nenhuma maneira de prever se Dilma Rousseff está realmente disposta, como diz, a enfrentar o desafio de realizar um verdadeiro ajuste fiscal, de manter os índices de preços dentro da meta estabelecida e de promover as reformas que são urgentes para desafogar o Estado e restabelecer a confiança do setor produtivo. A presidente não consegue convencer nem mesmo seu partido, o PT, da necessidade de apertar o cinto, talvez porque ela mesma não esteja certa disso. Todas as medidas de corte de gastos prometidas por Dilma foram apenas parcialmente adotadas, e a muito custo. Diante dessa gritante falta de convicção, não surpreende que o Congresso lhe seja terreno pedregoso, e que lá ninguém tenha ânimo para defender medidas cuja eventual impopularidade a própria presidente tem pavor de enfrentar. Assim, o único labor ao qual a tropa de choque do Planalto tem se dedicado com afinco é o toma lá da cá com os partidos aliados para evitar o impeachment. Essa não é uma situação circunstancial. As agruras do País se devem à incapacidade de Dilma de exercer o cargo que ocupa. A presidente não conseguiu construir, ao longo de cinco anos, o proverbial patrimônio de credibilidade ao qual os estadistas recorrem em momentos de crise. Falta-lhe o conjunto de qualidades que assegurariam à Nação a certeza de que, por pior que fosse a tormenta, sempre haveria uma liderança competente para conduzir o Brasil a bom porto. Ao contrário: o imenso edifício da crise atual, como já sabe a maioria dos brasileiros, foi construído, tijolo por tijolo, por Dilma em pessoa. Logo, como nada tem a oferecer para provar que é capaz de fazer o que tem de ser feito, resta-lhe bradar que é “honesta”, como se não fosse essa uma obrigação e como se apenas honestidade fosse bastante e suficiente neste momento. O Brasil está paralisado porque ninguém sabe o que se passa na cabeça da pessoa que tem a responsabilidade de tomar as decisões que terão impacto na vida de todos. Antes de sua reeleição, Dilma prometia manter firmes os fundamentos da economia; durante a campanha, atacou todos aqueles que apontavam a necessidade do ajuste fiscal ante o crescente descalabro das contas; reeleita, a petista voltou a garantir que controlaria a inflação e enxugaria gastos. Agora, fala em ajuste, mas à base de mais impostos e de estímulos que já se provaram aziagos. Esse zigue-zague de Dilma resultou numa disparada da inflação, no descontrole dos gastos e na alta do desemprego. Sua falta de credibilidade contaminou todo o governo – a última vítima foi o Banco Central. A passagem de Dilma pela Presidência, de tão insensata, poderia inspirar a lembrança de um aforismo grego recuperado pelo filósofo Isaiah Berlin: “A raposa sabe muitas coisas, mas o ouriço sabe uma coisa muito importante”. Dilma não é nem a raposa, que sabe muitas coisas, nem o ouriço, que sabe uma coisa muito importante. Ela não sabe nada.

Tens of millions of pounds of UK aid money has been siphoned through charities linked to Hillary Clinton, it emerged last night. British politicians – including Gordon Brown – stand accused of diverting huge amounts of cash through the organisations after falling under the spell of the US presidential candidate and her husband Bill. At least £50 million of taxpayer-funded foreign aid money has gone to Clinton charities, which are at the centre of allegations in the US that foreign governments used donations to buy influence. The UK is one of the biggest donors, handing over more than £20 million last year alone to the Clinton Health Access Initiative (CHAI), an organisation chaired by former President Bill, 68, and whose board includes the couple's daughter Chelsea, 35. Since 2011, a total of £48.9 million has gone into the coffers of this charity alone. Controversy: At least £50 million of taxpayer-funded foreign aid money has gone to Clinton charities, which are at the centre of allegations in the US that foreign governments used donations to buy influence Tory backbenchers say the revelation is symptomatic of the fact that the Department for International Development has so much money to spend that large amounts have to be simply handed to global charities, often leading to huge amounts of waste. The Clinton charities are involved in running projects receiving some £107 million from DfID since 2009 – although not all of this money went to their organisations. But critics are concerned that waste at CHAI is so high that British taxpayers may end up paying millions of pounds of management charges – money which they say would be much better spent on front-line disaster relief. Britain spends £12 billion a year on overseas aid, thanks to a new law which commits the Government to spending 0.7 per cent of national income on international development. CHAI spends its funds on improving the treatment of HIV/Aids, malaria and tuberculosis in the developing world, mainly in Africa. But a new book claimed that foreign governments and individuals received favourable treatment from the US government in return for donations to Clinton family charities. The revelations have proved an embarrassment for Mrs Clinton, 67, who has moved to distance herself from the charities. DAVE'S LAST-MINUTE £415MILLION HANDOUT JUST TO MEET 0.7% FOREIGN AID SPENDING TARGET Aid officials wrote a cheque for nearly half a billion pounds to an international charity in a desperate effort to meet David Cameron's spending target, it emerged last night. The extraordinary sum was rushed to the Swiss-based Global Fund with only days left to go to ensure the Government met its controversial pledge to spend 0.7 per cent of national income on aid. It meant Britain ended up providing more than a fifth of the organisation's total budget – twice the planned scale of donation, it was claimed last night. The Global Fund pays its 600 staff an average salary package of almost £130,000, and has also recently commissioned an expensive new lakeside headquarters in Geneva. The body was set up by the G8 to fight Aids, tuberculosis and malaria. Details of the enormous pledge in December 2013 were made public in a National Audit Office report. Last night a Department for International Development spokesman said the report concluded the timing of the donation 'made no impact on the scale of our investment'. He added: 'With our support, the Global Fund will save a life every three minutes.' Advertisement In 2008, Mr Brown addressed a meeting of the Clinton Global Initiative. The Clinton Foundation, the main family charity, revealed that the UK Government had been making donations since the following year – when Mrs Clinton took office as US Secretary of State. The UK's donations to the Clinton charities took off after then International Development Secretary Andrew Mitchell met Mrs Clinton at a UN summit in New York in 2010. An examination of published payments over £500 made by DfID in 2014 reveals that CHAI received £20.2 million, with £4.8million spent up to the end of May this year. In 2013, £13.1 million was handed over, with £9.6 million going to CHAI in 2012 and £1.1 million in 2011. Before this date there are no published figures. It is not known how much went to the Clinton Foundation. Philip Davies, the Tory MP for Shipley, said: 'The fact we are spending more and more on aid when we are massively in debt is bad enough, but when it is being tossed away for vanity reasons to ingratiate UK politicians with the rich and powerful in the US … I think most people would find that distasteful and unacceptable.' Jonathan Isaby, of the TaxPayers' Alliance, said: 'The ludicrous aid target means all too often DfID officials are desperate to spend money in any way they can, which is nothing more than irresponsible. We need DfID to provide far more transparency.' A DFID spokesman said: 'The Department for International Development does not fund the Clinton Foundation. DFID does fund the Clinton Health Access Initiative, an independent NGO founded in 2010.'

var baseForOwnRight = require('../internal/baseForOwnRight'), createFindKey = require('../internal/createFindKey'); /** * This method is like `_.findKey` except that it iterates over elements of * a collection in the opposite order. * * If a property name is provided for `predicate` the created `_.property` * style callback returns the property value of the given element. * * If a value is also provided for `thisArg` the created `_.matchesProperty` * style callback returns `true` for elements that have a matching property * value, else `false`. * * If an object is provided for `predicate` the created `_.matches` style * callback returns `true` for elements that have the properties of the given * object, else `false`. * * @static * @memberOf _ * @category Object * @param {Object} object The object to search. * @param {Function|Object|string} [predicate=_.identity] The function invoked * per iteration. * @param {*} [thisArg] The `this` binding of `predicate`. * @returns {string|undefined} Returns the key of the matched element, else `undefined`. * @example * * var users = { * 'barney': { 'age': 36, 'active': true }, * 'fred': { 'age': 40, 'active': false }, * 'pebbles': { 'age': 1, 'active': true } * }; * * _.findLastKey(users, function(chr) { * return chr.age < 40; * }); * // => returns `pebbles` assuming `_.findKey` returns `barney` * * // using the `_.matches` callback shorthand * _.findLastKey(users, { 'age': 36, 'active': true }); * // => 'barney' * * // using the `_.matchesProperty` callback shorthand * _.findLastKey(users, 'active', false); * // => 'fred' * * // using the `_.property` callback shorthand * _.findLastKey(users, 'active'); * // => 'pebbles' */ var findLastKey = createFindKey(baseForOwnRight); module.exports = findLastKey;

Sure, you know your mobile phone is essential, but exactly how much can you rely on it? A few days ago in Japan, Google threw down a gauntlet: how far can you get in a foreign country, where you can’t be sure of finding an English speaker, where the words, even the alphabet, are unfamiliar, and where the address system is notoriously tricky? So there I was, in Tokyo, charged with solving a series of puzzles using a smartphone and nothing more. First, I had to get myself from bustling Tokyo (where English speakers are plentiful and, because they are Japanese, endlessly helpful) to the distant city of Kanazawa. I had a JR train pass, which is the best way to get around Japan for a foreigner and which offers fantastic value, though you must buy it before you arrive in the country. So first, I needed to get to Tokyo station. This being a Google challenge, I’d been briefed on exactly which of the company’s apps would be helpful. First up was Google Maps which includes public transport in its knowledge base. I was using the company’s new handset, the Pixel XL. Speaking the name of the station was enough for it to guide me on foot to the nearest underground station, with detailed instructions of which train line and platform I needed. Gadget and tech news: In pictures Show all 25 1 /25 Gadget and tech news: In pictures Gadget and tech news: In pictures Gun-toting humanoid robot sent into space Russia has launched a humanoid robot into space on a rocket bound for the International Space Station (ISS). The robot Fedor will spend 10 days aboard the ISS practising skills such as using tools to fix issues onboard. Russia's deputy prime minister Dmitry Rogozin has previously shared videos of Fedor handling and shooting guns at a firing range with deadly accuracy. Dmitry Rogozin/Twitter Gadget and tech news: In pictures Google turns 21 Google celebrates its 21st birthday on September 27. The The search engine was founded in September 1998 by two PhD students, Larry Page and Sergey Brin, in their dormitories at California’s Stanford University. Page and Brin chose the name google as it recalled the mathematic term 'googol', meaning 10 raised to the power of 100 Google Gadget and tech news: In pictures Hexa drone lifts off Chief engineer of LIFT aircraft Balazs Kerulo demonstrates the company's "Hexa" personal drone craft in Lago Vista, Texas on June 3 2019 Reuters Gadget and tech news: In pictures Project Scarlett to succeed Xbox One Microsoft announced Project Scarlett, the successor to the Xbox One, at E3 2019. The company said that the new console will be 4 times as powerful as the Xbox One and is slated for a release date of Christmas 2020 Getty Gadget and tech news: In pictures First new iPod in four years Apple has announced the new iPod Touch, the first new iPod in four years. The device will have the option of adding more storage, up to 256GB Apple Gadget and tech news: In pictures Folding phone may flop Samsung will cancel orders of its Galaxy Fold phone at the end of May if the phone is not then ready for sale. The $2000 folding phone has been found to break easily with review copies being recalled after backlash PA Gadget and tech news: In pictures Charging mat non-starter Apple has cancelled its AirPower wireless charging mat, which was slated as a way to charge numerous apple products at once AFP/Getty Gadget and tech news: In pictures "Super league" India shoots down satellite India has claimed status as part of a "super league" of nations after shooting down a live satellite in a test of new missile technology EPA Gadget and tech news: In pictures 5G incoming 5G wireless internet is expected to launch in 2019, with the potential to reach speeds of 50mb/s Getty Gadget and tech news: In pictures Uber halts driverless testing after death Uber has halted testing of driverless vehicles after a woman was killed by one of their cars in Tempe, Arizona. March 19 2018 Getty Gadget and tech news: In pictures A humanoid robot gestures during a demo at a stall in the Indian Machine Tools Expo, IMTEX/Tooltech 2017 held in Bangalore Getty Gadget and tech news: In pictures A humanoid robot gestures during a demo at a stall in the Indian Machine Tools Expo, IMTEX/Tooltech 2017 held in Bangalore Getty Gadget and tech news: In pictures Engineers test a four-metre-tall humanoid manned robot dubbed Method-2 in a lab of the Hankook Mirae Technology in Gunpo, south of Seoul, South Korea Jung Yeon-Je/AFP/Getty Gadget and tech news: In pictures Engineers test a four-metre-tall humanoid manned robot dubbed Method-2 in a lab of the Hankook Mirae Technology in Gunpo, south of Seoul, South Korea Jung Yeon-Je/AFP/Getty Gadget and tech news: In pictures The giant human-like robot bears a striking resemblance to the military robots starring in the movie 'Avatar' and is claimed as a world first by its creators from a South Korean robotic company Jung Yeon-Je/AFP/Getty Gadget and tech news: In pictures Engineers test a four-metre-tall humanoid manned robot dubbed Method-2 in a lab of the Hankook Mirae Technology in Gunpo, south of Seoul, South Korea Jung Yeon-Je/AFP/Getty Gadget and tech news: In pictures Waseda University's saxophonist robot WAS-5, developed by professor Atsuo Takanishi Rex Gadget and tech news: In pictures Waseda University's saxophonist robot WAS-5, developed by professor Atsuo Takanishi and Kaptain Rock playing one string light saber guitar perform jam session Rex Gadget and tech news: In pictures A test line of a new energy suspension railway resembling the giant panda is seen in Chengdu, Sichuan Province, China Reuters Gadget and tech news: In pictures A test line of a new energy suspension railway, resembling a giant panda, is seen in Chengdu, Sichuan Province, China Reuters Gadget and tech news: In pictures A concept car by Trumpchi from GAC Group is shown at the International Automobile Exhibition in Guangzhou, China Rex Gadget and tech news: In pictures A Mirai fuel cell vehicle by Toyota is displayed at the International Automobile Exhibition in Guangzhou, China Reuters Gadget and tech news: In pictures A visitor tries a Nissan VR experience at the International Automobile Exhibition in Guangzhou, China Reuters Gadget and tech news: In pictures A man looks at an exhibit entitled 'Mimus' a giant industrial robot which has been reprogrammed to interact with humans during a photocall at the new Design Museum in South Kensington, London Getty Gadget and tech news: In pictures A new Israeli Da-Vinci unmanned aerial vehicle manufactured by Elbit Systems is displayed during the 4th International conference on Home Land Security and Cyber in the Israeli coastal city of Tel Aviv Getty To be frank, for visitors to Japan, this is an essential app. It gives you accurate details of how long your journey will take, even down to the time changing trains. It is reliable and comprehensive enough to make the most uncertain traveller feel completely confident. I used Google Maps plenty on this trip and it never let me down. Since the numbering of houses in Japanese streets is not predictable, being based on in which they were built, this app was unbelievably valuable later, when searching for a street address. Another app, Citymapper, also proved useful. Citymapper only works in selected cities, but has phenomenal detail levels, even telling you which part of the train to board so you can exit most quickly. Once at Tokyo station, I relied on the fact that the station staff spoke good English, gave me my ticket and directed me to the platform. I’m not sure any phone app could have been as helpful. On board, the two-hour-and-a-bit journey to Kanazawa was uneventful, with Google Maps as well as the carriage announcements letting me know how much further to go. I’d note in passing that Japan Rail trains are super-cool, from the conductors who touchingly bow as they enter and leave each carriage, to the seats which all face in the same direction but which, with one press of a lever can be spun through 180 degrees so groups of four or six face each other. Kanazawa is a city surrounded by mountains. It has two national parks, two rivers running through it and is picturesque. It’s known for gold leaf, which it has been producing for hundreds of years and almost all the gold leaf in Japan is made here. At the Kanazawa Noh Museum, my first task was to find masks that matched items in my smartphone photo library via cryptic clues sent by the Google messaging app Allo. Allo is a useful messaging app which, like many Google apps, works as happily on Android and iOS devices. On the Pixel phone, Google Photos is where pictures are found. It can search in sophisticated ways. So, in response to a clue for “something that was a colour and a fruit”, typing orange into the search box revealed photos dominated by the colour. This also works if you type, dogs, say, and canine photos pop up. It’s all done by machine learning: you don’t need to categorise photos. It works spookily well. Apple has recently revealed a similarly impressive feature in its latest iPhone software. The next app to be demonstrated, Duo, is for video calling. It’s Google’s answer to Apple’s FaceTime. It promises smooth switching from wi-fi to 4G and its headline-grabbing USP is Knock Knock, which shows live video of an incoming call before you decide to answer, on the basis that if what the caller is doing is intriguing enough, you’re more likely to answer. Apple’s FaceTime has an audio option, which is handy if you’re in a poor cell-tower area, but Duo lacks this. Still, I found video calls – especially when in a wi-fi area when they were free – to be as effective here as the first time I used Apple’s version. Since the challenge involved a game of charades with, I kid you not, a distant geisha acting out Japanese proverbs, Duo was essential. Not everyone finds themselves playing video charades to overcome the language barrier, but I guess you never know. The camera on the Pixel XL, is excellent. Recently it has been found to be prone to lens flare, which will be compensated for by software in a future update. Features such as creating quick animations were easily mastered and I like the way the burst shots have a kind of motion when you swipe past them in the phone’s photo library. Two other apps were real stand-outs on the Japanese journey. Google Translate, obviously, was a real help. There are other translation apps around but this is arguably the most versatile. You can type a question in English, or speak it, and the phone will display your question in Japanese, speak it for you and show a phonetic transliteration of what you should say in Japanese if you’re brave enough. I found that sometimes it was enough to hold the phone up and let the native speaker hear what the phone said, though asking them to read the text worked better. You can also touch a camera icon and the app can translate printed text. This was brilliant, though most effective when you worked through translation a bit at a time: translating a whole page swapped you to a new page and it was hard to get back again, so a new photo was required. There’s a conversation mode which kept things going well, though using this feature took a bit of practice. Offline capabilities meant you didn’t need a constant data connection, though not every feature worked without it. But this is undoubtedly a highly accomplished app, especially on Android. A word on phone data, on which nearly all these apps depend. Data in Japan is prohibitively expensive, so it’s worth considering a local data sim, and running a separate handset for it. I used a prepaid sim card from Bmobile which cost £22 for 5GB of data spread over 21 days. It was a data only sim; I used my regular phone for calls. Finally, there’s Google Assistant. In its most advanced state, this is only available on the Pixel and Pixel XL phones right now. And as voice-activated assistants go, it’s excellent. Like Apple’s Siri, it’s clever enough to handle follow-up questions. You can say “What’s the weather like in Tokyo?” wherever you are and follow up with “How about tomorrow?” and it’ll know you’re still talking about Tokyo. Introducing Google's phone - Pixel I notice, mind you, that neither can manage the answer to the question, “Was Ronnie Barker older than Ronnie Corbett?”. The underrated Evi app (now owned by Amazon but still available for Android and iPhone) passed this test happily, though better using text input than voice. Since you ask, Barker was born first but Corbett lived longer. International travellers also need to be mindful of battery life. The full-on, all-day challenges sapped the battery on both my phones (Pixel and iPhone). If you’re relying on your phone in this way, remember to pack a rechargeable battery. True, I was posting on Instagram, Facebook and Twitter at a fair old rate, but even a less busy day could see the battery failing before nightfall. So how good was Google at getting me through the challenges? Pretty marvellous, actually. Finding an address in a place like Japan is horribly confusing and unnerving. Google Maps sorted this perfectly, whether I was searching by landmark, street address or even co-ordinates, though this will be a function most will avoid. Being able to translate written text as well as spoken words was also a lifeline. To be honest, just as effective and ultimately more pleasing were the interactions with locals, you know, real human beings. Even in Kanazawa, many spoke enough English for me to muddle through – and their English was 300 times better than my Japanese. One taxi driver, ferrying me across town, took such pride in pointing out the museum, the town hall, the castle, the stunningly beautiful zen-like gardens that it was deeply touching.

Q: How to make Digest Authentication with http in Flutter? I am trying to make an ApI request with Digest Authentication. I found an answer to the above question FLUTTER How to implement Digest Authentification but it is not very clear. The docs for digest are very minimal. Following is my code import 'package:http/io_client.dart' as io_client; import 'package:http/http.dart' as http; try { HttpClient authenticatingClient = HttpClient(); authenticatingClient.authenticate = (uri, scheme, realm) { authenticatingClient.addCredentials( uri, realm, HttpClientDigestCredentials( DIGEST_AUTH_USERNAME, DIGEST_AUTH_PASSWORD)); return Future.value(true); }; http.Client client = io_client.IOClient(authenticatingClient); final response = await client.post(LOGIN_URL, body: { "username": userName, "password": password, "user_group": 2 }).timeout(const Duration(seconds: 20)); if (response.statusCode == 200) { debugPrint(response.body); CurvesLoginModel curvesLoginModel = standardSerializers.deserializeWith( CurvesLoginModel.serializer, json.decode(response.body)); return curvesLoginModel; } else { return null; } } on TimeoutException catch (_) { return null; } on SocketException catch (_) { return null; } } But what is realm in addCredentials. Also is this the way to implement Digest Authentication in http for Flutter? As soon as I hit my endpoint I get the following error Unhandled Exception: type 'int' is not a subtype of type 'String' in type cast A: Realm is an arbitrary string provided by the web server to help you decide which username to use, in case you have more than one. It's sort of analogous to domain. In one domain your username might be fbloggs, in another fredb. By telling you the realm/domain you know which to provide. Your cast problem is caused by using the value 2 in the body. That must be a Map<String, String>, but you have provided an integer. Replace it with 2.toString().

Plants Search Common name Scientific name Karri Eucalyptus diversicolor Karri: Eucalyptus diversicolor Common name: Karri Scientific name: Eucalyptus diversicolor (Myrtaceae) Alternative common names: Karie (Afrikaans) A tall, dense, massively branched, evergreen tree 25-58m high with smooth bark that is grey-blue in colour with orange-yellow blotches. Dark green leaves which are glossy above and distinctly paler beneath. Cream flowers appear from May to December. The fruit capsules are globular and brown. This tree invades forest clearings, fynbos, roadsides and water courses. Additional Info Where does this species come from? South-western Australia. What is its invasive status in South Africa? CARA 2002 – Category 2 NEMBA - a. Category 1b within- (i) riparian areas; (ii) a Protected Area declared in terms of the Protected Areas act; or, (iii) within a Listed Ecosystem or an ecosystem identified for conservation in terms of a Bioregional Plan or Biodiversity Management Plans published under the Act. b. Not listed within Nama-Karoo, Succulent Karoo and Desert biomes, excluding within any area mentioned in (a) above. c. Category 1b in Fynbos, Grassland, Savanna, Albany Thicket, Forest and Indian Ocean Coastal Belt biomes, but- (i) Category 2 for plantations, woodlots, bee-forage areas, wind-rows and the lining of avenues. (ii) Not listed within cultivated land that is at least 50 metres away from untransformed land, but excluding within in any area in (a) above. (iii) Not listed within 50 metres of the main house on a farm, but excluding in (a) above. (iv) Not listed in urban areas for trees within a diameter of more than 400 mm at 1000 mm height at the time of publishing of this Notice, but excluding in (a) above. Where in South Africa is it a problem? Western Cape. How does it spread? Spreads by seed dispersal. Why is it a problem? It competes with and has the potential to replace indigenous species. Trees along watercourses are likely to reduce stream flow.

New Zealand high school students have demanded examiners ignore that they don’t know what the word “trivial” means, after it appeared in a final-year exam and left many confused. Some students who took the year 13 history exam claimed the “unfamiliar word” was too hard, and the exam should now be marked according to each student’s different understanding and interpretation of “trivial”. The exam asked for students to write an essay on whether they agreed with a quote from Julius Caesar which reads: “Events of importance are the result of trivial causes”. An online petition claims the word trivial “caused much confusion” in the Wednesday exam and many students “were not particularly familiar with” the word. More than 2,500 people have signed the petition, calling on the New Zealand Qualifications Authority [NZQA] to “recognise the true potential of the students and mark the essay based on the student’s own content and understanding of the event, many of which were different to what the word actually means.” Year 13 student Logan Stadnyk who took the exam told local media that at least half of his classmates thought trivial meant “significant”. “Trivial isn’t a word that you hear too frequently, especially not if you’re in Year 13,” Stadnyk said. Kristine Kilkelly, NZQA deputy chief executive assessment officer, said the exam was written by experienced history teachers who had judged it suitable for year 13 students. “The language used in the question, such as the word ‘trivial’, was expected to be within the range of vocabulary for a NCEA Level 3 History student,” Kilkelly said. “If candidates have addressed the quote and integrated their ideas with it, then they will be given credit for the strength of their argument and analysis and will not be penalised for misinterpreting the word ‘trivial’.” “There have been no changes as a consequence of the petition.” According to NZQA 6,300 students were enrolled to sit the exam and the authority had received 13 complaints regarding it.

Q: Adding a barcode scanner to an android application just to decode using Zxing I've been searching on how to add a barcode scanner to my app just to decode barcodes. I found a really good application I could intergrate to do that called "Zxing" but the only problem is, it has encoding and decoding but what i really want is only decoding so that I could limit what I use from the Zxing open source file. Ive searched plenty of places couldnt find just decoding with zxing? So my question is how could I use Zxing only to decode and not to encode aswell? Example codes and step by step instructions will be really appreciated. Thanks in Advanced! A: The simplest way to do it is scan via Intent. here is some sample code: //This intent will ask the Barcode Scanner app to scan a code and give us the result Intent intent = new Intent("com.google.zxing.client.android.SCAN"); /* you can optionally add an extra to the intent that tells it what type of code its looking for. Like this: * * intent.putExtra("SCAN_MODE", "QR_CODE_MODE"); * * If you don't put that in it will scan all types. */ startActivityForResult(intent, 0); Then in your onActivityResult() you can get the scanned data like this: public void onActivityResult(int requestCode, int resultCode, Intent intent) { if (requestCode == 0) { if (resultCode == RESULT_OK) { // contents contains whatever was encoded String contents = intent.getStringExtra("SCAN_RESULT"); // Format contains the type of code i.e. UPC, EAN, QRCode etc... String format = intent.getStringExtra("SCAN_RESULT_FORMAT"); } } } EDIT: The Intent model is built in to the very core idea of android. And it was put there for good reason. By having only 1 application that handles the scanning of barcodes and just returns the result to any other application that wants to make use of it, we get less wasted space. For instance, if a user has 5 apps that all scan different barcodes and do various things with them if all 5 of those apps include their own barcode decoding within their own app, the user now has 5 copies of the barcode reading functionality on their device wasting space. Another upside to the Intent model(specifically with barcode decoding) is that it allows your application to require fewer permissions. Because you no longer need access to the camera. It also makes everything much simpler for the developer. As you can see above the amount of effort it takes to integrate with zxing via intent is minimal. You'll find that it is possible to re-use some portions of the Zxing project and include them within your application. But that it is much more difficult to get up and running. The ZXing project is open sourced so you are of course welcome to start picking through the source to figure out which classes you'll need to manually copy to your project. I suggest that if you intend to go this route that on your first attempt you do not try to remove the encoding functions. Get the entire thing up and working, and then start removing stuff. It is likely that if you try to take only some subset of the project some things won't function properly even though they don't seem like they should be affected by what you've left out. One last bit of advice, I totally understand why you want to include this functionality within your own app(I've been there myself). But don't make this decision lightly and do take some time to consider things like this: Lets say you do include this functionality within your own application. All goes well for a while. But after some time goes by you start to see strange errors popping up on some devices that cause them to be unable to use the scanning functionality of your app. Now you will be in a situation where you are going to have to try to debug and fix something that you did not create, and likely do not completely understand all of what is going on under the hood of. Whereas integrating with Intents makes it so that this debugging and fixing is done by the people who actually know every bit of how it works and what problems need addressed, and they work on their own update schedule. So this fixes will get out to the masses much quicker than you could probably get them out.

First Few Days at the Nursery I am sorry I haven’t been around for a while. Days are going too fast and it’s been pretty busy recently: Daniella’s very first few days at the nursery, Harry’s teething and all of us having some mild but unpleasant flu. It’s all falling back into places now, so I am back at my blog and I will try hard to keep up with my posts. 🙂 Daniella’s first few days at the nursery went better than I ever thought it would! I think she was so ready for that! We firstly went there for the induction with my toddler girl (Edward was working). I was sitting there in the play room, doing the paperwork for about an hour, while Daniella was playing around. She quickly started interacting with other children. Was clearly enjoying herself! Our next visit to the nursery was for Daniella to stay without mummy for about an hour. To see how she gets on with it. She was a little hesitant when I was about to leave, but soon, after kissing mummy and Harry goodbye she was off to play with other children again. When I came to pick her up that day, she was not so happy to see me taking her home. I was relieved my little daughter had a good time. Yesterday Daniella’s visit to the nursery lasted for 2.5 hours. She stayed over for lunch. Daniella didn’t want to go home again! I didn’t expect my little one will like her nursery so much. 😀 She had the remains of food around her mouth, that proved to me, that my little girl ate well! Very proud mama I was. 🙂 Before we went home she wanted to show off a bit and went independantly to the toilet. She washed her hands after and wiped them with a tissue, secretly looking at me, to make sure I was watching her. She was very confident there already! Today is Daniella’s first full day at the nursery – 8am to 6pm. she was very excited to go in the morning. This time her daddy took her to the nursery by car. Edward told me, she was not upset at all, said goodbye and went to play with other kids. I was so happy to hear this. My day was so unusually silent without Daniella! Yes, Harry is still here, but my main chatterbox is out and it actually feels, like something is missing in the house. 😀 I managed to do so much more though than I normally manage with two little ones. I have a feeling, that this time off will be useful for both parties – Daniella and mummy. My princess came back from her full day at the nursery all excited but tired. She still normally has a daytime nap when at home, but didn’t sleep at the nursery. However, she had a lot of stories to tell of how she played with other kids, how she was listening to the story, sang a song and ate all her lunch. She even made a mother’s day card for me (with teachers help of course). I wanted to cry!!! As you see, Daniella’s first few days at the nursery went pretty well. At the moment, she will only be doing 15 hours per week and I really do hope she will enjoy it as much, as she does now. Let’s wait and see!

The experimental data has been made available on a stable public repository (the Harvard Dataverse) and can be downloaded using the following link: <https://doi.org/10.7910/DVN/HVRL0S>. The descriptive data from government registers that we use to provide some background/context to the experiment will, of course, not be freely available as Statistics Sweden/the Swedish government prohibits the public dissemination of individual-level registry data (This is regulated in the Swedish Public Access to Information and Secrecy Act). Individual researchers can, however, apply for access to microdata; interested parties should email: <[email protected]>. Introduction {#sec001} ============ The economic integration of immigrants is one of the most pressing policy issues facing Europe today. Though many Western European countries have experienced large-scale migration for decades, their records of integrating migrants into domestic labor markets remain patchy. Millions of immigrants and their descendants remain unemployed or underpaid \[[@pone.0218044.ref001]\]. As a result, a growing literature has begun to investigate barriers to immigrants' economic success, with one strand focusing on the hurdles that migrants encounter during the hiring process. This research has consistently found that job applicants with immigrant origins are less likely to be invited to interviews than are natives \[[@pone.0218044.ref002]\]. Given that discrimination is pervasive, what options do policymakers and migrants have at their disposal to escape ethnic penalties? Existing research has demonstrated that foreign origin presents an obstacle in the recruitment process, but it has less frequently considered whether foreign origin is a proxy for other factors that migrants and policy can influence. If discrimination is largely driven by comparatively fixed ascriptive traits such as ethnicity or gender, states should design policies to help break down employer stereotypes. If, by contrast, employers respond to attributes over which immigrants have some control (cf., \[[@pone.0218044.ref003]\]), such as work experience, citizenship, or signals of religiosity, different policy prescriptions emerge. To provide answers to these questions, we carried out a correspondence study in Sweden and sent applications from fictitious immigrants and natives to restaurant and café jobs. Our outcome of interest is whether applicants received a callback for an interview. Going beyond much existing work, our study employs a factorial design. This design allows us to efficiently test for the impact of a larger range of characteristics (ascriptive traits, changeable attributes, as well as their combinations) than has been the case in previous work (see Appendix B in [S1 File](#pone.0218044.s001){ref-type="supplementary-material"}). Importantly, this approach permits us to test whether origin-based penalties diminish or persist once we vary attributes that employers could systematically link to specific countries of origin. To investigate whether ethnic hierarchies are at work, we consider four origin countries---Sweden, Poland, Iraq or Somalia---that have been shown to occupy different rungs on the ethnic hierarchy ladder. Research on social distance has demonstrated hierarchical orderings, whereby West Europeans and North Americans are positively stereotyped, followed by Southern and Eastern Europeans, Asians and Africans. Such hierarchies have been found to influence views about what groups are preferred neighbors or marriage partners \[[@pone.0218044.ref004]--[@pone.0218044.ref006]\]. We test whether they also extend to labor markets. Additionally, we test whether another comparatively fixed trait---gender---interacts with different ethnicities to shape hiring decisions. Since immigrants cannot easily change perceptions of ethnic hierarchies (or their gender), we next turn to attributes that immigrants can to some degree affect: the adoption of citizenship, the accumulation of skills, and the salience of their religious practice. Scholars have documented that immigrant citizens are more likely to be employed and to earn higher wages than are those who have not naturalized \[[@pone.0218044.ref007]--[@pone.0218044.ref009]\]. One policy prescription for immigrants who want to improve their labor market outcomes is therefore to naturalize. Yet, much of the existing work on the citizenship-employment link is observational and cross-sectional. As a result, it is difficult to disentangle whether citizenship acquisition increases earnings or employment options, or whether unobservable characteristics---such as motivation to work or to stay in the country---cause both naturalization and better economic outcomes. We therefore vary immigrant citizenship and examine whether employers are more likely to call back immigrants who have acquired citizenship. Another way in which immigrants can potentially boost their employment chances is by accumulating work experience early on. Our study consequently tests whether immigrants are more likely to receive callbacks from employers if they indicate more relevant prior work experience. Finally, Adida and colleagues \[[@pone.0218044.ref010]\] find that employers are especially likely to discriminate against Muslim immigrants. One mechanism driving this result are concerns that daily religious practice reduces productivity. Accordingly, some applications prime religious activity, allowing us to examine whether migrants who signal that they are religiously active receive fewer callbacks than those who do not. Our main findings are as follows. First, employer behavior follows ethnic hierarchies: Native Swedes receive the highest response rate (21%), followed by those born in Poland (17%), Iraq (10%), and lastly Somalia (5%). Callback rates for native Swedes are thus four times higher than they are for applicants born in Somalia. Moreover, gender matters. Across groups, women receive higher callback rates, leading to staggering gaps in recruitment: The callback rate for Somali men is *ten* times smaller than that for Swedish or Polish women. Groups that feature prominently in the debate about integration problems---young, low-skilled, male immigrants from Muslim-majority countries---encounter the most discrimination, even when their applications are otherwise identical to those of natives. As we discuss below, among Muslim applicants the positive effect of female gender could in part be driven by higher payoffs to integration signals among women when compared to men. Second, the point estimates for the effects of signaling citizenship, work experience and religious practice are much smaller than those for fixed traits, and the confidence intervals surrounding these effects are large. In other words, there is little precise evidence that characteristics over which immigrants have some control influence hiring decisions and, in turn, that these characteristics generate hierarchically-ordered ethnic penalties. In contrast to arguments about the economic returns to citizenship, we find that employers do not prefer immigrant citizens over non-citizens. Furthermore, effects of work experience are small and imprecisely estimated, implying that increased experience will not reduce immigrant-native employment inequalities in substantively meaningful terms. Finally, we do not find evidence of a penalty tied to priming religious activity. If anything, signals of religious practice slightly raise callback rates, but overall ethnicity trumps these signals. Our paper advances existing scholarship in several ways. First, by selecting several immigrant groups we can establish the significance of deep-seated ethnic hierarchies and, by implication, the severity of ethnic penalties. While most existing research does not examine such hierarchies (see Appendix B and Table F in [S1 File](#pone.0218044.s001){ref-type="supplementary-material"}), the few studies that do find mixed results \[[@pone.0218044.ref011]--[@pone.0218044.ref013]\]. This inconclusiveness may be due to employers differing in the unobserved heuristics they use: some employers might associate an immigrant group with citizenship or work experience, while others do not. Unlike most work, our factorial design explicitly tests whether a range of frequently unobserved non-ethnic characteristics produce observed ethnic penalties. Second, employing the factorial design in the context of a correspondence study is novel. While this design has been used in consumer research \[[@pone.0218044.ref014]\] and, more recently, in opinion surveys about immigrants \[[@pone.0218044.ref015]\], correspondence testers have not realized the methodology's full potential (see Appendix B in [S1 File](#pone.0218044.s001){ref-type="supplementary-material"}). In particular, using factorial designs one can simultaneously study the effects of several factors using the same sample size that would be required for the study of one independent variable \[[@pone.0218044.ref016]\]. Substantively, this design also allows us to examine whether ethnic hierarchies persist when country of birth is interacted with several important background characteristics. Though, for a given sample size, there is some loss in statistical power when estimating interactive (vs. average) treatment effects, the factorial design can test whether applicant attributes intersect to jointly produce discrimination \[[@pone.0218044.ref016]\]. Third, we are among the first to examine whether citizenship improves the employment chances of immigrants within the context of a correspondence study. Our results indicate that in the Swedish context, naturalization should not necessarily be considered a tool for economic integration. If citizenship improves employment outcomes at all, it is unlikely to do so by influencing employer behavior. Finally, the fact that ascriptive characteristics like ethnic origin and gender critically impact employment outcomes, and that these fixed traits have much larger effects than do attributes that policy and migrant behavior can actually influence, has significant policy implications. Specifically, efforts that seek to improve immigrants' economic integration will fall short if they are only targeted at immigrants. Instead, our results suggest that policies should focus at least as much on breaking down prejudice among natives. Additionally, governments should consider measures that level the playing field, such as anonymous job applications \[[@pone.0218044.ref017]--[@pone.0218044.ref019]\]. Results {#sec002} ======= Registry data results {#sec003} --------------------- To provide some background on the immigrant-native employment gap and to illustrate the inferential problems inherent in trying to estimate discrimination using observational data, we draw on government registers. These registry data cover the entire Swedish population and contain information on a range of individual characteristics, such as employment status, income, country of birth, citizenship acquisition, gender, education, age and residential location. They allow us to analyze the employment situation of close to six million Swedish residents. Like in many European countries, Sweden's immigrant-origin population consists of a mix of labor migrants, family migrants, and refugees from both within and outside of the European Union (EU). At the end of 2016 the ten countries with the largest stock of migrants were (in descending order): Finland, Syria, Iraq, Poland, Iran, the former Yugoslavia, Somalia, Bosnia and Herzegovina, Germany, and Turkey. Though employment rates vary across groups, the overall economic performance of migrants falls well below that of natives. When compared to other OECD countries, Sweden features the highest gap in employment rates (17.6 percentage points) between immigrants and natives \[[@pone.0218044.ref020]\]. [Table 1](#pone.0218044.t001){ref-type="table"} reports group-wise regressions and average employment rates. We observe an ordering consistent with ethnic hierarchies: native Swedes have the highest employment rates (86%), followed by those born in Poland (73%), Iraq (60%), and finally those born in the Horn of Africa (58%) (Somalia is one of the five countries grouped into this latter regional category; for details, see our discussion in the Materials and methods section). Furthermore, coefficient estimates differ across groups. The estimates for educational attainment are positive across the board, but the size is generally larger for Swedes, suggesting that natives reap higher returns from education. 10.1371/journal.pone.0218044.t001 ###### Correlates of having employment by country of birth. {#pone.0218044.t001g} ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- \(1\) \(2\) \(3\) \(4\) \(5\) ----------------------------- --------------------------------------------------- --------------------------------------------------- --------------------------------------------------- --------------------------------------------------- --------------------------------------------------- Mean outcome 0.8643 0.6908 0.7251 0.5957 0.5795 Gender (Female) 0.0018[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.0420[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.0280[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.1010[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.0885[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0003) (0.0008) (0.0038) (0.0028) (0.0034) *Education*: Elementary school 0.1007[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0603[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0118\ 0.0386[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0669[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0031) (0.0020) (0.0144) (0.0053) (0.0059) Upper secondary school 0.2685[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1944[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1862[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1752[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.2109[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0030) (0.0016) (0.0125) (0.0045) (0.0046) Post-secondary (≤2 years) 0.2801[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1922[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1702[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1641[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.2221[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0031) (0.0023) (0.0144) (0.0075) (0.0089) Post-secondary (≥2 years) 0.3242[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.2445[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.2234[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.2377[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.2515[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0030) (0.0016) (0.0125) (0.0044) (0.0059) Graduate School\ 0.3486[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.3274[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.2847[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.3296[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.2011[\*\*\*](#t001fn002){ref-type="table-fn"}\ (PhD) (0.0032) (0.0030) (0.0180) (0.0178) (0.0254) Age 0.0146[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0167[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0226[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0110[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0074[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0001) (0.0002) (0.0011) (0.0008) (0.0010) Age^2^ -0.0002[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.0003[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.0003[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.0003[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.0002[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0000) (0.0000) (0.0000) (0.0000) (0.0000) Citizen 0.0698[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1257[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0680[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1183[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0011) (0.0049) (0.0050) (0.0050) Time in Sweden 0.0139[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0027[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0309[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.0273[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0001) (0.0007) (0.0008) (0.0008) Time in Sweden^2^\ -0.0002[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.0001[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.0006[\*\*\*](#t001fn002){ref-type="table-fn"}\ -0.0005[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0000) (0.0000) (0.0000) (0.0000) Constant 0.3698[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1521[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1368[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.1715[\*\*\*](#t001fn002){ref-type="table-fn"}\ 0.2161[\*\*\*](#t001fn002){ref-type="table-fn"}\ (0.0033) (0.0049) (0.0254) (0.0157) (0.0186) Observations Adj. R-squared 4,755,922\ 1,112,526\ 55,597\ 105,707\ 70,587\ 0.0705 0.0982 0.0647 0.131 0.177 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Notes: The dependent variable is a dummy indicating whether an individual had any wage income in 2015 (1) or not (0). OLS coefficients; robust standard errors in parentheses. Significance levels: \*\*\* p\<0.01, \*\* p\<0.05, \* p\<0.1 [Table 1](#pone.0218044.t001){ref-type="table"} also includes variables specific to foreign-born groups, of which Time in Sweden has a positive, if decreasing, relationship with employment, with impacts substantively larger for those born in Iraq and the Horn of Africa. Most interestingly, citizenship is strongly correlated with employment for all foreign-born groups, raising the employment probability by between 7 and 13 percentage points. These results establish a set of important empirical regularities. First, employment gaps are consistent with an ethnic hierarchy, whereby those born in the Horn of Africa face the steepest penalty, followed by individuals born in Iraq, and then Poland. Second, citizenship is positively associated with employment, and it appears to narrow immigrant-native employment gaps. Yet, these analyses also face shortcomings. First, it is possible that we did not capture variables that lead to both employment gaps between immigrants and natives and to the specific ethnic hierarchies (e.g., group-level variation in confidence, networks, search intensity or choice of sector). Second, the citizenship effect is difficult to interpret. In line with models of statistical discrimination \[[@pone.0218044.ref021]--[@pone.0218044.ref023]\], citizenship may reduce employer discrimination by signaling commitment to stay in the country or by lessening administrative or legal hurdles that can arise in the hiring of non-citizens \[[@pone.0218044.ref024]\]. At the same time, citizenship itself might not contribute to employment, but the factors that lead to citizenship acquisition also lead to improved economic outcomes. Immigrants who are motivated to assimilate, to put down roots, or to move up economically might be more likely to acquire citizenship and to exhibit favorable employment outcomes. Third, it is challenging to measure the effects of prior work experience and immigrant status using observational data. If being born abroad reduces the odds of acquiring work experience due to employer discrimination, the inclusion of prior work experience would lead to a biased estimate (post-treatment bias) of the effect of having been born in a foreign country on employment. We face the same problem with some of the variables that we do include (such as citizenship acquisition and educational attainment), making it difficult to assess their impact; the impact of country of birth generally; and of ethnic hierarchies associated with the countries in our study specifically. In short, though the analyses relying on registry data provide us with a good overview of employment inequalities, they are not well suited for isolating the causal role that specific individual characteristics play when employers evaluate applicants. We therefore next turn to our correspondence study. CV experiment results {#sec004} --------------------- Our field experiment is designed to estimate the impact of two types of factors: relatively fixed attributes that individuals cannot readily modify and more malleable features over which individuals have some control and which employers may associate with ethnic backgrounds. Identifying which type of factor generates employer discrimination is critical if we want to make headway in improving immigrants' labor market integration. While modern racism or prejudice is typically subtle \[[@pone.0218044.ref025]\], testing studies in hiring processes offer a way to measure discrimination and have been conducted in a growing number of countries to unveil discrimination against different groups \[[@pone.0218044.ref026], [@pone.0218044.ref027]\]. We sent fictitious applications to hiring companies located in Sweden's seven largest metropolitan regions, which are home to about a third of the country's immigrant population. We varied applicants' country of birth, gender, citizenship, amount of previous work experience, and signals of religious activity (we also vary the name, selecting first and last names common in the origin country). All applications are sent by fictitious immigrants who came to Sweden as children and who were born in 1995 (making them 21 or 22 years of age; the experiment ran from February 2016 to May 2017). We chose this group to minimize presumed immigrant-native differences in unobserved characteristics such as language skills or the quality of education. Moreover, the future of immigrant integration hinges on the younger generation, making this group substantively important. Note that this choice (vs. selecting migrants who arrived as adults) likely reduces the amount of discrimination we observe. Applications were sent to jobs in the restaurant and café sector (one randomly selected application per job opening). We hold the sector constant, but jobs differ slightly in that some require prior experience (e.g., cashier or waiter) while others do not. All applications mention work at a café during high school, but for jobs that made previous work experience a requirement, we only sent applications that additionally included relevant post-high school work experience. We control for this difference in the analysis. We selected the restaurant and café sector because, first, it is the sector that currently employs the plurality of immigrants \[[@pone.0218044.ref028]\]. Second, this sector employs relatively young workers and is an important entry point into the labor market \[[@pone.0218044.ref028]\]. Third, it employs the highest number of undocumented migrants \[[@pone.0218044.ref029]\]; if citizenship matters by reducing concerns about hiring undocumented workers, we should observe effects in this sector. With respect to generalizability, several aspects should be considered. On the one hand, a large immigrant workforce is present in this sector, so our findings could present a lower bound of discrimination. On the other hand, because the jobs involve face-to-face interactions, employers might be concerned about customer prejudice, thereby raising levels of discrimination. We thus expect that our results should best generalize to service jobs that already employ migrant workers, require relatively few skills and involve face-to-face contact with customers. Turning to individual-level attributes, and as we detail in the design section below, to ensure that applications were not rejected across the board we developed cover letters that raised the baseline attractiveness of all applicants. This included, among other attributes, membership in the local football team. Given stereotypes about Muslim women's engagement with non-Muslims, it is possible that this membership is a signal of integration among female applicants born in Iraq and Somalia. Another feature to be kept in mind when considering generalizability relates to the assignment of treatments in the factorial design. These assignments are based on assessments about statistical power, rather than national representativeness (e.g., exactly half of the immigrants in our design are Swedish citizens/female, but the true proportions in the population are somewhat lower). The outcome of interest is the callback rate. A job offer, an invitation for an interview, or an inquiry asking about the applicant's continued interest were coded as 1. Non-responses and all other responses were coded as zero. We first display the callback rates by the ascriptive characteristics that we manipulate: country of birth and gender. [Fig 1](#pone.0218044.g001){ref-type="fig"} demonstrates that ethnic hierarchies indeed govern employer responses. Callback rates are higher for native Swedes (21%) than for applicants born outside of Sweden (11%). And when we disaggregate the foreign-born, it is clear that callback rates differ dramatically across countries of birth; native Swedes are followed by applicants born in Poland (17%), Iraq (10%), and Somalia (5%), respectively. The difference in callback rates between the Polish-born and the Iraqi and Somalia-born are thus substantively large and statistically significant (*p*\<0.01), as is the difference between immigrants born in Iraq vs. Somalia (*p*\<.01). These experimental results are in line with our observational findings, suggesting that the ethnic ordering of employment rates can at least in part be attributed to employer behavior, rather than simply to unobservable characteristics on which these groups vary. {#pone.0218044.g001} Furthermore, [Fig 2](#pone.0218044.g002){ref-type="fig"} demonstrates that callback rates differ dramatically when we take into account both country of birth and gender. Whereas only 2.5% of male Somali-born applicants receive a callback, the corresponding figure for female Somali-born applicants is 7.5% (*p*\<0.05). Female applicants receive higher callback rates, and this tendency is especially pronounced among immigrant groups. The lower employment rates among women born in Iraq and Somalia that were apparent in the registry data are therefore unlikely only the result of employer discrimination and instead partly reflect other differences in the drivers of female employment across groups. {#pone.0218044.g002} The results thus far establish the striking importance of ascriptive traits. Can immigrants escape the penalties imposed by their country of birth and gender? To answer this question, we first examine whether citizenship influences hiring. Since the design forces a correlation (*r* = -0.36, see Table D in [S1 File](#pone.0218044.s001){ref-type="supplementary-material"} for more details) between being foreign-born and Swedish citizenship (i.e., all natives are Swedish citizens), we move on to multivariate regression analysis. To ease the interpretation of our results, we consistently present estimates that rely on a linear probability model. Results using a logistic model are in the [S1 File](#pone.0218044.s001){ref-type="supplementary-material"} (Table A, Table B and Table C), and are substantively similar unless otherwise noted. We present two sets of results: one where we pool the applicants born outside of Sweden and one where we do not. The most basic specification ([Table 2](#pone.0218044.t002){ref-type="table"}, column 1) shows that citizenship has a positive, but very small and imprecisely estimated effect (*p*≈0.36), on the callback rate. The results are similar in column 3 (*p*≈0.39). These results do not lend support for the hypothesis that employers are more likely to hire immigrants who have adopted Swedish citizenship. 10.1371/journal.pone.0218044.t002 ###### CV experiment results. DV: Employer Callback. {#pone.0218044.t002g} -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- \(1\) \(2\) \(3\) \(4\) -------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- *Country of birth*:  Outside Sweden -0.089[\*\*\*](#t002fn002){ref-type="table-fn"}\ -0.087[\*\*\*](#t002fn002){ref-type="table-fn"}\ (0.030) (0.030)  Poland -0.026\ -0.024\ (0.034) (0.034)  Iraq -0.096[\*\*\*](#t002fn002){ref-type="table-fn"}\ -0.094[\*\*\*](#t002fn002){ref-type="table-fn"}\ (0.033) (0.032)  Somalia -0.146[\*\*\*](#t002fn002){ref-type="table-fn"}\ -0.144[\*\*\*](#t002fn002){ref-type="table-fn"}\ (0.031) (0.031) Citizenship (Yes) 0.016\ 0.016\ 0.014\ 0.014\ (0.017) (0.017) (0.017) (0.017) Gender (Female) 0.080[\*\*\*](#t002fn002){ref-type="table-fn"}\ 0.079[\*\*\*](#t002fn002){ref-type="table-fn"}\ (0.016) (0.016) Religious Activity (Yes) -0.005\ -0.005\ (0.016) (0.016) Previous Experience (More) 0.029\ 0.026\ (0.019) (0.019) Job requirement (Waiting experience) 0.038\ 0.043[\*](#t002fn004){ref-type="table-fn"}\ (0.025) (0.024) Observations 1,492 1,492 1,492 1,492 R-squared 0.053 0.075 0.072 0.094 City Dummies Yes Yes Yes Yes Time-trend Yes Yes Yes Yes Adj. R-squared 0.047 0.067 0.065 0.085 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Notes: The dependent variable is a dummy indicating whether applicants were called to an interview (1) or not (0). OLS coefficients; robust standard errors in parentheses. Significance levels: \*\*\* p\<0.01, \*\* p\<0.05, \* p\<0.1 In columns 2 and 4 of [Table 2](#pone.0218044.t002){ref-type="table"} we add further treatment conditions. Controlling for all covariates not only increases statistical power, but also allows us to compare the magnitude of the effect of country of birth to that of other characteristics. The point estimates for the effects of country of birth in column 2 closely track those in column 1, suggesting that randomization succeeded. Further, ethnic penalties for Iraqi and Somali applicants are large compared to other treatment conditions. If it is not obvious that immigrants can improve their labor market chances by adopting citizenship, does the accumulation of work experience help? We find that prior relevant work experience raises the probability of receiving a callback by about 3 percentage points. The effect is thus fairly small and fails to reach conventional levels of statistical significance (*p*\>0.1). The callback rates for jobs that require previous cashier and waiting experience are 4 percentage-points higher when compared to jobs that lack this requirement. Finally, explicit mentions of religious activity do not appear to harm applicants. Summing up, ascriptive traits such as country of birth and gender are much more consequential at the recruitment stage than are characteristics over which immigrants and policymakers have some control, such as citizenship acquisition, work experience, or signals of religious activity. The effects of malleable traits are estimated with a high degree of uncertainty, especially when contrasted with the clear effects of ascriptive traits. However, it is possible that the effects of some of these variables vary across groups. To test for this possibility, we leverage the factorial design, which allows us to examine whether ethnic hierarchies persist when country of birth is interacted with several important background characteristics. As mentioned earlier, statistical power will be lower when studying interaction (vs. main) effects \[[@pone.0218044.ref016]\]. This is especially true when we consider factors with several levels, such as country of birth. We therefore report one set of interaction results in [Table 3](#pone.0218044.t003){ref-type="table"}, where we increase statistical power by pooling Polish-, Iraqi- and Somali-born applicants into one group, and one set of more disaggregated results in [Table 4](#pone.0218044.t004){ref-type="table"}. While the disaggregated results come at the price of wider confidence intervals, they are included because they provide a more detailed picture of whether effects vary with applicants' countries of birth. 10.1371/journal.pone.0218044.t003 ###### Heterogeneous effects of being born outside of Sweden. DV: Employer Callback. {#pone.0218044.t003g} ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- \(1\) \(2\) \(3\) \(4\) ----------------------------------------- -------------------------------------------------- ------------------------------------------------- -------------------------------------------------- -------------------------------------------------- Born outside Sweden (Yes) -0.087[\*\*\*](#t003fn002){ref-type="table-fn"}\ -0.071[\*](#t003fn004){ref-type="table-fn"}\ -0.144[\*\*\*](#t003fn002){ref-type="table-fn"}\ -0.114[\*\*\*](#t003fn002){ref-type="table-fn"}\ (0.030) (0.040) (0.043) (0.040) Citizenship (Yes) 0.016\ 0.016\ 0.016\ (0.017) (0.017) (0.017) Gender (Female) 0.080[\*\*\*](#t003fn002){ref-type="table-fn"}\ 0.079[\*\*\*](#t003fn002){ref-type="table-fn"}\ 0.081[\*\*\*](#t003fn002){ref-type="table-fn"}\ 0.032\ (0.016) (0.016) (0.016) (0.055) Religious Activity (Yes) -0.005\ -0.006\ -0.105[\*](#t003fn004){ref-type="table-fn"}\ -0.005\ (0.016) (0.016) (0.054) (0.017) Previous Experience (Yes) 0.029\ 0.010\ 0.029\ 0.029\ (0.019) (0.059) (0.019) (0.019) Job requirement (Waiting Experience) 0.038\ 0.123[\*](#t003fn004){ref-type="table-fn"}\ 0.040\ 0.039\ (0.025) (0.074) (0.024) (0.025) Born outside Sweden×Citizenship 0.016\ (0.017) Born outside Sweden×Previous Experience 0.023\ (0.063) Born outside Sweden×Job Requirement -0.101\ (0.078) Born outside Sweden×Religious Activity 0.117[\*\*](#t003fn003){ref-type="table-fn"}\ (0.057) Born outside Sweden×Gender(Female) 0.056\ (0.057) Observations 1,492 1,492 1,492 1,492 R-squared 0.075 0.077 0.079 0.076 City Dummies Yes Yes Yes Yes Time-trend Yes Yes Yes Yes ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Notes: The dependent variable is a dummy indicating whether applicants were called to an interview (1) or not (0). OLS coefficients; robust standard errors in parentheses. Significance levels: \*\*\* p\<0.01, \*\* p\<0.05, \* p\<0.1 10.1371/journal.pone.0218044.t004 ###### Heterogeneous effects of country of birth. DV: Employer Callback. {#pone.0218044.t004g} ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- \(1\) \(2\) \(3\) \(4\) ------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- -------------------------------------------------- *Country of birth*:  Poland -0.031\ -0.018\ -0.086[\*](#t004fn004){ref-type="table-fn"}\ -0.079[\*](#t004fn004){ref-type="table-fn"}\ (0.037) (0.045) (0.048) (0.044)  Iraq -0.116[\*\*](#t004fn003){ref-type="table-fn"}\ -0.082[\*](#t004fn004){ref-type="table-fn"}\ -0.157[\*\*\*](#t004fn002){ref-type="table-fn"}\ -0.114[\*\*\*](#t004fn002){ref-type="table-fn"}\ (0.048) (0.042) (0.047) (0.042)  Somalia -0.154[\*\*\*](#t004fn002){ref-type="table-fn"}\ -0.114[\*\*\*](#t004fn002){ref-type="table-fn"}\ -0.192[\*\*\*](#t004fn002){ref-type="table-fn"}\ -0.152[\*\*\*](#t004fn002){ref-type="table-fn"}\ (0.047) (0.041) (0.044) (0.040) Citizenship (Yes) 0.014\ 0.014\ 0.015\ (0.017) (0.017) (0.017) Gender (Female) 0.079[\*\*\*](#t004fn002){ref-type="table-fn"}\ 0.078[\*\*\*](#t004fn002){ref-type="table-fn"}\ 0.079[\*\*\*](#t004fn002){ref-type="table-fn"}\ 0.032\ (0.016) (0.016) (0.016) (0.055) Religious Aciticity (Yes) -0.005\ -0.006\ -0.105[\*](#t004fn004){ref-type="table-fn"}\ -0.005\ (0.016) (0.016) (0.054) (0.016) Previous Experience (Yes) 0.026\ 0.010\ 0.026\ 0.027\ (0.019) (0.059) (0.019) (0.019) Job requirement (Waiting Experience) 0.043[\*](#t004fn004){ref-type="table-fn"}\ 0.123[\*](#t004fn004){ref-type="table-fn"}\ 0.045[\*](#t004fn004){ref-type="table-fn"}\ 0.044[\*](#t004fn004){ref-type="table-fn"}\ (0.024) (0.074) (0.024) (0.024) *Country of birth*×*Citizenship*:  Poland×Citizenship 0.001\ (0.035)  Iraq×Citizenship 0.032\ (0.045)  Somalia×Citizenship 0.007\ (0.041) *Country of birth*×*Previous Experience*:  Poland×Previous Experience 0.032\ (0.071)  Iraq×Previous Experience 0.032\ (0.068)  Somalia×Previous Experience -0.007\ (0.064) *Country of birth*×*Job Requirement*:  Poland×Job Requirement -0.084\ (0.091)  Iraq×Job Requirement -0.101\ (0.085)  Somalia×Job Requirement -0.099\ (0.081) *Country of birth*×*Religious Activity*:  Poland×Religious Activity 0.125[\*](#t004fn004){ref-type="table-fn"}\ (0.065)  Iraq×Religious Activity 0.128[\*\*](#t004fn003){ref-type="table-fn"}\ (0.061)  Somalia×Religious Activity 0.097[\*](#t004fn004){ref-type="table-fn"}\ (0.058) *Country of birth*×*Gender (Female)*:  Poland×Gender(Female) 0.109[\*](#t004fn004){ref-type="table-fn"}\ (0.065)  Iraq×Gender(Female) 0.042\ (0.062)  Somalia×Gender(Female) 0.01\ (0.059) Observations 1,492 1,492 1,492 1,492 R-squared 0.094 0.097 0.098 0.098 City Dummies Yes Yes Yes Yes Time-trend Yes Yes Yes Yes Adj. R-squared 0.084 0.084 0.087 0.087 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Notes: The dependent variable is a dummy indicating whether applicants were called to an interview (1) or not (0). OLS coefficients; robust standard errors in parentheses. Significance levels: \*\*\* p\<0.01, \*\* p\<0.05, \* p\<0.1 Tables [3](#pone.0218044.t003){ref-type="table"} and [4](#pone.0218044.t004){ref-type="table"} interact citizenship with countries of birth (recall that citizenship is held constant for the Swedish-born). The citizenship effect varies slightly across groups, but none of these interactions reach conventional levels of statistical significance. For example, the 95% confidence interval around the estimated effect of citizenship in [Table 3](#pone.0218044.t003){ref-type="table"} ranges from a small negative effect of -2 percentage points to a moderately-sized positive effect of 4 percentage points. (In Table E in the [S1 File](#pone.0218044.s001){ref-type="supplementary-material"} we address concerns related to multiple comparisons by presenting results controlling for the false discovery rate \[[@pone.0218044.ref030]\].) The second columns of Tables [3](#pone.0218044.t003){ref-type="table"} and [4](#pone.0218044.t004){ref-type="table"} presents the impact of being foreign-born conditional on previous experience. If statistical discrimination related to uncertainty about relevant background experience is at work, employers who receive CVs that contain information about such experience should discriminate less. The interactions in question are, however, substantively small and imprecisely estimated. Turning to an additional aspect of experience, in our design we distinguished between two types of jobs, those that require previous waiting experience and those that do not. The former always receive applications indicating more previous experience whereas the latter receive applications of both types. This design forces a correlation (*r* = .53) between previous experience and whether the job requires prior waiting experience, and therefore the interaction between country of birth and job requirement is also included in column 2 of [Table 3](#pone.0218044.t003){ref-type="table"} as well as of [Table 4](#pone.0218044.t004){ref-type="table"}. The interactions between job type and country of birth are quite large and negative, potentially suggesting that employers are reluctant to hire immigrants for positions which, on average, are likely to entail more customer contact. However, though large in magnitude, these interaction effects fall below conventional levels of statistical significance. We also examine whether employers react to signals of religiosity. Research has shown that employers in France discriminate against Muslim applicants, even when country of birth and other characteristics are held constant \[[@pone.0218044.ref010]\]. Our design does not allow us to tease apart religion, country of birth, and ethnicity: the great majority of Iraqi and Somali migrants are Muslim, and, to maintain realism and external validity, we did not vary their denomination. We instead chose to include signals of religiosity. That is, holding presumed denomination within a given country of birth constant, we assess whether priming religiosity influences employer behavior (for a similar approach, see \[[@pone.0218044.ref031]--[@pone.0218044.ref033]\]). We do so because some of the concerns about employing Muslims could relate to the group's religious needs (e.g., the frequency of prayer or the provision of halal foods) rather than their denomination per se, and how these needs interfere with productivity or company policies. Accordingly, if employers receive information that Muslim applicants indeed practice their religion, this could depress callback rates. To test this hypothesis, half of the Somali- and Iraqi-born applicants indicated that they were active in a local mosque. If bias against religiously-practicing Muslims were driving the results, we would expect Iraqis and Somalis to fare even worse when they indicate their religious involvement. Column three of [Table 4](#pone.0218044.t004){ref-type="table"} demonstrates that this is not the case. If anything, the ethnic penalty for religiously active Iraqi- and Somali-born applicants is smaller compared to that among the non-active compatriots, as can be seen from the interaction between the signal of religious activity and country of birth. For instance, Somali-born applicants that do not signal religious activity have a 19 percentage points lower callback rate than Swedish natives, whereas the penalty for those who do is almost 10 percentage points smaller. This provides suggestive evidence that discrimination against Iraqi- and Somali-born jobseekers is not solely driven by their degree of religiosity and the practical aspects related to accommodating religious Muslims at the workplace. Moreover, among Polish-born applicants, those who are religiously active (i.e., involved in a local Catholic Church), also face a smaller ethnic penalty. For all foreign-born groups, then, ethic penalties are smaller when they signal religious activity (see also column 3 of [Table 3](#pone.0218044.t003){ref-type="table"}). By contrast, indicating participation in a local Protestant church does reduce callbacks among native Swedes (*p* \< 0.10). In sum, the evidence does not support the conclusion that signals of religious practice (vs. denomination per se) among the foreign-born compound discrimination. Instead, the differences in the effects of religious activity across natives and immigrants are more in line with the role congruity theory of prejudice \[[@pone.0218044.ref034]\], in that candidates born in the largely secular, but historically Protestant, Sweden appear to be evaluated less favorably when practicing their religion, whereas candidates born in more religious parts of the world do not face an additional penalty when they make explicit mention of practicing the dominant religion of their country of birth. We next turn to interactions of country of birth and gender (column 4). The estimates in column four of Tables [3](#pone.0218044.t003){ref-type="table"} and [4](#pone.0218044.t004){ref-type="table"} suggest that ethnic penalties are smaller for women than for men. The interaction between country of birth and gender is, however, only statistically significant (*p*\<.10) for the Polish-born. Finally, do attributes that immigrants can affect---the adoption of citizenship, the accumulation of skills, and signals of religious practice---influence recruitment prospects? [Fig 3](#pone.0218044.g003){ref-type="fig"} presents the marginal effects of all other treatments conditional on country of birth (based on Tables [3](#pone.0218044.t003){ref-type="table"} and [4](#pone.0218044.t004){ref-type="table"}). Only gender matters consistently: Being a woman has a positive and statistically significant effect among all immigrant groups (For details on subgroup comparisons, see Appendix C in the [S1 File](#pone.0218044.s001){ref-type="supplementary-material"}). {#pone.0218044.g003} These findings conflict with accounts that document the multiple burdens of being a woman and belonging to a minority ethnic group \[[@pone.0218044.ref035]\]. Keeping in mind that we are considering migrants who have attained some degree of integration (recall the baseline attractiveness communicated in the cover letter and the potential football-related gender effects among Muslims), they are more consistent with role theories postulating that stereotypes about foreign nationalities are mainly ascribed to males \[[@pone.0218044.ref036]\]. Notably, among Swedish-born applicants there is little penalty for being male, suggesting that the gendered nature of callback rates among immigrants is not driven by a general, industry-specific preference for female labor. Discussion {#sec005} ========== Using a factorial field experiment, our study has gone beyond most existing work in simultaneously testing the impact of a number of factors on discrimination in the hiring process. Our results paint a bleak picture: We find substantial evidence in support of employer discrimination against immigrants and no consistent evidence that immigrants can reduce this discrimination by acquiring citizenship or investing in job-related experience. Ethnic hierarchies decisively influence immigrants' employment prospects. Though employers discriminate against all immigrant groups, callback rates decline significantly with the degree of socio-cultural and ethnic distance, leaving Iraqis and especially Somalis with much reduced employment chances. Moreover, among these groups, men fare particularly poorly. It bears repeating that Somali men only receive callbacks to 2.5 percent of applications, while the comparable number is 19 percent for Swedish men. Compared to these ascriptive traits, the effects of malleable traits are much smaller, and the confidence intervals surrounding these effects are wide. These outcomes are disconcerting on normative and practical grounds. Employers subscribe to an ethnic hierarchy when judging applicants, and their assessments are seemingly impervious to attributes that signal productivity or integration. Fixed traits such as country of birth and gender over which applicants have no control are given much more weight in the hiring process than are characteristics that immigrants and policy measures can actually affect. Turning to policy implications, the fact that immigrants confront severe obstacles even in low-skill entry-level jobs, and that they cannot easily address these obstacles on their own, calls for policy interventions that minimize the extent and impact of employer prejudice. Materials and methods {#sec006} ===================== Ethics statement {#sec007} ---------------- This research involves human subjects. Consent from participants was not obtained as that would undermine study credibility. The experimental data set has been anonymized by Vernby, who carried out the data analysis. While no individual names were saved, a data set that contains the names of the included establishments and their company registration number is kept by Vernby in a separate encrypted file on a password protected server. The research was conducted in Sweden and was approved by the Regional Ethical Review Board in Stockholm on September 3, 2015 (see approval number 2015/1352-31/5). Empirical strategy for the registry data analysis {#sec008} ------------------------------------------------- We use anonymized registry data based on administrative records and collected by the government statistical agency Statistics Sweden. These data cover the entire Swedish population, and we restrict our analysis to members of the working-age population (ages 15-64). For reasons of confidentiality, the "county-of-birth" variable aggregates countries that have sent relatively small numbers of migrants to Sweden into a regional category. This applies to Somalia, which is grouped with Eritrea, Ethiopia, Sudan and Djibouti. This grouping should not compromise our ability to document ethnic hierarchies. In 2015, the Somali-born made up more than 55% of this group (the second largest sender, Eritrea, made up 26%). Moreover, like Somalia, Djibouti and Sudan are majority Muslim, whereas Muslims constitute a significant (but not a majority) share of the population in Eritrea and Ethiopia. However, our ability to document ethnic hierarchies could be slightly confounded by this aggregation if migrants from Eritrea are more economically integrated than are those from Somalia. Fortunately, the CV study does not face similar methodological problems. The Swedish citizenship measure relies on a variable that indicates the date on which an individual has changed citizenship, but it does not indicate an individuals' nationality. Design of the CV study {#sec009} ---------------------- ### Experimental design {#sec010} The experiment employs a fractional factorial design. The advantage of this design is that it allows us to study the main effects of several factors using the same sample size that would be required for the study of one independent variable without loss of statistical power. Moreover, the factorial design allows testing for interactions between treatments. Note, however, that when studying interaction effects statistical power will be lower, resulting in wider confidence intervals than for main effects \[[@pone.0218044.ref016]\]. Additionally, if the combination of factors studied are both unrepresentative of real-wold settings, and exhibit strong interaction effects, this can limit the external validity of treatment effects from factorial experiments \[[@pone.0218044.ref037]\]. We randomly vary gender (Male/Female), post high-school work-experience (Yes/No), religious activity (Yes/No), country of birth (Sweden, Poland, Somalia, Iraq) and, for the foreign-born, Swedish citizenship (Yes/No). The job openings that were coded as requiring cashier and waiting staff experience only received applications with post high-school work-experience, whereas the ones that listed no such requirement received CVs both with and without post high-school work experience. ### Occupational sector {#sec011} To ensure maximum relevancy we chose to focus on the occupational sector in which the highest proportion of immigrants is employed. If we uncover discrimination in such a sector, we can conclude that discrimination has important consequences for the employment prospects of immigrants and, moreover, that our estimates of discrimination potentially represent a lower bound. In the Swedish case, this sector is the restaurant sector. Furthermore, given the focus on young adults (applicants are 21 to 22 years old) and the high level of youth unemployment in Sweden, jobs in the restaurant sector are suitable because they frequently represent entry-level occupations. ### Geographical area {#sec012} Our study focuses on the labor markets in the biggest city regions: Stockholm, Malmö, Gothenburg, Örebro, Västerås, Uppsala, Norrköping and Linköping. Again, this choice was made to ensure relevance. About 3 million of Sweden's 10 million inhabitants live in these regions. In addition, immigrants disproportionately live in cities, so if discrimination occurs in the biggest city regions this has important consequences for the employment prospects of immigrants. ### Time frame {#sec013} The experiment started in February 2016 and ended in May 2017. ### Further selection criteria {#sec014} Applications were sent by email to all job ads that fit the above requirements and that were announced on the Swedish Public Employment Agency's website Platsbanken. Ads that required applicants to fill out a pre-determined form had to be excluded since there was no way to follow the experimental protocol in such cases. We sent only one (randomly selected) application to each job opening because, first, we were concerned that sending several CVs to the same job opening would increase the risk of detection and, second, we worried about ethical implications. Specifically, we wanted to minimize the time spent by employers on fictitious applicants and to avoid the risk that employers would overestimate the labor supply, which could in turn affect their hiring and treatment of future employees. ### Coding of responses {#sec015} Of the 56 possible CVs, we randomly selected one to be sent to each opening. We registered replies in two ways. Positive responses (coded 1) most often came in the form of an invitation to interview, but they could also consist of requests for more information (e.g., "Are you still interested in working for us?") or direct offers of work. All other responses and non-responses were coded 0. ### Construction of CVs {#sec016} The names were chosen based on common names in the fictitious applicant's country of birth. To test the robustness of our results to the specific choice of name we used two female and two male names for each country of birth (see Appendix A in the [S1 File](#pone.0218044.s001){ref-type="supplementary-material"}). Treatment effects did not differ at conventional levels of statistical significance for any of the eight pairs of names (results are available from the authors). For people born in Poland, Iraq and Somalia, the city of birth was the capital of the country (Warsaw, Baghdad and Mogadishu, respectively). For people born in Sweden, the city of birth was one of the following (depending on which city the job opening was located in): Stockholm, Malmö, Gothenburg, Örebro, Västerås, Uppsala or Linköping. The previous residential area where the applicant went to primary and upper secondary school (the latter with a social science program) and current address were chosen with regard to average income and demographics, and we selected an existing public upper secondary school (with a social science program) in the previous residential area. The resumé contained no description of a specific primary school but was described as follows: Degree primary school, \[previous residential area\]. All persons (including the Swedish-born applicants) were described as having Swedish, English and some German language skills. Applicants who were born abroad indicated an additional language based on their country of birth. Three fictitious workplaces were used in the CVs. All applicants had worked at a café during upper secondary school. Their resumés also stated an internship at a cinema. Half of the applicants had additional work experience as a waiter at a restaurant since high school (these are considered as having more experience). The CV also included associational memberships. It stated that the applicant was member of football club in his/her residential area, and the club was therefore selected separately for each city. The choice of football is motivated by the fact that it is the most commonly practiced team-sport among the young according to *The Swedish Sports Confederation*. In particular, 26% of those between 15 and 24 played, and while there is a gender imbalance (34% of the men and 16% of the women in this age group played), it is the most common team sport among both men and women in this age category. The candidate's interest in football also provided a vehicle to mention the positive qualities he/she had acquired due to her engagement in team sports. Additionally, half of the CVs included membership in a religious congregation. Like in many previous correspondence studies on the impact of religious affiliation on hiring discrimination, we signal religious affiliation by having applicants report activities in religious groups. We selected the denomination and associated congregation on the basis of the dominant religion in the country of birth. The religious congregation was selected separately for each city. In the [S1 File](#pone.0218044.s001){ref-type="supplementary-material"} (Fig A and Fig B) we present translated CVs of a male Iraqi-born Swedish citizen who is active in a mosque in Stockholm (with more or less previous work experience, respectively). ### Cover letters {#sec017} All cover letters began with a self-description of the applicant as cooperative, ambitious and resourceful followed by a description of his or her commitment to football, with the focal point on the positive qualities which this commitment generated. While football was chosen because it is popular both among young men and women, as well as among natives and immigrants, it could arguably be a stronger signal of integration for Muslim women. To the extent that this is true, ethnic penalties could be slightly underestimated for female Muslim job candidates. Nonetheless, we find ethnic penalties as large as 14 percentage points for Somali women (See [Table 4](#pone.0218044.t004){ref-type="table"}). The mention of football was followed by a discussion of previous work experience. To increase the response rate, the work experience matched the qualities that were commonly mentioned in work ads. For example, resumés with experience from before graduation at a café stated cashier and barista skills. Resumés with work experience gained after graduation at a restaurant stated skills such as table service and management. Fig C and Fig D in the [S1 File](#pone.0218044.s001){ref-type="supplementary-material"} present translated cover letters of a male Iraqi-born Swedish citizen who is active in a mosque in Stockholm (with more or less previous work experience, respectively). ### Pilot study {#sec018} Between January and February in 2016, we carried out a pilot study in the Stockholm labor market. We sent applications to 90 job openings announced on the Swedish Public Employment Agency's website Platsbanken. Since the callback rate was low (5 invitations), we implemented a number of changes to make our fictitious candidates more attractive to employers. First, the format of the CVs and the cover letters should be fairly typical of young applicants, as we drafted them based on advice from the Swedish Public Employment Agency. However, due to the low callback rate, we improved the layout of the CVs. Second, we enhanced the cover letters and CVs, adding more detailed information about skills that are generally relevant to working in the category of jobs studied. These two changes were implemented in an identical fashion in all cover letters and CVs and thus likely raised the general quality of all our candidates. Third, CVs in the pilot study varied whether applicants had relevant work experience during high school. To increase the response rate in the main study, we decided that all applications would include this experience (and we varied post high-school work experience). This design choice potentially makes our applicants somewhat more attractive than the average real-world applicant. Supporting information {#sec019} ====================== ###### Additional information, tables and figures. (PDF) ###### Click here for additional data file. We thank Sofia Härd, Erik Antonsson and Martina Zetterqvist for valuable research assistance and participants at seminars at the American Political Science Association, Stanford University and Uppsala University as well as Olof Åslund, Adrián Lucardi, Mattias Engdahl, Stefan Eriksson, Dominik Hangartner, Sofia Härd, Giuseppe Pietrantuono and the reviewers for PLOS ONE for valuable comments. [^1]: **Competing Interests:**The authors have declared that no competing interests exist.

Designing a Portable Church Sound System Tips from Todd Hartmann at The Austin Stone This is a church that understands the concept of community. Launched just 12 years ago by Chris Tomlin and Matt Carter in the living room of Tomlin’s bass player’s house, The Austin Stone Community Church presently numbers four campuses across the greater Austin area and over 7,000 weekly congregants with a fifth campus scheduled to open next year. With the exception of one permanent facility, all of The Austin Stone’s campuses are “portable” – meaning they’re located within the unforgiving concrete walls of school gymnasiums. How Todd Hartmann – who coordinates audio for a total of nine Sunday services across all four locations – does it is nothing short of a miracle. But a few weeks ago, he slowed down long enough to tell us what it takes to meet the standards of a city that knows good music and good sound. Aaron Ivey Band at the ‘Austin Stone Live’ CD release First Tuesday event Evolution This, after all, is a city that calls itself the “Live Music Capital of the World,” so almost right from the start, The Austin Stone contracted with a production company in Dallas to fly the audio, lighting, and engineers when they moved into their main Austin High campus. By 2010, the church had grown to multiple locations throughout greater Austin. That’s when Todd Hartmann, who had earned his stripes as a live sound engineer in the secular world, entered the picture. “We were renting full production every week, and to be honest, every week was a guessing game. Which combination of loudspeaker cabinets, subs, amplifiers and processors would we be ending up with? Right away, I realized that we were spending too much on rental. We were doing four services for about five thousand people every Sunday. I knew we could get an A-list mobile tour grade rig for what we’re paying every year in rentals.” For many audio techs working in brick-and-mortar churches, the idea of setting up a complete system and breaking it down several hours later may seem pretty daunting. But for someone like Todd, “it was a natural transition because I was essentially doing everything I was used to doing on show sites. Everything operated the same way.” Designing a System “I spearheaded the project and convinced the leadership that purchasing gear was the right move. The liability, of course, was a very large capital investment. I’d already designed the system, so once everyone was on board, it was just a matter of putting all the pieces together.” Even though Todd was accustomed to the rigors of the concert scene, there were critical differences in putting together a portable system. “First of all, it’s not an installed system. The racks had to be located within a reasonable distance from the stage, and everything had to be rack-mounted. Even the interlocking connects between the racks had to be multi-pin, quick-connect…everything…to save us time.” Without a venue’s stage crew, add transportation issues. “When you’re designing cases, you have to keep a truck pack in mind. Everything has to fit perfectly since it’s probably going to travel on a 24′ box truck every week.” Even weight is a consideration. “How many people is it gonna take to remove a lid off something? There isn’t always a surplus of volunteer help for the audio portion of it, so we need to design rigs that just two people can set up. With our new system, we’ve got it down to about an hour and a half setting up and about an hour on the outs.” Basic Rig “Even though most of the services are held in gymnasiums, our services have the feel of a live music venue. Our worshippers feel every single hit of a kick drum or floor tom. We can’t take a typical church-grade system and expect to get concert-quality results out of it. If I wouldn’t spec it for a paid show, I wouldn’t spec it here.” Pastor of Worship Aaron Ivey and the band at the main campus While each rig varies a little from campus to campus, we wanted to know what the basic system includes. “One of our campuses has a previously installed Meyer M’elodie system and the others are d&b audiotechnik. We’re aiming for that same (d&b) level of quality going forward. We’re sticking with a medium compact line-array format with an adequate complement of subs that gives us a solid 110 db of headroom at the farthest seat at the venue. We don’t push it to the point where the low, mid-range is at its breaking point, but we know that it’s going to be able to deliver the SPL. Our average services are at about 98 decibels: the same that you’d experience at a Passion or Hillsong conferences. We want the worship experience to envelop the worshipper and create an undistracted environment where no one cares if they’re singing off-key.” Frequency Issues We expected frequency issues to be a challenge considering the number of live music venues in Austin. And even though The Austin Stone uses eight channels of wireless in-ears and two channels of wireless belt-packs for the pastors, their mostly neighborhood campus locations don’t present much in the way of interference. “There isn’t a lot of wireless traffic in those particular ranges. All of our stuff is in the (470 – 530) G1 band. The schools where we’re located are in residential areas, so there aren’t many times when we run into something and have to re-scan. But when we go into performance venues in town, we have to re-scan everything. We’ll pull out a Wireless Workbench and see what traffic looks like there, but for the most part, once we’re at one of our campus venues, the frequencies stay clean.” Acoustical Challenges Let’s not forget acoustics. According to Todd, “they’re almost all acoustically hostile environments. Imagine a 150-foot by 100-foot cinder block gymnasium.” Since The Austin Stone doesn’t use permanently or even portable acoustic treatments, we wanted to know how he’s able to achieve that great live concert sound. “The first step is finding loudspeakers with great directivity, a loudspeaker’s ability to make sure the pattern drops off where the manufacturers says it’s gonna drop off. So if it’s a 75-degree horizontal box, most boxes that only applies to the high end. In the mid-ranges it’s still spewing out 180-degrees all over the walls. And that’s why you have to have system tuning. The d&b boxes maintain constant directivity down to about 400 Hz. There’s a lot less energy being sprayed onto the walls making for a much cleaner-sounding room.” Hiring Professionals Here was a surprise. Except for the volunteers who unload and pack up the portable rigs, The Austin Stone hires vocational engineers. “I have volunteers who help me with the load-in and setup part, but not in actually running the system. Sound engineering is a professional trade. If you’re able to perform at that level, you should be compensated for it. That’s been our approach from the Chris Tomlin days.” Advice for the Church Planters With Todd’s long history in sound engineering and nearly four years designing and running sound systems for The Austin Stone’s expanding campus locations, we wondered what advice he could offer for congregations looking to build the same kind of “rock this house” audio standard. What’s your worship culture? Do you need something that is a really big rock ‘n roll kind of feel? And if not, then you can get away with a lot less. What does the room need? I always advise people to find loudspeakers with great directivity and to point the boxes at people and not at walls. If that means elevating them, putting up a pipe and drape to block off a back wall, all of those things will greatly affect your end result and how a room sounds. If there’s a professional sound company in your city that does concert tours, talk to someone there. You’ll get an unbiased opinion from somebody who works in the live music industry and deals with mobile stuff. They’ll also be able to shoot you straight on what your room actually needs and how to build a rig that makes sense for the volunteers taking it apart and putting it together every single week. In fact, find the right person and you may even want to consider hiring him or her on a freelance basis. A Shure associate since 1979, Davida Rochman graduated with a degree in Speech Communications and never imagined that her first post-college job would result in a life-long career that had her marketing microphones rather than speaking into them. Today, Davida is a Communications Manager, lending her skills to a wide spectrum of activities – from public relations and social media to content development and sponsorships. Thanks for taking a moment to report the bug you experienced. We’ll use the information you provide to fix it. Sending... Please describe what action you were taking when the bug occurred. *Please describe what went wrong. The most helpful way to do this: tell us what you expected to happen if the site were working properly; then, tell us what actually happened. *If we have follow-up questions, may we contact you via email? If so, please provide your email address below. (optional)Attach a screenshot (5MB max; PNG, JPG, GIF) Stay In Touch Subscribe to Shure email newsletters, which primarily feature the best of the Shure Blog, plus occasional content from other places, including our YouTube channel and shure.com. You can choose how much content you receive and how often you receive it.

Background ========== Prenylation is a stable lipid modification process involving covalent addition of either farnesyl (15-carbon) or geranylgeranyl (20-carbon) isoprenoids to conserved cysteine residues at or near the C-terminus of proteins \[[@B1]-[@B3]\]. It is believed that about 2% of eukaryotic cell proteins are modified by prenylation \[[@B2]\], which is accomplished by three distinct heterodimeric protein isoprenyltransferases. Protein with the carboxyl-terminal residue of the CaaX motif, where \"a\" refers to the aliphatic residue, is recognized either by farnesyltransferase (FTase) when \"X\" is methionine, glutamine, serine, alanine, or cysteine, or by geranylgeranytransferase type I (GGTase I) when \"X\" is leucine or isoleucine \[[@B1]-[@B3]\]. FTase and GGTase I are cytosolic enzymes utilizing farnesyl pyrophosphate and geranylgeranyl pyrophosphate as the isoprenyl donors, respectively \[[@B1]-[@B3]\]. The third isoprenyltransferase is geranylgeranytransferase type II (GGTase II), which transfers two geranylgeranyl groups from geranylgeranyl diphosphate to the carboxyl terminal cysteine residues of XCCXX, XXCXC, XXCCX, XXXCC, XCXXX or CCXXX motifs \[[@B4]\]. All three enzymes have been found in eukaryotes including protozoans, metazoans, fungi, and plants. In the plant kingdom, these enzymes have been reported in different species such as pea (*Pisum sativum*) \[[@B5],[@B6]\], tomato (*Solanum lycopersicum*) \[[@B7],[@B8]\], and *Arabidopsis thaliana*\[[@B9]-[@B13]\]. In Arabidopsis, FTase and GGTase I share a common α-subunit encoded by a single gene *PLP*(PLURIPETALA) \[[@B12]\], whereas the genes encoding the β-subunit of FTase and GGTase I are *ERA1 (ENHANCED RESPONSE TO ABA1)*\[[@B9],[@B10]\] and *GGB (GERANYLGERANYLTRANSFERASE BETA)*\[[@B11],[@B13]\], respectively. Following prenylation by FTase or GGTase I in cytoplasm, proteins are usually subject to further maturation processing in the endoplasmic reticulum (ER), including cleavage of the \'aaX\' residues by endoproteases and methylation of the newly created carboxyl terminal residue cysteine by isoprenylcycteine methyltransferase (ICMT) \[[@B1]-[@B3]\]. In Arabidopsis, two genes encoding CaaX endoprotease, AtSTE24 (At4 g01320) and AtFACE-2 (At2g36305 or *AtRCE1*), have been identified \[[@B14]-[@B16]\]. Similarly, two ICMT genes, AtSTE14A (At5g23320 or *AtICMTA*) and AtSTE14B (At5g08335 or *AtICMTB*), have also been characterized \[[@B17]-[@B19]\]. Using S-adenosyl-L-methionine as a methyl donor, AtSTE14A and AtSTE14B catalyze the methylation of biologically relevant isoprenylcysteine substrates, i.e. farnesylcysteine and geranylgeranylcysteine, but not geranylcysteine \[[@B17]-[@B19]\]. Biochemically, protein prenylation and subsequent mature processing steps increase its C-terminal hydrophobicity, which facilitate its attachment to membrane and, in some cases, promoting protein-protein interactions \[[@B1]-[@B3]\]. Physiologically, these protein lipid modifications including prenylation and subsequent methylation exert profound effects on diverse processes involving signal transduction and intracellular trafficking pathways \[[@B1]-[@B3]\]. In Arabidopsis, protein isoprenylation and its processing steps are involved in hormone metabolism and signaling, such as cytokinin biosynthesis, abscisic acid (ABA) and auxin signaling, meristem development, innate immunity, and other fundamental processes \[[@B4]\]. As protein function can be modulated by phosphorylation and dephosphorylation, it is believed that methylation of isoprenlated protein can be reversible by isoprenylcysteine methylesterase (ICME), and only this step can be reversible during protein prenylation and processing \[[@B1],[@B2]\]. Indirect evidence showed that those cell membranes that can methylate prenylated protein are also capable of demethylating prenylated amino acids N-acetyl-S-farnesyl-L-cysteine \[[@B20]\]. Recently, Deem et al. \[[@B21]\] identified an ICME coding gene At5g15860 in Arabidopsis. Two related Arabidopsis genes, At1g26120 and At3g02410, were also reported in their study. According to the latest version of TAIR9 (The Arabidopsis Information Resource) released at June 19, 2009, there are two At3g02410 splice variants, 1269 and 1062 bases, encoding two distinct protein products <http://www.arabidopsis.org>. The 1269 base At3g02410.1 transcript is predicted to encode a 422 amino acid polypeptide while the 1062 base At3g02410.2 transcript is predicted to encode a 353 amino acid polypeptide. Proteins encoded by both splice variants are different from the one reported by Deem et al \[[@B21]\] in which At3g02410 was predicted to encode a 373 amino acid with no predicted trans-membrane domain. The At1g26120 and At5g15860 data in TAIR9 is consistent with Deem et al \[[@B21]\], which highlights two At5g15860 splice variants encoding two distinct protein products and one single At1g26120 splice form <http://www.arabidopsis.org>. The ICME activity was reported in Arabidopsis membrane fractions \[[@B21]\], although the precise sub-cellular localization of this protein remains unknown. Overexpressing ICME in Arabidopsis resulted in an ABA hypersensitive phenotype in stomatal closure and seed germination, indicating ICME is a positive regulator of ABA signaling. Furthermore, the expression of this ICME gene can be induced by ABA after 24 hr treatment \[[@B22]\]. Despite these, knowledge about the protein\'s sub-cellular localization and expression patterns remains unavailable. Moreover, studies on this gene in response to other abiotic stresses have not been conducted. In the present study, the ICME and two ICME-like proteins, ICME-LIKE1 and ICME-LIKE2 encoded by respective At1g26120 and At3g02410, were characterized including their sub-cellular localization, tissue-specific expression patterns and responses to different abiotic stresses and ABA. The biological function of ICME-LIKE2 was explored by T-DNA knock out mutant. Results ======= Characterization and clustering analysis of *ICME*gene family in Arabidopsis ---------------------------------------------------------------------------- Since the gene product of At5g15860 was identified as ICME \[[@B21]\], we named the gene products of At1g26120 and At3g02410 as ICME-LIKE1 and ICME-LIKE2, respectively. To confirm the coding sequences deposited in public databases, the open reading frame (ORF) of these genes were obtained by RT-PCR. We successfully determined a 1431 base ORF for At1g26120, a 1269 base and a 1284 base ORFs for respective At3g02410 and At5g15860. The amplified PCR products were cloned into pGEMT-easy vector and sequenced. Sequencing results showed the ORF sequences of three genes are the same as those released by TAIR9. For At3g02410 and At5g15860, the two ORF sequences corresponded to At3g02410.1 <http://www.arabidopsis.org> and At5g15860.1 \[[@B21]\], the longer variants of the two genes. For this reason, in this study, we only focused our interests on the longer splice variants for both At3g02410 and At5g15860. The amino acid sequences were derived from these ORFs and multiple amino acid sequence alignment of the three proteins was performed using Clustal W2 program <http://www.ebi.ac.uk/Tools/es/cgi-bin/clustalw2>. Results revealed that these three proteins were highly similar: ICME-LIKE1 shared 59% and 61% amino acid identity with ICME-LIKE2 and ICME, respectively, while ICME-LIKE2 and ICME had 76% identity (figure [1A](#F1){ref-type="fig"}). PROSITE software analysis <http://www.expasy.ch/prosite> showed that all proteins contained a highly conserved catalytic triad: a serine, an aspartate and a histidine (figure [1A](#F1){ref-type="fig"}, indicated by \#) as well as substrate binding pocket domains, GGA and QSA (figure [1A](#F1){ref-type="fig"}, indicated by red boxes). Conserved domain search <http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi> showed that all three proteins belong to the esterase lipase superfamily (figure [1B](#F1){ref-type="fig"}), while ICME-LIKE2 and ICME contain carboxylesterases type-B serine active site with perfect pattern: F-\[GR\]-G-x (4)-\[LIVM\]-x-\[LIV\]-x-G-x-S-\[STAG\]-G <http://www.expasy.ch/prosite>. {#F1} Using these three proteins as search query, similar proteins with more than 50% identity from plant kingdom were retrieved from NCBI through Blastp \[[@B23]\] for the purpose of evaluating the evolutionary relationship among these proteins. Phylogenetic tree were constructed using several tree building programs, including Neighbor Joining (NJ), Minimum Evolution (ME) and Maximum Parsimony (MP), which are available at the MEGA4 website <http://www.megasoftware.net>. Clustering analysis showed that different methods yielded similar clustering patterns. The results obtained with NJ method were presented (figure [1C](#F1){ref-type="fig"}) and results obtained with ME and MP methods can be found in additional files [1](#S1){ref-type="supplementary-material"} and [2](#S2){ref-type="supplementary-material"}, respectively. Results showed that the ICME and two ICME-like proteins together with similar proteins, NP \_001132117 from *Zea mays*, BAF18320 and BAF20445 from *Oryza sativa*, CAO42055 from *Vitis vinifera*, and ABD96862 from *Cleome spinose*, could be classified into one group with 100% bootstrap support. The group is divergent from two other groups, including the previously reported 20 Arabidopsis Carboxylesterases (AtCXE) \[[@B24]\] and those that function as a suppressor of AvrBst-elicited resistance in Arabidopsis \[[@B25]\]. The analysis demonstrated that the ICME genes in Arabidopsis belong to a small gene family. ICMEs of Arabidopsis are targeted to ER and Golgi apparatus ----------------------------------------------------------- Trans-membrane domain was predicted using several online programs listed in Table [1](#T1){ref-type="table"}. ###### Programs used to predict trans-membrane domain of ICMEs of *Arabidopsis* ------------------------------------------------------------------------------------------------------------------------------------ *Programs and their websites* *Proteins* *No. of transmembrane domains* --------------------------------------------------------- ------------ ------------------------------------------------------------- DAS\ ICME-LIKE1 6 (loosing cutoff 1.7 ); 2 (strict cutoff 2.2) <http://www.sbc.su.se/~miklos/DAS/> ICME-LIKE2 4 (loosing cutoff 1.7 ); 4 (strict cutoff 2.2) ICME 4 (loosing cutoff 1.7 ); 2 (strict cutoff 2.2) HMMTOP\ ICME-LIKE1 2 (N-terminus: OUT) <http://www.enzim.hu/hmmtop/html/submit.html> ICME-LIKE2 4 (N-terminus: IN) ICME 4 (N-terminus: IN) SOSUI\ ICME-LIKE1 2 <http://bp.nuap.nagoya-u.ac.jp/sosui/sosui_submit.html> ICME-LIKE2 2 ICME NO TMpred\ ICME-LIKE1 4 (Inside to outside helices);5 (Outside to inside helices) <http://www.ch.embnet.org/software/TMPRED_form.html> ICME-LIKE2 5 (Inside to outside helices);5 (Outside to inside helices) ICME 5 (Inside to outside helices);7 (Outside to inside helices) TMHHM\ ICME-LIKE1 1 (N-terminus: IN) <http://www.cbs.dtu.dk/services/TMHMM-2.0/> ICME-LIKE2 1 (N-terminus: IN) ICME 1 (N-terminus: IN) ------------------------------------------------------------------------------------------------------------------------------------ As a result, except for SOSUI program that predicted ICME as a soluble protein, all other programs predicted that the three proteins all contain at least one trans-membrane domain (Table [1](#T1){ref-type="table"}). To provide experimental evidence of the sub-cellular localization of ICME and its homologs, a transient expression of GFP-fused ICME and its homologs into onion epidermal cells and *N. benthamiana* protoplasts that isolated from suspension cultured cells, was performed. Similar sub-cellular localization patterns of the ICME family were obtained in these two systems (the protoplast system results are presented in figure [2](#F2){ref-type="fig"} and the onion system results can be found in additional file [3](#S3){ref-type="supplementary-material"}). As shown in figures [2A](#F2){ref-type="fig"} and [2B](#F2){ref-type="fig"}, when co-expressing the free GFP gene with the ER or Golgi marker genes, the GFP fluorescence was spread throughout the cell (excluding vacuolar) with stronger signals in the nucleus (figures [2A](#F2){ref-type="fig"} and [2B](#F2){ref-type="fig"}, GFP channel), which was partially overlapped with the DesRed fluorescence emitted by the ER marker BiP-RFP (figure [2A](#F2){ref-type="fig"}, merged channel) and Golgi marker ST-mRFP (figure [2B](#F2){ref-type="fig"}, merged channel). When co-expressing the GFP fused ICME-LIKE1 with the ER and Golgi markers in protoplasts, besides small green punctates, the GFP fluorescence was predominantly restricted in the ER and Golgi apparatus, which was confirmed by co-localizing with the ER marker BiP-RFP (figure [2C](#F2){ref-type="fig"}, merged channel) and the Golgi marker ST-mRFP (figure [2D](#F2){ref-type="fig"}, merged channel). ICME-LIKE2 showed as an ER-resident protein (figure [2E](#F2){ref-type="fig"}) with partially localizing in the Golgi apparatus (figure [2F](#F2){ref-type="fig"}). Some fluorescent vesicles were observed surrounding the Golgi apparatus after GFP was fused to ICME-LIKE2 in some protoplasts (figure [2F](#F2){ref-type="fig"}, GFP channel). Similarly, ICME was predominantly localized in the ER and Golgi apparatus (figures [2G](#F2){ref-type="fig"} and [2H](#F2){ref-type="fig"}). {#F2} When the trans-membrane domain of the ICME family was predicted by using TMHHM program, both ICME and its homologs were found to contain one trans-membrane domain (Table [1](#T1){ref-type="table"}). For ICME, amino acids 102 to 124 were predicted as a trans-membrane helix. When this region was deleted and the mutant was fused to GFP followed by expression in protoplasts, the GFP fluorescence was still limited in ER and Golgi apparatus, which was confirmed by co-localizing with the ER and Golgi apparatus makers (figures [2I](#F2){ref-type="fig"} and [2J](#F2){ref-type="fig"}). Tissue-specific expression patterns of ICME gene family ------------------------------------------------------- To examine the tissue-specific expression of *ICME*and its homologs, total RNA was extracted from different tissues including roots, rosette leaves, cauline leaves, stems, flowers, and siliques of 4-5 weeks old plants, followed by further treatment with DNase to remove the possible trace genomic DNA. One microgram of DNA-free RNA was converted into cDNA and semi-quantitative RT-PCR or real-time quantitative RT-PCR (qPCR) was performed. Both semi-quantitative RT-PCR (figure [3A](#F3){ref-type="fig"}) and qPCR (figure [3B](#F3){ref-type="fig"}) results showed that all ICME genes are constitutively expressed in all examined tissues with differentiated expression levels (figures [3A](#F3){ref-type="fig"} and [3B](#F3){ref-type="fig"}). The steady-state messenger RNA (mRNA) level of *ICME*was low in the stems but high in the reproductive organs including flowers and siliques (figures [3A](#F3){ref-type="fig"} and [3B](#F3){ref-type="fig"}). For *ICME-LIKE1*, it showed the highest mRNA level in the leaves but the lowest in the stems (figures [3A](#F3){ref-type="fig"} and [3B](#F3){ref-type="fig"}). Overall, transcript abundance of the *ICME-LIKE2*gene was quite low; the mRNA level of *ICME-LIKE2*was much lower than that of *ICME*and *ICME-LIKE1*in all tested tissues (figures [3A](#F3){ref-type="fig"} and [3B](#F3){ref-type="fig"}), which was hardly detectable, especially in the vegetative organs including roots, leaves and stems, with semi-quantitative RT-PCR of less PCR cycles (figures [3A](#F3){ref-type="fig"} and [3B](#F3){ref-type="fig"}). {#F3} Expression profiles of ICME gene family in response to abiotic stresses and ABA ------------------------------------------------------------------------------- Time-course expression profiles of the ICME gene family in response to different abiotic stresses including cold (4°C), heat (37°C), drought (dehydration), mannitol (400 mM), NaCl (200 mM), and ABA (50 μM) were determined using qPCR. Overall, cold treatment resulted in no significant expression change of the *ICME*family (figure [4A](#F4){ref-type="fig"}). The *ICME-LIKE1*expression was slightly up-regulated by cold treatment after 60 min. In contrast, the expression of *ICME-LIKE2*gene was slightly down-regulated by cold treatment after 15 min and recovered to the pre-treatment level after 60 min. Similar to the *ICME-LIKE2*gene, under cold treatment, the *ICME*gene was slightly down-regulated quickly and then up-regulated. {#F4} In contrast to the response to the cold treatment, the expression of the *ICME-LIKE1*gene was down-regulated during heat treatment (figure [4B](#F4){ref-type="fig"}), which could be applied to the *ICME-LIKE2*gene (figure [4B](#F4){ref-type="fig"}). However, upon heat treatment, transcript of *ICME*showed a quick and transient increase. After 60 min of heat treatment, the *ICME*expression reached the maximum (figure [4B](#F4){ref-type="fig"}). At 120 min of heat treatment, the *ICME*expression was recovered to near the pre-treatment levels. From the expression profile, it is obvious that *ICME*is a quick and early response gene during heat stress, indicating that ICME may play an important role in the response of plants to heat stress. When suffered from drought stress, both *ICME*and its homologs exhibited similar responses. Overall, the transcript abundance of these genes was not changed significantly except that at 15 min and 120 min of drought stress. The transcripts of *ICME-LIKE1*and *ICME-LIKE2*decreased at 15 min of treatment; whereas the transcripts of *ICME*and *ICME-LIKE2*increased at 120 min after treatment (figure [4C](#F4){ref-type="fig"}). As shown in figure [4D](#F4){ref-type="fig"}, in general, both *ICME*and its homologs were elevated by osmotic stress induced by mannitol treatment with differential levels of increase. Among them, the *ICME*gene showed the most pronounced up-regulation. At 12 hr of treatment, the expression of ICME reached the maximum with its transcript abundance being at least 10 times of that of the pre-treatment. At 3 hr of treatment, the expression of *ICME-LIKE1*was maximally induced and this induction was lasted for 21 hrs. The *ICME-LIKE2*gene was induced at 3 hr of treatment and was maximally induced at 12 hr of treatment. Upon NaCl treatment, the expression profile of *ICME*and its homologs was similar to that in response to mannitol treatment. As shown in figure [4E](#F4){ref-type="fig"}, both *ICME*and its homologs were up-regulated by NaCl treatment, with *ICME*showing the strongest up-regulation. Moreover, the transcript of *ICME*increased quickly. The expression of *ICME*started increase at 1 hr of treatment and reached the maximum at 3 hr. Similarly, after 3 hr treatment, the expression of *ICME-LIKE1*was maximally induced and this induction was lasted until 24 hr of treatment. In contrast, *ICME-LIKE2*was induced at 3 hr of treatment and the expression reached the maximum at 12 hr of treatment. As shown in figure [4F](#F4){ref-type="fig"}, the expression of both *ICME*and its homologs was increased in response to ABA. Among them, *ICME*and *ICME-LIKE2*showed the most and the least pronounced up-regulation by ABA, respectively. Interestingly, transcript abundance of *ICME-LIKE2*fluctuated during the course of ABA treatment, i.e, the transcript increased at 3 hr and backed to the pre-treatment level at 6 hr and then increased again at 24 hr after treatment. In contrast, the transcript of *ICME*showed a regular pattern; it increased at 3 hr and reached the maximum at 24 hr of ABA treatment. Identification of T-DNA insertion lines --------------------------------------- To explore the biological functions of the ICME family, T-DNA insertion mutant lines were obtained from the Arabidopsis Biological Resource Center (ABRC, Ohio State University, Columbus). For each gene, two different T-DNA insertion lines were analyzed. A homozygous T-DNA insertion line, SALK_008773, with a T-DNA inserted at the 3\' UTR of *ICME-LIKE1*was identified by genomic DNA PCR and sequencing. However, this insertion neither disrupts the expression nor causes down-expression of *ICME-LIKE1*. Another line, SALK_011036 (putatively with a T-DNA inserted at the 5^th^intron according to ABRC), was identified without any insertions at *ICME-LIKE1*, although the seeds could grow on Kanamycin containing MS medium and the transcript of Neomycin Phosphotransferase gene was also amplified by RT-PCR from total RNA extracted from this line. These results suggested that this line is a T-DNA insertion line with the T-DNA inserted at other unknown position. In contrast, the homozygous T-DNA insertion lines, SALK_043448 (called *icme-like2-1*here) and SALK_002648 (called *icme-like2-2*here) with a T-DNA inserted at the 8^th^and 10^th^intron of *ICME-LIKE2*, respectively, were identified by genomic DNA PCR and sequencing (additional file [4](#S4){ref-type="supplementary-material"}). The expression of *ICME-LIKE2*was disrupted by both insertions (figure [5](#F5){ref-type="fig"}). Similarly, the homozygous T-DNA insertion lines, SALK_010304 (also called *icme-1*\[[@B22]\]) and SALK_075701 (called *icme-2*here) with a T-DNA inserted at the 1^st^intron and 11^th^exon of *ICME*, respectively, were identified by genomic DNA PCR and sequencing (additional file [5](#S5){ref-type="supplementary-material"}). Gene expression analysis showed that no transcripts (full-length ORF) of *ICME*were detected in the two homozygous mutants (figure [5](#F5){ref-type="fig"}). {#F5} Overall, *icme-like2-1, icme-like2-2, icme-1 and icme-2*mutants are not distinguishable from wild-type plants in appearance under normal growth conditions (additional file [6](#S6){ref-type="supplementary-material"}). Moreover, all of them exhibited similar responses when subjected to drought and salt stresses. Disruption of ICME-LIKE2 expression leads to increased sensitivity to ABA but slightly decreased to salt and osmotic stresses in seed germination ------------------------------------------------------------------------------------------------------------------------------------------------- Seed germination of the wild type and *icme-like2*mutants in response to ABA, salt and osmotic stresses was examined. Both *icme-like2-1*and *icme-like2-2*showed similar responses to the treatments. As shown in figure [6](#F6){ref-type="fig"}, in the absence of ABA, no differences of germination were observed between wild type and *icme-like2-1*mutant. By contrast, disruption of *ICME-LIKE2*expression leads to an increased sensitivity to ABA in seed germination, and the ABA-sensitive phenotype was apparent at all concentrations of ABA tested. On the other hand, the wild-type and the *ICME-LIKE2*mutant showed no significant differences of cotyledon greening and seedling root growth (data not shown). In addition, in the low concentration of exogenous ABA, the difference was only observed in a short span during the early time of seed germination; whereas the differences were lasted for a much longer time in the high concentrations of ABA. {#F6} In contrast to respond to ABA, overall, the *icme-like2-1*mutant showed slightly decreased sensitivity to salt (figure [7](#F7){ref-type="fig"}) and osmotic (figure [8](#F8){ref-type="fig"}) stresses in seed germination compared to the wild type. But these differences are significant only under specific concentration and stage (labeled as \* in figures [7](#F7){ref-type="fig"} and [8](#F8){ref-type="fig"}), suggesting that ICME-LIKE2 exerts its role in specific conditions and developmental stage in response to environmental stimuli. Similarly, the wild-type and the *ICME-LIKE2*mutants showed no significant differences of cotyledon greening and seedling root growth in response to these stresses. {#F7} {#F8} Discussion ========== ICME is involved in the process of demethylating the prenylated proteins in eukaryotic cells. An ICME was recently reported in Arabidopsis and its related gene was isolated \[[@B21]\]. Membranes isolated from *S. cerevisiae*cells expressing the *ICME*gene contain specific enzyme activity for relevant prenylcysteine methylesters \[[@B21]\]. Overexpression of ICME resulted in an ABA hypersensitive phenotype in stomatal closure and seed germination \[[@B22]\]. Moreover, this gene was up-regulated by ABA in Arabidopsis seedlings \[[@B22]\]. These results indicate that the demethylation of prenylated proteins is involved in at least some aspects, if not all, of ABA responses and ICME is a positive regulator of ABA signaling. Structurally, both ICME and its homologs in this study belong to the esterase lipase superfamily containing two highly conserved regions: (1) the GXSXG motif containing the Ser nucleophile (figure [1A](#F1){ref-type="fig"}); and (2) the conserved catalytic triad possessing the nucleophile-acid-His-ordered sequence (Ser, Asp, and His) (figure [1A](#F1){ref-type="fig"}). Initially, we identified ICME as an acetylcholinesterase (AChE)-like protein with the attempt to clone the gene encoding AChE-like protein in *Planta*since the AChE-like activity was detected in maize seedlings \[[@B26]\]. Until now, it is still unclear whether ICME and its two homologs, ICME-LIKE1 and ICME-LIKE2, possess enzyme activity to hydrolyze acetylthiocholine. In 2005, an AChE (NP_001105800) with 394 amino acids in length from maize seedlings was identified and the related gene was cloned \[[@B27]\]. This AChE contains the same conserved catalytic core as in the animal AChE, possessing the enzyme activity of hydrolyzing acetylthiocholine and propyonylthiocholine, but not S-butyrylthiocholine. Moreover, its enzyme activity was totally inhibited by neostigmine bromide, a specific inhibitor of animal AChE \[[@B27]\]. However, the amino acid sequence of this AChE showed no apparent similarity with that of the animal enzyme. Based on these, the authors proposed that this AChE family is a novel family of enzymes in plant kingdom. Amino acid sequence alignment showed ICME and its homologs were exhibited very lower similarity with that of the maize AChE (Data not shown), suggesting that ICME and its homologs are not AChE-like proteins. In 2003, twenty carboxylesterases in Arabidopsis (AtCXE) were systemically mined from Arabidopsis genome, and the expression profile across a range of tissues was detected by RT-PCR \[[@B24]\]. One of AtCXEs, AtCXE12, was reported to possess enzyme activity for hydrolyzing the pro-herbicide methyl-2,4-dichlorophenoxyacetate to the phytotoxic acid 2,4-dichlorophenoxyacetic acid \[[@B28]\]. It remains unknown whether ICME and its homologs have such enzyme activity to hydrolyze pro-herbicide methyl-2,4-dichlorophenoxyacetate. Although all the 20 AtCXEs contains the conserved catalytic triad, amino acid sequence alignment showed that ICME and its homologs are divergent from those AtCXEs. Moreover, none of AtCXEs is larger than 400 amino acids in length but ICME and its homologs are larger than 400 amino acids in length. In addition, ICME and its homologs are lack of the conserved sequence surrounding the motif known as the oxyanion hole in AtCXEs. Phylogenetic analysis further showed that ICME and its homologs and AtCXEs are clustered into different groups, respectively (figure [1C](#F1){ref-type="fig"}). These indicate that ICME and its homologs may not possess the enzyme activity of AtCXEs. In 2007, another carboxylesterase, SOBER1 (At4g22300), was identified as suppressors of AvrBsT-elicited resistance in Arabidopsis \[[@B25]\]. SOBER1 and its homologs are also clustered into an independent group (figure [1C](#F1){ref-type="fig"}). Enzymes in this group are smaller than that of AtCXEs and ICME and its homologs are less than 300 amino acids in length. Besides the conserved catalytic triad, enzymes in this group contain another unique \"LHGLGD\" motif in the N-terminal region that is not present in the ICME and its homologs. In summary, bioinformatic analysis in this study and previous biochemical evidence \[[@B21]\] suggest that ICME and its homologs may comprise a novel small subfamily of carboxylesterase in plant kingdom, possibly with the prenylated protein as its specific substrate. Given the high degree of similarity among ICME, ICME-LIKE1, and ICME-LIKE2 in terms of sequence and subcellular localization (figure [2](#F2){ref-type="fig"} and additional file [3](#S3){ref-type="supplementary-material"}), it is reasonable to predict that ICME-LIKE1 and ICME-LIKE2 possess ICME activity. Direct biochemical evidence of ICME activity of the ICME-like proteins is necessary for better understanding their functions in plants in the future. Documented data suggested that protein prenylation and subsequent mature processing steps promote its attachment to membrane and, in some cases, protein-protein interaction by increasing its C-terminal hydrophobicity \[[@B1]-[@B3]\]. In other words, with high possibility, a maturely prenylated protein is a membrane protein or is associated with the membrane system. ICME is involved in demthylation of the prenylated proteins, the only reversible process during protein prenylation modification. These suggest that ICME is likely a membrane-resident protein. Previous biochemical analysis also showed that enzyme activity of ICME was detected in membrane fragment \[[@B20],[@B21]\]. In the current study, more precise sub-cellular localizations of ICME family were provided using GFP tagged proteins. Initially, we fused all ICME and its homologs in frame to the N-terminus of GFP. Except for ICME, we failed to detect any fluorescent signal for GFP tagged ICME-LIKE1 and ICME-LIKE2, suggesting that N-terminus fused GFP may be unstable. We then fused these two proteins to the C-terminus of GFP and successfully detected the fluorescence. The fluorescent signals clearly revealed that proteins of the ICME family are intramembrane proteins predominantly localizing at the ER and Golgi apparatus, which was confirmed by co-expression of ER and Golgi markers, BiP-RFP and ST-mRFP, respectively (figure [2](#F2){ref-type="fig"} and additional file [3](#S3){ref-type="supplementary-material"}). These results also suggest that many prenylated proteins, at least those that being in the processes of demthylation, are targeted to ER and Golgi apparatus. Subcellular proteomics of ER and Golgi apparatus may provide more information about protein prenylation and its mature process, which will be helpful to explore the biological functions of protein prenylation. When transiently expressing GFP-ICME-LIKE2, some green vesicles surrounding the Golgi apparatus were observed in some protoplasts (figure [2](#F2){ref-type="fig"}). At present, the significance of these vesicles is unclear. We speculated that (1) these vesicles were secreted from ER and being sorted to the Golgi apparatus for its post-translational modifications. Motif scanning showed that ICME-LIKE2 could be modified by glycosylation (at the 47^th^and 213^th^amino acids Asn) and other potential manners <http://myhits.isb-sib.ch/cgi-bin/motif_scan>; (2) these vesicles modified in the Golgi apparatus were being sorted to its final target, ER. Further cell biology experiments, especially pharmacogenetic analysis, are needed to reveal the mechanisms underlying these vesicles. Contrary results were obtained in predicting the trans-membrane domain of ICME by using different programs (Table [2](#T2){ref-type="table"}). Zero and five transmembrane domains were predicted for ICME with SOSUI and TMpred programs, respectively. Deleting the putative transmembrane helix, amino acids 102^nd^to 124^th^, did not block its ER-targeting. It can be concluded from this that ICME is an intramembrane protein containing at least two transmembrane domains and predominantly localizing in the ER and Golgi apparatus. ###### Primers used in this study *Name* *Sequence (5\' to 3\')* *Use* ------------ ------------------------------------------ ------------------------------ 1gRTF GCACCATTGTAGAGCAGGTCA Semi-quantitative 1gRTR ACCAATCGCTTCTTGATCGTC RT- PCR 3gRTF TACATACCGCCAACGAGTGAT Semi-quantitative 3gRTR GCTACAAGAACCGTATCGAAG RT- PCR 5gRTF TCAAAGCAAGTCCGGAGGAGT Semi-quantitative 5gRTR TTTGGTCAGCCCATCATTGTC RT- PCR TuRTF AGAACACTGTTGTAAGGCTCAAC Semi-quantitative TuRTR GAGCTTTACTGCCTCGAACATGG RT- PCR 5gNcoI F CGGCCATGGAAATGCATTCGCCTCTTCAGACTCA pICME-GFP construction 5gNcoI R TTGCCATGGCGAAAGGGCTAATCTCACGAG 1gBglII F GCCAGATCTATGCCGTCGCAGATTCTCCAAAT pGFP-ICME-LIKE1 construction 1gSpeI R GTGACTAGTTAGAACGGACTGACCCAGTGAGCCAACTT 3gBglII F GTCTAGATCTATGCAGTTGTCTCCGGAACG pGFP-ICME-LIKE2 construction 3gSpeI R TTAACTAGTCAAAAAGGGCTGACCCTGCCAGCCAGTT 5gΔTM F1 GAAATGCATTCGCCTCTTCAG pICMEΔTM-GFP construction 5gΔTM R1 CGGACTTGCTTTGAGAAAAATTTTGTCATCCATCGATAGC 5gΔTM F2 GCTATCGATGGATGACAAAATTTTTCTCAAAGCAAGTCCG 5gΔTM R2 AAGGCATGCTACAATGATATC 1gqRTF CTCACATCATCTTCCACCTAAATC Real-time quantitative 1gqRTR AAATCGAGAGAGAAGGGTCGT PCR 3gqRTF CCGATGTCTGAAAACAGAGAGG Real-time quantitative 3gqRTR CCGGTGAAGATAATCTGTTGG PCR 5gqRTF AGGATCCCTTACGAGGAGGT Real-time quantitative 5gqRTR AGCCAACGAGTCTTTGGTCAG PCR TuqRTF GTGCTGAAGGTGGAGACGAT Real-time quantitative TuqRTR AACACGAAGACCGAACGAAT PCR Actin8qRTF TTACCCGACGGACAAGTGATC Real-time quantitative Actin8qRTR ATGATGGCTGGAAAAGGACTTC PCR P2 `tcacttccataatcggggtctg` T-DNA screening LBa1 `TggTTCACgTAgTgggCCATCg` T-DNA screening So far, the molecular information about the *ICME*family is unavailable except that the expression of *ICME*was up-regulated in Arabidopsis seedlings by ABA after 24 hrs. There is also a lack of information about the expression profiles for *ICME-LIKE1*and *ICME-LIKE2*in the public database. Study here showed that the members of the *ICME*family are expressed across a range of tissues with differential expression level (figure [3](#F3){ref-type="fig"}), indicating that ICME and its homologs may have broad functions in Arabidopsis. On the other hand, this also suggests the existence of functional redundancy among the ICME family. The base transcript of *ICME-LIKE2*is quite low, indicating it is a low abundance gene. The low detection sensitive of northern blotting may explain why there is no public microarray data available. It is also possible that the expression of *ICME-LIKE2*is indistinguishable from *ICME*due to their high similarity, leading to lack of expression information on *ICME-LIKE2*in the public microarray data. Lacking of the expression information on *ICME-LIKE1*in the public microarray data is unexpected since its base transcript abundance is similar to that of *ICME*(figure [3](#F3){ref-type="fig"}). Moreover, the transcript increased in response to cold, salt, osmotic stresses and ABA treatment (figure4). The most possible explanation for this is that the expression of *ICME-LIKE1*is indistinguishable from *ICME*because of their high similarity. By time-course assays, study here not only confirmed the previous data that *ICME*was up-regulated by ABA treatment after 24 hr \[[@B22]\], but also provided that *ICME*is also a stress-regulated gene, which is consistent with the public micoarray data <https://www.genevestigator.com/gv/directlink.jsp?geneIDs=AT5G15860>. In addition, *ICME* was dramatically up-regulated by other abiotic stresses, including heat, mannitol, and salt treatment, suggesting that ICME might be involved in stress response. Indeed, prenylated proteins have been implicated in the processes in response to heat stress \[[@B29]\]. Although study here showed that disruption the expression of ICME (figure [5](#F5){ref-type="fig"}) caused no different phenotypes between wild type and mutant plants under normal and drought and salt stress conditions (additional file [6](#S6){ref-type="supplementary-material"} and data not shown), whether the ICME activity is required for tolerating heat stress is to be confirmed with *icme*mutants, *icme*and *icme-like2*double mutants and transgenic plants bearing over-expression of ICME. By now, the biological functions of the ICME family are largely unclear; the only confirmed function is that the over-expression of ICME caused an ABA hypersensitive phenotype in stomatal closure and seed germination while *icme-1*mutant exhibited an ABA insensitive phenotype \[[@B22]\]. This is different from our data using ICME-LIKE2 mutants. Knocking out the expression of ICME-LIKE2 resulted in increased sensitivity to ABA in seed germination (figure [6](#F6){ref-type="fig"}). These suggest that ICME and ICME-LIKE2 may have different roles in seed germination in response to ABA. However, except that the disruption of *ICME-LIKE2*expression leads to increased sensitivity to ABA and slightly decreased to salt and osmotic stresses in seed germination, no significant differences were observed between wild type and mutant plants in terms of other physiological functions tested. Similarly, no significant differences were observed between wild type and ICME mutants in other biological process in previous study \[[@B22]\], which has been confirmed in the current study (additional file [6](#S6){ref-type="supplementary-material"}). This may be due to the existence of functional redundancy among the ICME family. Firstly, the expression of the ICME family is universal; secondly, the sub-cellular localizations of the ICME family are similar; thirdly, the expression patterns of the ICME family in response to abiotic stresses and ABA is similar; and finally, the members of the ICME family share high identity in amino acid and contain the conserved functional domain. The biological process of ICME-LIKE2 is worth further detailed study. Some important facts about ICME-LIKE2 include (1) it is a low abundance gene (figures [3](#F3){ref-type="fig"} and [4](#F4){ref-type="fig"}); (2) its transcript abundance is induced by abiotic stresses and ABA (figure [4](#F4){ref-type="fig"}); (3) it forms some vesicles around ER (figure [2](#F2){ref-type="fig"}); and (4) null mutants of ICME-LIKE2 are available (figure [5](#F5){ref-type="fig"}). Based on these, it can be predicted that ICME-LIKE1 and ICME-LIKE2 are involved in ABA signaling and may also be involved in other stress responses. To better understand the biological functions of the ICME family, future works will be to identify null or knock-down mutant of *icme-like1*and construct double and triple mutants of the ICME family. Conclusions =========== In this paper, the extended characterizations, sub-cellular localizations, expression profiles across different tissues and in response to abiotic stress and ABA of ICME and its homologs as well as their physiological functions are reported. These studies confirmed that there is a small ICME family with specific structural characterizations in Arabidopsis. All members of the family have similar sub-cellular localizations predominantly localizing at the ER and Golgi apparatus. The genes of the *ICME*family are expressed across a broad range of tissues. Upon stress stimuli and ABA treatment, most of the expressions of the *IMCE*family are up-regulated. Single mutants of icme and icme-like2 do not show significant effects in plant growth, development and responses to environmental stimuli. However, disruption of the *ICME-LIKE2*expression leads to increased sensitivity to ABA and slightly decreased sensitivity to salt and osmotic stresses in seed germination. Double and triple mutants of the *ICME*family may be better option to explore their functions in future. The ABA and abiotic stress regulated genes reported here are potentially useful resources for transgenic crops against drought and other stresses. Methods ======= Plant growth and treatments --------------------------- Arabidopsis thaliana ecotype Columbia was used throughout the current study. Mutant seeds *icme-like1-1*(SALK_008773), *icme-like1-2*(SALK_011036), *icme-like2-1*(SALK_043448), *icme-like2-2*(SALK_002648), *icme-1*(SALK_010304), and *icme -2*(SALK_075701) were obtained from the Arabidopsis Biological Resource Center (ABRC, Ohio State University, Columbus). Seeds were surface-sterilized and sown on solid agar plates containing 1× Murashige and Skoog (MS) salts, 1% (w/v) sucrose, 0.8% agar adjusted to pH5.7. After stratified at 4°C for 3 days, they were transferred to a growth chamber at 22°C under a 16-h light/8-h dark photoperiod at 130 μEm^-2^sec^-1^. Seven-day-old seedlings were used for different treatments: for salt, osmotic, and ABA treatment, seedlings sowed on filters (which were put on 1× MS agar media) were transferred to MS liquid media containing 200 mM NaCl, 400 mM mannitol, or 50 μM ABA for different time indicated. For cold and heat treatments, the plates were transferred to 4°C freezer or 37°C growth chamber. For dehydration test, seedlings were transferred to Petri dish covers and left at growth chamber for different length of times. After treatment, seedlings were collected in liquid nitrogen and stored at -80°C for RNA extraction. Verification of the T-DNA insertion mutants ------------------------------------------- Homozygous mutant was identified by PCR from genomic DNA using gene-specific primers (Table [2](#T2){ref-type="table"}) and T-DNA left border primers LBa1, and analyzed further by DNA sequencing to confirm the insertion of the T-DNA in the gene. Plasmid construction -------------------- ORFs encoding the full-length ICME-LIKE1, ICME-LIKE2, and ICME were amplified by PCR with the specific primer pairs listed in Table [1](#T1){ref-type="table"}. The PCR products were inserted in-frame to the C-terminus (for ICME-LIKE1 and ICME-LIKE2) or N-terminus (for ICME) of the GFP gene in plasmid pAVA121 \[[@B30]\]. This plasmid encodes an enhanced free GFP under the guide of 35 S promoter of *Cauliflower mosaic virus*and the NOS terminator, designated as pGFP here. The PCR products of ICME-LIKE1 and ICME-LIKE2 amplified with primer pairs 1gBglII F/1gSpeI R and 3gBglII F/3gSpeI R, respectively, were digested with BglII and SpeI and ligated to pGFP digested with BglII and XbaI to create pGFP-ICME-LIKE1 and pGFP-ICME-LIKE2, respectively. Similarly, PCR product of ICME from primer pair 5gNcoI F/5gNcoI R was digested with NcoI and inserted to pGFP, which was predigested with NcoI and followed by further dephosphorylation with shrimp alkaline phosphatase (Promega, USA). Constructs with correct orientation were selected by restriction assays and designated as pICME-GFP. Based on pICME-GFP, the putative transmembrane domain (TM), amino acids 102 to 124, was deleted to create plasmid pICMEΔTM-GFP by overlapping PCR. Briefly, the first fragment was generated with primer pair 5gΔTMF1/5gΔTMR1; while the second fragment was synthesized with primer pair 5gΔTMF2/5gΔTMR2 (primer 5gΔTMF2 is complementary exactly to the primer 5gΔTMR1 in nucleotide sequence). Next, overlapping PCR was performed with primer pair 5gΔTMF1/5gΔTMR2 using the mixture of the first and the second fragments as the PCR template. Following deletion, the final PCR product was digested with NsiI and NheI and subcloned into pICME-GFP digested with the same set of restriction enzymes to replace the corresponding fragment of wild type cDNA. All the final constructs were verified by DNA sequencing. Protoplast isolation, transformation, and Confocal Microscopy ------------------------------------------------------------- Protoplasts of N. benthamiana were isolated from suspension cell lines and co-transformed with plasmids bearing free GFP or GFP tagged ICME or its homologs and plasmids BiP-RFP or ST-mRFP \[[@B31]\], which are widely used as the ER and Golgi apparatus markers, respectively) as described earlier \[[@B32]\]. Confocal microscope images were taken using a confocal laser microscope MRC1024 under a ×63 water objective. DesRed images were captured in the 560- to 615-nm range after excitation at 543 nm with a HeNe laser beam. The GFP images were captured in the 505- to 530-nm range after excitation at 488 nm with an argon laser beam. Particle bombardment -------------------- Onion epidermal cells were co-bombarded with 2.5 μg of plasmids bearing free GFP, GFP tagged ICME or its homologs and plasmids BiP-RFP or ST-mRFP \[[@B30]\]. All the plasmids were coated onto 1-μm gold particles and delivered into onion epidermal cells at a pressure of 900 psi by PDS 1000/He particle delivery system (BioRad, U.S.A). After bombardment, onion slices of 2 × 2 cm were placed on a plate containing 1× MS salts, 30 g/L of sucrose, 1.5% agar, pH = 5.7. After at least 24 hr, the epidermis was removed from the onion slice and observed using a Confocal Laser Scanning Microscope. Total RNA isolation, Semi-Quantitative RT-PCR and Real-Time Quantitative RT-PCR ------------------------------------------------------------------------------- Total RNA was isolated from a broad range of tissues of 4-5 weeks old plants and seedlings of various treatments using RNeasy Mini Kit (QIAGEN) and further treated with DNase using the TURBO DNA-free Kit (Ambion) according to the manufacturer\'s manual. About 800 ng DNA-free total RNA was converted to cDNA using Oligo-dT (20) primer and Superscript II reverse transcriptase (Invitrogen) according to the manufacturer. Briefly, after incubation at 50°C for 1 h followed by 85°C for 5 min, 1 μl of RNase H was added and incubated for 20 min at 37°C. The cDNA was used as a PCR template for both Semi-Quantitative RT-PCR and Real-Time Quantitative RT-PCR. For Semi-Quantitative RT-PCR, β-tubulin was used as an internal control. Different PCR cycles (28, 30, and 35) were used for β-tubulin amplification to calculate the cDNA amount for gene-specific amplification. A total of 30 or 35 PCR cycles were used for ICMEs amplification. The PCR program used was as follows: pre-soaking in 94°C for 5 min, followed by different cycles of 94°C for 30 sec, 58°C for 30 sec and 72°C for 45 sec. A final incubation at 72°C for 7 min was included to complete product synthesis. PCR products were separated on a 1% agarose gel stained with ethidium bromide. For Real-Time Quantitative RT-PCR, PCR amplification was performed in a 20 μl reaction system using SYBR Green PCR Master Mix (Applied Biosystems) with programs recommended by the manufacturer (2 min at 50°C, 10 min at 95°C and 40 cycles of 95°C for 15 sec and 60°C for 1 min). Three independent replicates were performed for each sample. The comparative CT method was used to determine the relative amount of gene expression, with the expression of tubulin (for tissue expression patterns) or *Actin8*gene (for expression profiles responding to biotic stimuli) used as an internal control. The PCR was carried out in an ABI StepOne Real-Time PCR System (Applied Biosystems). All primers used in this study are listed in Table [2](#T2){ref-type="table"}. Seed germination and early seedling development assays ------------------------------------------------------ ### Seed Germination Plants of all genotypes were grown in the same conditions, and seeds were collected at the same time. For each comparison, seeds were planted on the same plate containing MS medium (0.5× MS salts, 1% Suc, and 0.8% agar) without or with different concentrations of ABA, NaCl or mannitol as indicated. Plates were stratified at 4°C in the dark for 3 d and transferred to 22°C with a 16-h-light/8-h-dark cycle. The percentage of seed germination was scored at the indicated times. Germination was defined as an obvious emergence of the radicle through the seed coat. ### Cotyledon greening To study the effect of ABA and other osmotic agents on cotyledon greening, seeds were sown on MS medium as described above. Three days after stratification, germinated seeds were transferred to medium containing different concentrations of ABA or other osmotic agents (NaCl and mannitol) as indicated. The percentage of cotyledon greening was recorded at 7 d after the end of stratification. Cotyledon greening is defined as obvious cotyledon expansion and turning green. ### Seedling root growth To study the effect of ABA and or other osmotic agents on seedling root growth, seeds were sown on MS plates vertically in growth chamber. Five-day-old seedlings were transferred to medium containing different concentrations of ABA or other osmotic agents for another 5 days and root growth was measured after the transfer. Drought, salt treatment and determination of transpiration rate --------------------------------------------------------------- Drought tolerance test was examined in soil, 7-day-old seedlings were transplanted from MS plates to the soil for another 2 weeks under normal growth conditions. Plants were then subjected to progressive drought test by withholding water for specified times or rosette leaves of similar developmental stages (third to fifth true rosette leaves) were detached and placed abaxial side up on open Petri dishes and weighed at different time intervals at room temperature to determine transpiration rate. For salt treatment, 3-week-old plants were watered with salt solution with increased concentration from 50 mM to 200 mM every four days. To minimize experimental variations, the same numbers of plants were grown on the same tray. The entire test was repeated for a minimum of three times. Authors\' contributions ======================= PL performed bioinformatics analysis, sub-cellular localization, germination experiments, identified T-DNA mutants (ICME-LIKE1 and ICME-LIKE2 genes) and drafted the manuscript. WL conducted real-time PCR, identified T-DNA mutants (ICME gene) and participated in drafting the manuscript. HW performed the Phylogenetic tree construction with Minimum Evolution and Maximum Parsimony methods and aided in data analysis. WM conceived the study, assisted in designing the experiment, interpretation of the data, and finalizing the manuscript. All authors approved of the manuscript. Supplementary Material ====================== ###### Additional file 1 **Phylogenetic tree was constructed by Minimum Evolution method using MEGA4 program**. Phylogenetic relationships of ICME, ICME-like proteins and their homologs from *Zea mays, Oryza sativa, Vitis vinifera*, and *Cleome spinosa*as well as carboxylesterases from *Arabidopsis*. ###### Click here for file ###### Additional file 2 **Phylogenetic tree was constructed by Maximum Parsimony method using MEGA4 program**. Phylogenetic relationships of ICME, ICME-like proteins and their homologs from *Zea mays, Oryza sativa, Vitis vinifera*, and *Cleome spinosa*as well as carboxylesterases from *Arabidopsis*. ###### Click here for file ###### Additional file 3 **Sub-cellular localization of GFP-tagged ICME and its homologs**. Onion epidermal cells were co-transformed with free GFP, GFP-ICME-LIKE1, GFP -ICME-LIKE2, ICME-GFP and ER marker BiP-RFP (A, C and E) or Golgi apparatus marker ST-mRFP (B, D and F), respectively. For each combination shown on the right, images of GFP fluorescence, DesRed fluorescence, brightfield, and the merged were taken using a Zeiss confocal laser microscope LSM510 and were displayed from left to right, respectively. ###### Click here for file ###### Additional file 4 **Identification of T-DNA insertion mutant lines of *ICME-LIKE2*gene**. (A) Gene structure of the *ICME*(thick lines indicate exon and thin lines indicate intron) and the locations of the T-DNA insertion in the icme-1(SALK_043448) and icme-2 (SALK_002648) lines are shown. Primers used to screen are shown as arrows. (B) Homozygous T-DNA insertion lines were identified by Genomic-PCR. *icme-like2-1*was identified by two primer pairs: (1) LBa1 and gene-specific forward primer 3gRTF for confirming T-DNA insertion and (2) 3gRTIF and 3gRTR for confirming homozygous T-DNA insertion. *icme-like2-2*was identified by two primer pairs: (1) LBa1 and gene-specific reverse primer 3gRTR for confirming T-DNA insertion and (2) 3gRTF and 3gRTR for confirming homozygous T-DNA insertion. (C) The flanking sequence of the T-DNA insertion lines. The position of the T-DNA insertion was confirmed by DNA sequence analysis of the resultant PCR products. Sequences underlined referred to the left border of LB, while the italic ones referred to the genomic sequences. The bold ones indicated the additional sequences due to T-DNA insertion. ###### Click here for file ###### Additional file 5 **Identification of T-DNA insertion mutant lines of *ICME*gene**. (A) Gene structure of the *ICME*(thick lines indicate exon and thin lines indicate intron) and the locations of the T-DNA insertion in the icme-1(SALK_010304) and icme-2 (SALK_075701) lines are shown. Primers used to screen are shown as arrows. **(B)**Homozygous T-DNA insertion lines were identified by Genomic-PCR. *icme-1*was identified by two primer pairs: (1) LBa1 and gene-specific forward primer 5gNcoIF for confirming T-DNA insertion and (2) 5gNcoIF and 5gRTR for confirming homozygous T-DNA insertion. *icme-2*was identified by two primer pairs: (1) LBa1 and gene-specific forward primer P2 for confirming T-DNA insertion and (2) P2 and 5gRTR for confirming homozygous T-DNA insertion. **(C)**The flanking sequence of the T-DNA insertion lines. The position of the T-DNA insertion was confirmed by DNA sequence analysis of the resultant PCR products. Sequences underlined referred to the left border of LB, while the italic ones referred to the genomic sequence. The bold ones indicated the additional sequences due to T-DNA insertion. ###### Click here for file ###### Additional file 6 **Phenotypes, drought treatment and transpiration rates of wild type and mutants**. The up panels of (**A)**and (**B)**were 21-day-old plants under normal growth condition of different genotypes. The down panels of (**A**) and (**B)**were drought treated plants. For drought treatment, 21-day-old plants under normal growth condition of different genotypes were withheld water for 14 days. **(C)**Transpiration rates. Rosette leaves of the same developmental stages were excised from 21-old-day plants and weighed at various time points after detachment. Each data point represents the mean of duplicate measurements. Error bars represent SD (*n*= 3 each). ###### Click here for file Acknowledgements ================ The study was financially supported by Murdoch University internal post-doctoral fellowship. Hangzhou Normal University provided supplementary funds to the study. We thank the Arabidopsis Biological Resource Center (ABRC) and SALK Institute for providing T-DNA insertion lines. The authors would like to extend their thanks to the two journal appointed reviewers who have given constructive comments and suggestion to improve the manuscript.

Jetstar pilots could walk off the job a matter of days before Christmas, in a move that could disrupt the holiday plans of thousands of Australians over the airline's busiest period. The Fair Work Commission gave the Australian Federation of Air Pilots the green light on Monday to hold a ballot on whether to take protected industrial action over a year-long pay dispute with the budget airline. Watch the video above Jetstar did not object to the union's application. The ballot is not expected to be finalised and approved by Elections Australia for at least another three weeks, meaning any proposed strike action would not commence until mid-December at the earliest. Pilots have been negotiating a new Enterprise Bargaining Agreement since January. But negotiations have broken down in recent weeks. Pay and conditions The union's executive director Simon Lutton said Jetstar's pilots were the lowest-paid jet airline pilots among Australia's four major carriers, and there were also concerns over working conditions that could threaten safety. "They have been subjected to gruelling rostering practices which the airline has refused to address at the negotiating table," Lutton said. "The Jetstar pilots are disappointed to have to take this step. "But, as negotiating with the company in good faith has got them nowhere, they have been left with no choice." More on 7NEWS.com.au A Jetstar spokesperson told 7NEWS.com.au: "It is disappointing that the AFAP has taken this step this early in negotiations. "We remain committed to reaching a new agreement to support the great work our people do every day, but not at any cost."

Pepper co-founders Jaclyn Fu and Lia Winograd believe their products for small-breasted women could be a $4 billion industry. The company's bra concept is up for $180,000 dollars at the WeWork Creator Awards in New York City. The city of Denver leans heavily on its international airport when building a brand in an increasingly global economy. From Cozumel and Calgary to London, Paris, Panama City, and Zurich, travelers departing from DIA will have direct access 26 international destinations by 2018. Development News Owner of Show of Hands, an art gallery and gift shop that’s called Cherry Creek North home for 32 years, said she’s seen sales decline this year as shoppers steer clear of the area because of construction. Featured Neighborhood Where else in Denver would you come across a cardboard sign propped on a barricade that says, "Street closed, block party?" Cut off from the central part of Denver by I-25, LoHi is where people who love the city, but are over carrying groceries for six blocks and taking out a loan to pay accumulated parking tickets, live. LoHi neighbors let the city in through loft windows (we're on a hill after all) and often work from its cafes and restaurants. The LoHi Music Festival in August is gaining in popularity and the brewing industry has followed Denver beer lovers into this outlying neighborhood. Even further removed from central Denver than LoHi, the Highlands attracts professionals and families who operate within their own parameters. Pieces of the neighborhood remain unpolished -- which is part of its attraction.

The 35-minute power outage at Sunday's Super Bowl XLVII caused consternation for CBS, the network that broadcast the game. For advertisers, the outcome was mixed, as some lost exposure and at least three fast-acting marketers were able to use Twitter to capture some attention. Looking at it in the context of viewability -- which has been a major issue lately for internet advertisers -- the blackout demonstrated TV, like the web, can fall short of reaching the eyeballs projected for a given ad placement. DVR provider TiVo was able to give marketers a small glimpse of which commercials were seen the most thanks to its set-top box analytics. However the company's second-by-second audience measurement data only counts a sample of 30,000 anonymous households. While it's not clear how many people tuned out during the "blackout," CBS has issued a statement promising to "honor all commercial commitments" nevertheless. According to TiVo's stats, this year's "most engaging Super Bowl commercial" was claimed by Taco Bell's Viva Young. Perhaps tellingly, all the top commercials in TiVo's ranking (read the release) were in the first half. Given the fact that the contest between the ultimately victorious Baltimore Ravens and the San Francisco 49ers wasn't even close before the half-time show starring Beyoncé, and the fact also, that viewership from non-football fans often drops off after the half-time shows, it seems very likely that the blackout had an impact. However, social media appeared to step into the void as viewers' attention turned from the broadcast to Twitter to see what was going on. Oreo, Bud Light and Tide all posted tweets related to the power outage and saw significant buzz until the game returned. Indeed, Super Bowl XLVII, broadcast on the CBS Television Network and streamed live on CBSSports.com, smashed the record as the most social event in the history of television, according to third-party research firms BlueFin and Trendrr. Trendrr tracked more than 47.5 million social comments, more than twice the numbers tracked for last year's Grammys and Super Bowl, the previous top events. Proactively tweeting about the big game may have been a bright move, and not only because so many millions were active on social platforms. "During the blackout, social conversations around ads had a clearly defined drop in activity," said Sean Reckwerdt, lead TV analyst at Networked Insights, in an email to AdExchanger. "The barrage of rerun ads (and those for CBS shows) were not helping to drive viewer conversations. The few brands that were quick on their feet and were able to 'hijack' the situation, like Oreo and Tide with their humorous relevant content, were able to garner a few impressions and applause from the viewers. However if the game had not quickly become so enthralling with the 49ers starting their comeback, the advertiser conversation may not have recovered to similar levels as they were pre-halftime." While analytics providers like Nielsen attempt to discern the level of viewer interest in TV spots by examining social media chatter on Twitter and Facebook, YouTube also provides a clear "sample" for Super Bowl ad viewability. Volkswagen's "Get In. Get Happy" garnered more than 8,373,067 views on YouTube before the live airings. In fact, nine of this year's top ten commercials were previewed on the web before the big game, suggesting that the answer to TV's viewability issues may lie in how people react to TV spots on the internet.

<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <!--NewPage--> <HTML> <HEAD> <!-- Generated by javadoc (build 1.6.0_31) on Sun Jan 06 11:49:17 CST 2013 --> <TITLE> Uses of Class com.intel.cosbench.driver.web.MissionPageController </TITLE> <META NAME="date" CONTENT="2013-01-06"> <LINK REL ="stylesheet" TYPE="text/css" HREF="../../../../../../stylesheet.css" TITLE="Style"> <SCRIPT type="text/javascript"> function windowTitle() { if (location.href.indexOf('is-external=true') == -1) { parent.document.title="Uses of Class com.intel.cosbench.driver.web.MissionPageController"; } } </SCRIPT> <NOSCRIPT> </NOSCRIPT> </HEAD> <BODY BGCOLOR="white" onload="windowTitle();"> <HR> <!-- ========= START OF TOP NAVBAR ======= --> <A NAME="navbar_top"><!-- --></A> <A HREF="#skip-navbar_top" title="Skip navigation links"></A> <TABLE BORDER="0" WIDTH="100%" CELLPADDING="1" CELLSPACING="0" SUMMARY=""> <TR> <TD COLSPAN=2 BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A NAME="navbar_top_firstrow"><!-- --></A> <TABLE BORDER="0" CELLPADDING="0" CELLSPACING="3" SUMMARY=""> <TR ALIGN="center" VALIGN="top"> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../../../../overview-summary.html"><FONT CLASS="NavBarFont1"><B>Overview</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../package-summary.html"><FONT CLASS="NavBarFont1"><B>Package</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../../../../com/intel/cosbench/driver/web/MissionPageController.html" title="class in com.intel.cosbench.driver.web"><FONT CLASS="NavBarFont1"><B>Class</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#FFFFFF" CLASS="NavBarCell1Rev"> &nbsp;<FONT CLASS="NavBarFont1Rev"><B>Use</B></FONT>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../package-tree.html"><FONT CLASS="NavBarFont1"><B>Tree</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../../../../deprecated-list.html"><FONT CLASS="NavBarFont1"><B>Deprecated</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../../../../index-files/index-1.html"><FONT CLASS="NavBarFont1"><B>Index</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../../../../help-doc.html"><FONT CLASS="NavBarFont1"><B>Help</B></FONT></A>&nbsp;</TD> </TR> </TABLE> </TD> <TD ALIGN="right" VALIGN="top" ROWSPAN=3><EM> </EM> </TD> </TR> <TR> <TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2"> &nbsp;PREV&nbsp; &nbsp;NEXT</FONT></TD> <TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2"> <A HREF="../../../../../../index.html?com/intel/cosbench/driver/web/\class-useMissionPageController.html" target="_top"><B>FRAMES</B></A> &nbsp; &nbsp;<A HREF="MissionPageController.html" target="_top"><B>NO FRAMES</B></A> &nbsp; &nbsp;<SCRIPT type="text/javascript"> <!-- if(window==top) { document.writeln('<A HREF="../../../../../../allclasses-noframe.html"><B>All Classes</B></A>'); } //--> </SCRIPT> <NOSCRIPT> <A HREF="../../../../../../allclasses-noframe.html"><B>All Classes</B></A> </NOSCRIPT> </FONT></TD> </TR> </TABLE> <A NAME="skip-navbar_top"></A> <!-- ========= END OF TOP NAVBAR ========= --> <HR> <CENTER> <H2> <B>Uses of Class<br>com.intel.cosbench.driver.web.MissionPageController</B></H2> </CENTER> <TABLE BORDER="1" WIDTH="100%" CELLPADDING="3" CELLSPACING="0" SUMMARY=""> <TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor"> <TH ALIGN="left" COLSPAN="2"><FONT SIZE="+2"> Packages that use <A HREF="../../../../../../com/intel/cosbench/driver/web/MissionPageController.html" title="class in com.intel.cosbench.driver.web">MissionPageController</A></FONT></TH> </TR> <TR BGCOLOR="white" CLASS="TableRowColor"> <TD><A HREF="#com.intel.cosbench.driver.web"><B>com.intel.cosbench.driver.web</B></A></TD> <TD>&nbsp;&nbsp;</TD> </TR> </TABLE> &nbsp; <P> <A NAME="com.intel.cosbench.driver.web"><!-- --></A> <TABLE BORDER="1" WIDTH="100%" CELLPADDING="3" CELLSPACING="0" SUMMARY=""> <TR BGCOLOR="#CCCCFF" CLASS="TableHeadingColor"> <TH ALIGN="left" COLSPAN="2"><FONT SIZE="+2"> Uses of <A HREF="../../../../../../com/intel/cosbench/driver/web/MissionPageController.html" title="class in com.intel.cosbench.driver.web">MissionPageController</A> in <A HREF="../../../../../../com/intel/cosbench/driver/web/package-summary.html">com.intel.cosbench.driver.web</A></FONT></TH> </TR> </TABLE> &nbsp; <P> <TABLE BORDER="1" WIDTH="100%" CELLPADDING="3" CELLSPACING="0" SUMMARY=""> <TR BGCOLOR="#CCCCFF" CLASS="TableSubHeadingColor"> <TH ALIGN="left" COLSPAN="2">Subclasses of <A HREF="../../../../../../com/intel/cosbench/driver/web/MissionPageController.html" title="class in com.intel.cosbench.driver.web">MissionPageController</A> in <A HREF="../../../../../../com/intel/cosbench/driver/web/package-summary.html">com.intel.cosbench.driver.web</A></FONT></TH> </TR> <TR BGCOLOR="white" CLASS="TableRowColor"> <TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1"> <CODE>&nbsp;class</CODE></FONT></TD> <TD><CODE><B><A HREF="../../../../../../com/intel/cosbench/driver/web/AbortMissionController.html" title="class in com.intel.cosbench.driver.web">AbortMissionController</A></B></CODE> <BR> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</TD> </TR> <TR BGCOLOR="white" CLASS="TableRowColor"> <TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1"> <CODE>&nbsp;class</CODE></FONT></TD> <TD><CODE><B><A HREF="../../../../../../com/intel/cosbench/driver/web/CloseMissionController.html" title="class in com.intel.cosbench.driver.web">CloseMissionController</A></B></CODE> <BR> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</TD> </TR> <TR BGCOLOR="white" CLASS="TableRowColor"> <TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1"> <CODE>&nbsp;class</CODE></FONT></TD> <TD><CODE><B><A HREF="../../../../../../com/intel/cosbench/driver/web/LaunchMissionController.html" title="class in com.intel.cosbench.driver.web">LaunchMissionController</A></B></CODE> <BR> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</TD> </TR> <TR BGCOLOR="white" CLASS="TableRowColor"> <TD ALIGN="right" VALIGN="top" WIDTH="1%"><FONT SIZE="-1"> <CODE>&nbsp;class</CODE></FONT></TD> <TD><CODE><B><A HREF="../../../../../../com/intel/cosbench/driver/web/PerformLoginController.html" title="class in com.intel.cosbench.driver.web">PerformLoginController</A></B></CODE> <BR> &nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</TD> </TR> </TABLE> &nbsp; <P> <HR> <!-- ======= START OF BOTTOM NAVBAR ====== --> <A NAME="navbar_bottom"><!-- --></A> <A HREF="#skip-navbar_bottom" title="Skip navigation links"></A> <TABLE BORDER="0" WIDTH="100%" CELLPADDING="1" CELLSPACING="0" SUMMARY=""> <TR> <TD COLSPAN=2 BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A NAME="navbar_bottom_firstrow"><!-- --></A> <TABLE BORDER="0" CELLPADDING="0" CELLSPACING="3" SUMMARY=""> <TR ALIGN="center" VALIGN="top"> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../../../../overview-summary.html"><FONT CLASS="NavBarFont1"><B>Overview</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../package-summary.html"><FONT CLASS="NavBarFont1"><B>Package</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../../../../com/intel/cosbench/driver/web/MissionPageController.html" title="class in com.intel.cosbench.driver.web"><FONT CLASS="NavBarFont1"><B>Class</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#FFFFFF" CLASS="NavBarCell1Rev"> &nbsp;<FONT CLASS="NavBarFont1Rev"><B>Use</B></FONT>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../package-tree.html"><FONT CLASS="NavBarFont1"><B>Tree</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../../../../deprecated-list.html"><FONT CLASS="NavBarFont1"><B>Deprecated</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../../../../index-files/index-1.html"><FONT CLASS="NavBarFont1"><B>Index</B></FONT></A>&nbsp;</TD> <TD BGCOLOR="#EEEEFF" CLASS="NavBarCell1"> <A HREF="../../../../../../help-doc.html"><FONT CLASS="NavBarFont1"><B>Help</B></FONT></A>&nbsp;</TD> </TR> </TABLE> </TD> <TD ALIGN="right" VALIGN="top" ROWSPAN=3><EM> </EM> </TD> </TR> <TR> <TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2"> &nbsp;PREV&nbsp; &nbsp;NEXT</FONT></TD> <TD BGCOLOR="white" CLASS="NavBarCell2"><FONT SIZE="-2"> <A HREF="../../../../../../index.html?com/intel/cosbench/driver/web/\class-useMissionPageController.html" target="_top"><B>FRAMES</B></A> &nbsp; &nbsp;<A HREF="MissionPageController.html" target="_top"><B>NO FRAMES</B></A> &nbsp; &nbsp;<SCRIPT type="text/javascript"> <!-- if(window==top) { document.writeln('<A HREF="../../../../../../allclasses-noframe.html"><B>All Classes</B></A>'); } //--> </SCRIPT> <NOSCRIPT> <A HREF="../../../../../../allclasses-noframe.html"><B>All Classes</B></A> </NOSCRIPT> </FONT></TD> </TR> </TABLE> <A NAME="skip-navbar_bottom"></A> <!-- ======== END OF BOTTOM NAVBAR ======= --> <HR> </BODY> </HTML>

--- abstract: | In this initial paper in a series, we first discuss why classical motions of small particles should be treated statistically. Then we show that [*any*]{} attempted statistical description of [*any*]{} nonrelativistic classical system inevitably yields the multi-coordinate Schrödinger equation, with its usual boundary conditions and solutions, as an essential statistical equation for the system. We derive the general “canonical quantization” rule, that the Hamiltonian operator must be the classical Hamiltonian in the $N$-dimensional metric configuration space defined by the classical kinetic energy of the system, with the classical conjugate momentum $N$-vector replaced by $-i\hbar$ times the vector gradient operator in that space. We obtain these results by using conservation of probability, general tensor calculus, the Madelung transform, the Ehrenfest theorem and/or the Hamilton-Jacobi equation, and comparison with results for the charged harmonic oscillator in stochastic electrodynamics. We also provide two illustrative examples and a discussion of how coordinate trajectories could be compatible with wave properties such as interference, diffraction, and tunneling. PACS numbers: 02.50Fz,03.65.Ta, 03.65.Sq author: - 'G. H. Goedecke' title: | Statistical approach to quantum mechanics\ I: General nonrelativistic theory --- Introduction {#Intro} ============ There is no universally accepted derivation of the Schrödinger equation for a single spinless pointlike particle, and certainly no derivation of quantum mechanics as a whole. There have been many attempts to establish a classical stochastic foundation for the single-particle Schrödinger or Dirac equation, e.g., Bohm’s hidden variable theory [@Bohm]; the stochastic mechanics approach of Nelson [@Nelson] and Baublitz [@Baublitz]; Okamoto’s approach using a complex Langevin equation [@Okamoto]; Srinivasan and Sudarshan’s use of quaternion measures and the Langevin equation (to obtain the Dirac equation) [@SrinivasanSudarshan]; use of the Fokker-Planck equation [@SED1]; and extensive work on the global statistical hidden variable theory known as stochastic electrodynamics (SED) [@SED1; @SED2]. Also, Gilson [@Gilson] and Collins [@Collins1; @Collins2; @Collins3; @Collins4] used the Madelung transform [@Madelung] in reverse to obtain a wave equation that must be obeyed by any system that satisfies a continuity equation for a non-negative density and associated flux in three-dimensional Eulidean space. Their wave equation has exactly the same [*form*]{} as the Schrödinger equation for a single point particle, but contains unknown functions instead of the potential energy and electromagnetic vector potential, and an unknown constant instead of Planck’s constant. The unknown functions and constant would be different for, say, a classical fluid system than for the statistical description of a one-particle system. The central hypothesis underlying most of the above-mentioned work is that quantum mechanics is actually a statistical description of the classical motions of small particles that are acted upon by both stochastic and non-stochastic force fields. In this work, we follow that hypothesis. In section \[SEMP\] we first mention the features and failures of classical electrodynamics that necessitate a statistical description of the motions of small charged particles. Then we provide a concise derivation of Collins’ statistical wave equation for a single electric monopole particle. Without reference to the Schrödinger equation, we show that the unknown quantities in the statistical equation must be the particle’s potential energy, the electromagnetic vector potential, and Planck’s constant. Also we note that the wavefuction of the equation has the same significance and must satisfy the same boundary conditions as the Schrödinger wavefunction, whereby the statistical wave equation and its solutions are indeed identical in all cases to the axiomatic Schrödinger equation and its solutions for such a particle. In section \[schrodinger\] we develop the mathematical formalism for the statistical description of the nonrelativistic motions of one or many particles, each of which may have mass, electric charge, spin and associated magnetic dipole moment, and possibly other properties, such that $N$ generalized coordinates are needed to describe the system classically. We begin with a generic nonrelativistic classical Lagrangian and corresponding Hamiltonian for $N$ generalized curvilinear coordinates, identify the metric of this $N$-space, and obtain the generalized Newton’s second law. Then, because the system must be treated statistically for the same reasons discussed in section \[SEMP\], we write down the ensemble-averaged continuity equation for the generalized-coordinate probability density and flux, and show by the same methods used in section \[SEMP\] that this $N$-space continuity equation indeed implies the usual $N$-space Schrödinger equation involving the expected general canonical quantization and the usual boundary conditions, solutions, and significance for the N-space wavefunction. In section \[examples\], we provide analyses for two important examples. The first example is a rudimentary two-particle atom, which yields the usual hydrogenic Schrödinger equation for spinless particles. The second example is a system of arbitrarily many spinless pointlike identical particles, which yields the expected nonrelativistic many-body quantum field theory for spinless bosons or fermions as a statistical theory. In section \[summary\], we provide a summary and discussion of our results, including possible differences in interpretation between the statistical nonrelativistic quantum mechanics developed herein and the conventional axiomatic nonrelativistic quantum mechanics; a preview of the next paper on particles with spin and magnetic moment; and plans and suggestions for future work. In the Appendix, we provide a summary of the general tensor calculus methods used in section \[schrodinger\]. Single electric monopole particle {#SEMP} ================================= In subsection \[failures\] below, we discuss the reasons why classical electrodynamics generally cannot be used to obtain the detailed motions of a pointlike electric monopole particle of small mass. In subsection \[statistics\], we show that the correct statistical description of the nonrelativistic motions of such a particle is indeed the conventional Schrödinger equation in three spatial dimensions along with its usual boundary conditions and solutions. Failures of classical electrodynamics {#failures} ------------------------------------- In order to appreciate the two principal features of classical electrodynamics (CED) that make it unable to predict the detailed motions of very small particles, one may consider a very simple system consisting of one indestructible particle having only the attributes of electric charge $q$, mass $m$, and center-of-mass (CM) position vector $\bm{X}(t)$ as a function of time $t$, acted upon by electromagnetic fields. For this system, nonrelativistic CED consists of the Maxwell equations and Newton’s second law for $\bm{X}(t)$, with Lorentz force containing both arbitrary external electromagnetic fields and appropriate self-fields. The self-fields and thus a radiation reaction force should be present; otherwise, e.g., Newton’s law would predict that a classical orbit in an isolated hydrogen atom would be stable despite its energy loss due to radiation. The first major failure of CED is that it offers no satisfactory representation of the radiation reaction force that acts on an accelerated charged particle. All attempts to derive radiation reaction self-forces from causal self-fields yield either runaway or acausal solutions of Newton’s 2nd law, as well as unbounded self-energy, in the point particle limit. The unbounded self-energy is not a fatal problem because it can be absorbed into a renormalized mass. One can avoid both the unbounded self- energy and runaway/acausal pathologies by using an extended-particle model, but a mass renormalization, albeit finite, is still needed, and the effective Newton’s law contains time derivatives of $\bm{X}(t)$ of arbitrarily high order, or becomes (approximately) a differential-difference equation [@Goedecke1975] that is dependent on the structure of the model particle. Special relativistic treatments such as the Lorentz-Dirac equation do not remove the difficulties. The second and even more important major failure of CED stems from the conventional interpretation of the classical Maxwell equations that the external electromagnetic fields acting on any particle are the sum of presumably causal fields emitted by other particles/sources. In principle, these external field sources are all the other particles in the universe. These causal fields include a broadband radiation field that cannot be described precisely unless the detailed motions of its sources are known exactly, which is manifestly impossible. So this radiation field should be expressed as a stochastic field. We shall call this field the “universal background field” (UBF), and later introduce a specific statistical model for it. If an object is sufficiently massive (macroscopic), neither the UBF nor the radiation reaction self-fields acting on its constituent microscopic particles should have measurable effect on the CM or rigid rotational motion of the object, so [*e.g.*]{} the CM coordinate of such an object should satisfy the classical Newton’s 2nd law in the presence of known applied force fields. However, any particle/object that interacts electromagnetically in molecular, atomic and nuclear processes has such small mass that even a fairly weak UBF should cause its CM position $\bm{X}(t)$, its overall angular velocity $\bm{\omega}(t)$ about its CM, and possibly other (internal) coordinates to execute considerable “zitterbewegung”, rapidly oscillating/fluctuating motion, which in turn should produce significant radiation reaction. Even if one could find closed-form expressions for $\bm{X}(t)$ and $\bm{\omega}(t)$ by solving the classical motion equations for such a particle, which is almost never possible, the expressions would contain the stochastic variables carried by the UBF. The conclusion is inevitable: The classical motions of small-mass particles should be described statistically. Statistics of single-particle translational motion {#statistics} -------------------------------------------------- ### Position probability densities and continuity equations {#3D continuity} In [*any*]{} statistical description of the motion of a pointlike particle that has the attributes of electric charge $q$, inertial mass $m$, and CM position $\bm{X}(t)$, but no rotational or other degrees of freedom, one fundamental quantity is the position probability density $\rho(x,t)$, such that $\rho(x,t)d^3x$ is the probability that the particle CM is in volume element $d^3x$ at location $x$ at time $t$. In this section, $x$ stands for the three independent Cartesian coordinate variables $x=x^1,x^2,x^3$ in a Euclidean 3-space, and $X(t)=X^1(t),X^2(t),X^3(t)$ for the three Cartesian coordinates of the particle CM as functions of $t$. The CM moves on a trajectory given by $x^i=X^i(t),\;i = 1,2,3$. The CM position vector may be written $\bm{X}(t)=\bm{\hat{e}}_i X^i(t)$, where the three Cartesian basis vectors $\bm{\hat{e}}_i = \bm{\hat{e}}^i$ are the orthogonal unit vectors of right-handed Cartesian coordinates. Repeated coordinate indices in any expression are summed over, from 1 to 3 in this case. We indicate the coordinates by superscripts in accordance with the standard notation of general tensor calculus (see the Appendix) that we must use in section \[schrodinger\] below. The fine-grained CM position probability density is $$\rho^f(x,t)=\prod_{i=1}^3 \delta \left( x^i-X^i(t) \right),$$ where $\delta$ is the Dirac delta. The associated fine-grained probability current density (flux) is $$\bm{j}^f(x,t)=\bm{\hat{e}}_i \dot{X}^i(t)\rho^f = \bm{\dot{X}}(t)\rho^f.$$ Note that these quantities satisfy the continuity relation $$\label{eq1} \partial_t \rho^f + \bm{\nabla}\bm{\cdot}\bm{j}^f = 0,$$ which guarantees conservation of probability. Here, the gradient operator $\bm{\nabla}=\bm{\hat{e}}^j \partial_j$ and $\partial_j = \partial/\partial x^j$, $\partial_t = \partial/\partial t$. However, these fine-grained densities are rarely useful, because in virtually no cases can we obtain expressions or accurate numerical solutions for $\bm{X}(t)$ for small masses, as mentioned above. A statistical description involving “smooth” densities is needed, so some kind of averaging of the fine-grained densities must be done. As we shall see below, the average that should be used is the ensemble average over the very many (perhaps infinitely many) stochastic variables in the UBF. Then the primary quantities of interest are the ensemble averages of the fine-grained densities, $\rho = \left<\rho^f \right>$ and $\bm{j} = \left<\bm{j}^f \right>$ , where $\left<\;\right>$ signifies the ensemble average. Clearly, the averaged densities also satisfy the continuity equation $$\label{eq2} \partial_t \rho + \bm{\nabla}\bm{\cdot}\bm{j} = 0,$$ since the processes of ensemble averaging and spacetime derivation commute. Furthermore, these smooth densities must satisfy eq. (\[eq2\]) regardless of whether detailed particle trajectories and fine-grained densities even exist, simply because probability must be conserved. Also we note that eq. (\[eq2\]) must be satisfied irrespective of what stochastic process is considered, [*e.g.*]{}, Markovian or not, and independently of what kind of stochastic dynamics is considered, [*e.g.*]{}, the Langevin equation, the Fokker-Planck equation, etc., and independently of what kind of position-velocity or position-momentum phase space treatment may be valid. In particular, the position probability density, fine-grained or smooth, is always related to the position-velocity ($x,v$) phase space probability density $f(x,v,t)$ by $\rho(x,t) = \int d^3v f(x,v,t)$, where the integral is over all velocity space; and similarly for position-momentum phase space. To the best of our knowledge, all statistical treatments of any kind have (usually tacitly) assumed that the densities are smooth differentiable functions, [*e.g.*]{}, not containing Dirac deltas. We began above with fine-grained position probability densities, analogously to the Klimontovich phase space approach in plasma physics, in order to emphasize that the statistical Schrödinger equation obtained in what follows seems to be compatible with coordinate trajectories. ### The Schrödinger equation {#3DSEQ} In this subsection, we show that the smooth-density continuity equation plus a very few other requirements [*inevitably*]{} yield the conventional Schrödinger equation (SEQ) as a correct statistical description of the single electric monopole particle system treated above. The first part of the derivation was published in 1977 by R.E.Collins [@Collins1]. We provide a concise form of Collins’ derivation below not only for clarity but also because we can use the same set of equations in sec. \[schrodinger\]. The first step is to define a probability flow velocity field $\bm{v}(x,t)$ by writing $$\label{eq3} \bm{j}(x,t)=\rho(x,t)\bm{v}(x,t),$$ so that $\bm{v}$ is analogous to a fluid flow velocity field. The physical significance of $\bm{v}$ will become apparent in the next subsection. It will be smooth since both $\rho$ and $\bm{j}$ are smooth. This definition may always be made provided that $\bm{j} = 0$ if $\rho = 0$, which is the case in any physical theory. With no loss of generality, one may express $\bm{v}$ as the sum of a gradient and another vector field that is not a gradient: $$\label{eq4} \bm{v}(x,t) = \frac{\Gamma}{m}\bm{\nabla}\Phi(x,t) - \bm{u}(x,t)$$ where $\Phi(x,t)$ is real-valued and required to be dimensionless, so that $\Gamma$ is an unknown real constant that has the dimension of angular momentum, and $\bm{u}(x,t)$ is an unknown real-valued vector field, not a gradient, having dimension velocity. That field may be required to have zero divergence, in which case eq. (\[eq4\]) is the Helmholtz theorem. The next step is to define the complex-valued function $\psi(x,t)$ as $$\label{eq5} \psi(x,t)=\sqrt{\rho}\,\exp(i\Phi)$$ This relation is known as the Madelung transform [@Madelung] when applied to the usual Schrödinger equation; here, it is being used in reverse. Note that $\rho\geq{0}$, so $\sqrt{\rho}$ is well-defined and real $\geq{0}$ if $\rho$ is smooth, e.g., not a product of Dirac deltas as is the fine-grained density. Equations (\[eq3\]-\[eq5\]) combine to yield $$\label{eq6} \rho=\psi^*\psi$$ $$\label{eq7} \bm{j}=\frac{\Gamma}{2im}(\psi^*\bm{\nabla}\psi - \psi\bm{\nabla}\psi^*) - \bm{u}\psi^*\psi$$ Then, requiring that the continuity equation be satisfied yields easily $$\label{eq8} \frac{O\psi}{\psi} = \frac{O^*\psi^*}{\psi^*} = W(x,t),$$ where $O$ is the operator $$\label{eq9} O = i\Gamma\partial_t - \frac{1}{2m}(-i\Gamma\bm{\nabla} - m\bm{u})^2$$ and $W(x,t)$ is an unknown real-valued scalar field having dimension energy. Therefore, the equation that must be satisfied by $\psi$ is $$\label{eq10} i\Gamma\partial_t\psi = \frac{1}{2m}(-i\Gamma\bm{\nabla} - m\bm{u})^2\psi + W\psi.$$ This statistical wave equation, which has exactly the same [*form*]{} as the conventional SEQ for this system, was the culmination of Collins’ purely mathematical derivation [@Collins1]; Gilson’s earlier work [@Gilson] did not include the vector field $\bm{u}$. Note that the meanings of $\rho$ and $\bm{j}$ were established [*a priori*]{} (which was not the case during the original development and interpretation of the SEQ), whereby $\psi$ must be bounded, single-valued, first-order differentiable except at (unphysical) Dirac delta potentials, and magnitude square integrable over all space, the same conditions that are imposed on the conventional SEQ wavefunction for this system. (A recent paper [@Goedecke2010] discusses several aspects of the inverse Madelung transform method, including why nodal surfaces of bound states do not exist except at spatial infinity, where $\psi\rightarrow 0$ rapidly enough that $\bm{\nabla}\psi$ is also zero there, whereby $\bm{\nabla}\psi$ exists everywhere except at Dirac delta potentials.) However, the presence of unknown functions $W$ and $\bm{u}$ and an unknown constant $\Gamma$ in eq. (\[eq10\]) might well cause one to regard Collins’ result as less than a full derivation of the SEQ. The doubt is strengthened when one realizes that eq. (\[eq10\]) must apply for [*any*]{} smooth quantities $\rho$ and $\bm{j}$ that satisfy a continuity relation, such as the smoothed mass density and mass flux in a classical fluid. For such an application, the unknown functions and constant must in general be quite different than in the statistical wave equation for a single point particle; the smoothing process may be different; and the interpretation of the wave equation must be different, as discussed by several authors [@Collins1; @Goedecke2010; @Klein]. Of course, one can identify $W$, $\bm{u}$, and $\Gamma$ in eq. (\[eq10\]) by comparison of its predictions with experimental results, or equivalently by comparison with the known SEQ, but doing so keeps the derivation purely mathematical and does not appear to resolve the objections noted above. So we ask: Are there any ways to identify these quantities [*a priori*]{} using only general physical theory? The answer is yes. For example, Collins [@Collins1] showed that the expectation energy of the particle is given by the usual quantum expression only if $W$, $\bm{u}$, and $\Gamma$ are the expected choices. Several authors, e.g. de la Peña and Cetto [@SED1], have provided arguments to identify $W$ and $\bm{u}$. In the remainder of this subsection, we provide physical rationale to identify all three of these quantities. [**Identification of unknown functions.**]{} One straightforward way to identify $W$ and $\bm{u}$ is to apply the Ehrenfest theorem [@Schiff] in reverse. That is, on the basis of the known statistical significance of $\rho$ and $\bm{j}$, we must require that the usual nonrelativistic Newton’s second law be valid in the mean. We begin as usual by defining the statistical mean or expectation CM position vector as $\overline{\bm{X}}(t) = \int d^3x \bm{x}\rho$. Then we obtain the mean CM velocity as $\bm{\overline{V}}(t) = d_t\overline{\bm{X}}(t) = \int d^3x \bm{x}\partial_t\rho$. Then we use the continuity equation and an integration by parts, assuming surface integrals vanish at spatial infinity, to obtain $$\label{eq11} \bm{\overline{V}}(t) = \int d^{3}x\rho\bm{v} = \frac{1}{m}\int d^{3}x \psi^*(-i\Gamma\bm{\nabla} - m\bm{u})\psi,$$ where the second equality results from using eq. (\[eq7\]) and another integration by parts, again assuming that surface integrals vanish. \[Note that we could have begun with a definition of the mean velocity, instead of the mean position vector used in many textbooks. We must do the former in the generalized curvilinear coordinates that we need in section \[schrodinger\]; the two starting points are equivalent in Cartesian coordinates in the Euclidean 3-space considered here.\] Also, note that eq. (\[eq11\]) provides a physical significance for the vector field $\bm{v}$, such that $\bm{j} = \rho\bm{v}$ is the probability flux density that yields the mean particle velocity $\bm{\overline{V}}(t)$. Now, take the time derivative of eq. (\[eq11\]), using eq. (\[eq10\]). It is straightforward to show that the result is $$\label{eq12} \frac{d\bm{\overline{V}}}{dt} = \frac{1}{m}\int d^{3}x \psi^*\bm{F}^{op}\psi\,$$ where $$\label{eq13} \bm{F}^{op} = -\bm{\nabla}W - m\partial_t\bm{u} + \mbox{\small$\frac{1}{2}$}m[\bm{v}^{op}\times{(\bm{\nabla}\times{\bm{u}})} - (\bm{\nabla}\times{\bm{u}})\times{\bm{v}^{op}}],$$ with $$\label{eq14} \bm{v}^{op} = m^{-1}\bm{p}^{op} - \bm{u};\;\;\;\;\bm{p}^{op} = -i\Gamma\bm{\nabla}.$$ Just as for eq. (\[eq11\]), the validity of eq. (\[eq12\]) depends on requiring that surface integrals at spatial infinity vanish, often accomplished by requiring the integrands to satisfy periodic boundary conditions on the surfaces of a cubical box of side length $L\rightarrow\infty$. These requirements are equivalent to assuming that all the operators indicated by the superscript “op" are Hermitian. (Note that these same requirements must also be applied in the usual treatment of the axiomatic SEQ.) From eqs. (\[eq12\]) - (\[eq14\]), it is evident that Newton’s second law is valid in the mean if and only if $$\label{eq15} W = q\varphi + W_{0};\;\;\;\; \bm{u}=q\bm{A}/mc,$$ where $\varphi$ and $\bm{A}$ are electromagnetic scalar and vector potentials, respectively, and $W_0$ is some other potential energy (say, gravitational) that can affect this monopole particle. This conclusion follows because only with these identifications do we obtain the correct (Hermitian) Lorentz force operator from eq. (\[eq13\]), $$\label{eq16} \bm{F}^{op} = -\bm{\nabla}W_0 + q[\bm{E}+(2c)^{-1}(\bm{v}^{op}\times{\bm{B}} - \bm{B}\times{\bm{v}^{op}})],$$ where $\bm{E} = -\bm{\nabla}\varphi - c^{-1}\partial_t\bm{A}$ is the electric field, and $\bm{B} = \bm{\nabla}\times{\bm{A}}$ is the magnetic field (flux density), in Gaussian units. After making the identifications in eq. (\[eq15\]), we may rewrite eq. (\[eq10\]) in the form $$\label{eq17} i\Gamma\partial_t\psi = H^{op}\psi,$$ where $$\label{eq18} H^{op} =\frac{1}{2m}(\bm{p}^{op} - \frac{q}{c}\bm{A})^2 + q\varphi + W_0$$ has the form of the classical nonrelativistic Hamiltonian of the system, with conjugate momentum $\bm{P}$ replaced by $\bm{p}^{op}$, including whatever fields $\bm{A}$, $\varphi$, and $W_0$ were appropriate for the classical Hamiltonian. Note that eqs. (\[eq17\]) and (\[eq18\]) also seem to apply to an electrically neutral particle, as conventionally assumed. There is another presumably equivalent but more direct method that can be used to identify the unknown functions. As is easily shown, [*e.g.*]{} see Goedecke and Davis [@Goedecke2010], substitution of eq. (\[eq5\]) into eq. (\[eq10\]) yields two equations that must be satisfied. One is the probability continuity equation itself, while the other is $\Gamma\partial_t\Phi + (2m)^{-1}(\Gamma\bm{\nabla}\Phi - m\bm{u})^2 + W - (\Gamma^2/2m)(\nabla^2\rho^{1/2}/\rho^{1/2}) = 0.$ The last term on the left-hand side is proportional to the so-called “quantum-mechanical potential (energy)”. If it is negligible, then this equation must reduce to the classical Hamilton-Jacobi equation for Hamilton’s principal function $S=\Gamma\Phi$ for the electric monopole system, which occurs if and only if eq. (\[eq15\]) is satisfied. At this point, we have shown something that seems quite remarkable, namely, that if [*for any reason*]{} we choose to describe the classical motion of an electric monopole or uncharged pointlike particle statistically, then a correct statistical description is the statistical Schrödinger equation  (\[eq17\]), which is indistinguishable from the conventional equation, and in which the wavefunction has the conventional meaning and satisfies exactly the usual conditions. Therefore, for any given quantized or c-number fields $\varphi, \bm{A}$, and $W_0$, [*all*]{} solutions of the statistical Schrödinger equation are exactly the same as the conventional ones, except that $\hbar$ is replaced by an unknown constant that we denoted by $\Gamma$. [**Identification of unknown constant.**]{} It is apparent that one must choose $\Gamma = \hbar$ in order that eq. (\[eq17\]) be formally identical to the nonrelativistic SEQ for the electric monopole particle system. We seek a physical rationale for that choice. We expect that the value of $\Gamma$ is determined by the universal background field (UBF) mentioned earlier, because that is the field that compels a statistical description. Therefore we require that the value of $\Gamma$ be universal, the same for all systems in the universe (or at least in a fairly extensive region of the universe). This requirement rules out the possibility that the UBF fields are just thermal fields; therefore, the mean energy density of the UBF must be considerably greater than that of all thermal fields, even those in stellar atmospheres. So we seek an omnipresent temperature-independent high-energy-density stochastic electromagnetic field as the overwhelmingly dominant part of the UBF. Such a field has been proposed and investigated extensively. Beginning in the early 1960’s, many authors [@SED1; @SED2] contributed to the development of what became known as “stochastic electrodynamics” (SED). The central thesis of SED is that all particles are acted upon by a universal stochastic background radiation field, omnipresent even at the absolute zero of temperature, which in turn causes particles that interact electromagnetically to perform “zero-point oscillations” and via radiation reaction be in dynamical equilibrium with the background field, in the absence of other external fields. This hypothesized field became known as the (stochastic) zero-point field (SZPF). The SZPF was modeled as a classical but stochastic free electromagnetic field, not referred to its sources, having expectation energy $(\hbar\omega_k/2,\;\omega_k = kc)$ per plane wave normal mode with propagation vector $\bm{k}$ and transverse polarization index 1 or 2, which is the same as the energy eigenvalue of a quantum vacuum field transverse normal mode. In 1969, Boyer [@Boyer] showed in detail that the presence of the SZPF plus a classical stochastic statistically independent thermal field yields exactly the Planck blackbody radiation spectrum for a collection of oscillators, without quantization of oscillator levels. During the development of SED, many authors also showed that the classical nonrelativistic Newton’s 2nd law applied to the system of a charged-particle isotropic harmonic oscillator with natural angular frequency $\omega_0$, and with damping force given by an Abraham-Lorentz radiation reaction term, acted upon by the SZPF in electric dipole approximation, yields the ensemble-average energy $3\hbar\omega_0/2$, the same as the quantum ground state energy. Some of these authors went further, deriving the SEQ and in some cases its closed-form solutions from the ensemble average of the fine-grained position-momentum phase space distribution function for the oscillator acted upon by the SZPF and other specified non-random radiation fields. These results showed that the appropriate smoothing average of the fine-grained probability density and flux is indeed the ensemble average, as mentioned just before eq. (\[eq2\]). For example, Goedecke [@Goedecke1983] showed that the usual quantum electrodynamics results for transition probabilities per unit time for resonance absorption, stimulated emission, and spontaneous emission were predicted, with the spontaneous emission occuring automatically, without the triggering needed in the Crisp-Jaynes-Stroud semiclassical theory [@CrispJaynes], and without quantization of electromagnetic fields. These SED derivations of a statistical SEQ, and of a companion equation that restricts initial conditions on the wavefunction so that the resulting Wigner phase space distribution can never be negative, are valid only for the nonrelativistic harmonic oscillator system in electric dipole approximation. They are completely different from the derivation of the statistical SEQ presented herein, which as shown above applies to all nonrelativistic single-particle electric monopole systems, with no restriction to the electric dipole approximation for any applied electromagnetic fields. For our purposes, the important aspects of the discussion above are that i) the SZPF contains Planck’s constant, and the SED results for a charged harmonic oscillator immersed in the SZPF imply that the (presumed universal) constant $\Gamma$ that appears in some of the equations (\[eq10\]) - (\[eq14\]) must be $\hbar$; and ii) the correct smoothing average of the fine-grained position probability density is the ensemble average over the stochastic variables in the SZPF, whereby the statistical Schrödinger equation derived above is itself an ensemble-averaged equation. We will discuss this feature in section \[summary\]. At this point, then, we have shown that if we attempt [*any*]{} statistical description of the classical nonrelativistic CM motion of a pointlike electric monopole particle immersed in the stochastic zero-point field and other force fields, then a correct ensemble-averaged statistical equation is the conventional Schrödinger equation in which the wavefunction has the conventional meaning and satisfies exactly the same conditions, so that all solutions are exactly the same as the conventional ones, for [*any*]{} choice of the potentials $\varphi, \bm{A}$, and $W_0$. General Schrödinger equation {#schrodinger} ============================ In this section we consider nonrelativistic systems that require $N$ generalized curvilinear coordinates to describe. For example, for a classical nonrelativistic system of $N_p$ identical particles with spin, the coordinates for each particle could be three Cartesian coordinates (or three spherical polar coordinates or ...) for the CM motion, and three Euler angles for the rotational motion, or altogether $N = 6N_p$ generalized coordinates that comprise the “configuration space" of the system. \[We treat spin in detail in the next paper in the series\]. In subsection \[genCM\], we discuss the forms of the classical nonrelativistic Lagrangian, Hamiltonian, and coordinate motion equations for virtually all systems that require $N$ coordinates, identifying the metric and the covariant and contravariant basis vectors and their crucial properties in the $N$-space. In subsection \[genSEQ\] we begin with the generalized-coordinate probability continuity equation, and show that the same approach used for an electric monopole in section \[SEMP\] yields the $N$-space Schrödinger equation, including the generalized conjugate momentum operators and Hamiltonian operator. Classical mechanics in generalized coordinates {#genCM} ---------------------------------------------- Although the tradition in nonrelativistic classical mechanics is to write generalized coordinates as $q_i$, with subscript indices, here we employ superscripts, and $x^i$ instead of $q_i$, in order to take advantage of the conventional general tensor calculus description of coordinate manifolds as metric spaces. So we represent the $N$ generalized coordinates needed for a system under consideration by the set $x = [x^1, \ldots, x^N]$, where each $x^p$ is an independent real continuous variable that may have any dimension and any range. A classical system moves on a trajectory in this $N$-space given by $[x^p = X^p(t),\;p = (1, \ldots, N)]$. The nonrelativistic Newton’s second law for the coordinates of a system always seems to result in coupled second order differential equations that are linear in the coordinate accelerations, at most quadratic in the coordinate velocities, and linear in the electromagnetic, gravitational, or other possible fields acting on the particles. (A discussion of why this should be the case is best left to the relativistic treatment to follow in a later paper.) Therefore, in this work, we consider only the most general form of Lagrangian that will yield such motion equations for the coordinates. The machinery of general tensor calculus in $N$ dimensions (see the Appendix) allows us to write down that generic Lagrangian in a familiar form. First, we define the $N$-velocity vector $\bm{V}(t)$ in terms of its contravariant components $\dot{X}^p$ and the covariant basis vectors $\bm{e}_p(X)$: $$\label{eq19} \bm{V} = \bm{e}_p(X)\dot{X}^p.$$ Then, the most general appropriate Lagrangian having the dimension of energy is $$\label{eq20} L = \mbox{\small$\frac{1}{2}$}m\bm{V}\bm{\cdot}\bm{V} + m\bm{u}(X,t)\bm{\cdot}\bm{V} - W(X,t),$$ where $\bm{u}(X,t)$ is an $N$-vector field having dimension velocity, $W$ is an $N$-scalar field having dimension energy, $m$ is a parameter having dimension mass, and the dot $\bm{\cdot}$ indicates the generalized dot or scalar product, as discussed in the Appendix. Note that $\bm{u}$ and $W$ may have both explicit and implicit time-dependence. Clearly, the first term in $L$ is a generalized kinetic energy. If all the particles in the system have the same mass, then one could choose $m$ to be that mass; in general, $m$ is any convenient constant having dimension mass, and actual masses or other appropriate parameters will be contained in the basis vectors and thus in the metric. If we write $\bm{u}$ as a linear combination of the contravariant basis vectors, as we may for any vector field, and use eq. (\[eq19\]) and eq. (\[eqA1\]), we find an equivalent expression for $L$, $$\label{eq21} L = \mbox{\small$\frac{1}{2}$}mg_{pq}(X)\dot{X}^p\dot{X}^q + mu_p(X,t)\dot{X}^p - W(X,t),$$ where $g_{pq}(X) = \bm{e}_p(X)\bm{\cdot}\bm{e}_q(X)$ is defined as the (covariant) metric (see the Appendix). Note that $g_{pq}$ is indeed the conventional metric as defined by eq. (\[eqA7\]). The covariant components of the conjugate momentum vector are given by $$\label{eq22} P_s = \partial L/\partial\dot{X}^s =m(g_{sq}\dot{X}^q + u_s).$$ In boldface N-vector notation this equation is simply $$\label{eq23} \bm{P} = \bm{e}^s P_s = \partial L/\partial\bm{V} = m(\bm{V} + \bm{u}),$$ where the notation $\partial L/\partial\bm{V}$ means the gradient of $L$ w.r. to $\bm{V}$. The Euler-Lagrange equations in component form are $dP_s/dt = \partial L/\partial X^s.$ Expressing these equations using eqs. (\[eq21\]), (\[eq22\]), and (\[eqA8\]) yields the component form of the classical motion equations: $$\label{eq24} m(g_{sq}\ddot{X}^q + [s,pr]\dot{X}^p\dot{X}^r) = -\partial_s W - m\partial u_s/\partial t + f_{sp}\dot{X}^p,$$ where $$\label{eq25} f_{sp} = m(\partial_s u_p - \partial_p u_s)$$ are the covariant components of an antisymmetric rank two tensor, and \[s,pr\] are the Christoffel symbols of the first kind, defined by eqs. (\[eqA11\]) and (\[eqA12\]). Similarly, the Euler-Lagrange equations in $N$-vector notation are $d\bm{P}/dt = \bm{\nabla} L$, which yields $$\label{eq26} md\bm{V}/dt = -\bm{\nabla}W -m\partial\bm{u}/\partial t + {\sf \bm{f}}\bm{\cdot}\bm{V}$$ where ${\sf \bm{f}} = \bm{e}^s\bm{e}^p f_{sp}$ is the dyadic form of the rank two antisymmetric tensor mentioned above. The motion equation in this form looks like the usual Newton’s 2nd law for Cartesian coordinates in Euclidean 3-space, but it applies to an arbitrary metric $N$-space. \[The proof that eqs. (\[eq26\]) and (\[eq24\]) are equivalent is not quite trivial. It depends on using eqs. (\[eq19\]) and (\[eqA7\]), and recognizing that here the basis vectors are functions of the time-dependent coordinates $X(t)$, so that $\partial\bm{e}_p/\partial t = 0$, but $d\bm{e}_p/dt = \dot{X}^q\partial_q\bm{e}_p$, whereby $d/dt = \partial/\partial t + \bm{V}\bm{\cdot}\bm{\nabla}$, the convective derivative, when acting on any vector field such as $\bm{V}$ or $\bm{u}$.\] The Hamiltonian for this general system is given by $$\label{eq27} H = \bm{V}\bm{\cdot}\bm{P} - L = \frac{1}{2m}(\bm{P} - m\bm{u})^2 + W,$$ where the last equality follows from eq. (\[eq23\]). Inserting components and basis vectors yields $$\label{eq28} H = \frac{1}{2m}\bm{e}^p(P_p - mu_p)\bm{\cdot}\bm{e}^q(P_q - mu_q) + W$$ which is the form that must be used in the transition to a statistical wave equation in which $P_p$ becomes a derivative operator that in general does not commute with either $\bm{e}^q$ or $u_q$, as we shall show in the next subsection. For the classical case treated here, eq. (\[eq28\]) reduces to the classical Hamiltonian $H_c$, given by $$\label{eq29} H_c = \frac{1}{2m}g^{pq}(P_p - mu_p)(P_q - mu_q) + W,$$ which is exactly what results if one starts with the usual definition $H_c = \dot{X}^p P_p - L$. Hamilton’s canonical motion equations are simply $\dot{X}^p = \partial H_c/\partial P_p$, and $\dot{P}_p = -\partial H_c/\partial X^p$, which combine to yield eq. (\[eq24\]); or $\bm{V} = \partial H_c/\partial\bm{P}$ and $\dot{\bm{P}} = -\bm{\nabla}H_c$, which combine to yield the equivalent eq. (\[eq26\]). Perhaps the most important result of this subsection is the proof that all the standard equations and relations in the usual nonrelativistic classical mechanics notation in which three-vectors are written in boldface, including Newton’s second law, the Lagrangian, the conjugate momenta, the Hamiltonian, the Euler-Lagrange equations, and Hamilton’s canonical equations, can be expressed in exactly the same boldface form in an $N$-dimensional metric configuration space of generalized curvilinear coordinates. Of course, in applying the equations, one must realize that each vector written in boldface has $N$ contravariant components that are the orthogonal projections of the vector onto the contravariant basis vectors, (and similarly for the $N$ covariant components), and that the metric and the affine connections must be specified in order to obtain the detailed $N$-space equations. We shall do examples later in this paper and in the next paper in this series to illustrate how one obtains and uses the basis vectors, the metric, and the connections. Derivation of the Schrödinger equation in $N$ generalized coordinates {#genSEQ} --------------------------------------------------------------------- For the same reasons discussed in section\[SEMP\], the classical motions of particles of very small mass should be treated statistically. Assuming that coordinate trajectories $x^p = X^p(t)$ exist, then the fine-grained coordinate probability density is given by $$\rho^{f}(x,t) = |g_\cdot|^{-1/2}\prod_{q=1}^N\delta(x^q - X^q(t))$$ where $|g_\cdot|$ is the magnitude of the determinant of the covariant metric matrix (see the Appendix). The corresponding fine-grained probability current density is $\bm{j}^f = \bm{e}_p\dot{X}^p\rho^{f}(x,t).$ Using relations in the Appendix, it is easy to show that these quantities satisfy the $N$-space continuity equation $\partial_t\rho^{f}(x,t) + \bm{\nabla}\bm{\cdot}\bm{j}^f = 0$. The ensemble-averaged (smoothed) densities $\rho$ and $\bm{j}$ must also satisfy the continuity equation $$\label{eq30} \partial_t\rho + \bm{\nabla}\bm{\cdot}\bm{j} = 0.$$ This equation looks exactly the same as eq.(\[eq2\]) for Euclidean 3-space. But here, the gradient operator $\bm{\nabla} = \bm{e}^p\partial_p$ is a sum of $N$ terms, as is $\bm{j}$, which is given by either $\bm{e}_p j^p$ or $\bm{e}^p j_p$; $x$ stands for the $N$ real independent variables (curvilinear coordinates) $x^1, \ldots ,x^N$; and the contravariant and covariant basis vectors $\bm{e}^p$ and $\bm{e}_p$ depend on the coordinates and are not unit vectors in general. Now we may proceed just as in section \[SEMP\]. That is, [*eqs.(\[eq3\])-(\[eq10\]) apply to the $N$-space system with no change in notation or form!*]{} We start with eq.(\[eq3\]), $\bm{j}(x,t)=\rho(x,t)\bm{v}(x,t)$, and proceed step by step through eqs.(\[eq4\])-(\[eq9\]) until we get to eq.(\[eq10\]), which we reproduce here: $$\label{eq31} i\hbar\partial_t\psi = \frac{1}{2m}(-i\hbar\bm{\nabla} - m\bm{u})^2\psi + W\psi.$$ Note that we have already chosen $\Gamma = \hbar$, in accordance with our discussion in Sec. \[SEMP\]. However, in eq.(\[eq31\]), $\bm{\nabla}$ is the $N$-space gradient operator, as noted just above; the unknown $N$-vector field $\bm{u}$ has $N$ covariant and $N$ contravariant components; and the wavefunction $\psi$, the unknown scalar field $W$, each of the components $u^p$, $u_p$, and each of the basis vectors may depend on all or some of the $N$ independent variables $x$. The form-invariance of eq.(\[eq31\]) when written in boldface vector notation should not be a great surprise: We use it in three dimensions every day, e.g., when we express the electric monopole SEQ in spherical polar coordinates $x=(r,\theta,\phi)$ for the unperturbed case $\bm{u} = 0$ and $W = W(r)$. For convenience in what follows, we write the analog of eq.(\[eq14\]): $$\label{eq32} \bm{v}^{op} = m^{-1}\bm{p}^{op} - \bm{u};\;\;\;\;\bm{p}^{op} = -i\Gamma\bm{\nabla} = -i\hbar\bm{e}^p\partial_p,$$ and we also define the operator $$\label{eq33} H^{op} = \frac{1}{2m}(\bm{p}^{op} - m\bm{u})^2 + W.$$ Note that the presence of the combination $(\bm{p}^{op} - m\bm{u})$ ensures that the $N$-dimensional vector field $\bm{u}$ must have the same significance as the electromagnetic vector potential for a single electric monopole, that of a gauge field. In accordance with eq.(\[eq28\]), $H^{op}$ must be written in terms of basis vectors and components as $$\label{eq34} H^{op} = \frac{1}{2m}\bm{e}^p(-i\hbar\partial_p - mu_p)\bm{\cdot}\bm{e}^q(-i\hbar\partial_q - mu_q) + W.$$ Then the N-space statistical wave equation (\[eq31\]) has the canonical form $$\label{eq35} i\hbar\partial_t\psi = H^{op}\psi.$$ At this point, for clarity we write out eq.(\[eq34\]): $$\label{eq36} H^{op} = \frac{1}{2m}[g^{pq}(-i\hbar\partial_p - mu_p) - i\hbar\bm{e}^p\bm{\cdot}\partial_p\bm{e}^q](-i\hbar\partial_q - mu_q) + W.$$ Note that $H^{op}$ will include not only the derivatives $\partial_p u^q$, but also the term involving $\bm{e}^p\bm{\cdot}\partial_p\bm{e}^q$. As discussed in the Appendix, in conventional tensor calculus the first derivatives of the basis vectors can be written as linear combinations (LC’s) of the basis vectors, and the coefficients of the LC’s are the affine connections $\Gamma^{q}_{pr}$; see eq. (\[eqA10\]). If these connections are symmetric in their lower indices, then they are equal to the corresponding Christoffel symbols, which depend only on the metric and its first derivatives. This symmetry occurs [*e.g.*]{} in a global coordinate transformation from say Cartesian to curvilinear coordinates such as spherical polar coordinates in Euclidean 3-space. However, if some or all of the curvilinear coordinate basis vectors are referred to a locally Cartesian (or pseudo-Cartesian) set of basis vectors, which may always be done, then the resulting connections may be asymmetric in their lower indices, and one obtains a different expression for $\bm{e}^p\bm{\cdot}\partial_p\bm{e}^q$ than the conventional expression involving the Christoffel symbols. See eqs. (\[eqA18\])-(\[eqA21\]). This kind of connection occurs in the treatment of particles with spin, in the next paper in this series. In order to identify $\bm{u}$ and $W$ in eq.(\[eq34\]), we follow the same procedure used in section\[SEMP\], namely, the Ehrenfest theorem in reverse. First, we define the mean $N$-velocity vector of the system by $$\label{eq37} \overline{\bm{V}}(t) = \int d^{N}x\,\sqrt{|g|}\,\bm{j}(x,t),$$ the analog of the first part of eq.(\[eq11\]). Then we substitute eq.(\[eq7\]) with $\Gamma = \hbar$, valid here as an $N$-space equation, integrate by parts, and use eq.(\[eq32\]) to obtain $$\label{eq38} \overline{\bm{V}}(t) = \int d^{N}x\,\sqrt{|g|}\,\psi^*\bm{v}^{op}\psi.$$ In doing this integration by parts, we insist that i) all integrands that are bilinear in $\psi^*$ and $\psi$ must obey periodic boundary conditions in all coordinates, and ii) eq. (\[eqA18\]) must be valid. Just as in the case of the axiomatic SEQ, these requirements make the operators $\bm{v}^{op},\,\bm{p}^{op}$, and $H^{op}$ Hermitian. Now, we take the time derivative of the mean velocity. From eqs.(\[eq38\]),(\[eq35\]),(\[eq34\]), and the Hermiticity of $H^{op}$, we obtain immediately $$\label{eq39} d\overline{\bm{V}}(t)/dt = \frac{1}{i\hbar}\int d^{N}x\,\sqrt{|g|}\,\psi^*[\bm{v}^{op},H^{op}]\psi.$$ where $[\bm{v}^{op},H^{op}]$ is the commutator. The force operator $\bm{F}^{op}$ is $$\label{eq40} \frac{m}{i\hbar}[\bm{v}^{op},H^{op}] \equiv \bm{F}^{op} = -\bm{\nabla}W - m\partial_t\bm{u} + \frac{1}{2}({\sf \bm{f}}\bm{\cdot}\bm{v}^{op} + \bm{v}^{op}\bm{\cdot}{\sf \bm{f}}),$$ where $$\label{eq41} {\sf \bm{f}} = \bm{e}^p\bm{e}^q m(\partial_p u_q - \partial_q u_p).$$ Equation(\[eq40\]), valid in the $N$-space, is the analog of eq.(\[eq13\]), valid in Euclidean 3-space. Note that the antisymmetric tensor term here replaces the cross-product term in eq.(\[eq13\]); cross-products exist only in 3-spaces. Now, comparing eqs.(\[eq40\]) and (\[eq39\]) with the generalized-coordinate Newton’s second law, eq.(\[eq26\]), it is immediately apparent that the Ehrenfest theorem is valid if and only if the $N$-space $H^{op}$ defined above is the usual classical system Hamiltonian with conjugate momentum $\bm{P}$ replaced by $\bm{p}^{op}$. That is, the analysis just above has identified the unknown functions $\bm{u}$ and $W$ that occur in the statistical wave equation constructed from the $N$-space probability continuity equation: The functions must be exactly those that appear in eq.(\[eq27\]), the $N$-space classical Hamiltonian of the system. In addition, the overall analysis in this subsection has derived the general rule for “canonical quantization”, that the $N$-vector conjugate momentum $\bm{P}$ in any $N$-space classical Hamiltonian is to be replaced by $\bm{p}^{op} = -i\hbar\bm{\nabla} = -i\hbar\bm{e}^p\partial_p$, as given by eq.(\[eq32\]). Note that this canonical quantization rule, $P_p\rightarrow p^{op}_p = -i\hbar\partial_p$, implies the usual commutator $[x^q , p^{op}_p] = i\hbar\delta^q_p$ in the $N$-space. Examples ======== In this section, we consider two simple examples that should help to clarify the generalized coordinate approach, namely, a system of two spinless point particles that may have diffeerent masses, and a system of arbitrarily many identical spinless point particles, in the unperturbed limit of two-body central force instantaneous internal interactions. Two pointlike particles {#2point} ----------------------- Let the masses be $m_1,m_2$, and choose three Cartesian coordinates for each particle’s CM location, $x^1,x^2,x^3$ for particle 1, $x^4,x^5,x^6$ for particle 2. Then the kinetic energy $T$ on the trajectory ($x^p = X^p(t),\;p = 1, \ldots, 6$) is $$\label{eq42} T = \frac{1}{2}m[\frac{m_1}{m}\dot{X}^i\dot{X}^i +\frac{m_2}{m}\dot{X}^{i+3}\dot{X}^{i+3}] = \frac{1}{2}mg_{pq}\dot{X}^p\dot{X}^q,$$ where the index $i$ ranges and sums from 1 to 3. From eq. (\[eq42\]), we may read off the diagonal 6-space metric: $$\label{eq43} g_{11}=g_{22}=g_{33} = m_1/m;\;\;\;g_{44}=g_{55}=g_{66} = m_2/m,$$ with other components zero. For this example, we consider the “unperturbed central force” case, by choosing $\bm{u} = 0$ and $W = W(r)_{x=X(t)}$ in the classical Lagrangian, where $$r = [(x^i - x^{i+3})(x^i - x^{i+3})]^{1/2}$$ is the distance between the particle CM’s. The classical Hamiltonian is $H = T + W$, and $\bm{p}^{op} = -i\hbar\bm{\nabla} = -i\hbar\bm{e}^p\partial_p$, where the $\bm{e}^p$ are the Cartesian unit basis vectors $\bm{\hat{e}}^i$ and $\bm{\hat{e}}^{i+3}$. Thus, according to our general results in Sec. \[schrodinger\], the Hamiltonian operator in the statistical SEQ is $H^{op} = (-\hbar^2/2m)\nabla^2 + W$, where $\nabla^2$ is given by eq. (A16). Since $g^{pq} = 1/g_{pq}$ for $p = q$ in this example, and zero otherwise, the SEQ is $$\label{eq44} i\hbar\partial_t\psi = -(\hbar^2/2m_1)\partial_i\partial_i\psi - (\hbar^2/2m_1)\partial_{i+3}\partial_{i+3}\psi + W\psi$$ At this point, one may go to the conventional notation $x^i=x^i_1, x^{i+3}=x^i_2$, and then to CM and relative coordinates. One reason for choosing this particular example is that it is probably the simplest two-particle example of the general method derived in section \[schrodinger\]. Another reason is to emphasize that what you get in the Hamiltonian operator in the derived SEQ is exactly what you have included in the classical Hamiltonian, no more and no less. For example, it is clearly physically incorrect to choose $\bm{u}$ = 0 and thus omit all incident and self radiation fields. It is also incorrect in principle to neglect retardation in two-body interactions, but that will be a negligible effect in cases involving slow motions of particles that remain close together. (Note that retardation for slowly-moving particles is not just a tiny relativistic correction if the particles are far apart.) Many pointlike particles {#Npoint} ------------------------ Consider the extension of the two-particle system above to $N_p$ point particles, interacting with each other via two-body central force potential energies and also allowing external electromagnetic fields. We let the particles be identical, each with electric charge $q$, mass $m$, and CM location. Then the classical nonrelativistic Lagrangian, Hamiltonian, and motion equations each involve $N=3N_p$ coordinates, $x^p=X^p(t),\;p={1, \ldots, N}$. The development in Sec. \[schrodinger\] yields the general Schrödinger equation (\[eq31\]), or, equivalently, eqs. (\[eq35\]) and (\[eq36\]), involving these $N$ coordinates. For this example, the metric may be chosen as the $N$-space Kronecker delta metric, $g_{pq}=\delta_{pq}=g^{pq}$, whereby the affine connections are zero, corresponding to three independent Cartesian coordinates for each particle. In order to achieve a familiar notation, we relabel the coordinates by letting $(x^p,\,p=1,N)\rightarrow(x_n^i,\,n=1,N_p,\,i=1,3)$, so that $n$ is a particle index and $i$ is a Cartesian coordinate index. Then, by analogy with the previous example, the simplest nontrivial “unperturbed” classical Hamiltonian contains $\bm{u} = 0$ and $$\label{eq45} W(x,t) = W^{int} = \frac{1}{2}\sum_{n=1}^{N_p}\sum_{n'=1}^{N_p}V(r_{nn'}),$$ where terms with $n=n'$ are omitted from the double sum, $r_{nn'} = [(x_n^i - x_n'^i)(x_n^i - x_n'^i)]^{1/2}$, and $V$ is the two-body interaction energy that could involve not only the Coulomb repulsion but also other forces such as Yukawa interactions and gravity. If we allow given external electromagnetic potentials $\varphi^{ext}, A_i^{ext}$ to perturb the system, then the Hamiltonian would include the terms $$\label{eq46} W(x,t) = W^{int} + q\sum_{n=1}^{N_p}\varphi^{ext}(x_n,t);\;\;u_{n,i}(x,t) = (q/mc)A_i^{ext}(x_n,t),$$ where $x_n$ stands for $(x_n^1,x_n^2,x_n^3)$. The $N$-vector $\bm{u} = \bm{e}^p u_p = \bm{e}_n^i u_{n,i}$, where $\bm{e}_n^i=\hat{\bm{e}}^i$, the Cartesian unit basis vector, the same for all $n$. Again we emphasize that the functions $W$ and $\bm{u}$ that appear in the Hamiltonian operator are exactly those that are chosen for inclusion in the classical Lagrangian and Hamiltonian. Clearly this often-used example once again neglects retardation and self-fields. It is important to note that for the identical particles in this example the total Hamiltonian is invariant under all pair interchanges of particle indices. This invariance leads immediately to the result that the total wavefunction solution of the general many-particle Schrödinger equation must either change sign under each pair interchange, or not change sign. As we know, the choice of sign change yields Fermions and the Pauli exclusion principle, while the choice of no sign change yields Bosons and Bose-Einstein condensation. Suppose one makes the sign change choice. Then, as discussed in detail by Schweber [@Schweber], the set of all Schrödinger equations for (1,2,3,...) identical particles is equivalent to the “second quantized" many-particle field theory for Fermions in occupation number space. Likewise, if one makes the choice of no sign change, then the set of all Schrödinger equations for different numbers of particles is equivalent to the second quantized theory for Bosons. These equivalences combined with the results herein seem to imply that the conventional many-body quantum theories are mathematically compatible with particle trajectories, and are actually statistical theories. Summary, discussion, and prognosis {#summary} ================================== [**Summary.**]{} In sections \[SEMP\] and \[schrodinger\], we showed the following: Given any system that requires $N$ independent real-valued curvilinear coordinates to describe classically. Given that the classical nonrelativistic kinetic energy of the system is bilinear in the coordinate first derivatives and thus defines a metric $N$-space. Also given that the force fields in the classical Lagrangian include non-negligible stochastic fields, so that the system must be described statistically. Then a correct statistical description of the system is always the usual $N$-coordinate Schrödinger equation, with an unknown constant $\Gamma$ in place of $\hbar$, in which the Hamiltonian operator is the classical Hamiltonian with the conjugate momenta replaced by momentum operators. The general $N$-vector momentum operator is simply $-i\Gamma$ times the $N$-space gradient operator. If the dominant stochastic field is the stochastic zero-point field (SZPF), then $\Gamma=\hbar$. In boldface $N$-vector notation, the resulting general $N$-coordinate nonrelativistic statistical Schrödinger equation is given by eq. (\[eq31\]), $$i\hbar\partial_t\psi = \frac{1}{2m}(-i\hbar\bm{\nabla} - m\bm{u})^2\psi + W\psi,$$ where $\bm{u}(x,t)$ is the $N$-vector velocity gauge field and $W(x,t)$ is the $N$-scalar potential energy that appear in the classical system Hamiltonian, $x = (x^1, \ldots, x^N)$ are the $N$ independent real curvilinear coordinates, $\bm{\nabla}=\bm{e}^q\partial_q$ is the $N$-space gradient operator, with $\bm{e}^q$ the contravariant basis vector normal to the hypersurface $x^q = const.^q$, and $m$ is a parameter having dimension mass that may be chosen at will, because the $N$-space metric contains the physical parameters. Furthermore, the multi-coordinate wavefunction in this statistical Schrödinger equation must satisfy exactly the same conditions as does the wavefunction in the usual axiomatic Schrödinger equation, whereby all wavefunction solutions are the same as the usual ones. We obtained these results by applying the reverse Madelung transform to the continuity equation for smooth coordinate probability density and flux, by using the covariant and contravariant basis vector approach to general tensor calculus in the metric $N$-space (see the Appendix), by applying the Ehrenfest theorem in reverse or by comparison with the classical Hamilton-Jacobi equation, and by comparison with well-known results for a classical charged radiation-damped harmonic oscillator immersed in the SZPF. In section \[examples\], we treated two examples. The first was essentially trivial, a system of two point spinless particles having different masses in the unperturbed limit of an internal static central force interaction but no external fields. This example was included mainly to illustrate how the classical Hamiltonian and the corresponding operator reduce from their six-dimensional metric space expressions to the usual CM and relative coordinate expressions. The second example was a system of arbitrarily many identical spinless point particles in the limit of two-body central force non-retarded internal interactions, also in the presence of applied external fields. This example was included mainly to show how the $3N_p$-space Hamiltonian operator reduces to the usual form involving three Cartesian components of the CM position vector for each of $N_p$ particles, and also to emphasize that the set of derived Schrödinger equations for $N_p = 1,2,3,...$ predicts either fermions or bosons, as expected, and is equivalent to the usual quantized field description in occupation number space [@Schweber]. [**Discussion.**]{} Since we have already discussed the mathematical approaches used in this work fairly thoroughly, in this subsection we will focus on interpretational and philosophical aspects of the results. In particular, we consider two important items, namely, whether classical trajectories are compatible with the conventional [*interpretation*]{} of the Schrödinger equation, and what could be the physical source of the wavelike properties of interference, diffraction, and tunneling predicted by the equation. The first item, discussed briefly in section \[SEMP\], is that the statistical Schrödinger equation itself is mathematically compatible with classical coordinate trajectories. This compatibility arises because there are two levels of statistics involved in deriving the equation: First, one obtains a continuity equation for smooth coordinate probability density and flux by averaging the fine-grained density and flux, which contains Dirac deltas, over the random variables in the stochastic zero-point field. Then, using the methods discussed above, one obtains the statistical Schrödinger equation as an ensemble-averaged equation involving a wavefunction that satisfies the usual conditions and is known [*a priori*]{} to have the usual statistical significance. However, the conventional interpretation of discrete sets of energy eigenvalues as strictly quantized energies, the only energies allowed to the system, is not compatible with underlying classical trajectories. This incompatibility was discussed thoroughly in the papers by the author on the charged HO in SED [@Goedecke1983]. In those papers it was shown that the HO energy is not sharp, even in the ground state, and furthermore that the system can never be in just a single excited state, despite the fact that the derived Schrödinger equation, which contains a radiation reaction vector potential that is not included in the conventional Schrödinger equation, yields the correct QED results for absorption and stimulated and spontaneous emission of electric dipole radiation, without electromagnetic field quantization. Even in the ground state, direct calculation of ensemble averages from the detailed trajectory of the HO in the SZPF revealed that $\left<E^2\right>= 2\left<E\right>^2$, characteristic [*e.g.*]{} of Gaussian random variables, and denying strict quantization. That is, energy fluctuations must be present if underlying classical trajectories exist. It may be that this apparent interpretational dilemma can be resolved quite easily, as follows. We note again that the statistical Schrödinger equation derived in this work is an ensemble-averaged statistical equation. Therefore its predicted quantized eigenvalues of the Hamiltonian operator for an unperturbed bound system, the same eigenvalues predicted by the axiomatic SEQ, are [*ensemble-averaged*]{} energies $\left<E\right>$, which may form a discrete spectrum with no internal contradictions. If a known radiation field is applied to the system, then standard time-dependent perturbation theory applied to the statistical SEQ still yields the Einstein rule for line spectra, that emitted and absorbed angular frequencies are given by $\Delta\left<E\right>/\hbar$, and also yields the usual transition rules and (ensemble-averaged) transition probabilities per unit time. (As mentioned above, spontaneous emission results without quantized applied radiation fields if an appropriate RR vector potential is included in the classical Hamiltonian and thus in the SEQ Hamiltonian operator, but results only from the quantized applied radiation field if the RR potential is omitted.) The actual energies may fluctuate around the ensemble average energy eigenvalues without changing these results. However, we would expect the ensemble-averaged coordinate probability distributions predicted by the statistical Schrödinger equation to be enormously more probable than any others. We defer detailed consideration of energy fluctuations until later work. The second item mentioned above is the possible source of the wavelike properties of interference, diffraction, and tunneling predicted by the Schrödinger equation. The direct source must be the stochastic zero-point field (SZPF). In order to discuss how the SZPF could produce interference effects, let’s focus first on Casimir forces. These well-known “vacuum forces”, such as the force between two very large parallel plates separated by a small distance, or the force between two polarizable electric dipoles (the Casimir-Polder force) result from modification of the zero-point field induced by the presence of matter with which the field interacts. The standard results may be derived using either the quantum vacuum field or the SZPF, as discussed by de la Peña and Cetto [@SED1], and as verified in unpublished calculations by the author, ca. 1983. When using the SZPF, the Casimir-Polder force results from the ensemble average of the forces due to coherent multiple scattering of each SZPF plane wave mode and the consequent coherent zero-point oscillations of the two induced dipoles. The Casimir force between two parallel conducting plates also results from coherent multiple scattering between the plates, which alters the mode structure of the vacuum SZPF in the region between the plates and causes a net attractive ensemble average force between the plates. In both cases, coherent multiple scattering of the SZPF plane wave modes produces the interference and the “vacuum” forces. Consider now a speculation on the famous problem of multiple-slit particle diffraction. It seems evident that the amplitudes and phases of the SZPF modes are altered from the free-field values by the presence of the matter in the plates containing the slits. These modes will be different in the cases of no slits, one slit, two slits, etc. in a plane. Therefore, the forces on an approaching particle due to the SZPF must be different in each case, and perhaps it is not so surprising that the distribution of the transmitted particles in a beam is quite different in each case. The Schrödinger/statistical wave equation derived herein predicts interference patterns as if each incident particle were a wave having a given ensemble-averaged incident direction and wavelength equal to Planck’s constant divided by the incident momentum. Of course a single particle actually makes a dot on the detector screen behind the slits. But the interference pattern is indeed reproduced after a very large number of identical non-interacting particles pass through the slits, whether they pass through one at a time or all in a bunch. With respect to tunneling through a potential barrier, a particle following a classical trajectory can do this only if temporarily it receives enough energy to be kicked over the barrier. Such temporary or “virtual” energy transfers will occur in the presence of the SZPF, and their statistics must be described by the Schrödinger/statistical wave equation. Let us add a comment about our identification of the unknown constant in the statistical wave equation as Planck’s constant. Our comparison with the results for the charged harmonic oscillator in SED is equivalent to comparison with experiment or with the axiomatic Schrödinger equation, except for our argument involving the SZPF and its close relation to the quantum vacuum field, which suggests the universality of the constant. A derivation of the numerical value of the constant is lacking, as has always been the case. For that matter, to the best of our knowledge there are no accepted derivations of the values of any of the fundamental constants. One expects that their values, which Dirac suggested might be time-dependent, are determined by the history and structure of the whole universe. In particular, as a classical albeit stochastic field, the SZPF must have sources, i.e., it must originate from (zero-point) oscillations of all the particles in the universe. Therefore there must be some self-consistency requirements involved that would determine values of one or more of the fundamental “constants”. Another point should be made about the universality of the unknown constant $\Gamma$ in the derived statistical Schrödinger wave equation: It seems clear that it should have the same value, $\hbar$, for every electrically charged fundamental particle that interacts via the Lorentz force with the SZPF. Furthermore, most fundamental particles are themselves charged or are composed of charged particles. Because of the extremely intense ultra-high-frequency amplitudes in the SZPF, which has a power spectrum $\propto\omega_k^3$, the SZPF should interact via the Lorentz force with each electrically charged constituent of any particle, [*e.g.*]{} with the quarks in a neutron. However, neutrinos are outstanding counterexamples. Should their statistical quantum equations also have $\Gamma=\hbar$? We defer consideration of this question to later work. [**Prognosis**]{}. In the next paper in this series, we utilize the results of this paper, in particular eqs. (\[eq35\]) and (\[eq36\]), to show that a straightforward statistical representation of the nonrelativistic rigid rotations of a charged massive object in terms of Euler angle coordinates and principal moments of inertia yields exactly the properties of quantum spin and the quantum interaction of a magnetic dipole with a magnetic field, including odd-half-integer as well as integer spin. We show that odd-half-integer spin particles cannot access integer spin states, and vice-versa. We also provide one simple way to overcome the well-known objection that an extended rigidly rotating electron model must involve supraluminal speeds. If the [*a priori*]{} statistical treatment developed in the first two papers in this series is to be viable, future work must include fully relativistic treatments of spinless and spinning particles utilizing the same approach. While we have made significant progress toward these treatments, as of this writing quite a bit remains to be done. Another point that we feel should be emphasized again: As implied by our results, quantum mechanics, axiomatic or statistical, is only as good as the classical mechanics that underlies it. When we set up a quantum mechanics problem, we first need to decide how many “classical” coordinates are needed. (For example, consider a diatomic molecule. Do we need only CM and (two) Euler angle coordinates, or should we include the “internal” vibration coordinate? It’s up to us. If we think ambient energies will be fairly large, then we need the latter.) Then we must decide how to represent the interaction potential energies and gauge fields in the classical Lagrangian/Hamiltonian. Usually we are forced to make approximations. (For the diatomic molecule, we often use the lowest order approximation by assuming only an instantaneous harmonic central force between the atoms. This is incorrect in principle, because it neglects retardation and vector potentials, including external and self radiation fields, but it is also clearly quite accurate in some applications.) Again, it’s up to us. So the traditional approach in classical mechanics, to choose the appropriate coordinates and interactions and obtain the Lagrangian and Hamiltonian, must still be done before one does the (statistical) quantum mechanics of the problem. Finally, we offer a further comparison of axiomatic nonrelativistic quantum mechanics (QM) with the statistical nonrelativistic QM developed herein. First, we re-emphasize that the two produce identical algebraic or numerical results for any and all choices of the classical Hamiltonian, for any nonrelativistic system whatsoever. We must remember that on its way to becoming axiomatic the original Schrödinger equation (SEQ) was inferred, not derived, by seeking the simplest linear second-order homogeneous wave equation whose eikonal limit is the Hamilton-Jacobi equation for the classical system considered. The probabilistic significance of the assumed smooth wavefunction $\psi$ and density $\psi^*\psi$ had to be determined [*a posteriori*]{}, as did the appropriate boundary conditions on the wavefunction, by comparison with experiment or by postulate. The significance of discrete sets of eigenvalues of the Hamiltonian operator as quantized energies, the only energies allowed, seemed obvious, but actually constituted another postulate. In contrast, the fully statistical theory is unavoidable. Except for identification of the unknown real constant $\Gamma$, the theory follows inevitably once one decides to treat the nonrelativistic classical motions of small particles statistically. It derives the general canonical quantization rule and SEQ for a smooth wavefunction with interpretations and boundary conditions known [*a priori*]{}; but it does not support quantized energies. (As mentioned above, the statistical SEQ is an ensemble-averaged equation, whereby its eigenvalues ought to be ensemble-averaged energies.) If we do insist on truly quantized energies, then we are choosing to maintain dual theories that seem to yield the same results. Therefore, it is most important that we continue to investigate the statistical approach in an effort to determine what experiments could distinguish between the two theories. Acknowledgements ================ The author would like to thank Stephen Pate, Michael Engelhardt, and Stefan Zollner for helpful discussions and assistance in preparing the manuscript. Generalized coordinates and coordinate basis vectors {#appendix} ==================================================== To the best of our knowledge, only the well-known text by Lichnerowicz [@Lichnerowicz] and a recent paper by the author [@Goedecke2011] provide fairly complete discussions of the basis vector approach to tensor calculus in general metric spaces. This very clear, efficient, and versatile approach is particularly well-suited to the material treated in this work. In the interest of readability, we provide a brief summary below. Consider a set of real continuous independent variables $x = (x^1, \ldots, x^N)$ as curvilinear coordinates in an $N$-dimensional manifold or “$N$-space". $N$ may be finite or infinite. Each coordinate $x^p,\;p = 1, \ldots, N$ may be non-compact or compact and may have any physical dimension. The $(N-1)$-dimensional coordinate hypersurfaces are defined as $[\Sigma_p:\;x^p = const.^p]$ , and the coordinate curves are given by $[C_p:\;x^q = const.^q,\,\forall{\,q\neq p}]$; [*i.e.*]{}, a particular $C_p$ that passes through a point $x$ is defined as the intersection of the $(N-1)$ hypersurfaces $[\Sigma_q,\,q\neq p]$ that contain $x$. We may define a set of $N$ linearly independent (LI) vectors $\bm{e}_p$, called “covariant" basis vectors, as tangents to the $[C_p]$ passing through point $x$, and a so-called dual LI set $\bm{e}^p$, called “contravariant" basis vectors, as normals to the $[\Sigma_p]$ at point $x$; either set will serve as a set of coordinate basis vectors for vector and tensor fields in the tangent linear vector space. The designations “contravariant" and “covariant" refer to how quantities transform under a general coordinate transformation in the $N$-space. For single-index quantities, “contravariant", indicated by a superscript index, means that the $\bm{e}^p$ and other single-superscript quantities transform as do the coordinate differentials $dx^p$; “covariant" means that the $\bm{e}_p$ and other single-subscript quantities transform as do the partial derivatives $\partial_p$. The inner (dot) products among the normal and tangent basis vectors at any point are given by $$\label{eqA1} \bm{e}_p\bm{\cdot}\bm{e}^q = \bm{e}^q\bm{\cdot}\bm{e}_p = \delta_p^q,$$ the Kronecker delta. We may write any $N$-vector field $\bm{A}(x)$ as linear combinations (LC’s) of the coordinate basis vectors: $$\label{eqA2} \bm{A}(x) = \bm{e}_p(x)A^p(x) = \bm{e}^q(x)A_q(x).$$ We adopt the extended Einstein summation convention that repeated indices in any term of an equation, one “up” and one “down”, or both up or both down, are summed over from 1 to $N$. The coefficients of the LC’s are also the components of the vector, [*i.e.*]{}, $A^q = \bm{e}^q\bm{\cdot}\bm{A}$ are the contravariant components, and $A_q = \bm{e}_q\bm{\cdot}\bm{A}$ are the covariant components. Similarly, we may write any 2nd rank tensor or “dyadic" field as bilinear combinations of the basis vectors; the coefficients of the bilinear combinations have two indices and are the “components" of the dyadic. Also, any triadic or third rank tensor is a trilinear combination of basis vectors; etc. All such components are present in the conventional Riemann-Einstein version of tensor calculus. However, that version does not use basis vectors and thus cannot write the invariant quantities such as an $N$-vector field $\bm{A}$ in the general and very convenient boldface notation of eq. (\[eqA2\]). The displacement vector $d\bm{x}$ connecting two infinitesimally separated points and the gradient operator $\bm{\nabla}$ are written as the following LC’s: $$\label{eqA3} d\bm{x} = \bm{e}_p dx^p;\;\;\;\bm{\nabla} = \bm{e}^p \partial_p,$$ where $\partial_p = \partial/\partial x^p.$ As in relativity, $d\bm{x}$ is chosen to have dimension length ($L$) and $\bm{\nabla}$ to have dimension $1/L$. Therefore, in general, $\bm{e}^p$ and $\bm{e}_p$ may not be unit vectors, may not be dimensionless, may not have the same dimension, and may not even be parallel; and the covariant and contravariant components of a vector may not have the same dimension or the same dimension as the vector itself. The square of the line element $ds$ between infinitesimally separated points is defined conventionally by $$\label{eqA7} \pm ds^2 = d\bm{x}\bm{\cdot}d\bm{x} = \bm{e}_p\bm{\cdot}\bm{e}_q dx^p dx^q = g_{pq}(x)dx^p dx^q,$$ where either + or - may be chosen, and the last equality defines the (covariant components of the) metric $g_{pq}$ and thereby the fundamental symmetric dot products among the subscripted basis vectors associated with these $N$ curvilinear coordinates. In general $ds^2$ may be positive, negative, or zero. The dot product of any basis vector with itself may be either positive or negative, yielding an “indefinite metric”, necessary here and in relativity since all coordinates are chosen to be real-valued. Using eqs. (\[eqA1\]) and (\[eqA2\]) yields $$\label{eqA8} \bm{e}_r\bm{\cdot}\bm{A} = A_r = g_{rp}A^p;\;\;\;\bm{e}^p\bm{\cdot}\bm{A} = A^p = g^{pq}A_q,$$ where $$\label{eqA9} g^{pq} = \bm{e}^p\bm{\cdot}\bm{e}^q$$ comprise the “contravariant components” of the metric, or in common usage, simply the contravariant metric. Also, eq. (\[eqA8\]) implies $g^{rp}g_{pq} = \delta^r_q$, i.e., the matrix $(g^{\cdot})$ with elements $(g^\cdot)_{pq} = g^{pq}$ is the inverse of the matrix $(g_{\cdot})$ with elements $(g_{\cdot})_{pq} = g_{pq}$. Note that in general indices may be raised and lowered using the appropriate components of the metric. In Lichnerowicz’ basis-vector approach to tensor calculus, the coordinate partial derivatives of the $N$-space basis vectors at point $x$ are expressible as LC’s of those basis vectors: $$\label{eqA10} \partial_p\bm{e}_q = \Gamma^r_{pq}\bm{e}_r;\;\;\;\partial_p\bm{e}^r = -\Gamma^r_{pq}\bm{e}^q.$$ The $ \Gamma^r_{pq}$ are the so-called affine connections; here, we are following Hartle’s [@Hartle] choice for the ordering of the subscripts on these connections, opposite to that used in the author’s recent paper [@Goedecke2011]. (In the conventional Riemann-Einstein version of tensor calculus, the affine connections are defined by considering “parallel transport" of vector components). A space in which the connections are symmetric in their lower indices is called “torsion-free”. Virtually all efforts in relativity have assumed this property. In such cases it is straightforward to show that $$\label{eqA11} \Gamma^r_{pq} = \{^r_{pq}\} = g^{rs}[s,pq],$$ $$\label{eqA12} [s,pq] =\mbox{\footnotesize$\frac{1}{2}$}[\partial_p g_{qs}+\partial_q g_{ps} - \partial_s g_{pq}],$$ where $[s,pq] = [s,qp]$ is called a “Christoffel symbol of the first kind", and $\{^r_{pq}\}$ is called a “Christoffel symbol of the second kind". These symbols satisfy an important identity, $$\label{eqA13} \{^q_{pq}\} = \partial_p\ln\sqrt{|g_\cdot|},$$ where $|g_\cdot|$ is the magnitude of the determinant of the matrix $(g_\cdot)$. Consider the gradient of a vector field, $$\label{eqA14} \bm{\nabla A} = \bm{e}^q \partial_q ( \bm{e}_p A^p) = \bm{e}^q\bm{e}_r(\partial_qA^r + \Gamma^r_{qp}A^p),$$ where the last term follows from eq. (\[eqA10\]). The quantity $(\partial_qA^r + \Gamma^r_{qp}A^p)$, denoted $A^r_{\;\,;q}$ or $D_qA^r$ or $\nabla_qA^r$, is called the covariant derivative of the vector (component) $A^r$. The open vector product $\bm{\nabla A}$ is called a “dyadic” (or rank two tensor); the quantities $D_qA^r = \bm{e}_q\bm{\cdot}\bm{\nabla A}\bm{\cdot}\bm{e}^r$ are the $N^2$ mixed components with first index down (covariant), second index up (contravariant). The divergence $\bm{\nabla}\bm{\cdot}\bm{A}$ of a vector field is an important quantity. To obtain it, just put a dot between the basis vectors in eq. (\[eqA14\]), and use eqs. (\[eqA1\]) and (\[eqA13\]): $$\label{eqA15} \bm{\nabla}\bm{\cdot}\bm{A} = (\sqrt{|g_\cdot|})^{-1}\partial_q(\sqrt{|g_\cdot|}A^q).$$ If $\bm{A}=\bm{\nabla}\Phi$, where $\Phi$ is any (scalar) function of $x$, then $$\label{eqA16} \bm{\nabla}\bm{\cdot}\bm{A} = \nabla^2\Phi = (\sqrt{|g_\cdot|})^{-1}\partial_q(\sqrt{|g_\cdot|}g^{qp}\partial_p\Phi).$$ The N-space volume element $dV_N$ is also needed; it is $$\label{eqA17} dV_N = d^Nx\sqrt{|g_\cdot|},\;\;\;d^Nx = dx^1, \cdots, dx^N.$$ An important identity is needed to show that various operators are Hermitian: $$\label{eqA18} \int d^Nx\sqrt{|g_\cdot|}\bm{\nabla}f = 0,$$ where the integration extends over all $N$-space and $f$ is any function. In order to prove this identity, simply write $\bm{\nabla}=\bm{e}^p\partial_p$, integrate by parts, use eqs. (\[eqA10\]),(\[eqA11\]), and (\[eqA13\]), and require that the integrand $\sqrt{|g_\cdot|}\bm{e}^q f$ satisfy periodic boundary conditions or go to zero at the coordinate boundaries. Up to this point, this appendix has considered conventional tensor calculus with coordinate basis vectors in a metric space of $N$ dimensions. The designation “conventional" here implies that i) the affine connections are symmetric in their lower indices, and ii) eqs. (\[eqA8\]) and (\[eqA10\]) are valid. Together, these equations imply that the $N$-space considered is completely isolated from other possible coordinate spaces. For example, suppose that a total space consists of an $N$-space and an $M$-space. In order for these two subspaces to be isolated from each other, i) the metric must be globally transformable to block diagonal form, $N\times N \oplus M\times M$, as implied indirectly by eqs. (\[eqA8\]) and (\[eqA10\]), and ii) the derivatives of basis vectors in each subspace must be expressible as LC’s of basis vectors only in that subspace, as implied by eq. (\[eqA10\]). Non-isolated subspaces are actually quite common [@Goedecke2011]; they should be important in a fully relativistic treatment. In this nonelativistic treatment, we work with isolated spaces. However, we do need to consider another deviation from conventional tensor calculus, namely, suppose the coordinate basis vectors $(\bm{e}_p,\bm{e}^q)$ are referred locally to a given Cartesian set $[\bm{\hat{e}}_i = \bm{\hat{e}}^i, \;\hat{g}_{ij} = \bm{\hat{e}}_i\bm{\cdot}\bm{\hat{e}}_j = \delta_{ij}]$, where the indices $i,j,k,...$ range and sum over the same set of integers as the indices $p,q,r,...$ (Just as in relativity, such a referral may always be done using local coordinate transformations.) That is, suppose that $$\label{eqA19} \bm{e}_q = A_{iq}\hat{\bm{e}}_i;\;\;\;\bm{e}^q = A^{-1}_{qj}\hat{\bm{e}}_j,$$ where the coefficients are given functions of the curvilinear coordinates, valid in a neighborhood around any point $x$. Note that the second relation in eq. (\[eqA19\]) is implied by the first and eq. (\[eqA1\]). The metric is then given by $$\label{eqA20} g_{pq} = \bm{e}_p\bm{\cdot}\bm{e}_q = A_{ip}A_{iq};\;\;\;g^{pq} = \bm{e}^p\bm{\cdot}\bm{e}^q = A^{-1}_{pj}A^{-1}_{qj}.$$ The affine connections are then obtained by derivation of eq. (\[eqA19\]), using eq. (\[eqA10\]): $$\label{eqA21} \Gamma^q_{pr} = (\partial_pA^{-1}_{qj})A_{jr},$$ keeping in mind that in a locally Cartesian system underlying the basis vectors $[\hat{\bm{e}}_i]$ at point $x$, the first derivatives of these vectors (and thus the locally Cartesian system connections) vanish at $x$. Then eqs. (\[eqA10\]), (\[eqA19\]) and (\[eqA20\]) yield $$\label{eqA22} \bm{e}^p\bm{\cdot}\partial_p\bm{e}^q = -g^{pr}\Gamma^q_{pr} = A^{-1}_{pi}\partial_pA^{-1}_{qi}.$$ Note that these $\Gamma^q_{pr}$ may not be symmetric in their lower indices. Such seems to be the case for the 3-space of the Euler angles, as mentioned in Sec. \[genSEQ\] above and derived in the next paper in this series. Nevertheless, the identity (\[eqA18\]) is still valid in the Euler angle space, as shown in that paper. [99]{} D. Bohm, Phys. Rev. 85, 166 and 180 (1952). E. Nelson, Phys. Rev. 150, 1079 (1966). M. Baublitz, Jr., Prog. Theor. Phys. 80, 232 (1988). H. Okamoto, J. Phys. A: Math Gen. 23, 5535 (1990). S. Srinivasan and E. Sudarshan, J. Phys. A: Math Gen. 29, 5181 (1996). For reviews of SED and many references, see e.g. T. H. Boyer, “A brief survey of stochastic electrodynamics", in Foundations of Radiation Theory and Quantum Electrodynamics, A. O. Barut, ed. (Plenum, NY, 1980); and L. de la Pena and A. Cetto, “The Quantum Dice: An Introduction to Stochastic Electrodynamics”, (Kluwer, The Netherlands, 1996). Seminal and comprehensive papers on SED published during the years 1960 - 1990 include several by T. Marshall, T. Boyer, M. Surdin, L. de la Pena, L. de la Pena and A. Cetto, E. Santos, O. Theimer, and G. Goedecke; see the reviews mentioned above. More recent papers include e. g. G. Manfredi, S. Mola, and M.R. Faix, Eur. J. Phys. 14, 101 (1993); K. Dechoum and H. Frana, Found. Phys. 25, 1599 (1995); K. Dechoum, H. Frana, and C. Malta, Phys. Lett. A 24, 93 (1998), and in “Fundamental Theories of Physics, Vol. 126, Gravitation and Cosmology: From the Hubble Radius to the Planck Scale", Part IV, p. 393 (Kluwer, Secaucus, NJ, USA), 2002. J. Gilson, Proc. Camb. Phil. Soc. 64, 106 (1968). R. Collins, Lett. Nuovo Cimento 18, 581 (1977). R. Collins, Found. Phys. 7, 475 (1977). R. Collins, Lett. Nuovo Cimento 25, 473 (1979). R. Collins, Found. Phys. Lett. 5, 63 (1992). E. Madelung, Z. Phys. 40, 322 (1926). G. Goedecke, Nuovo Cimento 30 B, 108 (1975); Lett. Nuovo Cimento 41, 1 (1984). G. Goedecke and B. Davis, Nuovo Cim. B 125, 941 (2010); DOI 10.1393/ncb/i2010-10897-y U. Klein, Found. Phys. 39, 964 (2009). See e.g. L.I. Schiff, “Quantum Mechanics", 3d ed. (McGraw-Hill, NY, 1968). T. Boyer, Phys. Rev. 182, 1374 (1969). G. Goedecke, Found. Phys. 13, 1101, 1121, and 1195 (1983) and 14, 41 (1984). M. Crisp and E. Jaynes, Phys. Rev. 179, 1253 (1969); 185, 2046 (1969); C. Stroud, Jr., Phys. Rev. A 1, 106 (1970). S. Schweber, “An Introduction to Relativistic Quantum Field Theory" (Row, Peterson, Evanston, IL, 1961), Chap. 6. A. Lichnerowicz, “Elements of Tensor Calculus" (Methuen, London, 1962). G. Goedecke, Eur. Phys. J. Plus 126, 32 (2011); DOI: 10.1140/epjp/i2011-11032-x G. Goedecke, J. Math. Phys. 15, 789 (1974). J. Hartle, “Gravity, an Introduction to Einstein’s General Relativity" (Pearson Education, 2003).

ARCHIVES: This is legacy content from before Industry Dive acquired Mobile Commerce Daily in early 2017. Some information, such as publication dates, may not have migrated over. Check out our topic page for the latest mobile commerce news. Mobile POS still fails to deliver on line-busting promise Author Caitlyn Bohannon For the last few years, consumers shopping in-store may have been met with checkout procedures that replace a register with a smartphone, aiming to speed up their transaction and utilize a source of modern technology. Some of these efforts are falling short due to a break in execution, perhaps involving an incomplete platform system in place or lack of associate experience. “The question is actually, ‘Have they made the infrastructure investments that would make mobile work well?’” said Paula Rosenblaum, managing partner at Retail Systems Research, Miami. “Technology is a tool. “There’s no purpose in a tool that doesn’t work well or doesn’t work as well as the tool it is replacing. Mobile can be great, especially for small retailers, such as Square, or retailers with a really large store footprint like department stores. “No retailer should use a tool that makes life less convenient for customers and store associates. It’s just old fashioned bad business.” Dissatisfied customersWhile brands’ and retailers’ bricks-and-mortar locations have been spending recent years integrating mobile in different ways, a common use of the technology has been used to complete the checkout process for in-store transactions. Sources of hardware and numerous applications can be combined to give smartphones transaction capabilities and when used can give the appeal of a tech-savvy establishment. However, if these implementations are not helping the customer, they are also unlikely to be helping business. A recent visit to an Urban Outfitters retail location in New Jersey by a Mobile Commerce Daily reporter highlighted this challenge. During this visit, an Urban Outfitters associate asked customers paying with a card to form an separate line at the checkout station. Once the associate was approached, she seemed unsure of the mobile checkout device and claimed that it “sometimes does not work.” The associate faced struggles of scanning the clothing items and using the credit card scanner. There were additional procedures of the associate entering a required identification number that seemed to take longer than usual given the small screen limitations. While this in-store usage of mobile may have been eye-catching to consumers when it was first implemented, the cool factor has died down, and customers now care more about efficiency. “Equipping store employees with smart phones so they can scan each item seems like it would take longer then using a traditional barcode scanner,” said Wilson Kerr, vice president of business development and sales at Unbound Commerce, Boston. “Also, I imagine, consumers would be very hesitant to put their credit card or payment information into a handheld device, being used by an individual. “Many small restaurants and businesses are moving their cash register systems over to a tablet-based check out, tied in to a physical cash register. PayPal’s Here iPad app others offer this option. “Since the tablet is bolted down, this seems to be a much better iteration of mobile checkout. Early companies in the space like Aisle Buyer may have exited well, but it is still extremely uncommon to see a store employee actually intercepting those in line and checking them out by hand using a smartphone.” All about executionMobile can serve the purpose of driving more revenue for brands and retailers, but if customers are met with inconvenient experiences, they are likely to be discouraged to do further business. “MPOS is a really powerful tool when used in the right place for the right reason,” said Thad Peterson, analyst at the Aite Group, Boston. “As with any retail process, it’s only valuable to the merchant if it either increases sales, return visits or it lowers cost. “MPOS can increase sales by speeding the transaction process and/or eliminating long waits in a checkout line. It can increase return visits by lessening the amount of time it takes for a consumer to make a purchase or by eliminating the need to visit a cash register. “It can lower costs if it can increase the volume of transactions delivered in the same amount of time for the same transaction cost. In order for MPOS to help, it has to be as or more fast and convenient than traditional POS.” Speed is key. Consumers want to pay for their items quickly and continue on with their day, but handicapped mobile implementations are only causing more problems rather than solving ones. “If it’s slower, then the customer isn’t pleased, and if it doesn’t work well, not only will the customer not be happy, but the associate will be put in an embarrassing position in front of a customer, and that could lessen their interest in offering or using MPOS with future customers,” Mr. Peterson said. “As with all new technologies, the application needs to match the use case, and in MPOS, that means fast, reliable and mobile transaction capture.” Final TakeCaitlyn Bohannon is an editorial assistant on Mobile Commerce Daily, New York

Molecular cloning and expression in Escherichia coli of two modification methylase genes of Bacillus subtilis. Two modification methylase genes of Bacillus subtilis R were cloned in Escherichia coli by using a selection procedure which is based on the expression of these genes. Both genes code for DNA-methyltransferases which render the DNA of the cloning host E. coli HB101 insensitive to the BspRI (5'-GGCC) endonuclease of Bacillus sphaericus R. One of the cloned genes is part of the restriction-modification (RM) system BsuRI of B. subtilis R with specificity for 5'-GGCC. The other one is associated with the lysogenizing phage SP beta B and produces the methylase M.BsuP beta BI with specificity for 5'-GGCC. The fragment carrying the SP beta B-derived gene also directs the synthesis in E. coli of a third methylase activity (M.BsuP beta BII), which protects the host DNA against HpaII and MspI cleavage within the sequence 5'-CCGG. Indirect evidence suggests that the two SP beta B modification activities are encoded by the same gene. No cross-hybridization was detected either between the M.BsuRI and M.BsuP beta B genes or between these and the modification methylase gene of B. sphaericus R, which codes for the enzyme M.BspRI with 5'-GGCC specificity.

Susan H. Black Susan Harrell Black (born October 20, 1943) is an American lawyer and a Senior United States Circuit Judge of the United States Court of Appeals for the Eleventh Circuit. She was a former United States District Judge of the United States District Court for the Middle District of Florida. Education and career Black was born in Valdosta, Georgia. She earned her Bachelor of Arts degree from Florida State University in 1964 and her Juris Doctor from the University of Florida College of Law in 1967. Black was a high school teacher in Jacksonville, Florida from 1967 to 1968 and an attorney for the United States Army Corps of Engineers in Jacksonville from 1968 to 1969. From 1969 to 1972 she served as assistant state attorney in Jacksonville and from 1972 to 1973 she served as assistant general counsel for the City of Jacksonville. State judicial service Black was a judge in Duval County Court from 1973 to 1975 and was a judge in the Fourth Judicial Circuit (Duval, Clay, and Nassau counties) from 1975 to 1979. Federal judicial service President Jimmy Carter nominated Black to the United States District Court for the Middle District of Florida on May 22, 1979, to a new seat created by 92 Stat. 1629. Confirmed by the Senate on July 23, 1979, she received her commission the next day. Black served as Chief Judge from 1990 to 1992. She received a Master of Laws from the University of Virginia School of Law in 1984. Her service terminated on September 3, 1992, due to elevation to the Eleventh Circuit. President George H. W. Bush nominated Black to the United States Court of Appeals for the Eleventh Circuit on March 10, 1992, to the seat vacated by Judge Thomas Alonzo Clark. Confirmed by the Senate on August 11, 1992, she received her commission the next day and began serving on the court on September 3, 1992. On February 25, 2011, Black took senior status. Notes References Category:1933 births Category:20th-century American judges Category:American women judges Category:Florida State University alumni Category:Judges of the United States Court of Appeals for the Eleventh Circuit Category:Judges of the United States District Court for the Middle District of Florida Category:Living people Category:People from Valdosta, Georgia Category:United States court of appeals judges appointed by George H. W. Bush Category:United States district court judges appointed by Jimmy Carter Category:University of Florida alumni Category:University of Virginia School of Law alumni

Extracellular ice and cell shape in frost-stressed cereal leaves: A low-temperature scanning-electron-microscopy study. Low-temperature scanning electron microscopy was used to examine transverse fracture faces through cereal leaf pieces subjected to frost. Specimens were studied before and after sublimation of the ice. The position of extracellular ice in the leaf was inferred from the difference between the specimen before and after sublimation and from ridges and points which occurred in the extracellular ice during sublimation. Steps in the fracture surface indicated that the fracture plane passed through the extracellular ice crystals as well as through cells and also helped identify extracellular ice. The cells in controls were turgid and extracellular ice was absent. Leaf pieces from hardened rye were excised and frost-stressed to-3.3°,-21° and-72°C, cooling at 2-12°·h(-1). Cell collapse and extracellular ice were evident at-3.3°C and increased considerably by-21° C. At-21° and-72°C the leaf pieces were mainly filled with extracellular ice and there were few remaining gas spaces. The epidermal and mesophyll cells were laterally flattened, perpendicular to their attachment to adjacent cells, and phloem and vascular sheath cells were more irregularly deformed. Leaf pieces from tender barley were cooled at 2°C·min(-1) to-20° C; they were then mainly filled with extracellular ice, and the cells were highly collapsed as in the rye. In rye leaves frozen to-3.6° C before excision, ice crystals occurred in peri-vascular, sub-epidermal and intervening mesophyll spaces. In rye leaf pieces frozen to-3.3° C after excision or to-3.6° C before excision, mesophyll cells were partly collapsed even when not covered by ice, indicating that collapse of the cell wall, as well as the enclosed protoplast, was driven by dehydration. No gas or ice-filled spaces were found between wall and the enclosed protoplast. It is suggested that this can be explained without invoking chemical bonding between cell wall and plasma membrane: when the wall pores are filled by water, the pore size would reduce vapour pressure so making penetration of the wall by ice or gas less likely.

EDITOR’S NOTE: We are thrilled to present Kelly Link’s weird and wonderful short story “Lull,” with special permission by the author. “Lull” copyright ©2002 was first published in Conjunctions 39 and reprinted in Kelly Link’s Magic For Beginners (Random House, 2014). There was a lull in the conversation. We were down in the basement, sitting around the green felt table. We were holding bottles of warm beer in one hand, and our cards in the other. Our cards weren’t great. Looking at each others’ faces, we could see that clearly. We were tired. It made us more tired to look at each other when we saw we weren’t getting away with anything at all. We didn’t have any secrets. We hadn’t seen each other for a while and it was clear that we hadn’t changed for the better. We were between jobs, or stuck in jobs that we hated. We were having affairs and our wives knew and didn’t care. Some of us were sleeping with each others’ wives. There were things that had gone wrong, and we weren’t sure who to blame. We had been talking about things that went backwards instead of forwards. Things that managed to do both at the same time. Time travelers. People who weren’t stuck like us. There was that new movie that went backwards, and then Jeff put this music on the stereo where all the lyrics were palindromes. It was something his kid had picked up. His kid Stan was a lot cooler than we had ever been. He was always bringing things home, Jeff said, saying, You have got to listen to this. Here, try this. These guys are good. Stan was the kid who got drugs for the other kids when there was going to be a party. We had tried not to be bothered by this. We trusted our kids and we hoped that they trusted us, that they weren’t too embarrassed by us. We weren’t cool. We were willing to be liked. That would have been enough. Stan was so very cool that he hadn’t even minded taking care of some of us, the parents of his friends (the friends of his parents), although sometimes we just went through our kids’ drawers, looked under the mattresses. It wasn’t that different from taking Halloween candy out of their Halloween bags, which was something we had also done, when they were younger and went to bed before we did. Stan wasn’t into that stuff now, though. None of the kids were. They were into music instead. You couldn’t get this music on CD. That was part of the conceit. It came only on cassette. You played one side, and then on the other side the songs all played backwards and the lyrics went forwards and backwards all over again in one long endless loop. La allah ha llal. Do, oh, oh, do you, oh do, oh, wanna? Bones was really digging it. “Do you, do you wanna dance, you do, you do,” he said, and laughed and tipped his chair back. “Snakey canes. Hula boolah.” Someone mentioned the restaurant downtown where you were supposed to order your dessert and then you got your dinner. “I fold,” Ed said. He threw his cards down on the table. Ed liked to make up games. People paid him to make up games. Back when we had a regular poker night, he was always teaching us a new game and this game would be based on a TV show or some dream he’d had. “Let’s try something new. I’m going to deal out everything, the whole deck, and then we’ll have to put it all back. We’ll see each other’s hands as we put them down. We’re going for low. And we’ll swap. Yeah, that might work. Something else, like a wild card, but we won’t know what the wild card was, until the very end. We’ll need to play fast — no stopping to think about it — just do what I tell you to do.” “What’ll we call it?” he said, not a question, but as if we’d asked him, although we hadn’t. He was shuffling the deck, holding the cards close like we might try to take them away. “DNA Hand. Got it?” “That’s a shitty idea,” Jeff said. It was his basement, his poker table, his beer. So he got to say things like that. You could tell that he thought Ed looked happier than he ought to. He was thinking Ed ought to remember his place in the world, or maybe Ed needed to be reminded what his place was. His new place. Most of us were relieved to see that Ed looked okay. If he didn’t look okay, that was okay too. We understood. Bad things had happened to all of us. We were contemplating these things and then the tape flips over and starts again. It’s catchy stuff. We could listen to it all night. “Now we chant along and summon the Devil,” Bones says. “Always wanted to do that.” Bones has been drunk for a while now. His hair is standing up and his face is shiny and red. He has a fat stupid smile on his face. We ignore him, which is what he wants. Bones’s wife is just the same, loud and useless. The thing that makes the rest of us sick is that their kids are the nicest, smartest, funniest, best kids. We can’t figure it out. They don’t deserve kids like that. Brenner asks Ed if he’s found a new place to live. He has. “Off the highway, down by that Texaco, in the orchards. This guy built a road and built the house right on top of the road. Just, plop, right in the middle of the road. Kind of like he came walking up the road with the house on his back, got tired, and just dropped it.” “Not very good feng shui,” Pete says. Pete has read a book. He’s got a theory about picking up women, which he’s always sharing with us. He goes to Barnes & Noble on his lunch hour and hangs around in front of displays of books about houses and decorating, skimming through architecture books. He says it makes you look smart and just domesticated enough. A man looking at pictures of houses is sexy to women. We’ve never asked if it works for him. Meanwhile, we know, Pete’s wife is always after him to go up on the roof and gut the drains, reshingle and patch, paint. Pete isn’t really into this. Imaginary houses are sexy. Real ones are work. He did go buy a mirror at Pottery Barn and hang it up, just inside the front door, because otherwise, he said, evil spirits go rushing up the staircase and into the bedrooms. Getting them out again is tricky. The way the mirror works is that they start to come in, look in the mirror, and think a devil is already living in the house. So they take off. Devils can look like anyone — salespeople, Latter-day Saints, the people who mow your lawns — even members of your own family. So you have to have a mirror. Ed says, “Where the house is, is the first weird thing. The second thing is the house. It’s like this team of architects went crazy and sawed two different houses in half and then stitched them back together. Casa Del Guggenstein. The front half is really old — a hundred years old — the other half is aluminum siding.” “Must have brought down the asking price,” Jeff says. “Yeah,” Ed says. “And the other thing is there are all these doors. One at the front and one at the back and two more on either side, right smack where the aluminum siding starts, these weird, tall, skinny doors, like they’re built for basketball players. Or aliens.” “Or palm trees,” Bones says. “Yeah,” Ed says. “Sure. Palm trees. And then one last door, this vestigial door, up in the master bedroom. Not like a door that you walk through, for a closet, or a bathroom. It opens and there’s nothing there. No staircase, no balcony, no point to it. It’s a Tarzan door. Up in the trees. You open it and an owl might fly in. Or a bat. The previous tenant left that door locked — apparently he was afraid of sleepwalking.” “Fantastic,” Brenner says. “Wake up in the middle of the night and go to the bathroom, you could just pee out the side of your house.” He opens up the last beer and shakes some pepper in it. Brenner has a thing about pepper. He even puts it on ice cream. Pete swears that one time at a party he wandered into Brenner’s bedroom and looked in a drawer in a table beside the bed. He says he found a box of condoms and a pepper mill. When we asked what he was doing in Brenner’s bedroom, he winked and then put his finger to his mouth and zipped his lip. Brenner has a little pointed goatee. It might look silly on some people, but not on Brenner. The pepper thing sounds silly, maybe, but not even Jeff teases Brenner about it. “I remember that house,” Alibi says. We call him Alibi because his wife is always calling to check up on him. She’ll say, So was Alec out shooting pool with you the other night, and we’ll say, Sure he was, Gloria. The problem is that sometimes Alibi has told her some completely different story and she’s just testing us. But that’s not our problem and that’s not our fault. She never holds it against us and neither does he. “We used to go up in the orchards at night and have wars. Knock each other down with rotten apples. There were these peacocks. You bought the orchard house?” “Yeah,” Ed says. “I need to do something about the orchard. All the apples are falling off the trees and then they just rot on the ground. The peacocks eat them and get drunk. There are drunk wasps, too. If you go down there you can see the wasps hurtling around in these loopy lines and the peacocks grab them right out of the air. Little pickled wasp hors d’oeuvres. Everything smells like rotting apples. All night long, I’m dreaming about eating wormy apples.” For a second, we’re afraid Ed might tell us his dreams. Nothing is worse than someone telling you their dreams. “So what’s the deal with the peacocks?” Bones says. “Long story,” Ed says. So you know how the road to the house is a private road, you turn off the highway onto it, and it meanders up some until you run into the house. Some day I’ll drive home and park the car in the living room. There’s a big sign that says private. But people still drive up the turnoff, lost, or maybe looking for a picnic spot, or a place to pull off the road and fuck. Before you hear the car coming, you hear the peacocks. Which was the plan because this guy who built it was a real hermit, a recluse. People in town said all kinds of stuff about him. Nobody knew. He didn’t want anybody to know. The peacocks were so he would know when anyone was coming up to the house. They start screaming before you ever see a car. So remember, out the back door, the road goes on down through the orchards, there’s a gate and then you’re back on the main highway again. And this guy, the hermit, he kept two cars. Back then, nobody had two cars. But he kept one car parked in front of the house and one parked at the back so that whichever way someone was coming, he could go out the other way real fast and drive off before his visitor got up to the house. He had an arrangement with a grocer. The grocer sent a boy up to the house once every two weeks, and the boy brought the mail too, but there wasn’t ever any mail. The hermit had painted in the windows of his cars, black, except for these little circles that he could see out of. You couldn’t see in. But apparently he used to drive around at night. People said they saw him. Or they didn’t see him. That was the point. The real estate agent said she heard that once this guy had to go to the doctor. He had a growth or something. He showed up in the doctor’s office wearing a woman’s hat with a long black veil that hung down from the crown, so you couldn’t see his face. He took off his clothes in the doctor’s office and kept the hat on. One night half of the house fell down. People all over the town saw lights, like fireworks or lightning, up over the orchard. Some people swore they saw something big, all lit up, go up into the sky, like an explosion, but quiet. Just lights. The next day, people went up to the orchard. The hermit was waiting for them — he had his veil on. From the front, the house looked fine. But you could tell something had caught fire. You could smell it, like ozone. The hermit said it had been lightning. He rebuilt the house himself. Had lumber and everything delivered. Apparently kids used to go sneak up in the trees in the orchard and watch him while he was working, but he did all the work wearing the hat and the veil. He died a long time ago. The grocer’s boy figured out something was wrong because the peacocks were coming in and out of the windows of the house and screaming. So now they’re still down in the orchards and under the porch, and they still came in the windows and made a mess if Ed forgot and left the windows open too wide. Last week a fox came in after a peacock. You wouldn’t think a fox would go after something so big and mean. Peacocks are mean. Ed had been downstairs watching TV. “I heard the bird come in,” he says, “and then I heard a thump and a slap like a chair going over and when I went to look, there was a streak of blood going up the floor to the window. A fox was going out the window and the peacock was in its mouth, all the feathers dragging across the sill. Like one of Susan’s paintings.” Ed’s wife, Susan, took an art class for a while. Her teacher said she had a lot of talent. Brenner modeled for her, and so did some of our kids, but most of Susan’s paintings were portraits of her brother, Andrew. He’d been living with Susan and Ed for about two years. This was hard on Ed, although he’d never complained about it. He knew Susan loved her brother. He knew her brother had problems. Andrew couldn’t hold down a job. He went in and out of rehab, and when he was out, he hung out with our kids. Our kids thought Andrew was cool. The less we liked him, the more time our kids spent with Andrew. Maybe we were just a little jealous of him. Jeff’s kid, Stan, he and Andrew were thick as thieves. Stan was the one who found Andrew and called the hospital. Susan never said anything, but maybe she blamed Stan. Everybody knew Stan had been getting stuff for Andrew. Another thing that nobody said: what happened to Andrew, it was probably good for the kids in the long run. Those paintings — Susan’s paintings — were weird. None of the people in her paintings ever looked very comfortable, and she couldn’t do hands. And there were always these animals in the paintings, looking as if they’d been shot, or gutted, or if they didn’t look dead, they were definitely supposed to be rabid. You worried about the people. She hung them up in their house for a while, but they weren’t comfortable paintings. You couldn’t watch TV in the same room with them. And Andrew had this habit, he’d sit on the sofa just under one portrait, and there was another one too, above the TV. Three Andrews was too many. Once Ed brought Andrew to poker night. Andrew sat awhile and didn’t say anything, and then he said he was going upstairs to get more beer and he never came back. Three days later, the highway patrol found Ed’s car parked under a bridge. Stan and Andrew came home two days after that, and Andrew went back into rehab. Susan used to go visit him and take Stan with her — she’d take her sketchbook. Stan said Andrew would sit there and Susan would draw him and nobody ever said a word. After the class was over, while Andrew was still in rehab, Susan invited all of us to go to this party at her teacher’s studio. What we remember is that Pete got drunk and made a pass at the instructor, this sharp-looking woman with big dangly earrings. We were kind of surprised, not just because he did it in front of his wife, but because we’d all just been looking at her paintings. All these deer and birds and cows draped over dinner tables, and sofas, guts hanging out, eyeballs all shiny and fixed — so that explained Susan’s portraits, at least. We wonder what Susan did with the paintings of Andrew. “I’ve been thinking about getting a dog,” Ed says. “Fuck,” we say. “A dog’s a big responsibility.” Which is what we’ve spent years telling our kids. The music on the tape loops and looped. It was going round for a second time. We sat and listened to it. We’ll be sitting and listening to it for a while longer. “This guy,” Ed says, “the guy who was renting this place before me, he was into some crazy thing. There’s all these mandalas and pentagrams painted on the floors and walls. Which is also why I got it so cheap. They didn’t want to bother stripping the walls and repainting; this guy just took off one day, took a lot of the furniture too. Loaded up his truck with as much as he could take.” “So no furniture?” Pete says. “Susan get the dining room table and chairs? The bed? You sleeping in a sleeping bag? Eating beanie weenies out of a can?” “I got a futon,” Ed says. “And I’ve got my work table set up, the TV and stuff. I’ve been going down to the orchard, grilling on the hibachi. You guys should come over. I’m working on a new video game — it’ll be a haunted house — those are really big right now. That’s why this place is so great for me. I can use everything. Next weekend? I’ll fix hamburgers and you guys can sit up in the house, keep cool, drink beer, test the game for me. Find the bugs.” “There are always bugs,” Jeff says. He’s smiling in a mean way. He isn’t so nice when he’s been drinking. “That’s life. So should we bring the kids? The wives? Is this a family thing? Ellie’s been asking about you. You know that retreat she’s on, she called from the woods the other day. She went on and on about this past life. Apparently she was a used-car salesman. She says that this life is karmic payback, being married to me, right? She gets home day after tomorrow. We get together, maybe Ellie can set you up with someone. Now that you’re a free man, you need to take some advantage.” “Sure,” Ed says, and shrugs. We can see him wishing that Jeff would shut up, but Jeff doesn’t shut up. Jeff says, “I saw Susan in the grocery store the other day. She looked fantastic. It wasn’t that she wasn’t sad anymore, she wasn’t just getting by, she was radiant, you know? That special glow. Like Joan of Arc. Like she knew something. Like she’d won the lottery.” “Well, yeah,” Ed says. “That’s Susan. She doesn’t live in the past. She’s got this new job, this research project. They’re trying to contact aliens. They’re using household appliances: satellite dishes, cell phones, car radios, even refrigerators. I’m not sure how. I’m not sure what they’re planning to say. But they’ve got a lot of grant money. Even hired a speechwriter.” “Wonder what you say to aliens,” Brenner says. “Hi, honey, I’m home. What’s for dinner?” “Your place or mine?” Pete says. “What’s a nice alien like you doing in a galaxy like this?” “Where you been? I’ve been worried sick,” Alibi says. Jeff picks up a card, props it sideways against the green felt. Picks up another one, leans it against the first. He says, “You and Susan always looked so good together. Perfect marriage, perfect life. Now look at you: she’s talking to aliens, and you’re living in a haunted house. You’re an example to all of us, Ed. Nice guy like you, bad things happen to you, Susan leaves a swell guy like you, what’s the lesson here? I’ve been thinking about this all year. You and Ellie must have worked at the same car dealership, in that past life.” Nobody says anything. Ed doesn’t say anything, but the way we see him look at Jeff, we know that this haunted house game is going to have a character in it who walks and talks a lot like Jeff. This Jeff character is going to panic and run around on the screen of people’s TVs and get lost. It will stumble into booby traps and fall onto knives. Its innards will sloop out. Zombies are going to crack open the bones of its legs and suck on the marrow. Little devils with monkey faces are going to stitch its eyes open with tiny stitches and then they are going to piss ribbons of acid into its eyes. Beautiful women are going to fuck this cartoon Jeff in the ass with garden shears. And when this character screams, it’s going to sound a lot like Jeff screaming. Ed’s good at the little details. The kids who buy Ed’s games love the details. They buy his games for things like this. Jeff will probably be flattered. Jeff starts complaining about Stan’s phone bill, this four-hundred-dollar cell phone charge that Stan ran up. When he asked about it, Stan handed him a stack of twenties just like that. That kid always has money to spare. Stan also gave Jeff this phone number. He told Jeff that it’s like this phone sex line, but with a twist. You call up and ask for this girl named Starlight, and she tells you sexy stories, only, if you want, they don’t have to be sexy. They can be any kind of story you want. You tell her what kind of story you want, and she makes it up. Stan says it’s Stephen King and sci-fi and the Arabian Nights and Penthouse Letters all at once. Ed interrupts Jeff. “You got the number?” “What?” Jeff says. “I just got paid for the last game,” Ed says. “The one with the baby heads and the octopus girlies, the Martian combat hockey. Let’s call that number. I’ll pay. You put her on speaker and we’ll all listen, and it’s my treat, okay, because I’m such a swell guy.” Bones says that it sounds like a shit idea to him, which is probably why Jeff went and got the phone bill and another six-pack of beer. We all take another beer. Jeff turns the stereo down— Madam I’m Adam Oh Madam my Adam —and puts the phone in the middle of the table. It sits there, in the middle of all that green, like an island or something. Marooned. Jeff switches it on speaker. “Four bucks a minute,” he says, and shrugs, and dials the number. “Here,” Ed says. “Pass it over.” The phone rings and we listen to it ring and then a woman’s voice, very pleasant, says hello and asks if Ed is over eighteen. He says he is. He gives her his credit card number. She asks if he was calling for anyone in particular. “Starlight,” Ed says. “One moment,” the woman says. We hear a click and then Starlight is on the line. We know this because she says so. She says, “Hi, my name is Starlight. I’m going to tell you a sexy story. Do you want to know what I’m wearing?” Ed grunts. He shrugs. He grimaces at us. He needs a haircut. Susan used to cut his hair, which we used to think was cute. He and Andrew had these identical lopsided haircuts. It was pretty goofy. “Can I call you Susan?” Ed says. Which we think is strange. Starlight says, “If you really want to, but my name’s really Starlight. Don’t you think that’s sexy?” She sounds like a kid. A little girl — not even like a girl. Like a kid. She doesn’t sound like Susan at all. Since the divorce, we haven’t seen much of Susan, although she calls our houses sometimes, to talk to our wives. We’re a little worried about what she’s been saying to them. Ed says, “I guess so.” We can tell he’s only saying that to be polite, but Starlight laughs as if he’s told her a joke. It’s weird hearing that little-kid laugh down here. Ed says, “So are you going to tell me a story?” Starlight says, “That’s what I’m here for. But usually the guy wants to know what I’m wearing.” Ed says, “I want to hear a story about a cheerleader and the Devil.” Bones says, “So what’s she wearing?” Pete says, “Make it a story that goes backwards.” Jeff says, “Put something scary in it.” Alibi says, “Sexy.” Brenner says, “I want it to be about good and evil and true love, and it should also be funny. No talking animals. Not too much fooling around with the narrative structure. The ending should be happy but still realistic, believable, you know, and there shouldn’t be a moral although we should be able to think back later and have some sort of revelation. No and suddenly they woke up and discovered that it was all a dream. Got that?” Starlight says, “Okay. The Devil and a cheerleader. Got it. Okay.” The Devil and the Cheerleader So the Devil is at a party at the cheerleader’s house. They’ve been playing spin the bottle. The cheerleader’s boyfriend just came out of the closet with her best friend. Earlier the cheerleader felt like slapping him, and now she knows why. The bottle pointed at her best friend who had just shrugged and smiled at her. Then the bottle was spinning and when the bottle stopped spinning, it was in her boyfriend’s hand. Then all of a sudden an egg timer was going off. Everyone was giggling and they were all standing up to go over by the closet, like they were all going to try to squeeze inside. But the Devil stood up and took the cheerleader’s hand and pulled her backwards-forwards. So she knew what exactly had happened, and was going to happen, and some other things besides. This is the thing she likes about backwards. You start out with all the answers, and after a while, someone comes along and gives you the questions, but you don’t have to answer them. You’re already past that part. That was what was so nice about being married. Things got better and better until you hardly even knew each other anymore. And then you said good night and went out on a date, and after that you were just friends. It was easier that way — that’s the dear, sweet, backwards way of the world. Just a second, let’s go back for a second. Something happened. Something has happened. But nobody ever talked about it, at least not at these parties. Not anymore. Everyone’s been drinking all night long, except the Devil, who’s a teetotaler. He’s been pretending to drink vodka out of a hip flask. Everybody at the party is drunk right now and they think he’s okay. Later they’ll sober up. They’ll think he’s pretentious, an asshole, drinking air out of a flask like that. There are a lot of empty bottles of beer, some empty bottles of whiskey. There’s a lot of work still to be done, by the look of it. They’re using one of the beer bottles, that’s what they’re spinning. Later on it will be full and they won’t have to play this stupid game. The cheerleader guesses that she didn’t invite the Devil to the party. He isn’t the kind of guy that you have to invite. He’ll probably show up by himself. But now they’re in the closet together for five minutes. The cheerleader’s boyfriend isn’t too happy about this, but what can he do? It’s that kind of party. She’s that kind of cheerleader. They’re a lot younger than they used to be. At parties like this, they used to be older, especially the Devil. He remembers all the way back to the end of the world. The cheerleader wasn’t a cheerleader then. She was married and had kids and a husband. Something’s going to happen, or maybe it’s already happened. Nobody ever talks about it. If they could, what would they say? But those end-of-the-world parties were crazy. People would drink too much and they wouldn’t have any clothes on. There’d be these sad little piles of clothes in the living room, as if something had happened, and the people had disappeared, disappeared right out of their clothes. Meanwhile, the people who belonged to the clothes would be out in the backyard, waiting until it was time to go home. They’d get up on the trampoline and bounce around and cry. There would be a bottle of extra-virgin olive oil and sooner or later someone was going to have to refill it and go put it back on the pantry shelf. You’d have had these slippery naked middle-aged people sliding around on the trampoline and the oily grass, and then in the end all you’d have would be a bottle of olive oil, some olives on a tree, a tree, an orchard, an empty field. The Devil would stand around feeling awkward, hoping that it would turn out he’d come late. The kids would be up in their bedrooms, out of the beds, looking out the windows, remembering when they used to be older. Not that they ever got that much older. But the world is younger now. Things are simpler. Now the cheerleader has parents of her own, and all she has to do is wait for them to get home, and then this party can be over. Two days ago was the funeral. It was just how everyone said it would be. Then there were errands, people to talk to. She was busy. She hugged her aunt and uncle good-bye and moved into the house where she would live for the rest of her life. She unpacked all her boxes, and the Salvation Army brought her parents’ clothes and furniture and pots and pans, and other people, her parents’ friends, helped her hang her mother’s clothes in her mother’s closet. (Not this closet.) She bunched her mother’s clothes up in her hand and sniffed, curious and hungry and afraid. She suspects, remembering the smell of her mother’s monogrammed sweaters, that they’ll have fights about things. Boys, music, clothes. The cheerleader will learn to let all of these things go. If her kids were still around, they would say I told you so. What they did say was, Just wait until you have parents of your own. You’ll see. The cheerleader rubs her stomach. Are you in there? She moved the unfamiliar, worn-down furniture around so that it matched up old grooves in the floor. Here was the shape of someone’s buttocks, printed onto a seat cushion. Maybe it would be her father’s favorite chair. She looked through her father’s records. There was a record playing on the phonograph, it wasn’t anything she had ever heard before, and she took it off, laid it back in its empty white sleeve. She studied the death certificates. She tried to think what to tell her parents about their grandchildren, what they’d want to know. Her favorite song had just been on the radio for the very last time. Years and years ago, she’d danced to that song at her wedding. Now it was gone, except for the feeling she’d had when she listened to it. Sometimes she still felt that way, but there wasn’t a word for it anymore. Tonight, in a few hours, there will be a car wreck and then her parents will be coming home. By then, all her friends will have left, taking away six-packs and boyfriends and newly applied coats of hair spray and lipstick. She thinks she looks a bit like her mother. Before everyone showed up, while everything was still a wreck downstairs, before the police had arrived to say what they had to say, she was standing in her parents’ bathroom. She was looking in the mirror. She picked a lipstick out of the trash can, an orangey red that will be a favorite because there’s just a little half-moon left. But when she looked at herself in the mirror, it didn’t fit. It didn’t belong to her. She put her hand on her breastbone, pressed hard, felt her heart beating faster and faster. She couldn’t wear her mother’s lipstick while her mother lay on a gurney somewhere in a morgue: waiting to be sewn up; to have her clothes sewn back on; to breathe; to wake up; to see the car on the other side of the median, sliding away; to see her husband, the man that she’s going to marry someday; to come home to meet her daughter. The recently dead are always exhausted. There’s so much to absorb, so many things that need to be undone. They have their whole lives ahead of them. The cheerleader’s best friend winks at her. The Devil’s got a flashlight with two dead batteries. Somebody closes the door after them. Soon, very soon, already now, the batteries in the Devil’s flashlight are old and tired and there’s just a thin line of light under the closet door. It’s cramped in the closet and it smells like shoes, paint, wool, cigarettes, tennis rackets, ghosts of perfume and sweat. Outside the closet, the world is getting younger, but in here is where they keep all the old things. The cheerleader put them all in here last week. She’s felt queasy for most of her life. She’s a bad time traveler. She gets time-sick. It’s as if she’s always just a little bit pregnant, are you in there? and it’s worse in here, with all these old things that don’t belong to her, even worse because the Devil is always fooling around with time. The Devil feels right at home. He and the cheerleader make a nest of coats and sit down on them, facing each other. The Devil turns the bright, constant beam of the flashlight on the cheerleader. She’s wearing a little flippy skirt. Her knees are up, making a tent out of her skirt. The tent is full of shadows — so is the closet. The Devil conjures up another Devil, another cheerleader, mouse-sized, both of them, sitting under the cheerleader’s skirt. The closet is full of Devils and cheerleaders. “I just need to hold something,” the cheerleader says. If she holds something, maybe she won’t throw up. “Please,” the Devil says. “It tickles. I’m ticklish.” The cheerleader is leaning forward. She’s got the Devil by the tail. Then she’s touching the Devil’s tail with her pompoms. He quivers. “Please don’t,” he says. He giggles. The Devil’s tail is tucked up under his legs. It isn’t hot, but the Devil is sweating. He feels sad. He’s not good at being sad. He flicks the flashlight on and off. Here’s a knee. Here’s a mouth. Here’s a sleeve hanging down, all empty. Someone knocks on the closet door. “Go away,” the cheerleader says. “It hasn’t been five minutes yet. Not even.” The Devil can feel her smile at him, like they’re old friends. “Your tail. Can I touch it?” the cheerleader says. “Touch what?” the Devil says. He feels a little excited, a little nervous. Old enough to know better, brand-new enough, here in the closet, to be jumpy. He’s taking a chance here. Girls — women — aren’t really domestic animals at the moment, although they’re getting tamer, more used to living in houses. Less likely to bite. “Can I touch your tail now?” the cheerleader says. “No!” the Devil says. “I’m shy,” he says. “Maybe you could stroke my tail with your pompom, in a little bit.” “We could make out,” the cheerleader says. “That’s what we’re supposed to do, right? I need to be distracted because I think I’m about to have this thought. It’s going to make me really sad. I’m getting younger, you know? I’m going to keep on getting younger. It isn’t fair.” She puts her feet against the closet door. She kicks once, like a mule. She says, “I mean, you’re the Devil. You don’t have to worry about this stuff. In a few thousand years, you’ll be back at the beginning again and you’ll be in good with God again, right?” The Devil shrugs. Everybody knows the end of that story. The cheerleader says, “Everyone knows that old story. You’re famous. You’re like John Wilkes Booth. You’re historical — you’re going to be really important. You’ll be Mr. Bringer-of-Light and you’ll get good tables at all the trendy restaurants, choruses of angels and maître d’s, et cetera, la, la, la, they’ll all be singing hallelujahs forever, please pass the vichyssoise, and then God unmakes the world and he’ll put all the bits away in a closet like this.” The Devil smirks. He shrugs. It isn’t a bad life, hanging around in closets with cheerleaders. And it gets better. The cheerleader says, “It isn’t fair. I’d tell him so, if he were here. He’ll unhang the stars and pull Leviathan right back out of the deep end of the vasty bathwater, and you’ll be having Leviathan tartare for dinner. Where will I be, then? You’ll be around. You’re always around. But me, I’ll get younger and younger and in a handful of years I won’t be me at all, and my parents will get younger and so on and so on, whoosh! We’ll be gone like a flash of light, and you won’t even remember me. Nobody will remember me! Everything that I was, that I did, all the funny things that I said, and the things that my friends said back to me, that will all be gone. But you go all the way backwards. You go backwards and forwards. It isn’t fair. You could always remember me. What could I do so that you would remember me?” “As long as we’re in this closet,” the Devil says, he’s magnanimous, “I’ll remember you.” “But in a few minutes,” the cheerleader says, “we’ll go back out of the closet and the bottle will spin, and then the party will be over, and my parents will come home, and nobody will ever remember me.” “Then tell me a story,” the Devil says. He puts his sharp, furry paw on her leg. “Tell me a story so that I’ll remember you.” “What kind of story?” says the cheerleader. “Tell me a scary story,” the Devil says. “A funny, scary, sad, happy story. I want everything.” He can feel his tail wagging as he says this. “You can’t have everything,” the cheerleader says, and she picks up his paw and puts it back on the floor of the closet. “Not even in a story. You can’t have all the stories you want.” “I know,” the Devil says. He whines. “But I still want it. I want things. That’s my job. I even want the things that I already have. I want everything you have. I want the things that don’t exist. That’s why I’m the Devil.” He leers and it’s a shame because she can’t see him in the dark. He feels silly. “Well, what’s the scariest thing?” says the cheerleader. “You’re the expert, right? Give me a little help here.” “The scariest thing,” the Devil says. “Okay, I’ll give you two things. Three things. No, just two. The third one is a secret.” The Devil’s voice changes. Later on, one day the cheerleader will be listening to a preschool teacher say back the alphabet, with the sun moving across the window, nothing ever stays still, and she’ll be reminded of the Devil and the closet and the line of light under the door, the peaceful little circle of light the flashlight makes against the closet door. The Devil says, “I’m not complaining,” (but he is) “but here’s the way things used to work. They don’t work this way anymore. I don’t know if you remember. Your parents are dead and they’re coming home in just a few hours. Used to be, that was scary. Not anymore. But try to imagine: finding something that shouldn’t be there.” “Like what?” the cheerleader says. The Devil shrugs. “A child’s toy. A ball, or a night-light. Some cheap bit of trash, but it’s heavier than it looks, or else light. It shines with a greasy sort of light or else it eats light. When you touch it, it yields unpleasantly. You feel as if you might fall into it. You feel light-headed. It might be inscribed in a language which no one can decipher.” “Okay,” the cheerleader says. She seems somewhat cheered up. “So what’s the next thing?” The Devil shines the flashlight in her eyes, flicks it on and off. “Someone disappears. Gone, just like that. They’re standing behind you in a line at an amusement park — or they wander away during the intermission of a play — perhaps they go downstairs to get the mail — or to make tea — ” “That’s scary?” the cheerleader says. “Used to be,” the Devil says. “It used to be that the worst thing that could happen was, if you had kids, and one of them died or disappeared. Disappeared was the worst. Anything might have happened to them.” “Things are better now,” the cheerleader says. “Yes, well.” The Devil says, “Things just get better and better nowadays. But — try to remember how it was. The person who disappeared, only they didn’t. You’d see them from time to time, peeking in at you through windows, or down low through the mail slot in your front door. Keyholes. You might see them in the grocery store. Sitting in the backseat of your car, down low, slouching in your rearview mirror. They might pinch your leg or pull your hair when you’re asleep. When you talk on the phone, they listen in, you hear them listening. The cheerleader says, “Like, with my parents — ” “Exactly,” says the Devil. “You’ve had nightmares about them, right?” “Not really,” the cheerleader says. “Everyone says they were probably nice people. I mean, look at this house! But, sometimes, I have this dream that I’m at the mall, and I see my husband. And he’s just the same, he’s a grown-up, and he doesn’t recognize me. It turns out that I’m the only one who’s going backwards. And then he does recognize me and he wants to know what I’ve done with the kids.” The last time she’d seen her husband, he was trying to grow a beard. He couldn’t even do that right. He hadn’t had much to say, but they’d looked at each other for a long time. “What about your children?” the Devil says. “Do you wonder where they went when the doctor pushed them back up inside you? Do you have dreams about them?” “Yes,” the cheerleader says. “Everything gets smaller. I’m afraid of that.” “Think how men feel!” the Devil says. “It’s no wonder men are afraid of women. No wonder sex is so hard on them.” The cheerleader misses sex, that feeling afterwards, that blissful, unsatisfied itch. “The first time around, things were better,” the Devil says. “I don’t know if you remember. People died, and no one was sure what happened next. There were all sorts of possibilities. Now everyone knows everything. What’s the fun in that?” Someone is trying to push open the closet door, but the cheerleader puts her feet against it, leaning against the back of the closet. “Oh, I remember!” she says, “I remember when I was dead! There was so much I was looking forward to. I had no idea!” The Devil shivers. He’s never liked dead people much. “So, okay, what about monsters?” the cheerleader says. “Vampires? Serial killers? People from outer space? Those old movies?” The Devil shrugs. “Yeah, sure. Boogeymen. Formaldehyde babies in Mason jars. Someday someone is going to have to take them out of the jar, unpickle them. Women with teeth down there. Zombies. Killer robots, killer bees, serial killers, cold spots, werewolves. The dream where you know that you’re asleep but you can’t wake up. You can hear someone walking around the bedroom picking up your things and putting them down again and you still can’t wake up. The end of the world. Spiders. No one was with her when she died. Carnivorous plants.” “Oh goody,” the cheerleader says. Her eyes shine at him out of the dark. Her pompoms slide across the floor of the closet. He moves his flashlight so he can see her hands. “So here’s your story,” the cheerleader says. She’s a girl who can think on her feet. “It’s not really a scary story. I don’t really get scary.” “Weren’t you listening?” the Devil says. He taps the flashlight against his big front teeth. “Never mind, it’s okay, never mind. Go on.” “This probably isn’t a true story,” the cheerleader says, “and it doesn’t go backwards like we do. I probably won’t get all the way to the end, and I’m not going to start at the beginning, either. There isn’t enough time.” “That’s fine,” the Devil says. “I’m all ears.” (He is.) The cheerleader says, “So who’s going to tell this story, anyway? Be quiet and listen. We’re running out of time.” She says, “A man comes home from a sales conference. He and his wife have been separated for a while, but they’ve decided to try living together again. They’ve sold the house that they used to live in. Now they live just outside of town, in an old house in an orchard. The man comes home from this business conference, and his wife is sitting in the kitchen and she’s talking to another woman, an older woman. They’re sitting on the chairs that used to go around the kitchen table, but the table is gone. So is the microwave, and the rack where Susan’s copper-bottomed pots hang. The pots are gone, too. The husband doesn’t notice any of this. He’s busy looking at the other woman. Her skin has a greenish tinge. He has this feeling that he knows her. She and the wife both look at the husband, and he suddenly knows what it is. It’s his wife. It’s his wife, two of her, only one is maybe twenty years older. Otherwise, except that this one’s green, they’re identical: same eyes, same mouth, same little mole at the corner of her mouth. “How am I doing so far?” “So-so,” the Devil says. The truth (the truth makes the Devil itchy) is, he only likes stories about himself. Like the story about the Devil’s wedding cake. Now that’s a story. The cheerleader says, “It gets better.” It Gets Better The man’s name is Ed. It isn’t his real name. I made it up. Ed and Susan have been married for ten years, separated for five months, back together again for three months. They’ve been sleeping in the same bed for three months, but they don’t have sex. Susan cries whenever Ed kisses her. They don’t have any kids. Susan used to have a younger brother. Ed is thinking about getting a dog. While Ed’s been at his conference, Susan has been doing some housework. She’s done some work up in the attic which we won’t talk about. Not yet. Down in the spare bathroom in the basement, she’s set up this machine, which we get around to later, and this machine makes Susans. What Susan was hoping for was a machine that would bring back Andrew. (Her brother. But you knew that.) Only it turns out that getting Andrew back requires a different machine, a bigger machine. Susan needs help making that machine, and so the new Susans are going to come in handy after all. Over the course of the next few days, the Susans explain all this to Ed. Susan doesn’t expect Ed will be very helpful. “Hi, Ed,” the older, greenish Susan says. She gets up from her chair and gives him a big hug. Her skin is warm, tacky. She smells yeasty. The original Susan — the Susan Ed thinks is original, and I have no idea if he’s right about this, and, later on, he isn’t so sure, either — sits in her chair and watches them. Big green Susan: am I making her sound like Godzilla? She doesn’t look like Godzilla, and yet there’s something about her that reminds Ed of Godzilla, the way she stomps across the kitchen floor — leads Ed over to a chair and makes him sit down. Now he realizes that the kitchen table is gone. He still hasn’t managed to say a word. Susan, both of them, is used to this. “First of all,” Susan says, “the attic is off-limits. There are some people working up there. (I don’t mean Susans. I’ll explain Susans in a minute.) Some visitors. They’re helping me with a project. About the other Susans, there are five of me at the moment — you’ll meet the other three later. They’re down in the basement. You’re allowed in the basement. You can help down there, if you want.” Godzilla Susan says, “You don’t have to worry about who is who, although none of us are exactly alike. You can call us all Susan. We’re discovering that some of us may be more temporary than others, or fatter, or younger, or greener. It seems to depend on the batch.” “Are you Susan?” Ed says. He corrects himself. “I mean, are you my wife? The real Susan?” “We’re all your wife,” the younger Susan says. She puts her hand on his leg and pats him like a dog. “Where did the kitchen table go?” Ed says. “I put it in the attic,” Susan says. “You really don’t have to worry about that now. How was your conference?” Another Susan comes into the kitchen. She’s young and the color of green apples or new grass. Even the whites of her eyes are grassy. She’s maybe nineteen, and the color of her skin makes Ed think of a snake. “Ed!” she says, “How was the conference?” “They’re keen on the new game,” Ed says. “It tests real well.” “Want a beer?” Susan says. (It doesn’t matter which Susan says this.) She picks up a pitcher of green foamy stuff, and pours it into a glass. “This is beer?” Ed says. “It’s Susan beer,” Susan says, and all the Susans laugh. The beautiful, snake-colored nineteen-year-old Susan takes Ed on a tour of the house. Mostly Ed just looks at Susan, but he sees that the television is gone, and so are all of his games. All his notebooks. The living room sofa is still there, but all the seat cushions are missing. Later on, Susan will disassemble the sofa with an ax. Susan has covered up all the downstairs windows with what looks like sheets of aluminum foil. She shows him the bathtub downstairs where one of the Susans is brewing the Susan beer. Other Susans are hanging long, mossy clots of the Susan beer on laundry racks. Dry, these clots can be shaped into bedding, nests for the new Susans. They are also edible. Ed is still holding the glass of Susan beer. “Go on,” Susan says. “You like beer.” “I don’t like green beer,” Ed says. “You like Susan, though,” Susan says. She’s wearing one of his T‑shirts, and a pair of Susan’s underwear. No bra. She puts Ed’s hand on her breast. Susan stops stirring the beer. She’s taller than Ed, and only a little bit green. “You know Susan loves you,” she says. “Who’s up in the attic?” Ed says. “Is it Andrew?” His hand is still on Susan’s breast. He can feel her heart beating. Susan says, “You can’t tell Susan I told you. She doesn’t think you’re ready. It’s the aliens.” They both stare at him. “She finally got them on the phone. This is going to be huge, Ed. This is going to change the world.” *** Ed could leave the house. He could leave Susan. He could refuse to drink the beer. The Susan beer doesn’t make him drunk. It isn’t really beer. You knew that, right? There are Susans everywhere. Some of them want to talk to Ed about their marriage, or about the aliens, or sometimes they want to talk about Andrew. Some of them are busy working. The Susans are always dragging Ed off to empty rooms, to talk or kiss or make love or gossip about the other Susans. Or they’re ignoring him. There’s one very young Susan. She looks like she might be six or seven years old. She goes up and down the upstairs hallway, drawing on the walls with a marker. Ed isn’t sure whether this is childish vandalism or important Susan work. He feels awkward asking. Every once in a while, he thinks he sees the real Susan. He wishes he could sit down and talk with her, but she always looks so busy. By the end of the week, there aren’t any mirrors left in the house, and the windows are all covered up. The Susans have hung sheets of the Susan beer over all the light fixtures, so everything is green. Ed isn’t sure, but he thinks he might be turning green. Susan tastes green. She always does. Once Ed hears someone knocking on the front door. “Ignore that,” Susan says as she walks past him. She’s carrying the stacked blades of an old ceiling fan, and a string of Christmas lights. “It isn’t important.” Ed pulls the plug of aluminum foil out of the eyehole, and peeks out. Stan is standing there, looking patient. They stand there, Ed on one side of the door, and Stan on the other. Ed doesn’t open the door, and eventually Stan goes away. All the peacocks are kicking up a fuss. Ed tries teaching some of the Susans to play poker. It doesn’t work so well, because it turns out that Susan always knows what cards the other Susans are holding. So Ed makes up a game where that doesn’t matter so much, but in the end, it makes him feel too lonely. There aren’t any other Eds. They decide to play spin the bottle instead. Instead of a bottle, they use a hammer, and it never ends up pointing at Ed. After a while, it gets too strange watching Susan kiss Susans, and he wanders off to look for a Susan who will kiss him. Up in the second-story bedroom, there are always lots of Susans. This is where they go to wait when they start to get ripe. The Susans loll, curled in their nests, getting riper, arguing about the end of some old story. None of them remember it the same way. Some of them don’t seem to know anything about it, but they all have opinions. Ed climbs into a nest and leans back. Susan swings her legs over to make room for him. This Susan is small and round. She tickles the soft part of his arm, and then tucks her face into his side. Susan passes him a glass of Susan beer. “That’s not it,” Susan says, “It turns out that he overdosed. Maybe even did it on purpose. We couldn’t talk about it. There weren’t enough of us. We were trying to carry all that sadness all by ourself. You can’t do something like that! And then the wife tries to kill him. I tried to kill him. She kicks the fuck out of him. He can’t leave the house for a week, won’t even come to the door when his friends come over.” “If you can call them friends,” Susan says. “No, there was a gun,” Susan says. “And she has an affair. Because she can’t get over it. Neither of them can.” “She humiliates him at a dinner party,” Susan says. “They both drink too much. Everybody goes home, and she breaks all the dishes instead of washing them. There are plate shards all over the kitchen floor. Someone’s going to get hurt; they don’t have a time machine. They can’t go back and unbreak those plates. We know that they still loved each other, but that doesn’t matter anymore. Then the police showed up.” “Well, that’s not the way I remember it,” Susan says. “But I guess it could have happened that way.” Ed and Susan used to buy books all the time. They had so many books they used to joke about wanting to be quarantined, or snowed in. Maybe then they’d manage to read all the books. But the books have all gone up to the attic, along with the lamps and the coffee tables, and their bicycles, and all Susan’s paintings. Ed has watched the Susans carry up paperback books, silverware, old board games, and holey underwear. Even a kazoo. The Encyclopædia Britannica. The goldfish and the goldfish bowl and the little canister of goldfish food. The Susans have gone through the house, taken everything they could. After all the books were gone, they dismantled the bookshelves. Now they’re tearing off the wallpaper in long strips. The aliens seem to like books. They like everything, especially Susan. Eventually when the Susans are ripe, they go up in the attic too. The aliens swap things, the books and the Susans and the coffee mugs for other things: machines that the Susans are assembling. Ed would like to get his hand on one of those devices, but Susan says no. He isn’t even allowed to help, except with the Susan beer. The thing the Susans are building takes up most of the living room, Ed’s office, the kitchen, the laundry room— The Susans don’t bother with laundry. The washer and the dryer are both gone and the Susans have given up wearing clothes altogether. Ed has managed to keep a pair of shorts and a pair of jeans. He’s wearing the shorts right now, and he folds the jeans up into a pillow, and rests his head on top of them so that Susan can’t steal them. All his other clothes have been carried up to the attic —and it’s creeping up the stairs, spilling over into the second story. The house is shiny with alien machines. Teams of naked Susans are hard at work, all day long, testing instruments, hammering and stitching their machine together, polishing and dusting and stacking alien things on top of each other. If you’re wondering what the machine looks like, picture a science fair project involving a lot of aluminum foil, improvised, homely, makeshift, and just a little dangerous-looking. None of the Susans is quite sure what the machine will eventually do. Right now it grows Susan beer. When the beer is stirred, left alone, stirred some more, it clots and makes more Susans. Ed likes watching this part. The house is more and more full of shy, loud, quiet, talkative, angry, happy, greenish Susans of all sizes, all ages, who work at disassembling the house, piece by piece, and, piece by piece, assembling the machine. It might be a time machine, or a machine to raise the dead, or maybe the house is becoming a spaceship, slowly, one room at a time. Susan says the aliens don’t make these kinds of distinctions. It may be an invasion factory, Ed says, or a doomsday machine. Susan says that they aren’t that kind of aliens. Ed’s job: stirring the Susan beer with a long, flat plank — a floorboard Susan pried up — and skimming the foam, which has a stringy and unpleasantly cheeselike consistency, into buckets. He carries the buckets downstairs and makes Susan beer soufflé and Susan beer casserole. Susan beer surprise. Upside-down Susan cake. It all tastes the same, and he grows to like the taste. The beer doesn’t make him drunk. That isn’t what it’s for. I can’t tell you what it’s for. But when he’s drinking it, he isn’t sad. He has the beer, and the work in the kitchen, and the ripe, green fuckery. Everything tastes like Susan. The only thing he misses is poker nights. Up in the spare bedroom, Ed falls asleep listening to the Susans talk, and when he wakes up, his jeans are gone, and he’s naked. The room is empty. All the ripe Susans have gone up to the attic. When he steps out into the hall, the little Susan is out there, drawing on the walls. She puts her marker down and hands him a pitcher of Susan beer. She pinches his leg and says, “You’re getting nice and ripe.” Then she winks at Ed and runs down the hall. He looks at what she’s been drawing: Andrew, scribbly crayon portraits of Andrew, all up and down the walls. He follows the pictures of Andrew down the hall, all the way to the master bedroom where he and the original Susan used to sleep. Now he sleeps anywhere, with any Susan. He hasn’t been in their room in a while, although he’s noticed the Susans going in and out with boxes full of things. The Susans are always shooing at him when he gets in their way. The bedroom is full of Andrew. There are Susan’s portraits of Andrew on the walls, the ones from her art class. Ed had forgotten how unpleasant and peculiar these paintings are. In one, the largest one, Andrew, life-sized, has his hands around a small animal, maybe a ferret. He seems to be strangling it. The ferret’s mouth is cocked open, showing all its teeth. A picture like that, Ed thinks, you ought to turn it towards the wall at night. Susan’s put Andrew’s bed in here, and Andrew’s books, and Andrew’s desk. Andrew’s clothes have been hung up in the closet. There isn’t an alien machine in the room, or for that matter, anything that ever belonged to Ed. Ed puts a pair of Andrew’s pants on, and lies down on Andrew’s bed, just for a minute, and he closes his eyes. When he wakes up, Susan is sitting on the bed. He can smell her, that ripe green scent. He can smell that smell on himself. Susan says, “If you’re ready, I thought we could go up to the attic together.” “What’s going on here?” Ed says. “I thought you needed everything. Shouldn’t all this stuff go up to the attic?” “This is Andrew’s room, for when he comes back,” Susan says. “We thought it would make him feel comfortable, having his own bed to sleep in. He might need his stuff.” “What if the aliens need his stuff?” Ed says. “What if they can’t make you a new Andrew yet because they don’t know enough about him?” “That’s not how it works,” Susan says. “We’re getting close now. Can’t you feel it?” “I feel weird,” Ed says. “Something’s happening to me.” “You’re ripe, Ed,” Susan says. “Isn’t that fantastic? We weren’t sure you’d ever get ripe enough.” She takes his hand and pulls him up. Sometimes he forgets how strong she is. “So what happens now?” Ed says. “Am I going to die? I don’t feel sick. I feel good. What happens when we get ripe?” The afternoon light makes Susan look older, or maybe she just is older. He likes this part: seeing what Susan looked like as a kid, what she’ll look like as an old lady. It’s as if they got to spend their whole lives together. “I never know,” she says. “Let’s go find out. Take off Andrew’s pants, and I’ll hang them back up in the closet.” They leave the bedroom and walk down the hall. The Andrew drawings, the knobs and dials and stacked, shiny machinery watch them go. There aren’t any other Susans around at the moment. They’re all busy downstairs. He can hear them hammering away. For a minute, it’s the way it used to be, only better. Just Ed and Susan in their own house. Ed holds on tight to Susan’s hand. When Susan opens the attic door, the attic is full of stars. Stars and stars and stars. Ed has never seen so many stars. Susan has taken the roof off. Off in the distance, they can smell the apple trees, way down in the orchard. Susan sits down cross-legged on the floor and Ed sits down beside her. She says, “I wish you’d tell me a story.” Ed says, “What kind of story?” Susan says, “A bedtime story? When Andrew was a kid, we used to read this book. I remember this one story about people who go under a hill. They spend one night down there, eating and drinking and dancing, but when they come out, a hundred years have gone by. Do you know how long it’s been since Andrew died? I’ve lost track.” “I don’t know stories like that,” Ed says. He picks at his flaky green skin and wonders what he tastes like. “What do you think the aliens look like? Do you think they look like giraffes? Like marbles? Like Andrew? Do you think they have mouths?” “Don’t be silly,” Susan says. “They look like us.” “How do you know?” Ed says. “Have you been up here before?” “No,” Susan says. “But Susan has.” “We could play a card game,” Ed says. “Or I Spy.” “You could tell me about the first time I met you,” Susan says. “I don’t want to talk about that,” Ed says. “That’s all gone.” “Okay, fine.” Susan sits up straight, arches her back, runs her green tongue across her green lips. She winks at Ed and says, “Tell me how beautiful I am.” “You’re beautiful,” Ed says. “I’ve always thought you were beautiful. All of you. How about me? Am I beautiful?” “Don’t be that way,” Susan says. She slouches back against him. Her skin is warm and greasy. “The aliens are going to get here soon. I don’t know what happens after that, but I hate this part. I always hate this part. I don’t like waiting. Do you think this is what it was like for Andrew, when he was in rehab?” “When you get him back, ask him. Why ask me?” Susan doesn’t say anything for a bit. Then she says, “We think we’ll be able to make you, too. We’re starting to figure out how it works. Eventually it will be you and me and him, just the way it was before. Only we’ll fix him the way we’ve fixed me. He won’t be so sad. Have you noticed how I’m not sad anymore? Don’t you want that, not to be sad? And maybe after that we’ll try making some more people. We’ll start all over again. We’ll do everything right this time.” Ed says, “So why are they helping you?” “I don’t know,” Susan says. “Either they think we’re funny, or else they think we’re pathetic, the way we get stuck. We can ask them when they get here.” She stands up, stretches, yawns, sits back down on Ed’s lap, reaches down, stuffs his penis, half-erect, inside of her. Just like that. Ed groans. He says, “Susan.” Susan says, “Tell me a story.” She squirms. “Any story. I don’t care what.” “I can’t tell you a story,” Ed says. “I don’t know any stories when you’re doing this.” “I’ll stop,” Susan says. She stops. Ed says, “Don’t stop. Okay.” He puts his hands around her waist and moves her, as if he’s stirring the Susan beer. He says, “Once upon a time.” He’s speaking very fast. They’re running out of time. Once, while they were making love, Andrew came into the bedroom. He didn’t even knock. He didn’t seem to be embarrassed at all. Ed doesn’t want to be fucking Susan when the aliens show up. On the other hand, Ed wants to be fucking Susan forever. He doesn’t want to stop, not for Andrew, or the aliens, or even for the end of the world. Ed says, “There was a man and a woman and they fell in love. They were both nice people. They made a good couple. Everyone liked them. This story is about the woman.” This story is about a woman who is in love with somebody who invents a time machine. He’s planning to go so far into the future that he’ll end up right back at the very beginning. He asks her to come along, but she doesn’t want to go. What’s back at the beginning of the world? Little blobs of life swimming around in a big blob? Adam and Eve in the Garden of Eden? She doesn’t want to play Adam and Eve; she has other things to do. She works for a research company. She calls people on the telephone and asks them all sorts of questions. Back at the beginning, there aren’t going to be phones. She doesn’t like the sound of it. So her husband says, Fine, then here’s what we’ll do. I’ll build you another machine, and if you ever decide that you miss me, or you’re tired and you can’t go on, climb inside this machine — this box right here — and push this button and go to sleep. And you’ll sleep all the way forwards and backwards to me, where I’m waiting for you. I’ll keep on waiting for you. I love you. And so they make love and they make love a few more times and then he climbs into his time machine and whoosh, he’s gone like that. So fast, it’s hard to believe that he was ever there at all. Meanwhile she lives her life forward, slow, the way he didn’t want to. She gets married again and makes love some more and has kids and they have kids and when she’s an old woman, she’s finally ready: she climbs into the dusty box down in the secret room under the orchard and she pushes the button and falls asleep. And she sleeps all the way back, just like Sleeping Beauty, down in the orchard for years and years, which fly by like seconds, she goes flying back, past the men sitting around the green felt table, now you can see them and now they’re gone again, and all the peacocks are screaming, and the Satanist drives up to the house and unloads the truckload of furniture, he unpaints the pentagrams, soon the old shy man will unbuild his house, carry his secret away on his back, and the apples are back on the orchard trees again, and then the trees are all blooming, and now the woman is getting younger, just a little, the lines around her mouth are smoothing out. She dreams that someone has come down into that underground room and is looking down at her in her time machine. He stands there for a long time. She can’t open her eyes, her eyelids are so heavy, she doesn’t want to wake up just yet. She dreams she’s on a train going down the tracks backwards and behind the train, someone is picking up the beams and the nails and the girders to put in a box and then they’ll put the box away. The trees are whizzing past, getting smaller and smaller and then they’re all gone too. Now she’s a kid again, now she’s a baby, now she’s much smaller and then she’s even smaller than that. She gets her gills back. She doesn’t want to wake up just yet, she wants to get right back to the very beginning where it’s all new and clean and everything is still and green and flat and sleepy and everybody has crawled back into the sea and they’re waiting for her to get back there too and then the party can start. She goes backwards and backwards and backwards and backwards and backwards and backwards and backwards and backwards and backwards and backwards and backwards— The cheerleader says to the Devil, “We’re out of time. We’re holding things up. Don’t you hear them banging on the door?” The Devil says, “You didn’t finish the story.” The cheerleader says, “And you never let me touch your tail. Besides, there isn’t any ending. I could make up something, but it wouldn’t ever satisfy you. You said that yourself! You’re never satisfied. And I have to get on with my life. My parents are going to be home soon.” She stands up and slips out of the closet and slams the door shut again, so fast the Devil can hardly believe it. A key turns in a lock. The Devil tries the doorknob, and someone standing outside the closet giggles. “Shush,” says the cheerleader. “Be quiet.” “What’s going on?” the Devil says. “Open the door and let me out — this isn’t funny.” “Okay, I’ll let you out,” the cheerleader says. “Eventually. Not just yet. You have to give me something first.” “You want me to give you something?” the Devil says. “Okay, what?” He rattles the knob, testing. “I want a happy beginning,” the cheerleader says. “I want my friends to be happy too. I want to get along with my parents. I want a happy childhood. I want things to get better. I want them to keep getting better. I want you to be nice to me. I want to be famous, I don’t know, maybe I could be a child actor, or win state-level spelling bees, or even just cheer for winning teams. I want world peace. Second chances. When I’m winning at poker, I don’t want to have to put all that money back in the pot, I don’t want to have to put my good cards back on top of the deck, one by one by— Starlight says, “Sorry about that. My voice is getting scratchy. It’s late. You should call back tomorrow night.” Ed says, “When can I call you?” Stan and Andrew were friends. Good friends. It was like they were the same species. Ed hadn’t seen Stan for a while, not for a long while, but Stan stopped him, on the way down to the basement. This was earlier. Stan grabbed his arm and said, “I miss him. I keep thinking, if I’d gotten there sooner. If I’d said something. He liked you a lot, you know, he was sorry about what happened to your car — ” Stan stops talking and just stands there looking at Ed. He looks like he’s about to cry. “It’s not your fault,” Ed said, but then he wondered why he’d said it. Whose fault was it? *** Susan says, “You’ve got to stop calling me, Ed. Okay? It’s three in the morning. I was asleep, Ed, I was having the best dream. You’re always waking me up in the middle of things. Please just stop, okay?” Ed doesn’t say anything. He could stay there all night and just listen to Susan talk. What she’s saying now is, “But that’s never going to happen, and you know it. Something bad happened, and it wasn’t anyone’s fault, but we’re just never going to get past it. It killed us. We can’t even talk about it.” Ed says, “I love you.” Susan says, “I love you, but it’s not about love, Ed, it’s about timing. It’s too late, and it’s always going to be too late. Maybe if we could go back and do everything differently — and I think about that all the time — but we can’t. We don’t know anybody with a time machine. How about this, Ed — maybe you and your poker buddies can build one down in Pete’s basement. All those stupid games, Ed! Why can’t you build a time machine instead? Call me back when you’ve figured out how we can work this out, because I’m really stuck. Or don’t call me back. Good-bye, Ed. Go get some sleep. I’m hanging up the phone now.” Susan hangs up the phone. Ed imagines her, going down to the kitchen to microwave a glass of milk. She’ll sit in the kitchen and drink her milk and wait for him to call her back. He lies in bed, up in the orchard house. He’s got both bedroom doors open, and a night breeze comes in through that door that doesn’t go anywhere. He wishes he could get Susan to come see that door. The breeze smells like apples, which is what time must smell like, Ed thinks. There’s an alarm clock on the floor beside his bed. The hands and numbers glow green in the dark, and he’ll wait five minutes and then he’ll call Susan. Five minutes. Then he’ll call her back. The hands aren’t moving, but he can wait.

I remember in seminary Dr. Frank Minirth covering my class on pastoral counseling. He was an internationally know Christian psychiatrist who had a successful ministry in healthcare and had published dozens of books including Happiness is a Choice. I was excited about the subject. I don’t remember whether it was instigated by a question or if it was the topic of the day, but the subject of demonology was our focus. Specifically, the question of whether in our pastoral care of those suffering from mental illness could be considered the victim of demonic possession or oppression. Whether we like to admit it or not, this is an intensely difficult subject to navigate intellectually. What I mean is that with all the advancements in medicine and science it has become harder and harder to find any practical place for the supernatural, especially for demons. In fact, even mentioning “the demonic” or the possibility of demon “possession” can bring a red face even to the most conservative Christian. After all, we are intellectuals now. We rub shoulders with all those in the modern world of rationality. And while many aspects of spirituality may be making a comeback, demonology is still out of bounds. Any mention of the possibility that a person’s depression, anger, or suicidal thoughts may be demonically influenced will be immediately vetoed by looks similar to those of someone after you suggest that they discipline their children by locking them in a closet. Not only is it outdated and archaic, its just wrong . . . damn wrong! And you should be locked up for mentioning it. This is kind of the way it felt in class that day; in seminary class that day.; in Dallas Theological Seminary class that day. How could the topic of demons have come up? After all, this was Dr. Frank Minirth, the psychiatrist who is renowned and respected around the world, by believers and unbelievers alike. What did he have to say about demonic possession? Well, the subject came up and here is how it went down: (Dr. Minirth placing a CAT scan of a patient on the overhead, showing the parts of the brain that change when he was depressed) Dr. Minirth: “The very chemistry of our brain changes when we experience depression.” Student: “Dr. Minirth, do you think we could attribute any of this to demonic influence?” Dr. Minirth: “Only if we grant that demons are scared of Zoloft!” The entire class broke out in laughter, including me. Why? Well . . . because it was funny. With this laughter we demonstrated both relief (that we did not have to consider demonology when exploring mental illness) and our ability to advance with science. Our Lack of Expertise We have moved well beyond the Frank Peretti school of fiction. We have seen the hurt and abuses of well-meaning Christians as they find a devil around every corner. I suppose it is often the easy way out. Whenever someone is suffering from a mental illness, just blame it on the devil. The only tradition in the Protestant community that is even willing to touch Satan and demons are those wild-eyed fanatics. To them, everything is demonic. We take the long way around them. Concerning demon possession (or, better, “demonization”), we don’t really know what to do. There is not much in Scripture about how to deal with demons. We saw how Jesus did it. We see how the Apostles tried to do it. We see Jesus rebuking the disciples for not being able to do it. The only instruction that Jesus gives them for future reference is to pray: “These kind can be cast out only by prayer” (Mark 9:14-29). Wait . . . what “kind”? Is there a “kind” that can be cast out easier? If so, what do we do then? Do we follow your example or just wing it? Catholic Exorcisms At least the Catholic Church gives it the ol’ college try. They have a full program and are ramping up on training priests how to perform exorcisms. Here is what they say to a demon during one these exorcisms: I command you, unclean spirit, whoever you are, along with all your minions now attacking this servant of God, by the mysteries of the incarnation, passion, resurrection, and ascension of our Lord Jesus Christ, by the descent of the Holy Spirit, by the coming of our Lord for judgment, that you tell me by some sign your name, and the day and hour of your departure. I command you, moreover, to obey me to the letter, I who am a minister of God despite my unworthiness; nor shall you be emboldened to harm in any way this creature of God, or the bystanders, or any of their possessions. https://www.catholic.org/prayers/prayer.php?p=683 While there is nothing about Zoloft or any other specific medications, they only perform this ritual when “all other causes have been ruled out.” The Day I Failed at an Exorcism I remember when my sister was suffering from severe depression. After multiple attempts at suicide, trying every drug on the market (including Zoloft!), and 17 electric shock therapies, she told me she thought she had a demon. What does that even mean? I had no idea. I knew I believed in Satan and demons, but they had been largely ignored both in my education and practice. However, here my sister was asking her pastor/brother to cast the demon out. I searched Scripture in hopes that there was something I missed. I had no idea what to do. I had seen how they did it in Hollywood (long drawn out exorcisms), but nothing really substantial in the Bible (just short and to the point). So I decided to give it a whirl. I prayed beforehand expressing my ignorance and helplessness to the Lord, then I moved forward with my methodology. I placed my hand on her head (why? I don’t know . . . it just seemed right) and said: “I command you in the name of Jesus to come out.” Angie (my sister) had her eyes closed. I think she expected me to produce more, but I had nothing. That was it. She opened her eyes and looked at me. I could tell there was no change. So I placed my hand on her head and said the same thing more fervently, emphasizing the name “Jesus”, “If there is a demon here I command you in the name of Jesus to come out.” I almost asked it it’s name like Jesus did, but I would not have known what to do if it told me. “Hi, my name is Michael. Nice to meet you”? After nothing happened, I told her I was sorry. I just figured that I did my best and the Lord was in control. Unfortunately, Angie did kill herself a few months later. Characteristics of Demon Possession What does a demonized person look like? Who can be demonized? And for goodness sakes, why do demons want to take up residence in a person (or pigs)? As I look through Scripture, I find this subject to be extremely unclear. Angels, demons, and Satan are largely a mystery. And any time there is a lack of revelation on a subject, we are notorious for filling in those gaps with our own speculation turned dogma. I think it is best to leave some of this stuff a mystery, with a few exceptions. It does seem that people who “have a demon” are not well mentally. They are self-destructive and often suicidal. The little boy who had a demon was continually thrown into a fire. Presumingly, the demon was trying to kill him or have him kill himself (Mark 9:21-22). The seems self-defeating to me, but, I guess, to each his own. The demoniac in Mark 5:1-20 was extremely strong. He isolated himself and spent night and day hurting himself (Mark 5:5). Clearly, his mind was not well. Again, this stuff looked a lot like mental illness. Should We Move Beyond Demons and Demonology? I don’t mean to be flippant with this subject. It is a very serious thing. After all, when Jesus taught the disciples (and us) to pray, the model prayer only has only six requests and one of them deals directly with our current subject (Matt. 6:9-13): That his name would be holy That his kingdom would come That his will would be done That he would give us our daily provisions That he would forgive out sins That he would protect us from Satan (the evil one) Let’s be honest: How often do we in the Evangelical church pray for protection from Satan? I mean really pray for it. Is it part of your daily prayer? If I am honest, I often forget. Obviously, if Christ only had six things for us to pray about, each one is not just a suggestion. Far from moving beyond this subject, we should take it much more seriously. The Evangelical church needs a more robust and thoughtful demonology. I am not sure what that looks like, but I have some ideas below. We have to start somewhere. So . . . Are Demons Afraid of Zololf? Is it demons or chemical imbalances? Is it exorcism or Zoloft? Is it a spiritual battle or a physical one? I think the first mistake we make here is dichotomizing these things. I don’t think it is an either/or, but, more often than not, a both/and. Are demons afraid of Zoloft? Maybe so. Seriously . . . Let me explain. What we are asking here is Can we affect demonic activity with more natural means? Again, I think so. Let me give you an example from 1 Sam. 16: 14 Now the Spirit of the Lord had departed from Saul, and an evil spirit from the Lord tormented him. 15 Saul’s attendants said to him, “See, an evil spirit from God is tormenting you. 16 Let our lord command his servants here to search for someone who can play the lyre. He will play when the evil spirit from God comes on you, and you will feel better.” 21 David came to Saul and entered his service. Saul liked him very much, and David became one of his armor-bearers. 22 Then Saul sent word to Jesse, saying, “Allow David to remain in my service, for I am pleased with him.” 23 Whenever the spirit from God came on Saul, David would take up his lyre and play. Then relief would come to Saul; he would feel better, and the evil spirit would leave him. 1 Sam. 16:14-16; 21-23 Now, aside from dealing with the problem that this evil spirit was from the Lord, notice how Saul deals with his “torment”. Maybe he should have prayed, fasted, or had Samuel come and cast out the spirit. I don’t even know if he knew it was an evil spirit causing his anxiety, depression, or terror (I suspect he did not). But we get a view of the situation that speaks directly to our current issue. We see that it was an evil spirit. We see that David came and played music. And we see that it was the music that drove the demon away! Think about the implication and the principle that we can draw from this. Demons are affected by natural remedies. Was it that the demon hated the music? Was it that the evil spirit hated David, a man of God, playing the music? Or was it Christian music that David played (let’s hope it wasn’t!). I don’t think any of these are true. I believe it was how the music positively affected Saul that drove the demon away. If this is right (and I have no reason to think it is not), then this opens the door for all manner of natural means affecting the presence, possession, or influence of a demon. Think of how many things fit this category: Laughter Beauty Exercise Medication Surgery Healthy foods Vacations Antibiotics Reading a good novel Sleep Getting out of the house Going for a drive with the top down (my favorite way to drive demons away!) Zoloft Are there times when a different type of spiritual intervention may be necessary? Maybe so. I just don’t know what that looks like right now. However, again, I don’t think we can or should separate the two so sharply. I know our battle is not against flesh and blood. But that simply means our enemy is a spiritual enemy. It does not say we cannot fight spiritual battles—particularly of demonic origin—with music or other natural means. When we have chemical imbalances in our brain, is it demonic? Maybe so. I am sure they work in and with physical infirmities? (Matt.9:33; Luke 13:11; Matt.12:22). But I don’t think we have to determine whether it is the chicken or the egg causing the problem. I think we see that God has created the world in such a way that even music can sometimes drive a demon away and affect the chemicals in our brain.

International Group, Inc The International Group, Inc. (IGI) is a Canadian corporation specializing in wax technology and product development and in the manufacturing of petroleum wax and specialty wax blends. It is a privately held company and currently maintains operations in both the United States and Canada. Industries served by IGI include the corrugated box, flexible packaging, candles, tire and rubber products, adhesives, personal care, oil field production, and others. History The organization was founded in 1943 by William Reucassel as International Waxes, Ltd. and was incorporated in 1945, in Toronto, Ontario. Dr. David Aziz, a young engineer at the time, was brought on board shortly thereafter to develop technical aspects of the refinery. William Reucassel died in 1955 and in 1966 his son Ross became president. Ross Reucassel is the current Chairman and CEO for International Waxes. During the 1970s and 1980s International Waxes, Ltd. acquired several US-based blending and sales operations. The acquisitions resulted in International Waxes, Ltd. becoming the International Group, Inc. to encompass the full range of operations. The 1990s saw the addition of Ross's son, Ken, to the Organization. Ken Reucassel is now the President and COO of IGI. In 2003 IGI acquired the BP Global Special Product US wax business. The sale included BP’s wax operations throughout North and Central America. Under the terms of the sale, IGI acquired wax formulation data, local trademarks, supplier and customer information, manufacturing knowledge, and inventory. In 2005 IGI acquired the US-based industrial wax business from Honeywell Specialty Materials. This sale included not only product and customer data but refining and blending facilities as well. The acquisition increased IGI's total refining capacity and strengthened positions in such areas as candles and tire and rubber industries. At that time, the BP and Honeywell transactions caused some concern among large purchasers of wax-based products. Previously, companies such as Shell, Amoco, Conoco, and Chevron had already exited the wax business. The additional consolidation of the wax business by IGI meant a less diverse choice of domestic wax suppliers. This trend has continued. Production locations IGI currently operates four refineries, one in Toronto and the other two in Farmers Valley, Pennsylvania, Woods Cross, Utah, and Evanston, Wyoming. Four blending plants exist as well: Baytown, Texas, Oshkosh, Wisconsin, Titusville, Pennsylvania, and Toronto. Wax supply Most petroleum waxes are derived from the by-products of lubricant oils. Specifically, Group I motor oils result in a waxy distillate formed during the separation and refining of crude oils. This by-product will typically have a 5-20% oil content. IGI maintains "de-oiling" refining facilities that are able to remove the oil and be left with a finished wax product. Trends in industries such as automotive have put increased demand on lubrication oils and thus a trend towards using Group II and III has been seen in recent years. These types of oils do not contain a waxy by-product and also are not as crude oil dependent as Group I oils. This has resulted in an overall decrease in the diversity of North American feedstocks suitable for the manufacture of petroleum waxes. IGI and its competitors have compensated by attempting to diversify its supply base, including the use of completely refined wax feed stocks from international sources such as China. Typically, these supply challenges have been discussed by the National Petroleum Refiners Association. External links IGI website Category:Manufacturing companies established in 1943 Category:Manufacturing companies of Canada Category:1943 establishments in Ontario

Laser warning receivers and high data rate optical communication systems require local oscillators which can rapidly track the frequency of received radiation. Situations occur where significant uncertainty exists regarding the optical carrier frequency of the anticipated signal. Such uncertainty can result from doppler shifts in the radiation transmitted from satellites, missiles, etc., or in the case of uncooperative transmitters, transmitters tuned to differing operating frequencies. A common approach to tracking the frequency of received radiation employs a phase-locked-loop. Recent optical implementations of this widely used electronic concept, such as A. Scholtz, W. Leeb, R. Flatscher, and H. Philips, "Realization of a 10.mu.m Homodyne Receiver," Journal of Lightwave Tech., Vol. LT-5, No. 4, Apr. 1987 and S. Lowney and D. Marquis., "Frequency Acquisition and Tracking for Optical Heterodyne Communication Systems," Journal of Lightwave Tech., Vol. LT-5, No. 4, Apr. 1987., exploit an optical voltage controlled oscillator (OVCO), to provide frequency tunable laser output in a feedback control loop with various kinds of rf frequency discrimination to compare the OVCO frequency with that of the received radiation. These implementations achieve frequency lock in times on the order of hundreds of microseconds. The presently disclosed approach can acquire frequency lock at least two orders of magnitude faster with a reduced amount of hardware.

Q: How do I call up the "last command" in eclipse osgi console? How do I call up the "last command" in eclipse osgi console? Is there a similar behavior as in Windows Explorer of using the up/down arrows to recall last executed commands? A: Both the initial incubator project and the OSGi console tutorial mention that: The history is a buffer, which saves each command line when a new line character is read, just before passing it to the shell input stream. With the up and down arrow the user can navigate through the history. Via -console 5555 you can open a port to which you can telnet. If you telnet to the OSGi console the new console included in Eclipse 4.2 support tab completion and a history of the commands.

In the construction and operation of greenhouses, it is often necessary at times to provide a completely glazed roof for maximum solar heating and maximum growing conditions. At other times, however, it is desirable to open the interior of the greenhouse to either direct sunlight or natural weather conditions. In the past, roof frames have been provided with glazed roof vents which move away from the frames to allow the flow of air through the greenhouse when desirable. In other words, the greenhouse has been provided with a rigid non-removable framework to which the vents were hingedly attached. Although these greenhouses have been provided with sawtooth construction and served their purpose after a fashion, there was a considerable problem in some climates with snow loading. Furthermore, they did not readily drain from the valleys between the peaks. In addition, they were subject to damage and the replacement of damaged or broken panels was a difficult and expensive matter. Furthermore, the greenhouses have been basically expensive in their initial construction. These and other difficulties experienced with the prior art devices have been obviated in a novel manner by the present invention. It is, therefore, an outstanding object of the invention to provide a greenhouse construction which permits multi-functional operation. Another object of this invention is the provision of a construction for a greenhouse roof in which glazed panels can be hinged to open position or can be entirely removed. A further object of the present invention is the provision of greenhouse roof construction which is capable of extensive snow loading without damage and which drains very well. It is another object of the instant invention to provide a greenhouse roof which is simple in construction, which is inexpensive to manufacture and maintain, and which is capable of a long life of useful service with a minimum of maintenance. A still further object of the invention is the provision of a construction for a greenhouse roof and the like, wherein the glazed area is maximized and the benefits of solar heating are obtained in addition to heating experiences by conventional heating sources. It is a further object of the invention to provide a clear span greenhouse construction which is light in weight and which provides a maximum length of bridging without the use of intervening permanent beams and supports. A further object of the invention is the provision of a greenhouse in which, because of the rectangular side wall construction and the rectangular base plan, the side walls can be as high as needed to make it accessible to motorized equipment or to adapt it to any intended use. With these and other objects in view, as will be apparent to those skilled in the art, the invention resides in the combination of parts set forth in the specification and covered by the claims appended hereto.

In recreational pools, such as swimming pools, spas or whirlpools, it is typical to use a pool cleaning apparatus that employs a skimmer. The skimmer housing is mounted to an outside surface of the sidewall of the pool and includes a filter means for cleaning the water within the pool after it is drawn through the skimmer. A faceplate is mounted to the inside surface of the pool and has a generally large opening that is sealed with respect to the inside surface of the pool wall and is generally located at the surface water level. The skimmer includes means for creating a vacuum within the housing so that the surface water continuously flows from the pool surface into the housing and then through the pool filtering equipment and then back into the pool by means of another opening or outlet port generally located below the surface level of the water. The skimmer housing assembly is mounted behind the pool wall and the faceplate is fastened to the opposite surface of the pool wall, such as by screws that pass through the faceplate and the pool wall, and is threaded into the skimmer housing assembly. A gasket may be positioned between the faceplate and the pool wall for an additional watertight seal. In this manner, a seal is provided between the faceplate, the pool wall, and the skimmer housing. During initial construction of the skimmer assembly, it is not uncommon for the screws that mount the faceplate to the pool to become loose a short time after initial installation. Periodically, the owner of the pool must retighten these fasteners in order to maintain the seal and to prevent leakage of water behind the skimmer faceplate and housing. Typically, this retightening procedure must occur during the winter months in the North, for example, when the pool has been covered-over for the winter months. Moreover, in order to prevent water from freezing within the skimmer assembly and damaging the typically plastic components due to expansion of the ice within the skimmer, the skimmer assembly must be evacuated to prevent the build-up of ice within the skimmer. Additionally, within many pools, it is important to maintain the level of water within the pool so as to provide support for the walls of an in-ground pool, for example. In order to close off the opening of the skimmer, closure assemblies have been developed to cover the faceplate prior to the evacuation of water from the skimmer so that the level of water within the pool remains generally consistent with the level of the faceplate. However, the re-tightening procedure necessitates the owner removing the cover from the pool and accessing the screws around the outer periphery of the skimmer faceplate. Examples of such closure assemblies are shown in U.S. Pat. Nos. 4,913,810, 5,285,538 and 5,937,453. However, if the pool owner needs to retighten the screws around the faceplate, for example, if a leak occurs between the faceplate and pool wall, these cover assemblies need to be removed in order to access the screws. Since these cover assemblies fit over the faceplates, and hence over the screws, it is necessary to remove the faceplate to access the screws. This then allows water to flow into the skimmer assembly during the cold winter months and requires re-evacuation of the skimmer. What is needed, then, is a pool skimmer faceplate cover that completely seals off the skimmer, while allowing access to the screws for retightening by the pool owner. Additionally, objects such as water toys which float may often be left in the pool and may get hung up in the skimmers opening and strainer basket housing, which in turn obstructs the skimmers normal skimming action. What is needed then is a pool skimmer faceplate that allows leaves and bugs to enter the skimmer but prohibits larger amphibious objects from entering and obstructing the skimmer. The present invention is directed toward overcoming one or more of the above-mentioned problems.

Russia’s main independent pollster has been declared a “foreign agent” after showing a drop in the ruling party’s popularity before a major vote. Unless the Levada Centre, which began doing surveys in 1987, is able to appeal against the justice ministry’s ruling, it will be forced to close down due to the stigma of the label, said the director Lev Gudkov. The move comes less than two weeks before parliamentary elections. Survey results the Levada Centre published at the beginning of September showed that only 31% of respondents were ready to vote for United Russia, which has a huge majority in parliament and in regional administrations around the country. This was down from 39% a month before. The president, Vladimir Putin, noted the party’s falling rating in an interview with Bloomberg, but blamed it on critics he suggested were not “ready to take on responsibility” for making decisions. Although a new electoral commission head seen as more progressive was appointed in March, opposition candidates have been marginalised in state-controlled media and even attacked at appearances this year. The elections have been moved from December to September, which is likely to promote low turnout and benefit United Russia. Complaints of vote-rigging in the 2011 parliamentary elections sparked a huge street protest movement. The justice ministry based its decision on checks of the Levada Centre carried out in August at the request of MP Dmitry Sablin, a leader of the Kremlin-loyal Anti-Maidan movement. Although Levada stopped accepting foreign grants in 2013, Anti-Maidan accused it of being paid by the Pentagon as part of a project with the University of Wisconsin. Gudkov said the centre had worked on studies with the university but denied any links to the US defence department, telling the independent TV station Rain the checks were a “political hit job”. Putin signed a law in 2012 requiring non-government organisations that receive funding from abroad and engage in vaguely defined “political activity” to register as foreign agents. Besides putting this label – which is often used to mean spy in Russia – on all their publications, non-governmental organisations must submit to burdensome audits and reporting requirements. The leading electoral monitor, Golos, was declared a foreign agent in 2014. The legislation has been criticised as a crackdown on civil society, and the United Nations has asked Russia to amend it. Human Rights Watch said in August the justice ministry had declared 138 groups as foreign agents. At least 22 of these have shut down, including the Memorial anti-discrimination centre, LGBT group Coming Out and the Committee Against Torture. Many more, such as HIV outreach group the Rylkov Foundation and environmental group Dauriya, face uncertain futures.

Mursi language Mursi (also Dama, Merdu, Meritu, Murzi, Murzu) is a Nilo-Saharan Eastern Sudanic language spoken by the Mursi people, in the central Omo region of southwest Ethiopia. It is similar to Suri, spoken in most of the immediately surrounding area. Notes Bibliography Bender, M. Lionel and David Turton. 1976. "Mursi". The Non-Semitic Languages of Ethiopia. East Lansing: African Studies Center, Michigan State University. pp. 533–561. D. Turton, M. Yigezu and O. Olibui. 2008. Mursi-English-Amharic Dictionary. Addis Ababa: Culture and Arts Society of Ethiopia. Yigezu, Moges and David Turton. 2005. Latin based Mursi Orthography. ELRC Working Papers, Ethiopian Languages Research Center, Addis Ababa University, 1:2, pp. 242-57 (2005). External links Mursi Online, University of Oxford Mursi basic lexicon at the Global Lexicostatistical Database World Atlas of Language Structures information on Mursi Category:Languages of Ethiopia Category:Surmic languages

#248: Elite Squad: The Enemy Within (2010) August 20th, 2015, on Hulu Plus. Allison had her FastBreak bar from yesterday, and I had some Nestle Quik for the first time in at least ten years. Had I seen this film already? No. What did I know about the movie before watching it? Guns and action. More subtitles. I expected disappointment. What do I know about it now? Guns and action, but set up brilliantly early on. The plot wasn’t anything innovative, but the narrator broke the fourth wall immediately, and the characters sucked me in. I was in there early. What are some themes in the film? Corruption and the vain attempts of humanity to serve justice with temptation ever knocking on the door. The narrator repeatedly referred to “the system”, alluding to a natural cycle of events where those in power always fall into criminal mindsets to maintain things. Did this affect me personally? Yes. It’s an eagle’s eye view of the reality of many dangerous Latin American cities. The narrator stated early on that this account, though fictional, is close to a reality many people ignore. It made me grateful that our country is not as corrupt as many citizens believe it is. Why is this ranked #248? This one is also off the Top 250 already, but it’ll be back on where it belongs. It bears merit for its realistic attributes more so than its cinematic traits, which most viewers will appreciate. Did my wife watch/like it? Not really. This is definitely a bro movie. A brovie. Would I watch it again? No. Would I recommend it to a friend? Yes, simply to be grateful we have it so good here. Does it deserve to be on this list as one of the greatest films of all time? I’m a bit undecided. It depends on where you come from, I suppose. What makes this film work is the way it demonstrates you never really know who the bad guys are, from start to finish, even in the changes. And that’s the point.

Our new issue, “After Bernie,” is out now. Our questions are simple: what did Bernie accomplish, why did he fail, what is his legacy, and how should we continue the struggle for democratic socialism? Get a discounted print subscription today ! Naomi Klein released her latest book, This Changes Everything, as more than four hundred thousand people joined the People’s Climate March in New York City and environmental activists around the world organized 2,646 solidarity protests in 162 countries, making it by far the largest climate justice march in history. Growing mobilizations, particularly among indigenous and rural communities, against fossil-fuel extraction — fracking, tar sands, offshore oil, coal — and resistance to pipelines from Michigan to Texas have resulted in escalating state repression and propaganda campaigns from energy companies. Two people were killed worldwide every week in 2014 because of their environmental activism — more than double the rate of similar killings earlier in the decade. These mobilizations, and the people’s willingness to risk their lives for environmental justice, are rooted in a broader consensus — excepting Republican presidential hopefuls — on the scale and immediacy of the climate crisis. The Global Humanitarian Forum estimates that climate change is already responsible for more than three hundred thousand global deaths annually, affects a wider 300 million people, and is a major driver of humanitarian crises. Entire nations — like Bangladesh — are facing displacement and hundreds of thousands of people have already been driven from their homes. Closer to home, evidence of our changing climate abounds — sometimes, dramatically — as when Superstorm Sandy slammed into the densely populated eastern seaboard, or when floods raged across Texas, or in the ongoing drought devastating California. Other effects of climate change don’t make national news. In research interviews with farmers in the North Carolina piedmont, one farmer described to me how the spring and summer rains have become more erratic and reduced the number of hay cuttings they can make each year. Another pointed to a dirt paddock: “That should all be mud,” she explained. “It should be deep mud for a least a few more weeks, but it’s dry already. Dry as a bone.” What’s more, the experience of climate change maps onto existing inequalities: Copenhagen builds levees while the Maldives flood. The rich adapt as the poor face displacement. As Christian Parenti noted in his latest book, Tropic of Chaos: Climate Change and the New Geography of Violence, “Climate change arrives in a world primed for crisis.” The intersection of a changing climate with a world of unbelievable inequalities is indeed, as he describes, a catastrophic convergence. Growth and Globalization Klein’s book focuses on this catastrophic convergence, setting up the environmental challenge as a global one, and points to global “deregulated” capitalism — deeply polarized, unequal, consumptive, destructive, and, most importantly, demanding infinite growth — as the culprit. In this high-stakes political moment, when Green, Inc. too often shies away from political-economic critiques, Klein’s intervention is important. From Dhaka to Vancouver, we are bound together by jet streams and lean production, fiber optic cables and trade agreements, hip-hop and river deltas. Our connections are never merely social, economic, political, or ecological, but rather everything all at once. These connections are often used to obscure the inequalities that accompany them and the deep social divisions that persist. The Internet and the technologies that accompany it make it possible to connect the world at a speed and level of intimacy that was once only imagined, but they have also exacerbated the inequalities of industrial technology production and hastened the export of ecological destruction to “sacrifice zones” — places which supply the world with the raw materials and energy resources needed to produce immense wealth and modern comforts and yet which disproportionately bear the social and ecological devastation wrought by such extraction. With the ease of flipping on a light switch, we are blinded to the global poverty and pollution that can be traced back along power lines and trade routes to the scarred mountains of Appalachia or the burning palm oil plantations of Indonesia. The economic growth fueling this highly contradictory global age is a specifically capitalist growth: a world where capital “flows” but workers and their families are trapped on opposite sides of borders, where food is produced in excess while tens of thousands die from hunger every day. The contradictory nature of capitalist growth is the central material reality that separated Marx from earlier communist theorists: capitalism created for the first time in history regular abundance and surplus — the precondition for a world without it. For more than two centuries of industrial capitalism, the exploitation of fossil fuels has — simultaneously — raised the living standards of people, including working people, worldwide overall but has also concentrated the social ills and ecological degradation of production and the ever-deepening inequalities which result. Klein recognizes these processes and cogently describes the relationship between environmental destruction and capitalism. But her solutions fall into an all-too-common dual strategy of building alternatives and resistance. Klein correctly insists that “dropping out and planting vegetables is not an option for this generation,” and instead demands that we simultaneously “build and support inspiring alternatives . . . and make sure they have a fighting chance of thriving by trying to change an economic model so treacherous that nowhere is safe.” This solution is a good one in the sense that struggle is dialectical: as Nancy Cott says, the world we live in — which includes “alternatives” to economic-growth-centered production — “frames what people can envision for themselves and can conceivably demand.” Meanwhile people’s demands, and the struggle to implement them, transforms the world, expanding the vision of the possible. In arguing that we can’t simply drop out from capitalism, Klein not only recognizes that we can’t ignore the global structures that shape our lives, but also that in any real battle for power (or for our future) capitalism forces us to fight it on its own terms. Alternatives we build in the present exist under the same pressures as the capitalist forces which created them. Yet this strategy does nothing to lessen the central contradiction of capitalist economic growth: decreased consumption and selective de-growth are the antithesis of a world where economic growth is treated as the driving force of history, and where it consumes all in its path. Even a small decrease in the rate of growth (let alone negative economic growth) has the capacity to throw the whole system into crisis. And this isn’t just because capitalists want growth at all costs or only because they are exceptionally greedy, but because the system demands it. Even at best, alternatives in our neoliberal world are always on the defensive. We thus find ourselves embedded in one of capitalism’s enduring contradictions — that it is essential to struggle against its structures, logics, and centers of power in order to expand our own thinking about the possible future and about a new society, but that simultaneously, resisting the drives of capitalism is not enough: capitalism must be replaced. But Klein, now the author of three books that have fueled anticapitalist organizing, remains unwilling to come out and frame the challenge in this way. In This Changes Everything, the tension between her often incisive critique of capitalism and her unwillingness to point to its replacement except in exceedingly vague gestures is a source of constant frustration. Why does someone with such a keen sense of power and what is at stake in this fight evade the central question her book raises? Certainly, if capitalism is the problem, the solution must mirror it in scale and imagination, but Klein’s response falls far short of the rigor of the rest of the book. She responds simply and frankly, “Well, we do what we can.” What Can We Do? The evasiveness of this response in the context of the book’s searing indictment reflects longstanding trends in environmentalist politics and among some sections of the Left more generally: to counterpose broad political strategy, including the building of large political organizations, with small campaigns rooted around local issues. The organizing principle at work is that of the bumper sticker slogan, “Think globally, act locally.” Even activists with a clear sense of the systemic, global problems we face too often turn to local, prefigurative solutions. This isn’t to say that local action isn’t important — the solidarity committees feeding people in the ravaged neighborhoods of Greece, or the Black Panther Party’s breakfast programs clearly show they are — but these programs were also tied to political organization. In other words, even as organizations like the Black Panthers and, today, networks like Solidarity for All work to feed people, stock clinics with medicine, and more, they are (and were) conceptualized not as the sole site of political transformation, but rather as part of larger political projects which saw “building power” and “taking power” as two aspects of the same dialectical process. Localist politics divorced from larger political organization is a product of the deep fragmentation and isolation of the Left since 1970, of the sense that we don’t have the capacity to build mass parties, or wage nationally and internationally coordinated struggles that are more than loose coalitions united around “days of action.” Born of a sense of Left impotence stemming from the retreat of movements, localism took on a life of its own. Today, localism is pervasive in much of the environmental movement in particular: it calls for local food, local production, local economies. At worst, it’s a concept marshaled by Whole Foods–style corporations to salve liberal guilt about the inequalities of life under capitalism. But even at its best, localism is a poor unifying concept for politics, one which ignores the ways in which we are products of our own history. The level of global economic interdependency we experience now may not have been inevitable, equitable, or just, but it is a historical reality which has not only shaped our understanding of climate science but also the bounds of possibility for action. At its heart, even anticapitalist localism relies on a single basic assumption: we can create spaces outside of capitalism, and from these spaces, either build a separate society or use these spaces to struggle against capitalism. The former approach is rejected by Klein: “giving up on real solutions,” she writes, “is not an option.” But what about the second option? Such an approach is commonplace, and is actually emblematic of the Left’s weakness following decades of neoliberal onslaught and the struggle to build a non-Stalinist socialist current after the collapse of the Soviet Union. We need spaces of our own to recoup and reorganize, the argument goes. Klein asks: “what if we stay quiet [about climate change] not out of acquiescence but in part because we lack the collective spaces in which to confront the raw terror of ecocide?” Unfortunately, full disengagement from capitalism, even for the purpose of turning to fight it, is impossible. Marx wrote of a revolution from within for this very reason: capitalism is an expansive logic and must be fought from within. The working class has social power precisely because it operates the machine from within the machine, and not outside of it. It’s true that building for small, local victories is more conceivable for most people than more widespread victories which might occur on a nationwide, regional, or even global scale, and it is also true that such victories are important — not because they arrest climate change, but because they shift the ground on which we struggle and expand mass conceptions of what is possible. As Klein notes, “for most of us living in post-industrial societies, when we see the crackling black-and-white footage of general strikes in the 1930s, victory gardens in the 1940s, and Freedom Rides in the 1960s, we simply cannot imagine being part of any mobilization of that depth and scale.” True enough, though this state of affairs appears to be changing if the last four years are any indication. The key, then, is not to eschew local projects but to be clear about their potential: they will not generate additive change which at some point will outweigh capitalism, leaving us with an alternative social system, which is how Klein conceptualizes the struggle against climate change. Instead, local projects must be viewed as part of a dynamic struggle — turning one gear may turn many more gears unexpectedly, but if we are ultimately to change its function, the machine must be taken apart, redesigned, and rebuilt. The distinction may seem small, but its importance becomes clear when Klein tries to link up local and regional resistance movements which she highlights at length across the second half of the book to the concept of a global struggle toward the abolition of fossil fuels, a change which Klein believes can be brought about through a combination of New Deal–style policy changes and a cultural delegitimization of growth in favor of a feverish moral outcry like that which accompanied the growing international movement for the abolition of slavery in the nineteenth century.

Watching live music in India usually means crowded bars, diners making a racket, and a sea of smartphones taking selfies. Now, imagine seeing a gig without all these distractions, at an office or a living room near you.It’s part of a movement that began in London in 2009, and has been brought to 13 Indian cities by Sofar Sounds, an international music event management company. Sofar gigs are unique—not only do they keep secret who the three musicians performing are until you show up, there are no tickets. You apply for an invite online; and the location is disclosed only if you get one. After the show, you pay what you want. Phones have to be put away.Tanya Nath, Sofar Sounds’ Delhi leader, says the aim is to bring people who are passionate about music together. “Most concerts in India take place in bars and restaurants that are full of distractions and people aren’t paying attention to the music. Here, the music is at the centre.”The shows happen once a month in major metros as well as cities like Goa, Kochi Shillong and Jaipur. The venues are offbeat and deliberately small, from offices to cramped bookstores or a stranger’s living-room. A selection committee of five chooses the performers, usually ‘stripped back acts’ that perform original music. From rappers to bluegrass bands, singer-songwriters to all-female acapella groups, they look for quality over fame. Musicians are compensated—they can either opt for one-fourth of the night’s earnings, or for well-produced recordings of their performance.Saby, a Chandigarh-based indie folk musician who has performed at four Sofar gigs, loves the element of surprise. “Even as performers, none of us know who else is playing there. Sometimes it’s friends or at other times, you meet artistes from different genres. You get to interact with the people attending in a way that’s more personal,” he says.Sofar regular Madhav Khemka has attended nine shows in Delhi. He says, “I love that it isn’t commercialised. The musicians sit with us on the floor when other people are performing. You see talented and new artistes before they become famous. It’s become so popular in the city that the last time I tried to apply, it was sold out within hours.”An international community has been formed around the events, and travellers seek out Sofar shows wherever they go. Spaniard Irene Arredondo has attended shows in South Africa and India, and even hosted one in Poland. “Shows in different countries mysteriously feel similar. They have an identity of their own that’s become universal,” she says.For musicians, the experience is important. Musician Amira Gill performed with her band Amira Gill and Friends in Delhi earlier this year. “The intimacy of the show was amazing. The people watching you have come for the music and the audience knows the musicians are there to provide it to them. That specific night, it was raining cats and dogs so it was a huge honour to have a packed house,” she says.

A Day At The Park "A-alright." Jake nodded, and smiled, as they continued to eat. Every once in a while he'd look up, to eye the new male who sat across from him, quite intrigued, actually. He licked his lips, and continued to eat slowly, as this meal was the most he'd had in a week. He didn't generally eat much, if any at all. But he smiled anyway, and observed the two rabbits as they ate. Mandrake moved gracefully and was always dabbing his lips at the simple bits of any residue that would have remained. Flip was similar but lacked the grace the other did. He didn't pat his lip ever so often either. He more so simply ate but then spoke up, "So Jake do you work tomorrow?" Jake nodded. "I actually do..." He said, pondering on the thought, possibly more than he should have. Flip had said this guy was rather rough. But so far, he was quite the gentlemen. He hoped it's show itself at a later date, thought he quite enjoyed this side of him as well. He took another bite, pondering on all the things he had been asked to do. Flip looked over to Jake almost catching onto his disappointment. He kept quiet knowing he could tell him later what would most likely set off the other male. He didn't see what Jake liked about being dominated and especially possibly even raped. Mandrake finished the meal he had and then looked to the two wondering why they were both so quiet. He felt a chill run his spine as though feeling lightly intimidated from the two's silence and feeling as though he was the victim here. Jake caught onto the silence as well, biting his lip timidly. His motives came from his past, which was a long and painful story. His ears shot up, as he practically slammed his hands onto the table. "SO." He said, full of energy again. "What now?" He asked rather loudly, looking around the table to the other two, a wide, and possibly exaggerated smile on his face. Mandrake looked to Jake then narrowed his eyes to Flip as though going to ram a knife into his throat just to watch him bleed. Flip swallowed and smiled sheepishly then looked over to the fox, "Well If your finished you can go change while I do dishes." Jake smiled to Flip, and stood, catching the boy's glare as he did so. Rather worried, he quickly walked to the bedroom, and shut the door behind him. He had a feeling something was going on, but he couldn't figure out what. He shrugged, and opened his closet, beginning to decipher exactly what to wear. Mandrake watched the Fox leave and rose up then went over to Flip standing behind his chair and took his shoulders leaning his head down to the others ears whispering, "If he has any disease of sorts and you expect me to fuck him I'm going to break you all over again." He pulled his ears back hard seeing the pain in his eyes then released him going to the couch. Flip shuddered and bit his lip almost scared and began to move to the kitchen and begin to clean up the dishes as he enjoyed the warm water thinking maybe it was a bad idea to invite him. Jake looked through his closet, pulling out a big black bag. Looking through it, he sighed, and put it back, hiding it behind a pile of clothes. He grabbed a pair of clothes, and quickly slipped into it, peeking his head out the door. This night would go one of two ways. He eagerly hoped for the first one. Flip finished the dishes and set the wet dishes upon the rack to allow them to dry. He then began to dry his own paws his ears down now thinking he should try to stop him from getting this to happen or go anywhere. Mandrake sat back in the couch staring at the room and how things were laidout in the room. He then looked down the hall expecting the fox to return. Eyes then went to the door staring at it. Jake looked around timidly. "Um.. are you sure you really want me to dance...?" He asked rather shyly. In all honestly, he really didn't want to dance. And he felt suddenly uncomfortable. He had been around guys like this before... He'd had his share of bruises as well... but again, that was another story. He bit his lip, and looked to the rabbit on the couch, almost nervously. Mandrake sat on the couch simply staring ahead his hazelnut eyes almost seemed bored and uninterested though his body was leaned back and relaxed as though he felt he had control over whatever they had planned. "Sit." He almost said demandingly not moving his eyes from his spot, "You said you danced and I expect to see one. Do not keep your company waiting it is very rude." He closed his eyes and kept them closed. Flip sat down beside Mandrake and pulled out his phone sending a text, "Please come out Jake. I'm sure you look and will do just fine. Wnat me to dim the lights some?" He offered. Jake bit his lip, looking to Flip with a face of "..Please don't make me...". He looked back to the boy, raising his eyebrow, and sighed. He opened the door, and slowly strolled his way into the living room. He wore a pair of tight, black, spandex/latex pants, and a tube top that matched. He was barefoot, and quietly walked in front of the couches, holding his hands together, unsure of what to do next. Mandrake watched his eyes a bit more intense as he watching his hips move as his eyes went to his waist then over to his chest. HE looked over to flip, "Relax. I will not hurt him don't worry.. at least not yet." Jake closed his eyes for a moment, getting a bit more comfortable with himself, as he began to slowly spin, continuing the swaying movements, swishing his tail playfully, slowly raising his hands above his head, to slowly slide down into the splits, his head cocked back slightly, the slightest grin on his face. Flip watched Jake rather enjoying the foxs movements. The way he ha moved was quite graceful and even more charming than many he had seen dance. His eyes went to Mandrake with a slight gulp in hope that the male wouldn't try anything dangerous to harm his friend.Mandrake was watching with much muse seeing the male moving. Dark eyes wandered over the fox and he spread his legs his pants growing a bit tight at the waist as he licked his lips more intent now on putting that ass to work. Jake slowly came to stand, without the use of his hands. He smiled, and continued to dance, moving his tail around rythmically, his body almost hypnotic as he moved. This was just one of the many forms of dancing he did. Mandrake looked to the fox then rose his voice, "You move very well though I must ask if you would come and sit on my lap. Show me a little lap dance. I wont touch you at first. I'd just like to see you up close."Flip looked over then to Jake and shrugged. He wasn't sure what all he was thinking but he seemed interested him all the same. Jake grinned, and slowly made his way over to the rabbit, swaying his entire body with each step. He placed his knees on the couch, and moved forward to perch himself atop the boy's lap. He grinned, and held his hands above his head again, beginning to slowly sway his hips back and forth, and side to side, moving his body around as of it were a sheet, rippling and swaying like a wave of fur, smiling down to him as his tail made it's way up his own chest, around his neck. Mandrakes dark eyes looked over the young male fox as he moved closer to him; movements were so flawless he wondered if the boy ever sat. A smirk crossed his thin lips seeing the sway of Jake's hips; refraining from touching was rather hard especialy when the males fur was so close to his own. Flip's bright Irish green eyes went to the fox and eyed him as he went to Mandrake doing a rather taunting dance infront of him. He had a feeling that it was safe for now so he sighed in relief that he wasn't being violent. Jake grinned softly, slowly running his hands down his own smooth chest, to his wide hips. He stroked these tenderly, and fluffed out his tail, his emerald green eyes staring deep into Mandrake's own, so longingly. He leant closer, his lips near the boy's ear. "Do you like what you see...?" He purred softly. Mandrake had a smirk cross his thin lips as he looked to the fox, "God yes I love what I see. I want you to ride me rather badly. Seeing these hips sway.. perhaps I can even ram myself into you; that would be most pleasurable to me." He brushed his hips and lelaned in pushing his nose to his bely as he gripped his hips and slipped his hands to his ass gripping the soft cheeks. Flip watched and looked away blushing feeling himself growing a bit hard from watching Jake dancing. Jake grinned, his fluffy tail slowly snaking up Mandrake's body, wrapping itself around both of their waists, pulling them close. "I'd like that too..." He purred sweetly into the boy's ear, winking over his shoulder to the bunny in the corner. He lightly pulled on the waistband of his tight, lacy purple panties, (that accented his rump quite nicely) and let it snap back against his thigh, purring at the sweet sting. Mandrake smirked and his eyes narrowed as he quickly moved Jake's over to him and pushed him down on the couch and pulled his little hip huggers down and smacked his ass hard! He shoved his pants down and poked his pucker and smirked, "This is going to be rather fun. While you are down there blow Flip!" Flip looked to Jake's face which was between his legs as his pants had lightly tightened. Jake grinned as he was toyed with a bit, squealing as he was flipped over. He looked behind him to see that Mandrake was already stark naked. He bit his lip softly, as the boy was moving a tad too fast for him. He frowned inwardly as he felt himself already being positioned for entry, and forced between Flip's legs. "Aye... Moving a bit fast back there, eh, Cowboy...?" He laughed, a bit nervously, and turned to look up at Flip with those wide eyes, suddenly so full of innocence, and purity. Flip saw the look in the males eyes and bit his lip trying to think of a way to help Jake from the assult of Mandrake. Moving up he stopped him, Mandrake.. would you fuck me while i fuck Jake? It would be to your advantage fucking us both technically." Mandrake stopped and pondered this and nods, "Perhaps so. such a good little rabbit. Hurry up and put your dick in him." Flip hovered over Jake and whispered in his ear, "I am sorry I didn't want you on his receiving end just yet. you will see why soon enough.." He gripped his hips poking the tip to the fine pucker. Jake shook his head, and pushed Flip away lightly. "No, it's fine." He grinned, and strolled towards Mandrake. "I can take him." He said in a confident manner, swaying his gorgeous hips as e approached the rabbit, trailing his thumbs along the waistband of his panties, winking at the boy. Flip watched him and trembled lightly sitting back as he saw Mandate repeat the process of moving him and shoving his hips up to his waist. He licked.his palm and coated the dry member allowing him some lube before pushing the hard-on in all the way and leaving it there he pulled Jake's hair and pushed his mouth towards Flip's throbbing erection, "Do it." Jake grunted and groaned as he was entered, squealing softly as his hair was pulled. He always liked it rough, but wasn't sure he was ready for this. He panted softly, and stayed still for a moment, getting accustomed to the large member throbbing inside of him. He slowly ran his hands up Flip's stomach, to stroke his chest as he dragged his hot, vixen tongue along his member, breathing so warmly... So hot... Those eyes of his staring deep into Flip's.. Like daggers... He giggled softly. Flip shuddered watching Jake as he rolled that rather long tongue over his shaft and tip. His body began to grow hot from the pleasure he was being given. His thoughts had halted just to enjoy the feeling of what he was receiving.Mandrake didn't hold back, after the first initial thrust he was soon thrusting more quickly and a bit more violently. Jake grinned, and slowly slipped the boy's entire length into his throat, suckling eagerly. He smiled as he was tended to from behind by the rough rabbit, quite pleased by the setup he'd been placed into. Mandate gripped his hips and kept going rather hard. He was forcing his head over Flip as well smirking, "Hmm such a good hole to fill right flip? Pull his ears and force him on you." flip groaned petting the.fur of his head and gently tugged the code ears finding it to be really good. Jake groaned as his body was complimented, and squeaked softly as his ear was tugged. He didn't care for it too much, as his ears, among various other places, were very sensitive to pain. He didn't enjoy it, but he chose to stay quiet, and continue his handiwork. Mandate now plowing into the boy; shoved so hard it was forcing the Fox closer to his Rabbit friend, "Im going to fill you up... I'm so close.." flip was being gentle so as not to harm Jake but looked down to him as though adding a 'I told you so'. "Ahh why shouldn't I fill you? I'm so close you better answer fast before I explode." Mandate smirked doing small deep thrusts now which sucked his dick hard making him near his peak. flip bit his lip trying to see if he could persuade him as Jake said, "You should cover him... Soak his fur so I am forced to lick it off..." Mandrake smirked, "You don't want it inside you? Why? you're not putting up much of a fight. I think I'll fill you anyways!" He began to go hard again, "I'm... about to.." His panting labored. Flip narrowed his eyes and got up moving and went to shove Mandrake but his wrist was caught, "You dare... defy me? Mandrake shoved Flip back and shook his head, "No way not going to pul out you just pissed me off is all! So now I'm going to fill you! So suck it up bitch!" He thrusted hard a few more times feeling the sputter of cum shot from his tip and fill the Fox infront of him. He didn't stop there though, he kept pumping in more. "God you are so tight! I don't think I can stop!" Jake's eyes widened as he heard the boy's screams. He gripped the pillow in front of him, and shoved his face into it, his eyes brimming with tears. He attempted to pull himself away crying harder and harder into the pillow, his ears low, tail limp behind him. Mandrake groaned closing his eyes as he pumped into Jake hard, "Now your so much wetter inside nice and loose to fit me for round two." Flip looked up and now was enraged. He wouldn't let his friend suffer this! He got up and rushed Mandrake tackling him down and hit his face. Flip gasped as he was rolled to the ground and his face was hit with a fist. He began to choke as Mandrake held his throat firm in his fists, "You little bitch I'll end you!" He pushed his head into the ground. Flip felt like he was loosing consciousness. Jake's eyes widened, and he let out a horrified scream. He ran, full speed at the rabbit, slamming his head into his gut, and tackling him to the floor, perched atop his chest, slamming his head into the floor, and taking his claws to his throat, an inch away from his flesh. Tears streamed down his face, as his tail moved up to wipe his eyeliner away. "Get out of my apartment." Mandrake growled shoving him off and looked to the rabbit and narrowed his eyes as he gathered his clothes and rushed to the door, "You are both a disappointment..." The door slammed and Flip was left on the ground trying to catch his breath as best he could. Jake stood there for a moment, running his fingers through his hair. He slowly kneeled, letting out a painful whine. He began to cry again, sitting on the floor, his back against the couch, tail wrapped around him. Flip slowly crawled toward him and crawled up hugging him tightly against him and kissed his neck he felt sad as well as tears left his own face, "I'm so sorry Jake... This is al my fault. I should have never..."

--- abstract: 'We construct random triangles via uniform sampling of certain families of lines in the plane. Two examples are given.  The word uniform turns out to be vague; two competing models are examined.  Everything we write is well-known to experts.  Which model is more appropriate?  Our hope is to engage a larger audience in answering this question.' author: - Steven Finch date: 'February 8, 2018' title: Three Random Intercepts of a Segment --- Let $\ell$ denote a planar random line with slope $\tan(\omega)$ and $x$-intercept $\xi$, where $\omega\sim\,$Uniform$[0,\pi]$ and $\xi\sim \,$Uniform$[-1,1]$ are independent. Let $\ell_{1}$, $\ell_{2}$, $\ell_{3}$ be independent copies of $\ell$. The three lines determine a compact triangle $\Delta$ almost surely. The probability density function for the maximum angle in $\Delta$ is [@Grffths] $$f(\alpha)=\left\{ \begin{array} [c]{lll}6(3\alpha-\pi)/\pi^{2} & & \text{if }\pi/3\leq\alpha<\pi/2,\\ 6(\pi-\alpha)/\pi^{2} & & \text{if }\pi/2\leq\alpha\leq\pi,\\ 0 & & \text{otherwise}\end{array} \right.$$ and hence the probability that $\Delta$ is obtuse is $3/4$. A variation on the preceding is to require $\omega\sim\,$Uniform$[\pi /4,3\pi/4]$, that is, the lines $\ell_{1}$, $\ell_{2}$, $\ell_{3}$ each have $\left\vert \text{slope}\right\vert $ exceeding $1$. The maximum angle density here is [@Finch1; @BjxHys]$$f(\alpha)=\left\{ \begin{array} [c]{lll}24(\pi-\alpha)(2\alpha-\pi)/\pi^{3} & & \text{if }\pi/2\leq\alpha\leq\pi,\\ 0 & & \text{otherwise.}\end{array} \right.$$ The random triangle $\Delta$ is almost surely obtuse. Gates [@Gates94] examined the same two problems, for triangles generated by uniform random lines, but adopted a different probability model than the preceding. He did not elaborate on the quoted phrase, but referred to an earlier paper [@Gates93], where it is apparent that the density for $\omega$ should be proportional to $\sin (\omega)$. On the one hand, his model is *standard* in the sense that the measure is invariant under rigid motions [@KndlMrn; @Santalo]. On the other hand, it possesses a feature that vertical lines are weighted more than horizontal lines. This curious tradeoff raises an interesting question: which model is more appropriate when constructing random triangles? For the unrestricted case ($0\leq\omega<\pi$), the inclination angle density is $$g(\omega)=\frac{1}{2}\sin(\omega)$$ and the maximum angle density is consequently [@Gates94] $$f(\alpha)=\left\{ \begin{array} [c]{lll}\dfrac{3}{4}\left[ (3\alpha-\pi)\cos(\alpha)+2\sin(\alpha)-2\sin (2\alpha)+\sin(3\alpha)\right] & & \text{if }\pi/3\leq\alpha<\pi/2,\\ \dfrac{1}{4}\left[ 3(\pi-\alpha)\cos(\alpha)+3\sin(\alpha)-2\sin (2\alpha)\right] & & \text{if }\pi/2\leq\alpha\leq\pi,\\ 0 & & \text{otherwise.}\end{array} \right.$$ It follows that$$\mathbb{P}\left\{ \Delta\text{ is obtuse}\right\} =2-\frac{3\pi}{8}=0.8219...$$ which is larger than $3/4$.  For the restricted case ($\pi/4\leq\omega \leq3\pi/4$), the inclination angle density is $$g(\omega)=\frac{1}{\sqrt{2}}\sin(\omega)$$ and the maximum angle density is [@Gates94]$$f(\alpha)=\left\{ \begin{array} [c]{lll}\dfrac{1}{2}\left[ \cos(\alpha)+\sin(\alpha)+\cos(2\alpha)-2\sin (2\alpha)\right] & & \text{if }\pi/2\leq\alpha\leq\pi,\\ 0 & & \text{otherwise.}\end{array} \right.$$ The expressions for $f$ when $\omega$ enjoys constant weighting are simpler than those for $f$ when $\omega$ enjoys sinusoidal weighting.  This statement alone does not imply that the first model is preferable to the second model; there are other issues to consider too. To generate random triangles according to [@Gates94] is only slightly more complicated than according to [@Grffths; @Finch1]: if $U\sim\,$Uniform$[0,1]$, then by the inverse CDF method, $$\omega=\arccos\left( 1-2U\right)$$ gives inclination angles for the unrestricted case and$$\omega=\arccos\left( (1-2U)/\sqrt{2}\right)$$ gives inclination angles for the restricted case.   The most compelling argument for sinusoidal weighting is its theoretical consistency with the Poisson line process [@Miles64; @Solmn].  Let us focus on the unrestricted case.  By Example 20 of [@Baddly1], the inclination angles $\omega_{j}$ of the lines relative to the $x$-axis are independent and identically distributed with density $\sin(\omega)/2$ on $[0,\pi]$.  In words, acute angles $\approx0^{\circ}$ and obtuse angles $\approx180^{\circ}$ are less likely than near-right angles $\approx90^{\circ }$.  Vertical rain wets more than slanted rain [@Serra]. We quote [@Baddly1]: > ... although the lines of the line process have uniformly distributed orientations in some sense, the angles of incidence with any fixed axis are not uniformly distributed... the probability of ‘catching’ a random line in a given sampling interval of the $x$-axis depends on the orientation of the line... and, further, [@Baddly2]: > This is a classic paradox. If you consider the random lines which **intersect a given, fixed line**, then these random lines have angles which are non-uniformly distributed with probability density proportional to the sine of the incidence angle. If you consider the random lines which **intersect a given circle** then these random lines have uniformly-distributed orientation angles. In each case the **bold text** describes a selection or sampling operation, and sampling operations introduce bias. We sketch a proof of this theorem in Appendix 1.  Proofs of the four density formulas for $f$ are not provided here; in the following section, we choose instead to examine only a special scenario for illustration’s sake. Diagonal Line ============= Let us examine the restricted case ($\pi/4\leq\omega\leq3\pi/4$), initially with constant weighting and subsequently with sinusoidal weighting.  We follow [@BjxHys] closely.  Let $\omega_{1}=\pi/4$, $\omega_{2}$, $\omega_{3}$ be the inclination angles of the three lines, hence the first line is fixed as the diagonal $y=x$. Clearly $\omega_{1}<\omega_{2}$ and $\omega_{1}<\omega_{3}$ almost surely.  The angles $\omega_{2}$, $\omega_{3}$ are independent and identically distributed, thus $\mathbb{P}\left\{ \omega_{2}<\omega_{3}\right\} =1/2$.  The triangle formed by the three lines has angles $\omega_{2}-\omega_{1}$, $\omega_{3}-\omega_{2}$, $\pi-\omega _{3}+\omega_{1}$.  Since $\pi/2=\pi-3\pi/4+\pi/4\leq\pi-\omega_{3}+\omega _{1}$, the maximum angle is obviously $\alpha=5\pi/4-\omega_{3}$.  We have$$\begin{aligned} \mathbb{P}(\alpha & <a)=\mathbb{P}\left\{ \begin{array} [c]{ccc}5\pi/4-\omega_{3}<a & \mid & \omega_{2}<\omega_{3}\end{array} \right\} \\ & =\frac{\mathbb{P}\left\{ \begin{array} [c]{cc}\omega_{3}>5\pi/4-a, & \omega_{2}<\omega_{3}\end{array} \right\} }{\mathbb{P}\left\{ \omega_{2}<\omega_{3}\right\} }\\ & =2\,\mathbb{P}\left\{ \omega_{3}>\max\left( \begin{array} [c]{cc}\omega_{2}, & 5\pi/4-a \end{array} \right) \right\} \\ & =2\left[ {\displaystyle\int\limits_{\pi/4}^{5\pi/4-a}} \,{\displaystyle\int\limits_{5\pi/4-a}^{3\pi/4}} g(\omega_{3})g(\omega_{2})d\omega_{3}d\omega_{2}+{\displaystyle\int\limits_{5\pi/4-a}^{3\pi/4}} \,{\displaystyle\int\limits_{\omega_{2}}^{3\pi/4}} g(\omega_{3})g(\omega_{2})d\omega_{3}d\omega_{2}\right] .\end{aligned}$$ For $g(\omega)=2/\pi$, evaluating the double integrals yields$$\mathbb{P}(\alpha<a)=\frac{(2a-\pi)(3\pi-2a)}{\pi^{2}}$$ and, upon differentiation, $$\begin{array} [c]{ccc}f(\alpha)=\dfrac{8(\pi-\alpha)}{\pi^{2}}, & & \dfrac{\pi}{2}\leq\alpha\leq \pi. \end{array}$$ For $g(\omega)=\sin(\omega)/\sqrt{2}$, evaluating the double integrals yields$$\mathbb{P}(\alpha<a)=\dfrac{1}{4}\left[ 2-2\cos(a)-2\sin(a)-\sin(2a)\right]$$ and, upon differentiation,$$\begin{array} [c]{ccc}f(\alpha)=\dfrac{1}{2}\left[ -\cos(\alpha)+\sin(\alpha)-\cos(2\alpha)\right] , & & \dfrac{\pi}{2}\leq\alpha\leq\pi. \end{array}$$ Moments are easily calculated; the mode is $\pi/2$ for the former and$$2\arctan\left[ \frac{1}{2}\left( -3+\sqrt{17}+\sqrt{2\left( 5-\sqrt {17}\right) }\right) \right] =1.7713...$$ for the latter.  Identical results apply when instead the third line is fixed as the anti-diagonal $y=-x$. On a personal note, I had intended this article to be a quick follow-up to my 2011 article on random tangents to a circle [@Finch2] .  Who would have suspected that random intercepts of a segment might be so much more hazardous than the preceding?  Uncovering Gates’ model [@Gates94; @Gates93] constituted a turning point in my writing.  This humble contribution is the uncertain outcome of several years of hesitation and delay. The R package *spatstat* [@BRT] has planar random process simulation capabilities.  I can generate Poisson lines in a sampling window via *rpoisline* and determine their inclination angles $\omega_{j}$ via *angles.psp* (with option *directed=FALSE*).  An elliptical window of eccentricity $\varepsilon\approx1$ is less likely to be hit by lines almost parallel to the major axis than by almost perpendicular lines.  In contrast, for a circular window ($\varepsilon=0$), all directions are equally likely.  Clarifying these observations more rigorously would be worthwhile and I welcome thoughts on how this should be done. Appendix 1 ========== The ordered pair $(\xi,\omega)$ offers one representation of a line $L$, involving the $x$-intercept $\xi$ and inclination angle $\omega$.  Another representation $(p,\theta)$ where $-\infty<p<\infty$ and $0\leq\theta<\pi$, called the Hesse normal form, involves the length $|p|$ of the perpendicular segment from $(0,0)$ to $L$ and the orientation angle $\theta$ of this segment.  In the definition of a Poisson line process, it is usually assumed that $\theta\sim\,$Uniform$[0,\pi]$.  From$$x\cos(\theta)+y\sin(\theta)=p$$ we see that$$\begin{array} [c]{ccc}p=\left\{ \begin{array} [c]{lll}-\xi\sin(\omega) & & \text{if }\omega<\pi/2,\\ \xi\sin(\omega) & & \text{if }\omega\geq\pi/2 \end{array} \right. , & & \theta=\left\{ \begin{array} [c]{lll}\omega+\pi/2 & & \text{if }\omega<\pi/2,\\ \omega-\pi/2 & & \text{if }\omega\geq\pi/2 \end{array} \right. \end{array}$$ since $\cos(\omega\pm\pi/2)=\mp\sin(\omega)$.  At first glance, it would seem that $\omega\sim\,$Uniform$[0,\pi]$ immediately because $\theta\sim \,$Uniform$[0,\pi]$.  In fact, the $2\times2$ Jacobian determinant of the transformation $(\xi,\omega)\mapsto(p,\theta)$ is $\mp\sin(\omega)$, which implies that the density of $\omega$ is $\sin(\omega)/2$.  Reason for the factor of $2$: both $(\xi,\omega)$ and $(-\xi,\pi-\omega)$ are mapped to the same $(p,\theta)$.  Details of the proof in a more general setting appear in [@Solmn; @Wlfwtz; @Morton]. Appendix 2 ========== We present R simulation output results (ten histograms in blue) graphed against density expressions found herein (six curves in red).  The first four plots correspond to the first four expressions for $f$, given without proof.  The next two plots correspond to those associated with the diagonal line $y=x$ scenario.  Analysis of other scenarios involving the vertical line $x=0$ or the horizontal line $y=0$ are left to the reader. [j1234.eps]{} [j5-10.eps]{} Appendix 3 ========== Given a convex region $C$ in the plane, a width is the distance between a pair of parallel $C$-supporting lines.  Fix an inclination angle $0\leq\omega<\pi$ relative to the $x$-axis.  A measure of all lines of angle $\omega$ hitting a $C$-window is proportional to the corresponding width.  For example, if $C$ is the square $[-1,1]\times\lbrack-1,1]$, we obtain a bimodal inclination angle density [@Finch3]$$\frac{1}{4}\max\left\{ \sqrt{1+\sin(2\omega)},\sqrt{1-\sin(2\omega)}\right\}$$ with modes at $\pi/4$ and $3\pi/4$.  It is easier to obtain the $\sin (\omega)/2$ density for the interval $[-1,1]$, but harder to examine $2\times2\sqrt{1-\varepsilon^{2}}$ rectangles of eccentricity $0<\varepsilon <1$. [99]{} D. Griffiths, Uniform distributions and random triangles, *Math. Gazette*. 67 (1983) 38–42. S. R. Finch, Problem 1895, *Math. Mag.* 85 (2012) 151. E. Bojaxhiu and E. Hysnelaj, Solution of problem 1895: The probability density function of the maximum angle, *Math. Mag.* 86 (2013) 152–153. J. Gates, Shape distributions for planar triangles by dual construction, *Adv. Appl. Probab.* 26 (1994) 324–333; MR1272714 (95b:60012). J. Gates, Some dual problems of geometric probability in the plane, *Combin. Probab. Comput.* 2 (1993) 11–23; MR1234786 (95g:60018). M. G. Kendall and P. A. P. Moran, *Geometrical Probability*, Hafner, 1963, pp. 1–23; MR0174068 (30 \#4275). L. A. Santaló, *Integral Geometry and Geometric Probability*, Addison-Wesley, 1976, pp. 27–30; MR0433364 (55 \#6340). R. E. Miles, Random polygons determined by random lines in a plane, *Proc. Nat. Acad. Sci. U.S.A.* 52 (1964) 901–907; MR0168000 (29 \#5265). H. Solomon, *Geometric Probability*, SIAM, 1978, pp. 25–30, 39–55; MR0488215 (58 \#7777). A. J. Baddeley, A crash course in stochastic geometry, $3^{\text{rd}}$ *Séminaire Européen de Statistique on Stochastic Geometry, Theory and Applications*, Toulouse, 1996, ed. O. Barndorff-Nielsen, W. Kendall and M. N. M. van Lieshout, Chapman & Hall/CRC, 1999, pp. 1–35; MR1673110; http://school.maths.uwa.edu.au/adrian/reprints/chapter1.ps. J. Serra, Random tesselations, ch. XXV, *Courses on Mathematical Morphology*, http://cmm.ensmp.fr/serra/cours/. A. J. Baddeley and E. Rubak, Planar Poisson line process & angles of inclination, http://math.stackexchange.com/questions/2609173/planar-poisson-line-process-angles-of-inclination/. S. R. Finch, Three random tangents to a circle, arXiv:1101.3931. A. Baddeley, E. Rubak and R. Turner, *Spatial Point Patterns: Methodology and Applications with R*, Chapman and Hall/CRC Press, 2015; http://spatstat.org/. J. Wolfowitz, The distribution of plane angles of contact, *Quart. Appl. Math.* 7 (1949) 117–120; MR0028551 (10,464g). R. R. A. Morton, The expected number and angle of intersections between random curves in a plane, *J. Appl. Probab.* 3 (1966) 559–562; MR0203756 (34 \#3604). S. R. Finch, Width distributions for convex regular polyhedra, arXiv:1110.0671. \[c\][lll]{} & Steven Finch &\ & MIT Sloan School of Management &\ & Cambridge, MA, USA &\ & *steven\[email protected]* &

Sponsor Sponsor 1st bus rapid transit line opens in Minn. ST. PAUL, Minn. -- Minnesota's first bus rapid transit service launches this weekend. The new Red Line operated by Metro Transit will offer service from Apple Valley to the Mall of America. The route will provide service throughout the day for people in the south metro area, said Arlene McCarthy, the agency's director of transportation. "If you wanted to get home earlier, get home in the middle of the day or come home later in the evening after your normal express service has ended, you now have a new option," McCarthy said. "If you are in downtown Minneapolis, you can take the Blue Line, or Hiawatha light rail, down to the Mall of America, transfer to the Red Line and finish your trip." McCarthy added: "Our goal is to have a system of transit ways, across the region, so that people have a convenient trip on transit, regardless of where they are starting from, and where their destination is." The new bus rapid transit line will operate more like the light rail than a bus line, McCarthy said. Riders on the Red Line will buy tickets in advance at vending stations for buses that will drive on bus-only shoulder lanes to avoid traffic. The Red Line is the first of many projects designed to increase bus efficiency in the metro area, she said.

Huckle-Bearies Espresso & Bake Shop About Us We are located on the corner of Sumner and Maple in Aberdeen, and we now have a second location inside the Grays Harbor Community Hospital. We will deliver to your business. Minimum of 4 drinks…read more About We are located on the corner of Sumner and Maple in Aberdeen, and we now have a second location inside the Grays Harbor Community Hospital. We will deliver to your business. Minimum of 4 drinks please. Stop by for fresh baked goods, a great cup of coffee, and a smile! In a hurry? Call ahead and we'll have your drink ready when you arrive. Our mission is to provide our customers with a great cup of coffee and a smile. Our Bakery selections are baked fresh daily and include muffins, scones, strudels, cookies and much more. Come by and say hi, and enjoy a great cup of coffee or blender drink! Highlights Bake Shop Espresso Media Whom to Contact Wendy Peterson Owner Phone:(360) 537-1170 What's Nearby? Distance:mi. Greater Grays Harbor 506 Duffy Street Aberdeen WA 98520 Phone: (800) 321-1924 Email: [email protected] All information contained within this web site is the Intellectual Property of Greater Grays Harbor Inc. and may not be reproduced, copied or modified in any form without the express written consent of Greater Grays Harbor Inc.

◙ "A fat woman sloshed into the shoe store today. Said she was retaining water. I told her not to worry the dam of cellulite should keep us all safe for the next few years!" ◙ "A skinny woman with a hooked nose olive-oils into the shoe store and says "I want something to make me look sexy". I say "You'll have to wait a long time before someone that ugly comes in and stands next to you!!"." ◙ "A fat woman clip-clops into the shoestore today and says "I want something I can feel comfortable in." so I said "Try Wyoming!" ◙ "Then this woman comes in who doesn't speak English. She points at the shoes, I point at the door. She points at the sky and then knees me in the nay-nays!" ◙ "Let me explain. It's just like an elevator. There's a 2 ton weight limit on those shoes..." ◙ "A customer walks into the shoestore today. A tall willowy brunette. She sits down and asks to try on a pair of size 12 pumps. So I sit down there, doing my business and I notice she's wearing a garter belt which I like. All the time she'd smiling at me. Suddenly she uncrosses her legs like in Basic Instinct..... It was a guy!!!" ◙ "A fat woman walked into the shoe store today. She was so fat, she had three smaller women orbiting around her." ◙ "A woman comes into the shoestore today, so huge she's protected by GreenPeace. She asked for a pair of size 4 so I asked if she'd eat them here or take them home. Then she has the nerver to complain about my performance!" ◙ "A fat woman godzillas into the shoe store today, she asks for something she could wear to walk in the woods. Jokingly I suggest she wear a sign that says "Don't shoot! From the front I look human!"." ◙ "A fat woman came into the shoe store today. Wanted a pair of shoes for a Christmas party. I told her to stand on her hands, put a star in her butt and go as the world's largest, ugliest tree!" ◙ A little kid and his mum are in the store. The kid says "I want a balloon" and Al replies (looking at the fat mother) "You've already got one!". ◙ If God had wanted women to bowl, he would have put their breasts on their backs so we would have something to watch while waiting our turn. ◙ Peggy: No TV, Al, we're talking. Al: You're my wife. I will not talk to you while I have a TV. ◙ Al: Peg, kids, get ready to torture me - I'm home. ◙ Kelly: Bud, I'm gonna kill you and then I'm gonna bury you alive. ◙ Peggy: I want sex. Al: So do I, but I see no reason to drag *you* into it. ◙ Peggy: Did you miss me? Al: With every bullet, so far. ◙ Al: Now wait a second Peg, the kids are here. If you want to have sex, they'll have to leave. And if you want it to be good, you'll have to leave. 1685. You whine when you find out that Margalla motel is not your centre 1686. You have a friend/relative in almost every street of Islamabad 1687. You think its perfectly normal to have a 4km park in the middle of the city 1688. You see the same cars every morning when going to school/work 1689. You practically live in Jinnah 1690. You practiacally live for the "Gandey" waley chips from Jinnah and dont like any other chips no matter how good they are 1691. You use to go to "Yummy 36" for ice cream because that was the only ice cream parlour in town 1692. You ditched "Yummy 36" for hot spot when it opened up because it served amazing ice cream1693. You're proud of the fact that hot spot opened in Islamabad first then in Lahore and Karachi 1694. You used to go to "Sogo 2000" for burgers because that was the only burger joint in the city and have celebrated many birthdays there ¤ Vi mora da ste iz Jorka ako… (UK, poglavlje XXXIV) 1695. You meet up at the fountain 1696. You know the name of all the "bars" (not the drinking places) 1697. You pass the Minster every weekend but have never been in it 1698. You promise yourself you'll go on a ghostwalk but probably never will 1699. You wonder how many foreign people's photos you're in. 1700. You know what a "snickelway" is 1701. You start getting pissed off with people in walking boots and wearing backpacks, because you know they're fucking tourists. 1702. You act pissed off when a tourist asks you for directions (but you secretly love it) 1703. You know you shouldn't, but always find yourself eating at Jumbo's 1704. You know Plaggy Terry and/or have a photo with him 1705. You've seen "Janice Church" written somewhere… (who is she?) 1706. You know the only decent cinema is a thirty minute buss ride away 1707. You still get excited when seeing the squirrels in the museum gardens 1708. You don't go to the back of the MuseumGardens because you know, invariably, you will be stabbed 1709. Having Vikings, Romans and dead people walk by you has become a matter of course and you don't give it a second thought. 1710. You've seen every single buskers act in the whole of York, but you'll still stop every now and then to watch it again. 1711. You deliberately walk behind the Zombie to make him jump at you and then act as if nothing's happened, just to impress the tourists 1712. You act as if you dont care when the river floods to the tourists, but when no one's looking, you rush over and have a look 1713. You think you know all the "shortcuts" in York, but tbh, they're always clogged up with shitty tourists 1714. You wait all year for the ice rink and you get excited, but once it's here, you realise how shit it is 1715. You stop and listen to the Christian preachers… Not because they have anyting valid to say, you just fancy some cheap laughs.

When we started in the year 2005, it was very anxious how things might turn out with the new journal started during that time. I am very happy to present you a report on Phcog Mag. for the last 5 years. The journal seems to be flourishing and expanding day by day. High-quality papers are being published in every issue and the issue is being launched on time. It was a remarkable amount of growth when we merged with Medknow Publications and Media Pvt. Ltd. in the year 2009. We are now having an online manuscript submission system (Journalonweb) through which peer review process is much faster. Our site is fully dynamic and the papers being published are now available in multiple formats such as PDF, Full text, ePUB, Sword repository plugin, eBook, etc. We have received only positive comments about the new cover that was introduced last year. So, this will remain in place for the foreseeable future. We have summarized the achievement as highlights of the year 2010\[[Table 1](#T0001){ref-type="table"}\]. We are very thankful to Medknow Publications and Media Pvt. Ltd. for their excellent work in making our journal reach good heights. ###### Highlights of the year 2010 -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- PubMed indexingOnline manuscript submission system (Journalonweb)Articles published in multiple formatIssues are now available in eBook formatReferences are downloaded in different citation formatNew page layout and journal coverNew Editorial BoardInclusion of more than 200 new reviewers, etc.Speedier publication processSwift decisions and faster peer review -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- QUALITY ARTICLES {#sec1-1} ================ We hope you enjoyed reading the articles published last year. We already have enough leading articles for 2010. We had a successful year in 2009, with over 266 submissions. The number of submissions is increasing year by year\[[Figure 1](#F0001){ref-type="fig"}\]. These articles of course will be available online well before their print publication date. Phcog Mag. is known for publishing the issue on time. Our article has passed the litmus test and it is now been indexed in most of the databases such as CAB Abstracts, Caspur, Chemical Abstracts, CSA databases, DOAJ, EBSCO Publishing's Electronic Databases, Excerpta Medica/EMBASE, Google Scholar, Hinari, Index Copernicus, Indian Science Abstracts, Journal Citation Reports, OpenJGate, PrimoCentral, ProQuest, PubMed, Pubmed Central, Science Citation Index Expanded, SCOLOAR, SCOPUS, SIIC databases, Summon by Serial Solutions, Ulrich's International Periodical Directory, Web of Science, etc. Figure 1Number of submissions in the past 5 years PEER REVIEW PROCESS {#sec1-2} =================== On behalf of the Editor-in-Chief and editorial board members, I would like to thank all the reviewers who have helped us in refining the papers submitted to Phcog Mag. We acknowledge them fully for their contribution and we have published a list of all of our reviewers in page 81. [Table 2](#T0002){ref-type="table"} summarizes the acceptance/ratio percentage. Performance of our reviewers is included in [Table 3](#T0003){ref-type="table"}. We are constantly adding new reviewers. Hopefully, we will have large number of active and dedicated reviewers by this year end. Our reviewers review the papers for us on time. Not all the time, our reviewers' response toward my invitation is fruitful. Most of our reviewers remain busy with their busy research or academic schedules. We are extremely thankful to them for spending their precious time in refining the articles of Phcog Mag. ###### Number of Articles submitted along with accepted/rejected ratio during the year 2010 Article type Submitted Accepted Rejected Under review --------------------- ----------- ---------- ---------- -------------- Editorial 8 1 (13) 7 (88) 0 (0) Guest editorial 1 1 (100) 0 (0) 0 (0) Letter to editor 3 2 (67) 1 (33) 0 (0) Original article 240 68 (28) 136 (57) 36 (15) Short communication 14 2 (14) 10 (71) 2 (14) Total decisions 228 74 (32) 154 (68) Total articles 266 74 (28) 154 (58) Courtesy: Journalonweb, Figures in parentheses are in percentage ###### Reviewers' performance for the year 2010 ------------------------------------------ ------------ Total referees 167 Number of reviewers used (/article) 122 (2) Number of reviewers responded (/article) 101 (1) Reviewers on time 135 (111%) Returned late 67 (55%) Never returned 46 (38%) Required reminders 0 ------------------------------------------ ------------ Courtesy: Journalonweb PROCESSING TIME OF MANUSCRIPTS {#sec1-3} ============================== The manuscripts are now peer reviewed using the powerful manuscript handling system, Journalonweb (Courtesy: Medknow Publications). The processing time of the manuscript is improving day by day. As can be seen in [Table 4](#T0004){ref-type="table"}, the number of days to suggest and add reviewers is within a week's time. [Table 4](#T0004){ref-type="table"} also shows the Editor's response toward the reviewers, author's reply, and the publication time. The number of days utilized for a paper is now approximately around 106 days from the time of submission. The total period of publication time from the time of submission is now approximately 56 days. We will try to reduce the time in the coming years by speeding the pagination and editorial/peer review process. ###### Submitted to first decision for the year 2010 -------------------------------------------------- ----------------- Number of articles submitted 266  Days to suggest reviewers 7.63 (0, 51)  Days taken by reviewers 21.44 (1, 42)  Days taken by the Editor for decision 7.50 (0, 78)  Days until paper is under review 36.57 Revisions for the year 2010  Days from first decision until revision arrives 14.82 (0, 79)  Days for the Editor to take decision 1.00 (0, 1)  Days to send revision decision by the Editors 1.00 (0, 1)  Days from revision receipt to revision decision 2 Accepted papers for the year 2010  Days from first submission to acceptance 106.40 (0, 198)  Days from acceptance to publication 56.35 (9, 119) -------------------------------------------------- ----------------- Courtesy: Journalonweb \[[Table 5](#T0005){ref-type="table"}\] summarizes the number of authors registered in manuscript submission site. As can be seen, more and more papers are being submitted from abroad. ###### Results for the year 2010 --------------------------------------------------------------- ----------- Total number of authors registered with the site 337 Number of authors who have submitted manuscripts 215 Number of authors who have submitted more than one manuscript 10 Number of manuscripts from abroad 143 (54%) Number of original articles from abroad 134 (56%) --------------------------------------------------------------- ----------- Courtesy: Journalonweb CHALLENGES AHEAD {#sec1-4} ================ We are constantly working on the quality of articles published in each issue. From January 2011, we have restricted to publish the content covering preliminary studies, etc.\[[@CIT1]\] Further, based on authors' need, we have included many article types from this year. There is a drastic rise in the article downloads from the website and we are expecting that more number of articles will be cited in this year. Phcog Mag. SNIP value for the year 2009 is 0.260 (Courtesy: SCOPUS). It is likely to have Scmiago Journal Ranking (SJR) as we are already indexed in SCOPUS and we are also expecting to have an Impact Factor at the end of this year and I would like to list here the most cited articles from 2008.\[[@CIT2]--[@CIT25]\] Finally, I would like to inform that the publishing cost is very high. As we are not still self-sufficient to cover the cost, we request all the authors to subscribe the journal and strengthen us financially. I wish you a Happy New Year!

Tufts Jumbos The Tufts Jumbos are the varsity intercollegiate athletic programs of Tufts University, in Medford, Massachusetts. The Jumbos compete in the NCAA Division III National Collegiate Athletic Association (NCAA) and the New England Small College Athletic Conference (NESCAC). Tufts does not offer athletic scholarships. Coed and women's sailing are the only Division I sports at the school. Sports The Jumbos compete in the following men and women sports: Men's sports Baseball Basketball Crew Cross Country Football Golf Hockey Lacrosse Sailing Soccer Squash Swimming Tennis Track & Field Women's sports Basketball Crew Cross Country Fencing Field Hockey Golf Lacrosse Sailing Soccer Softball Squash Swimming Tennis Track & Field Volleyball Football The Tufts football program is one of the oldest in the country. The 1,000th game in team history was played during the 2006 season. Historians point to a Tufts versus Harvard game in 1875 as the first game of college football between using American football rules. The team plays at the Ellis Oval, located on the southwest corner of the campus. Sailing In sailing, the Jumbos particularly stand out, competing in the New England Intercollegiate Sailing Association. The sailing team won the Leonard M. Fowle Trophy eight times, along with the 2001 Dinghy National Championship and won more championships in the 1990s than any other team. Several world and olympic champions have been a part of the Tufts Sailing Team; among them, Tomas Hornos (class of 2010), world champion in 2007. Kaitlin Storck was awarded in 2008 the ICSA Women's College Sailor of the Year trophy, and Roger Altreuter in 1975, R. Stuart Johnstone in 1980, Paul Dickey in 1981, and Senet Bischoff in 1996, the ICSA College Sailor of the Year trophy. Other Men's Squash maintains a top 20 Division I national ranking. Tufts University won its first NCAA-sanctioned national team championship when the men's lacrosse team defeated Salisbury in the 2010 Division III men's lacrosse final. Since then, Tufts has captured NCAA Division III National Championships in women's field hockey (2012), women's softball (three consecutive from 2013-2015), men's lacrosse again (2014), and men's soccer (2014). Tufts teams also reached the 2008 championship game in women's field hockey and the 2011 championship game in men's lacrosse. References External links

Q: Get top 3 counts from list using stream I am trying to convert java7 program into java 8. I want below output using stream API. public List<String> getTopThreeWeatherCondition7() { List<String> _Top3WeatherList = new ArrayList<String>(); Map<String, Integer> _WeatherCondMap = getWeatherCondition7(); List<Integer> _WeatherCondList = new ArrayList<Integer>(_WeatherCondMap.values()); Collections.sort(_WeatherCondList, Collections.reverseOrder()); List<Integer> _TopThreeWeathersList = _WeatherCondList.subList(0, 3); Set<String> _WeatherCondSet = _WeatherCondMap.keySet(); Integer count = 0; for (String _WeatherCond : _WeatherCondSet) { count = _WeatherCondMap.get(_WeatherCond); for (Integer _TopThreeWeather : _TopThreeWeathersList) { if (_TopThreeWeather == count) { _Top3WeatherList.add(_WeatherCond); } } } _WeatherCondList = null; _WeatherCondMap = null; _TopThreeWeathersList = null; _WeatherCondSet = null; return _Top3WeatherList; } A: I strongly suggests to adhere to Java coding conventions. Start variable names with a lower case letter instead of _+upper case letter. Second, don’t assign local variables to null after use. That’s obsolete and distracts from the actual purpose of the code. Also, don’t initialize variables with an unused default (like the count = 0). In this specific case, you should also declare the variable within the inner loop, where it is actually used. Note also that you are comparing Integer references rather than values. In this specific case it might work as the objects originate from the same map, but you should avoid that. It’s not clear whether there might be duplicate values; in that case, this loop will not do the right thing. Also, you should not iterate over the keySet(), just to perform a get lookup for every key, as there is entrySet() allowing to iterate over key and value together. Since you said, this code ought to be a “Java 7 program” you should mind the existence of the “diamond operator” (<>) which removes the need to repeat type arguments when creating new instances of generic classes. Instead of sorting the values only and searching for the associated keys, you should sort the entries in the first place. So a clean Java 7 variant of your original code would be: static final Comparator<Map.Entry<String, Integer>> BY_VALUE_REVERSED= new Comparator<Map.Entry<String, Integer>>() { public int compare(Map.Entry<String, Integer> o1, Map.Entry<String, Integer> o2) { return Integer.compare(o2.getValue(), o1.getValue()); } }; public List<String> getTopThreeWeatherCondition7() { List<String> top3WeatherList = new ArrayList<>(); Map<String, Integer> weatherCondMap = getWeatherCondition7(); List<Map.Entry<String, Integer>> entryList=new ArrayList<>(weatherCondMap.entrySet()); Collections.sort(entryList, BY_VALUE_REVERSED); List<Map.Entry<String, Integer>> topThreeEntries = entryList.subList(0, 3); for(Map.Entry<String, Integer> entry: topThreeEntries) { top3WeatherList.add(entry.getKey()); } return top3WeatherList; } This also handles duplicates correctly. Only if there is a tie on the third place, just one of the valid candidates will be chosen. Only if you have a clean starting point, you may look, how this can benefit from Java 8 features Instead of copying the content to a List to sort it, you can create a Stream right from the Map and tell the stream to sort You can create a comparator much easier, or even use one of the new builtin comparators You can chain the task of limiting the result to three elements, map to the key and collect to the result List right to the stream of the previous steps: public List<String> getTopThreeWeatherCondition7() { Map<String, Integer> weatherCondMap = getWeatherCondition7(); List<String> top3WeatherList = weatherCondMap.entrySet().stream() .sorted(Collections.reverseOrder(Map.Entry.comparingByValue())) .limit(3) .map(Map.Entry::getKey) .collect(Collectors.toList()); return top3WeatherList; }

Introduction {#section1-2515841418822288} ============ Axenfeld--Rieger syndrome (ARS) is an autosomal-dominant disorder in which structures of the anterior segment of the eye are improperly developed as a result of impaired neural crest cell migration and differentiation during embryonic development.^[@bibr1-2515841418822288]^ ARS patients present with a spectrum of anterior segment anomalies including a prominent and anteriorly displaced Schwalbe's line (posterior embryotoxon), iridocorneal adhesions, and iris anomalies like policoria, corectopia, hypoplasia, and ectropion uveae. Patients with ARS have an approximately 50% risk of developing glaucoma. Systemic anomalies may also accompany to ARS like the abnormality of the cardiovascular outflow tract, craniofacial abnormalities that consist of tissues of neural crest origin, and dental and skeletal anomalies.^[@bibr2-2515841418822288]^ Pellucid marginal degeneration (PMD) is a usually bilateral, progressive ectatic corneal disorder involving the inferior cornea. The thinning extends 1--2 mm away from the limbus and the cornea above the thinned out area is ectatic. Patients usually present with reduced visual acuity caused by high irregular astigmatism. Corneal topography shows characteristic crab-claw pattern representing inferior steepening with flatter vertical corneal meridian.^[@bibr3-2515841418822288]^ Inferior keratoconus, in which the cone is localized away from the corneal center and a crab-claw pattern is seen on the sagittal topographic map, is often confused with PMD.^[@bibr4-2515841418822288]^ However, both prognosis and management of PMD and keratoconus are different, and PMD should be distinguished from keratoconus.^[@bibr5-2515841418822288]^ Inferior keratoconus does not show the classic band-like inferior thinning that is best demonstrated by a full coverage (12-mm) corneal thickness map. Therefore, analyzing only the anterior corneal surface without additional information is not sufficient in the differential diagnosis of inferior keratoconus and PMD. Although corneal disorders like megalocornea^[@bibr6-2515841418822288]^ and keratoconus^[@bibr7-2515841418822288],[@bibr8-2515841418822288]^ were reported in patients with ARS, PMD was not reported yet. In this case report, we aimed to present the results of corneal crosslinking (CXL) treatment in a case with ARS and unilateral progressive PMD. Case report {#section2-2515841418822288} =========== A 31-year-old male patient of Turkish Caucasian origin presented to hospital with the complaint of slow but progressive vision loss in his left eye. There were not any history of previous intraocular surgery and symptoms of atopy and eye rubber. Corrected distance visual acuity (CDVA) was 20/20 in the right eye and 20/200 in the left eye. Slit-lamp biomicroscopic examination showed posterior embryotoxon, iris hypoplasia, and iridocorneal adhesion in his both eyes, corectopia in the right eye, and peripheral inferior thinning and ectasia in the left eye ([Figure 1(a)](#fig1-2515841418822288){ref-type="fig"} and ([b](#fig1-2515841418822288){ref-type="fig"})). Intraocular pressure measured by a Goldmann applanation tonometer was 13 mmHg in the right eye and 16 mmHg in the left eye. Gonioscopy revealed multiple broad iris processes and prominent Schwalbe's line. The dilated fundus examination showed normal maculas and no evidence of any retinal anomaly. In addition, no glaucomatous changes were detected in the optic disk and retinal nerve fiber layer analysis. Anterior sagittal curvature map (Pentacam HR; Oculus) showed a slightly asymmetric bowtie pattern in the right eye and a crab-claw pattern in the left eye, and the bell sign was seen in the full coverage (12-mm) corneal thickness map in the left eye ([Figure 2(a)](#fig2-2515841418822288){ref-type="fig"} and ([b](#fig2-2515841418822288){ref-type="fig"})). Scheimpflug imaging of the patient also confirmed the peripheral thinning of the left cornea, while the right cornea was unremarkable ([Figure 3(a)](#fig3-2515841418822288){ref-type="fig"} and ([b](#fig3-2515841418822288){ref-type="fig"})). No systemic abnormalities were reported. {#fig1-2515841418822288} {#fig2-2515841418822288} {#fig3-2515841418822288} Topographic examination was compared with a previous (6 months earlier) topographic examination (Pentacam HR) which was evaluated in a different medical center. The comparison showed 1.6-D steepening of maximum keratometry (*K~max~*) and 22-µm decrease of thinnest corneal pachymetry. Therefore, corneal CXL was performed on the left eye. Corneal epithelium was removed mechanically in an 8-mm area which was slightly decentralized through the inferior region. Iso-osmolar 0.1% riboflavin solution was instilled to the cornea every 3 min for 30 min. Ultraviolet A (UVA) irradiation at 3 mW/cm2 was applied for 30 min. The follow-up period was 28 months. Visual acuity, *K~max~*, and corneal thickness were evaluated during the postoperative period. At the 28th month of follow-up, topographic evaluation showed 1.1-D flattening of *K~max~* and 88-µm decrease of thinnest corneal pachymetry ([Figure 4](#fig4-2515841418822288){ref-type="fig"}) compared to preoperative topographic findings and CDVA improved to 20/20 with scleral lens ([Figure 5](#fig5-2515841418822288){ref-type="fig"}). No intraoperative and postoperative complications occurred. {#fig4-2515841418822288} {#fig5-2515841418822288} Discussion {#section3-2515841418822288} ========== ARS develops as a result of improper neural crest cell migration and differentiation of the anterior segment structures. It is an autosomal-dominant disorder.^[@bibr1-2515841418822288]^ Two major genes involved in the pathogenesis of ARS are PITX~2~ and FOXC~1~.^[@bibr2-2515841418822288]^ In addition, Micheal and colleagues^[@bibr9-2515841418822288]^ also found a mutation in the PRDM5 gene in ARS. These genes demonstrate full penetrance and variable expressivity. PMD is characterized by thinning of the corneal stroma. Like most of the anterior segment structures, corneal stroma also originates from neural crest cells. However, any genetic basis is not defined yet for PMD.^[@bibr10-2515841418822288]^ In our case, ARS was bilateral but PMD was unilateral. PMD is a mostly bilateral disorder, and unilateral PMD is rare.^[@bibr11-2515841418822288]^ Therefore, it is unlikely that the PITX~2~ and FOXC~1~ mutation itself is responsible for the PMD findings. The PMD and ARS association in this case is most likely coincidental. Corneal CXL is useful for halting the progression of corneal ectatic disorders like keratoconus, PMD, and post-LASIK ectasia.^[@bibr12-2515841418822288],[@bibr13-2515841418822288]^ The literature concerning the results of corneal CXL in PMD is limited. While corneal CXL has been found to be effective in stopping PMD progression, improving CDVA and reducing irregular astigmatism in numerous case reports,^[@bibr13-2515841418822288][@bibr14-2515841418822288][@bibr15-2515841418822288]--[@bibr16-2515841418822288]^ there is no randomized prospective study evaluating larger groups of patients. Tuffaha and colleagues^[@bibr17-2515841418822288]^ reported a case of progressive PMD treated with corneal CXL after a previous unsuccessful implantation of intracorneal segments. After 1-year follow-up, an increase in corneal biomechanical properties accompanied by an improvement in CDVA was observed. Also Kymionis and colleagues^[@bibr18-2515841418822288]^ present a case of progressive PMD treated by simultaneously photorefractive keratotomy and corneal CXL. At 12 months postoperatively, uncorrected and best-corrected visual acuities improved and corneal topography revealed a significant improvement. Mamoosa and colleagues^[@bibr19-2515841418822288]^ evaluated visual acuity, refractive errors, and topographic outcomes 6 months after corneal CXL in 21 eyes of 15 patients with PMD and their results demonstrated a significant reduction in keratometry values, an improvement in CDVA at the 6th month of follow-up. Bikbov and colleagues^[@bibr20-2515841418822288]^ evaluated the clinical effectiveness of corneal CXL in 16 eyes of 9 patients with PMD and reported that uncorrected and best-corrected visual acuities improved and corneal topography revealed a significant improvement in 1-year follow-up. Only, Steppat and colleagues^[@bibr16-2515841418822288]^ reported a progression of PMD after corneal CXL in 1 of their 13 cases. Also, Uysal and colleagues^[@bibr8-2515841418822288]^ reported that a case with ARS and keratoconus developed sterile keratitis after accelerated corneal CXL (9 mW/cm2). There were no complications after accelerated corneal CXL in our case report. In conclusion, unilateral PMD and ARS were present in our case, which had not been reported previously and PMD progression halted via corneal CXL treatment. This case showed that corneal CXL can be useful for management of PMD. M.K., P.K., M.I., and K.T. performed the medical practices; M.K., P.K., M.I., and K.T. conceived the concept of this study; M.K., P.K., and M.I. performed data collection or processing; M.K., P.K., M.I., and K.T. performed the analysis or interpretation; M.K. and K.T. performed the literature search; M.K., P.K., M.I., and K.T. wrote the manuscript. This case report was partially presented in the 51st National Ophthalmology Congress of the Turkish Ophthalmology Association (24--29 October 2017; Antalya, Turkey). **Funding:** The authors received no financial support for the research, authorship, and/or publication of this article. **Conflict of interest statement:** The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article. **Informed consent:** A written informed consent was obtained from the patient to publish medical data and images.

Associações e imigrantes manifestam-se hoje, às 14.00, no Martim Moniz, em Lisboa, contra o que dizem ser a "alteração na política de imigração para uma política securitária", favorecendo o "trabalho ilegal e a escravatura". E pedem documentos para 30 mil estrangeiros que se encontram em Portugal. Os responsáveis do Serviço de Estrangeiros e Fronteiras - que tem registados 388 731 imigrantes legais - justificam que estão a "aplicar a lei" de 2007 e que, nestes nove anos, foram legalizadas 80 mil pessoas. A manifestação decorre no âmbito do 10.º Festival do Imigrante, na zona do Martim Moniz, cujo lema é "Igualar-te nos direitos, cultura de todos, documentos para todos". Inclui espetáculos e atividades culturais de vários cantos do mundo Timóteo Macedo, presidente da associação Solidariedade Imigrante, promotora do protesto e que envolve outras 46 organizações não governamentais, responde que foram legalizadas muitas pessoas mas que, desde o despacho n.º7/2016, de 21 março, torna-se quase impossível a regularização. "Com a entrada do governo houve uma alteração da norma o que se faz com que se tenha uma leitura diferente da Lei de Estrangeiros. Passou a ser exigido um visto de entrada legal em Portugal para a regularização. Como consequência os imigrantes permanecem em situação irregular. Há uma política securitária e que favorece o trabalho ilegal e a escravatura." A Direção do Serviço de Estrangeiros e Fronteiras considera "infundada" a acusação, lembrando que a Lei de Estrangeiros sempre obrigou à obtenção de um visto adequado nos consulados portugueses, o que no caso de trabalhadores subordinados, implica a obtenção prévia de visto de residência ou de visto de estada temporária. Fechar Subscreva as newsletters Diário de Notícias e receba as informações em primeira mão. Subscrever "Mas isso exclui mais de 90% dos imigrantes. As pessoas não vêm diretamente para Portugal, entram de forma regular no espaço Schengen, um espaço de livre circulação, até aqui chegar. A nova leitura, que não está coberta por uma exposição da lei, diz que a entrada legal passa a ser a de quem tenha um visto Schengen, entrado em Portugal dentro da legalidade do visto e que declarado a sua entrada legal". Em causa o artigo 88/2, que prevê a regularização a título excecional dos estrangeiros "integrados no mercado de trabalho, mas que por algum motivo não tenham seguido o regime geral ou a regra". E o despacho n.º7/2016, justifica o SEF, "limita-se a repor a legalidade no que concerne a um dos requisitos essenciais seja a de entrada legal no país seja ao abrigo da isenção de vistos - como é o caso, por exemplo, dos cidadãos brasileiros - seja com visto nacional, seja com visto Schengen". Até março, os estrangeiros que trabalhassem e pagassem a segurança social tinham hipóteses de regularizar a situação ao abrigo do artigo 88/2, o que deixou de ser possível, desde logo, argumenta Timóteo Macedo, "porque nem se podem inscrever na segurança social". O SEF justifica o despacho de março como uma forma de evitar a exploração laboral. "O que se tornou mais difícil foi a regularização de cidadãos que vivem ilegalmente noutros países do espaço Schengen e eram trazidos a Portugal por redes criminosas só para obterem uma autorização de residência".Salienta a autoridade policial que há exceções para os casos de interesse humanitário e quando se comprove uma permanência já duradoura de cidadãos estrangeiros e inserção no mercado de trabalho". A diretoria nacional do SEF emitiu um despacho, a 4 de julho, que estipula que as situações expostas até à data despacho de março e que tenham sido rejeitadas "exclusivamente por não preencherem o requisito de entrada legal em território nacional possam ser, a título excecional, objeto de reapreciação casuística, com dispensa daquele requisito" Aquele documento surgiu depois da manifestação de imigrantes de 3 de julho. "A nova política é direcionada para as comunidades muçulmanas e do Indostão e, na sequência, da política securitária da Europa. E Portugal podia marcar a diferença, mas não o faz. Ao mesmo tempo que se disponibiliza para receber refugiados está a expulsar mais de 30 mil imigrantes". O Bloco de Esquerda e o PCP apresentaram na Assembleia da República projetos para alteração da Lei de Estrangeiros.

Dabei wäre es einfach, Amthor inhaltlich anzugehen. Er spricht sich gegen die Selbstbestimmung von Frauen beim Thema Abtreibung aus (bento), hält die Ehe für alle für ein verfassungsrechtliches "Unding" (SPIEGEL ONLINE) und befürwortet Abschiebungen nach Afghanistan (Deutschlandfunk). Das alles begründet er und man könnte dagegen argumentieren. Bei einem TV-Talk über Paragraf 219a konnten Amthors Gegnerinnen so sogar seine Sicht auf Abtreibungen ein bisschen verändern. Da gab der Hardliner schließlich zu: "Niemand glaubt, dass eine Frau sich eine Entscheidung über einen Schwangerschaftsabbruch leicht macht, auch wir in der CDU nicht." (bento) Aber diese Art von Dialog scheint viele gerade gar nicht zu interessieren. Da ist ein konservativer Politiker, der nicht wie Christian Lindner im Dreitagebart vom Plakat lächelt. Einer der, entgegen dem Klischee, nicht gockelig durch die Landschaft läuft und anderen ständig seine Männlichkeit aufdrängt. Philipp Amthors Kritiker tun das, was sonst vor allem Rechtspopulisten und rechte Trolle hinbekommen: persönlich werden, Fakten scheuen und immer unter die Gürtellinie zielen. Vielleicht lohnt es, sich an Rezo ein Beispiel zu nehmen. Der YouTuber hat im bento-Interview gesagt, was er von CDUlern hält, die sein "Zerstörungsvideo" nicht ernst nehmen: "Es ist ziemlich peinlich, dass die CDU auf mit Fakten hinterlegte Kritik mit Diskreditierung und dummen Behauptungen reagiert, anstatt darauf einzugehen." Genau das könnte Amthor über viele seiner Kritikerinnen und Kritiker sagen. Korrektur: In einer früheren Version dieses Artikels haben wir das Wort "Netzgemeinde" verwendet.

Chromium as an industrial carcinogen: Part I. Successive cohorts by year of hire at the same chromate plant (1931-1932, 1933-1934, 1935-1937) and the combined cohort (1931-1937) of 332 employees were followed through 1993. A total of 283 deaths (85%) of the total cohort were identified. In the combined cohort (1931-1937), 66 lung cancers were found, constituting 23.3% of all deaths and 64.7% of all cancers. The lung cancer mortality rates are shown over a span of decades, from 15 years to over 55 years, with progressive rise. Observations of lung cancer identified, employees not found, and cancer risk by age at hire are cited. Lung cancer death rates increased by gradient level of exposure to insoluble (trivalent) chromium and to soluble (hexavalent) chromium, with a pattern of increase by total chromium. Age-specific death rates for lung cancer according to the same gradient exposure range for total, insoluble, and soluble chromium are presented. The potential cancer risk extends to all forms of chromium and to total chromium.

Conservation International turns a blind eye to illegal logging in the Cardamom Mountains, Cambodia Last month, the Phnom Penh Post published a shocking article about the illegal logging of rosewood in the Central Cardamom Protected Forest in Cambodia. According to the article, the illegal logging is abetted by military personnel, while Conservation International, which is working with the Cambodian government to manage the protected area, denies that the trade is taking place. The CCPF is one of the largest conservation areas in Cambodia, covering 401,313 hectares. Conservation International has been working to protect the forest since 2001. On one Sunday night in December 2011, Phnom Penh Post journalists counted “at least nine industrial transport trucks, seven pick-up trucks and one Land Rover packed with timber drive out of Koh Kong province’s Thma Bang district in the CCPF on one road alone”. They could hear “large numbers of trucks” driving along a nearby road. The journalists wrote that, Villagers, loggers and conservationists have verified that Forestry Administration officials, military officers and rangers working in partnership with the NGO Conservation International are making no effort to stop the massive trade in protected rosewood. In many cases, it is alleged, they are actively profiting. A conservation researcher who has “worked extensively” in Koh Khong provice’s Thma Bang district told the journalists, “It’s like a gold rush – the value of rosewood is so high, it’s irresistible for cutters and middlemen. It’s all relatively organised, how much the loggers and middlemen have to pay, and to whom. They know which checkpoints they have to go through. It has apparently reached the stage where most young men in Tatai Leu commune [in Thma Bang district] have been absorbed into the rosewood extraction.” The journalists reported the researcher as saying that “officials working with CI stationed at a checkpoint on road 48 – the only avenue out of Thma Bang – are allowing trucks carrying rosewood to drive straight through in exchange for ‘taxes’”. Conservation International denied any wrong-doing whatsoever. David Emmett, Conservation International’s Senior Vice President for the Asia-Pacific Field Division, said in a statement that, “A recent story in a Cambodian newspaper has made a number of claims about the practices of Conservation International (CI) in Cambodia’s Central Cardamoms Protected Forest that are dramatically inaccurate and patently untrue. CI Cambodia completely refutes the suggestion that it is turning a ‘blind eye’ to illegal logging or that it is complicit in any way with the practices alleged in the newspaper story.” Conservation International explained to mongabay.com that it “does not oversee enforcement, and does not maintain or facilitate any checkpoints or rangers in or outside the CCPF.” “Rather, we provide grants to the Forestry Administration to support ongoing monitoring of the CCPF such as upkeep of ranger stations, GPS technology, provision of equipment, outfits and salary supplements to strengthen and increase the numbers of rangers, and diesel for their patrols; in other words, CI provides supportive funding, the government does the patrolling. In fact, CI does not even have staff on the ground in the Central Cardamoms Protected Forest – our team works with the local communities outside this area.” Conservation International provides the money to the Forestry Administration from its Global Conservation Fund. The Global Conservation Fund receives its money from the Moore Foundation and is supposed to “finance the creation, expansion and long-term management of protected areas”. The money, according to Conservation International’s website, supports on-site surveillance and enforcement systems by Conservation International’s Cambodia Program to provide immediate protection for the area, which is under threat from illegal logging and hunting activities. The program advises the Royal Government of Cambodia on protected area management, as well as training and patrolling. Surely Conservation International’s advice to the Cambodian Government, must include something about the importance of dealing with illegal logging? In any case, if Conservation International is paying the Forestry Administration to patrol the Central Cardamom Protected Forest and the Forestry Administration is doing little or nothing to stop large scale illegal logging from taking place, then Conservation International has a problem to deal with. Attempting to pass the buck will solve nothing. Obviously, as a US-based NGO, Conservation International is not responsible for arresting illegal loggers in Cambodia. But pretending that the organisation has no responsibility, despite the fact that it is helping fund the Forestry Administration, is simply unacceptable. In its response to the article, Conservation International states that large amounts of rosewood are not found with the Central Cardamom Protected Forest and that the logging is taking place outside the protected area: “[Rosewood] occurs mostly in open semi-deciduous or broadleafed forest, and is most abundant in lowland forest. Most of the 402,000ha CCPF is entirely unsuitable for rosewood to occur in significant densities due to the high altitude and steep slopes. . . The CCPF consists predominantly of hill evergreen forest with pine forest and montane grasslands on the plateau. The areas described in the article are lowland forests to the south of the CCPF, not the CCPF itself, so this represents an error in geography and is well outside the geography of our project area.” But in a brochure about its work in the CCPF, Conservation International explains that preserving the forests around the CCPF is an important part of Conservation International’s work: Another important component of the strategy has been working in the broader Cardamom landscape beyond the CCPF. Conserving the forests outside the protected area is important for mitigating the effects of climate change. These forests are currently experiencing high rates of deforestation and degradation. Their protection will reduce the amount of carbon being emitted into the atmosphere, contributing positively to climate stabilization. It will also serve to buffer the CCPF from detrimental threats. There is no doubt that illegal logging in Cambodia is rampant and is a serious threat to the forests. The fact is that the Cambodian authorities are unable or unwilling to address illegal logging and are, in some cases at least, directly profiting from it. This has obvious implications for REDD in Cambodia. Unless the underlying causes of deforestation are addressed, including illegal logging, REDD stands no chance of succeeding. It is difficult to see why Conservation International appears stubbornly incapable of grasping this simple point. And while you’re at it, bombard ALL NGO’s receiving grant money from the Gordon and Betty Moore Foundation, which is among the principle funders of Conservation International and The Nature Conservancy, among many other despicable corporate front groups. An alike situation can be found in Western Siem Pang, Stung Tring Province. The situation there is such that BirdLife International Cambodian Program has accepted conservation responsibility for 150,000 ha forest (mainly DDF), but proper forest protection activities are blocked by the Management of that project. The reason behind is the fear of the managers to become target of the Cambodian logging mafia. It is of course very understandable that certain characters are not willing to get into harm’s way. But then such characters should not try to make their living through working as Managers in projects where forest conservation plays a main role. If they do so and block any proper enforcement of the Cambodian forest laws then they degenerate to “helpers” of the logging mafia as I see it done in Western Siem Pang. More details are available through Thomas Kuenzel. REDDisms: We think there’s a 30 percent chance the [carbon] market collapses … That could create a ‘fat tail’ (a very rare event with major consequences) for us to make money.— Anthony Limbrick, chief investment officer of hedge fund firm Pure Capital, June 2009 – Limbrick clarifies this quotation, here

Q: Face Detection algorithm is not working if I click a snap from landscape mode I have used the below code to detect face from an image: -(void)markFaces:(UIImageView *)imagePick { CIImage* image = [CIImage imageWithCGImage:imagePick.image.CGImage]; CIDetector* detector = [CIDetector detectorOfType:CIDetectorTypeFace context:nil options:[NSDictionary dictionaryWithObject:CIDetectorAccuracyHigh forKey:CIDetectorAccuracy]]; NSDictionary* imageOptions = [NSDictionary dictionaryWithObject:[NSNumber numberWithInt:6] forKey:CIDetectorImageOrientation]; NSLog(@"imageOptions %@",imageOptions); NSArray* features = [detector featuresInImage:image options:imageOptions]; if([features count] > 0) { NSLog(@"Face Found"); } else { NSLog(@"Face not Found"); } } and this algorithm is not working if I click a snap from landscape mode. Why? Any help would be appreciated. Thanks in Advance A: I think the problem is in this line: NSDictionary* imageOptions = [NSDictionary dictionaryWithObject:[NSNumber numberWithInt:6] forKey:CIDetectorImageOrientation]; You are actually telling it to look for portrait orientations only as the number you are passing is 6. The documentation in the header file says that: // Options that can be used with -[CIDetector featuresInImage:options:] /* The value for this key is an integer NSNumber from 1..8 such as that found in kCGImagePropertyOrientation. If present, the detection will be done based on that orientation but the coordinates in the returned features will still be based on those of the image. */ And the options are It's annoying that featuresInImage:options: is not documented (I'll have to file a bug now that I've seen it)

Vote triggered after former Labour MP Fiona Onasanya was jailed for lying about a speeding offence. Business tycoon Mike Greene could become the Brexit Party’s first MP in a by-election in the British town of Peterborough on Thursday. The 54-year-old had been a supporter of the Conservative Party until March 29, when Prime Minister Theresa May postponed Brexit by six months, he told the Huffington Post. The millionaire then had the opportunity to stand for the Brexit Party – a seven-week-old political group which takes pride in having no published manifesto beyond a hearty enthusiasm for Britain’s swift withdrawal from the European Union. The by-election was triggered after former Labour MP Fiona Onasanya was jailed for lying about whether she was driving when her car was photographed by a speed camera. In the first use of a “recall petition” since their introduction in 2015, 27 percent of her constituents demanded she be removed from office – far exceeding the 10 percent threshold required. Onasanya had held the seat since 2017, when she defeated the incumbent Conservative MP, Stewart Jackson, by just 607 votes. 190527181736101 In the 2016 Brexit referendum, more than 62 percent of voters in the constituency voted to leave the European Union. In last week’s European Parliament elections, the Brexit Party received most votes of any party in Peterborough, with 38 percent of votes cast. “Latest betting gives The Brexit Party an 82 percent chance of winning,” British bookmakers Ladbrokes tweeted on Wednesday afternoon. Greene led a takeover bid for 140 convenience stores in 2015, and was financially backed by Greybull Capital – the finance firm which owned British Steel until its collapse last month. The shops were rebranded, but crashed into administration a year later at the cost of more than 1,600 workers’ jobs. Also standing for election in Peterborough are Lisa Forbes, the Labour Party candidate who was forced to apologise after “liking” a Facebook post saying Prime Minister Theresa May was being controlled by “Zionist slave masters”, and Conservative candidate Paul Bristow, a former local councillor in West London and a previous parliamentary candidate in the northern England town of Middlesbrough. They are joined on the polling slip by Beki Sellick, the Liberal Democrat who received 3.3 percent of the vote after fighting for the seat in the 2017 election, and Joseph Wells of the Green Party.

Listeria infection inhibits IgE production in regional lymph nodes by suppressing chemotaxis of basophils to lymph nodes. Infection with Listeria induces a dominant shift to the Th1 immune response and inhibits the Th2 response. Papain is frequently utilized in animal models of allergies. Papain administration induces chemotaxis of basophils to regional lymph nodes (LNs) and production of interleukin (IL)-4 by basophils, resulting in a Th2-dominant status and increased IgE production in LNs. In this model, production of immunoglobulin (Ig) E by LN cells is primarily controlled by IL-4 produced by basophils. Based on this model, it was postulated that Listeria monocytogenes (Lm) infection suppresses IgE production by LN cells. Therefore, the effects of Lm infection on a papain-induced mouse model of allergies were investigated. Following s.c. injection of papain, basophils transiently migrated to draining LNs because of the effects of chemokine (C-C) motif ligand (CCL) 24 and secreted IL-4, inducing a Th2 response. Lm infection blocked recruitment of basophils into the popliteal LNs by inhibiting CCL24 production. Papain-induced class switch recombination (CSR) to IgE is inhibited by Lm infection, whereas CSR to IgG1 is not affected by the same treatment. Therefore, the CSR of IgG1 to IgE is basophil-dependent, whereas the CSR of IgM to IgG1 is basophil-independent. Hence, Lm infection suppresses CSR to IgE without affecting CSR to IgG1.

Q: Complex numbers inequality done geometricaly? Let $a \in \mathbb{C}$. Prove that, if $|a+z| \leq |a+1|, \: \forall z \in \mathbb{C}$ such that $|z|=1$, then $a \in [0, \infty)$. After squaring I got $z\overline{a}+\overline{z}a \leq a+ \overline{a}$ and after letting $a=m+ni$ and $z=p+qi$ with $p^2+q^2=1$, I obtained $m \geq 0$ and $n \leq m\frac{\sqrt{1-p}}{\sqrt{1+p}}$, for $p \in [-1,1)$. Choosing $p \in [0,1)$ we can easily see that $n \leq 0$. Similarly we can get $n\geq 0$, thus $m \geq 0$ and $n=0$, so $a \in [0,\infty)$. What I'm asking is whether there is a nice geometrical solution or not. Thanks! A: Here's a geometric interpretation and an alternative proof. Consider the number $a$ and the disk on $\mathbb{C}$ given by all the numbers of absolute value less or equal than $|a+1|$. Then, if $a$ is not pointing to the same direction as $1$, we can "move along" $a$ for one unit distance and end up outside the disk of radius $|a+1|$. Drawing a picture with $a$, $a+1$, disk of radius $|a+1|$ and $a+a/|a|$ makes this intuition clear. Algebraically, the same idea gives another proof of the statement: let's pick $z = a/|a|$, so $|z| = 1$ and see what happens: $$ |a+a/|a||= |a(1+1/|a|)| = |a|(1+1/|a|) = |a| + 1 $$ This choice of $z$ actually maximizes $|a+z|$, which at least geometrically should be clear. Now by the triangle inequality $$ |a+1| \leq |a|+1. $$ In particular the inequality is strict when $a \notin [0, \infty)$, which can be seen by squaring both sides (or just geometrically thinking about the triangle with sides of length $|a+1|$, $|a|$ and $1$). So $|a+1| \leq |a+a/|a||$ with strict inequality whenever $a$ is not a non-negative real number.

Q: Farm scope Event Receiver For some security reasons on one of our farm level solutions, we need to limit some actions using Event Receiver-FileMoving event. However, as known, event receivers can be deployed only by Site or SiteCollection level features. Since the solution that provides the main functionality is on farm scope, we need to be able to apply this event receiver to each and every document library there is. I thought of creating a site level feature for the event receiver, and then enable it on all sites via FeatureActivated event of the farm scoped feature. But it doesn't cover new sites being added after the feature is activated. And since there is no setting for Site level features to "default enable", it doesn't work. Then I found out Site Added event, where I can enable the feature as soon as it's added. But, from what I understand, it's also site(SPWeb) scoped, so new web applications and site collections are not covered. So, any ideas how I can make a farm scoped solution to deploy FileMoving event throughout the farm? Sharepoint 2010/2013 Enterprise edition A: You can use feature stapling to achieve this. You just deploy a simple element file in a feature and activate it at the web application level. <?xml version="1.0" encoding="utf-8"?> <Elements xmlns="http://schemas.microsoft.com/sharepoint/"> <FeatureSiteTemplateAssociation Id="the guid of the feature to staple to new sites" TemplateName="GLOBAL"/> </Elements> Also see this rather informative SP.SE post about feature stapling: What is "feature stapling"?

XRP is rocking the news space again, and this time around, it’s about its price and overall market standing. Of late, there has been a lot of speculation about both the short-term and long-term future of the popular cryptocurrency. After months of great news as the crypto scored major exchange listings, something was bound to happen in the end. While that swelled up, Ripple, the blockchain startup that created XRP, has been gaining a lot of positive publicity. Couple that with the great news of the crypto’s adoption by a major system like Apple Pay, and you have a sharp bull run. XRP is now on a steady rise, with some people suggesting that it could actually be headed to the “moon.” What Really Happened? On Monday, news broke that XRP would be supported by Wirex as an Apple Pay option. Such news was bound to cause a market event, given the advancements in adoption the crypto has made in the last few weeks. Ultimately, this latest news turned out to be the last button that launched the Bull Run. The upscale saw the crypto gain by over 18% to breach the $0.5 barrier and cement a new support level at $0.53-$0.54. Still, most people expect the price to shoot up much higher. There are some analysts who put XRP’s final point at $10 – $15 by year’s end. However, it’s not to be forgotten that XRP has previously set out on its own bull run and later dropped back to its support levels. But this time might be different. Given the predictions from various crypto experts and the general market mood, the cryptocurrency might be headed to a higher place this time. Also, the timing favors this prospect. People have always anticipated a massive market rally to happen during the final months of the year. XRP Market Cap Beats Ethereum One of the most noticeable facts about XRP’s change in the market is its growing market cap. The cryptocurrency then briefly edged out Ethereum to stand at position 2 in the market in terms of market cap, . That begs the big question: Could XRP be on the way to surpass Bitcoin too? What if it did? Ultimately, XRP is bound to attract even more attention as it digs in to maintain the new support level and probably achieve new price milestones. As a matter of fact, it’s hard not to expect such outcome as the crypto scores more major listings and gets adopted by various large financial institutions across the world.

352 B.R. 769 (2006) In re Dontae LACKEY, Debtor. No. 1:06-BK-00679. United States Bankruptcy Court, N.D. West Virginia. September 14, 2006. *770 Dontae Lackey, Morgantown, WV, pro se. MEMORANDUM OPINION PATRICK M. FLATLEY, Bankruptcy Judge. On September 12, 2006, the Debtor, pro se, filed a motion to reconsider the court's order dismissing his Chapter 13 case based on his failure to obtain a pre-petition, budget and credit counseling briefing and based on his ineligibility to obtain a postponement or waiver of that requirement. The Debtor asserts that he desires to convert his case to chapter 7, and that credit counseling is not required for chapter 7 debtors. For the reasons set forth herein, the court will deny the motion to reconsider dismissal, motion to convert case to chapter 7, and motion to waive filing fee. The Debtor filed his Chapter 13 bankruptcy petition on August 7, 2006, accompanied by a motion to waive his pre-petition credit counseling requirement or to extend time for obtaining that counseling. The court entered an order on August 8, 2006, requiring the Debtor to file a written supplement to his motion to waive credit counseling or to extend time for credit counseling, which outlines the attempts made to obtain credit counseling prior to the filing and the exigent circumstances necessitating a waiver of the credit counseling requirement; however, the Debtor failed to file the supplemental documentation. The court held a hearing on that motion on August 30, 2006, at which time, the court found that the Debtor had failed to comply with the provisions of 11 U.S.C. 109(h)(1), and the court dismissed the § petition.[1] The court entered an order on September 1, 2006, memorializing its oral findings. On September 12, 2006, the Debtor filed this motion to reconsider the September 1, 2006 order.[2] The Debtor argues that reconsideration is proper because a chapter 7 debtor is not required to obtain pre-petition *771 credit counseling. A motion for reconsideration is an extraordinary means of relief in which the movant must do more than simply reargue the facts or law of the case. See Hutchinson v. Staton, 994 F.2d 1076, 1081 (4th Cir.1993) (recognizing three major grounds for Rule 59(e) relief: "(1) an intervening change in controlling law;. (2) the availability of new evidence [not available previously]; [or] (3) the need to correct clear error [of law] or prevent manifest injustice."); Stanziale v. Nachtomi, No. 01-403, 2004 WL 1812705, at *2-3 (D.Del. Aug.6, 2004) (stating that a court may grant a motion for reconsideration "if it appears that the court has patently misunderstood a party, has made a decision outside the adversarial issues presented by the parties, or has made an error not of reasoning, but of apprehension."); Dentsply Int'l, Inc. v. Kerr Mfg. Co., 42 F.Supp.2d 385, 417 (D.Del.1999) ("[Motions for re-argument] should be granted sparingly and should not be used to rehash arguments already briefed or allow a `never-ending' polemic between the litigants and the court."). Here, reconsideration of the court's September 1, 2006 order is not proper because the Debtor has not articulated any applicable basis to alter or amend its ruling. Moreover, in order to be a debtor under title 11, an individual must receive a credit counseling briefing from an approved nonprofit budget and credit counseling agency within the 180-day period preceding the date of filing of the petition. 11 U.S.C. § 109(h)(1). The court is able to grant a temporary exemption to the credit counseling requirement, which will give a debtor up to forty-five (45) additional days to complete the credit counseling requirement. 11 U.S.C. § 109(h)(3). In order to receive an exemption, however, a debtor is required to file a certification with the court that outlines unsuccessful attempts to obtain the services, exigent circumstances meriting a waiver, and is satisfactory to the court. Id. "The requirements in section 109(h)(3) are mandatory. The court has no discretion to waive the credit counseling certificate requirement or to grant an exemption and extension unless a certification satisfying all three requirements is filed by the debtor." In re Raymond, No. 06-10275, 2006 WL 1047033, at *1, 2006 Bankr.LEXIS 604, at *3 (Bankr.D.N.H. April 12, 2006) (holding that the court was required to dismiss the debtor's chapter 7 bankruptcy for failure to obtain pre-petition credit counseling services as required by 11 U.S.C. § 109(h)(3)). The credit counseling requirement pertains to individuals who file under chapter 7, as well as chapter 13. The Debtor is not eligible to be a debtor under chapter 13 or chapter 7 based on his failure to obtain the credit counseling prior to filing his petition. The Debtor, however, is free to file another bankruptcy at anytime, and he may, at that time, file an application to waive the filing fee. For the reasons set forth herein, the court will deny the Debtor's motion for reconsideration. The court will enter a separate order pursuant to Fed. R. Bankr.P. 9021. NOTES [1] The Debtor's petition was deficient, and despite a deficiency notice by the court, the Debtor had failed to cure the deficiencies by the August 22, 2006 deadline as required under 11 U.S.C. § 521(a), providing additional grounds for dismissal. [2] In the same motion, the Debtor requests conversion of his case to one under chapter 7 and to waive the chapter 7 filing fees.

Local Involvement Ragnar Relay for UO Denver Dear Urban Outreach Denver friends: We’re nearly there! Of our $5,000 goal, we have raised $2,113.15 so far. This coming weekend is the Reebok Ragnar Colorado. We’ve been training hard and we are really looking forward to finishing this 200 mile race strong! Join us by supporting our cause with a donation. Help us bring in that last $2,886.85! Any amount helps and will be appreciated! Click on the link below to help us reach our goal! On Thursday, March 16, 2017, we will be celebrating our 200th Community Dinner. Will you consider celebrating with us? On Saturday, December 17 we held an outreach in -2 degree temperatures! We distributed 200 care bags, 200 pairs of gift-wrapped socks, as well as several bags loaded with hats, gloves, scarves and coats! We are thankful for two local partners, Passionate Life Church and Community of Faith, who made this possible! Here’s the video! Denver 7News came and captured some great footage of our Thanksgiving Community Dinner, and we made it on the news! Here is the link to the video and article! We are currently running our annual kids summer camp. One of the kids challenged our director to a race, so we thought we would have a little bit of fun with it. Enjoy “The Race.” Last month, Isaac ran the Colfax Marathon to raise support and awareness for our cause! Here is an article that was written about it with some cool photos! Assemblies of God U.S. Missionary Isaac Olivarez, 37, is the director and founder of Urban Outreach Denver. However, he harbored a hatred — to this day, he vividly remembers his intense, passionate distaste for running. But God took something Olivarez “never ever” desired for himself (running), and made it an answer to prayer. “I hated running, absolutely hated running,” Olivarez states emphatically, who serves as a Missionary Church Planter and Developer in Denver with his wife, Jaime, and their three children. “But one of our team members at Urban Outreach Denver was a runner and kept inviting me.” Finally, about four years ago, Olivarez gave in and took a test run. “I couldn’t even run a quarter mile . . . it was awful,” he says. “But I had the sudden realization of how out of shape I was, so even though I hated it, I started running simply to become active again.” What began as an effort to regain some form of fitness resulted in Olivarez shedding 55 pounds and taking part in area 5K races and “Tough Mudder” obstacle-race events. But even though his hatred for running dissolved, running a marathon wasn’t something on his bucket list. That is, until God revealed a way to use running to raise awareness about Urban Outreach Denver (UOD) and help kids at the same time . . . perhaps something He had in mind all along! “Urban Outreach Denver is an inner-city church that is full of drug addicts, the homeless, prostitutes, and hurting and broken people,” Olivarez says. “We run a Thursday night dinner church — community dinners — to feed and minister to a neighborhood called Five Points.” Darlene Robison, senior director of Missionary Church Planters and Developers, says the dinners not only bring the neighborhood together as a community, forging relationships as they share a meal together, there’s also a spiritual aspect. “It is clear that this is a spiritual community as well,” she says. “They eagerly worship, pray, and engage Scripture in a way that encourages each person to take the next step in obedience to Christ.” Olivarez says that he was praying about ways to raise awareness about UOD as well as raise funds to help inner-city and poverty-stricken kids be able to attend the church’s annual summer camp. The summer camp, Olivarez explains, is far more extensive than a typical VBS program. It runs four weeks and provides kids with breakfast and lunch. “About 95 percent of the kids who attend are African-American kids from the neighborhood,” Olivarez says. “The meals we serve are healthy and replace the meals they may now be missing because they’re out of school for the summer.” The camp is filled with activities for the kids, including excursions out of the city for horseback riding and other activities. Olivarez says some of the kids have never been outside of the greater city limits. The camp also builds kids’ character and provides a regular and clear presentation of the gospel message. At the end of the camp, which runs June 27-July 22, each child is presented with a backpack filled with school supplies and a kids Bible. Of course, all of this takes money. “When it was suggested that I run a marathon to raise awareness and help fund the camp . . . ,” Olivarez says, pausing. “Well, let’s just say that’s what it took for me to even consider running a marathon. So, in January, I started training.” “One of the things I love about this missionary team is that they invest their lives in children in such a generous way,” Robison says. “They work hard and love deeply, and I believe God is using them to change the future for many families.” The Colfax Marathon, which is an event that includes numerous race distances, is held annually in Denver, Colorado — this year on May 15. Urban Denver Outreach became a charity partner with the marathon and as a partner, other people could join Olivarez and Urban Denver Outreach and run one of the event races to raise funds for the kids camp. “I had people who I didn’t even know who signed up to run and raise funds for us,” Olivarez says. “We had a lot of exposure — we had people running the 5K, the 10-mile, the half-marathon, and even a marathon relay team for the camp!” Olivarez, however, was the only one on the team who signed up for the marathon. “In my training, I had followed the program and run up to 20 miles,” Olivarez says. “And on that 20-mile run, I felt great, so I was sure I could do the marathon.” For many experienced marathon runners, 20 miles is simply known as the first “half” of the 26.2-mile race. The last 6.2 miles (or 10 kilometers) is often just as physically demanding and much more mentally demanding than the first 20 miles. It was a reality first-time-marathoner Olivarez would experience first hand. “I didn’t hit the wall at 20 miles, but about mile 22 or 23, my legs began hurting really bad — I was hurting really bad,” Olivarez admits. “But then I began thinking of the people I was doing this for, about those who had told me that they couldn’t believe I was running for them . . . I wanted to be able to tell them that I finished for them, that God loves them — they are the ones I thought about those last grueling miles!” Through his efforts (he finished in 4:07) and the efforts of others, Olivarez says they have raised a little over $5,000 so far, which is about half of the amount needed to fund the camp. “We could still make it to $10,000,” he says with optimism. “Additional churches and supporters are giving to my missionary account for the race, so I’m still hopeful that we’ll reach our goal.” Following the marathon, Olivarez put together a short PowerPoint presentation, featuring all those who ran for the church and the camp. When he concluded, the church erupted in cheering. Some may question how anyone can impact someone else for Christ simply by doing something like running. Aside from the money raised for the camp, Olivarez offers this insight: “After the presentation and service that night, one guy, Chuck, was getting ready to leave, when he stopped and became all emotional. He said, ‘Thank you for loving us like you do; it means more than you’ll ever know!’ “But you know,” Olivarez observes, “it’s not what I’m doing for them, it’s what Jesus is doing in them!”

--- abstract: 'We investigate the ac transport of magnetization in non-itinerant quantum systems such as spin chains described by the XXZ Hamiltonian. Using linear response theory, we calculate the ac magnetization current and the power absorption of such magnetic systems. Remarkably, the difference in the exchange interaction of the spin chain itself and the bulk magnets (i.e. the magnetization reservoirs), to which the spin chain is coupled, strongly influences the absorbed power of the system. This feature can be used in future spintronic devices to control power dissipation. Our analysis allows to make quantitative predictions about the power absorption and we show that magnetic systems are superior to their electronic counter parts.' author: - 'Bj[ö]{}rn Trauzettel' - Pascal Simon - Daniel Loss date: April 2008 title: 'AC magnetization transport and power absorption in non-itinerant spin chains' --- Power dissipation is one of the most important limitations of state-of-the-art electronic systems. The same is true for spintronic devices in which spin transport is accompanied by charge transport. In non-itinerant quantum systems, the dissipation problem is reduced since true magnetization transport generates typically much less power than charge currents [@hall2006; @ovchi2008]. This is one of the main reasons for putting so much hope and effort into spin-based devices for future applications [@wolf2001; @awschalom2002; @awschalom2007]. Here, we analyze non-itinerant quantum systems described by a spin Hamiltonian in which ac magnetization transport occurs via magnons or spinons (without the transport of charge). In Ref. [@meier2003], the spin conductance of such a device has been derived with a particular focus on the role of the magnetization reservoirs to which a one-dimensional spin chain is attached. We generalize this theory to the response to an ac magnetization source. This allows us to directly calculate (and thus estimate) the power absorption of such magnetic systems at a given driving frequency $\omega$ using linear response theory. In general, the exchange coupling $J$ in the spin chain and in the reservoirs will be different which is schematically illustrated in Fig. \[fig\_setup\]. It turns out that the difference of the exchange coupling plays a crucial role in the dependence of the absorbed power as a function of $\omega$. The larger the difference the stronger will be the suppression of power dissipation at finite frequencies. At low frequencies, however, the dissipative power is independent of the difference of the exchange couplings and takes a universal value determined by $J$ in the reservoirs. We analyze the ac transport problem in quantum spin chains by a mapping of the spin Hamiltonian coupled to magnetization reservoirs to the so-called inhomogeneous Luttinger liquid (LL) Hamiltonian [@maslov1995; @ponomarenko1995; @safi1995]. Interestingly, the absorbed power that is derived in this letter has an astonishingly simple dependence on the interaction parameters of the LL model, see Eq. (\[W\_result\]) below. This makes it a prime candidate for the experimental observation of LL physics in nature. ![(color online) Schematic of a quantum spin chain coupled to magnetization reservoirs. The magnetic field bias $\Delta B$ changes periodically in time. In the upper part of the figure, we illustrate that the exchange coupling in the spin chain $J_{\rm sc}$ (for $|x|<L/2$) can in general be different from the exchange coupling in the grey-shaded magnetization reservoirs $J_{\rm res}$. As suggested in Ref. [@meier2003], this setup can be realized by a bulk material with an intra-chain exchange much stronger than the inter-chain exchange, where the material is heated to a temperature $T > T_N$ in the central part and cooled to $T \ll T_N$ in the reservoir parts. ($T_N$ is the Néel ordering temperature.)[]{data-label="fig_setup"}](spinchain_setup){width="7.5cm"} In order to describe the system shown in Fig. \[fig\_setup\], we consider a one-dimensional XXZ spin chain in the presence of a time-dependent magnetic field $\mathbf{B} (\mathbf{x}_i,t) = B_i(t) \mathbf{e}_z$ which can be described by the Hamiltonian $H=H_{\rm XXZ}+H_B(t)$, where $$\begin{aligned} H_{\rm XXZ} &=& J \sum_{\langle i,j \rangle} \Bigl( s_{i,x} s_{j,x} + s_{i,y} s_{j,y} + \Delta s_{i,z} s_{j,z} \Bigr) , \\ H_B(t) &=& g_e \mu_B \sum_i B_i(t) s_{i,z} .\end{aligned}$$ Here, $s_{i,\alpha}$ is the $\alpha$-component of the spin operator at $\mathbf{x}_i$, $\langle i,j \rangle$ denotes nearest neighbor sites, $g_e$ is the g-factor, $\mu_B$ Bohr’s magneton, and we assume anti-ferromagnetic coupling with $J,\Delta > 0$. A possible realization of spin chains described by $H_{\rm XXZ}$ is, for instance, a bulk structure of KCuF$_3$ or Sr$_2$CuO$_3$, where the exchange among different chains in the crystal is much weaker than the intra-chain exchange [@tennant1995; @solog2001; @hess2001]. It is well-known that the Hamiltonian $H_{\rm XXZ}$ can be mapped onto a LL of spinless fermions [@haldane1980; @affleck1989; @fradkin1991] $$\label{hll} H_{\rm LL} = \frac{\hbar v}{2} \int dx \left[ g (\Pi(x))^2 + \frac{1}{g} \left( \partial_x \varphi(x) \right)^2 \right] ,$$ where we have ignored Umklapp scattering [@foot1] and made the identifications $v=v_B/g$, $v_B = Ja \sin(k_B a)/\hbar$, and $g=(1+4\Delta/\pi)^{-1/2}$ ($a$ is the lattice constant). In Eq. (\[hll\]), $\varphi(x)$ is the standard Bose field operator in bosonization associated with spinon excitations here, $\Pi(x)$ its conjugate momentum density, $v$ the spinon velocity, $v_B$ the bare spinon velocity (at $\Delta = 0$), $k_B$ the bare spinon wave vector, and $g$ the interaction parameter ($g=1$ corresponding to a non-interacting system, i.e. $\Delta=0$, and, in general for a $H_{\rm XXZ}$ spin chain, $1/2\leq g\leq 1$) [@gogolin1999; @giamarchi2004]. In order to be able to properly describe the effect of reservoirs, we modify the Hamiltonian $H_{\rm LL}$ in the spirit of the inhomogeneous LL model [@maslov1995; @ponomarenko1995; @safi1995] described by a Hamiltonian $H_{\rm ILL}$, where we assign a spatial dependence to $v$ and $g$ such that $v(x)=v_l$ and $g(x)=g_l$ being the spinon velocity and the interaction parameter in the reservoirs (for $|x|>L/2$), respectively, and $v(x)=v_w$ and $g(x)=g_w$ being the corresponding quantities in the spin chain region (for $|x|<L/2$). Within this model, non-equilibrium transport phenomena such as the non-linear $I-V$ characteristics and the current noise in the presence of impurities have been analyzed extensively [@peca2003; @dolcini2003; @trauzettel2004; @dolcini2005; @recher2006]. In this letter, we are interested in a different situation, namely the ac magnetization transport in the linear response regime which should be seen complementary to the electric ac response analyzed in Ref. [@cuni1998; @safi1999a]. The Hamiltonian $H_B(t)$ describes a spatially varying and time-dependent magnetic field $\delta B(x) \cos(\omega t) \mathbf{e}_z$ with $\delta B(x) = -\Delta B/2$ ($\Delta B/2$) for $x<-L/2$ ($x>L/2$). For $|x|<L/2$, $\delta B(x)$ interpolates smoothly between the values $\pm \Delta B/2$ in the reservoirs [@foot2]. The dc ($\omega=0$) magnetization transport of such a system has been analyzed in Ref. [@meier2003] and a spin conductance $G_s=g_l (g_e \mu_B)^2/h$ has been predicted. The magnetization current in linear response to an oscillating magnetic field can be evaluated using the following expression $$\label{im_linear} I_m(x,t) = \int_{-\infty}^\infty d \tau \int_{-\infty}^\infty dy \sigma_0(x,y,\tau) \partial_y \delta B(y,t-\tau)$$ with $$\sigma_0(x,y,\tau) = 2i \frac{(g_e \mu_B)^2}{h} \Theta(\tau) \partial_\tau \Bigl\langle [ \varphi(x,\tau), \varphi(y,0) ] \Bigr\rangle$$ and the expectation value is taken with respect to $H_{\rm ILL}$. For $x>L/2$ and $|y| \leq L/2$, the spin conductivity is given by $$\begin{aligned} \label{sigmas} && \sigma_0(x,y,\tau) = g_l \frac{(g\mu_B)^2}{h} (1-\gamma) \Theta(\tau) \sum_{p=0}^\infty \sum_{\alpha=\pm} \times \\ && \Bigl\{ \gamma^{2p} \delta \Bigl( \tau + \alpha \Bigl( \frac{x-L/2}{v_l} + \frac{L/2-y}{v_w} + \frac{2pL}{v_w} \Bigr) \Bigr) + \nonumber \\ && \gamma^{2p+1} \delta \Bigl( \tau + \alpha \Bigl( \frac{x-L/2}{v_l} + \frac{L/2+y}{v_w} + \frac{(2 p+1)L}{v_w} \Bigr) \Bigr) \Bigr\} \nonumber ,\end{aligned}$$ where $\gamma = (g_l-g_w)/(g_l+g_w)$ is the reflection coefficient of spinon excitations at a sharp boundary with different interaction coefficients $g_l$ and $g_w$ [@safi1995] and $\Theta(\tau)$ the Heaviside function. The resulting spin current under continuous wave radiation reads $$\begin{aligned} \label{imfinal} && I^{({\rm cw})}_m(x,t) = 2(1-\gamma)\frac{g_l v_w}{\omega} \frac{(g_e \mu_B)^2}{h} \frac{\Delta B}{L} \sum_{p=0}^\infty \gamma^{2p} \times \nonumber \\ && \sin \Bigl( \frac{\omega L}{2 v_w} \Bigr) \Bigl\{ \cos \Bigl[ \omega \left(t-\frac{(2p+1/2)L}{v_w} + \frac{L-2x}{2v_l} \right) \Bigr] \nonumber \\ &&+ \gamma \cos \Bigl[ \omega \left(t-\frac{(2p+3/2)L}{v_w} + \frac{L-2x}{2v_l} \right) \Bigr] \Bigr\} .\end{aligned}$$ We clearly observe an interaction-dependence of the magnetization current in Eq. (\[imfinal\]) through $g_l$ and $\gamma$. The presence of higher harmonics due to higher order terms in $\gamma^m$ would be a strong experimental evidence for the spatial inhomogeneity of spin-spin coupling in realizations of XXZ spin chains. The physics behind the result in Eq. (\[imfinal\]) is the following one: the system is driven with a continuous wave due to the ac magnetization source; therefore spinon excitations constantly enter and leave the spin chain from and to the reservoirs. Whenever, they experience a boundary in the exchange interaction, they are partly transmitted and partly reflected with a reflection coefficient $\gamma$. The resulting expression (\[imfinal\]) is the superposition of all possible contributions to the spin current after infinitely many reflection processes. As a natural consequence, one may wonder whether an initial magnetization signal is actually transmitted through the spin chain. This depends crucially on the value of $\gamma$. To answer this question, we look at the magnetization current in linear response to a unit pulse described by $\partial_y \delta B(y,t) = \delta B_p \delta \tau_p \delta(t-t_0) \delta(y-y_0)$ with $y_0 \in [-L/2,L/2]$ (where $\delta B_p$ corresponds to the height and $\delta \tau_p$ to the duration of the pulse). If we plug this expression into Eq. (\[im\_linear\]), we obtain for the spin current $$\begin{aligned} \label{imfinal_up} && I^{({\rm pul})}_m(x,t) = g_l \delta B_p \delta \tau_p \frac{(g_e \mu_B)^2}{h} (1-\gamma ) \Theta(t-t_0) \sum_{p=0}^\infty \times \nonumber \\ && \sum_{\alpha=\pm} \Bigl\{ \gamma^{2p} \delta \Bigl( \tau + \alpha \Bigl[ \frac{x-L/2}{v_l} + \frac{L/2-y_0}{v_w} + \frac{2pL}{v_w} \Bigr] \Bigr) + \nonumber \\ && \gamma^{2p+1} \delta \Bigl( \tau + \alpha \Bigl[ \frac{x-L/2}{v_l} + \frac{L/2+y_0}{v_w} + \frac{(2 p+1)L}{v_w} \Bigr] \Bigr) \Bigr\} . \nonumber \\\end{aligned}$$ The derivation of $I^{({\rm pul})}_m(x,t)$ demonstrates that the initially sharp $\delta$-pulse is decomposed into a sum of infinitely many $\delta$-pulses. Importantly, the amplitude of these pulses decreases by a factor $\gamma$ in a stepwise fashion once in each time interval $L/v_w$ corresponding to the transit time in the wire. So, to answer the question how much signal has been transmitted we have to fix $x$, $y_0$, $t_0$, and $\gamma$ in Eq. (\[imfinal\_up\]) and sum up all the prefactors of the $\delta$-functions that can be non-zero in a given time interval between $t_0$ and $t$. This analysis implies that all the dissipation happens in the leads and intrinsic relaxation is absent which is a direct consequence of the fact that the LL Hamiltonian describes a free boson. Once we introduce impurities the situation is different and intrinsic dissipation matters which we will briefly address below. We now turn to the discussion of the power absorption under continuous wave radiation. It turns out that the absorbed power is an ideal physical quantity to measure the reflection coefficient $\gamma$. We derive the absorbed power of the 1D spin chain using Fermi’s golden rule and linear response theory where particular care has to be taken of the spatial inhomogeneity of systems. The resulting expression is $$\label{W1} W(\omega) = \frac{1}{2} \left\{ \int_{-L/2}^{L/2} dx \int_{-L/2}^{L/2} dy {\rm Re} \, \sigma_0(x,y,\omega) \right\} \left| \frac{\Delta B}{L} \right|^2 ,$$ where $$\begin{aligned} \label{resig} {\rm Re} \, \sigma_0(x,y,\omega) &=& g_w \frac{(g_e \mu_B)^2}{h} \Bigl\{ \cos({\tilde{\omega}} ({\tilde{x}}-{\tilde{y}})) \\ &+& \frac{2 \gamma (1-\gamma^2) \cos ({\tilde{\omega}}) \cos({\tilde{\omega}} ({\tilde{x}}+{\tilde{y}}))}{1+\gamma^4-2\gamma^2 \cos(2{\tilde{\omega}})} \nonumber \\ &+& \frac{2 \gamma^2 \cos({\tilde{\omega}} ({\tilde{x}}-{\tilde{y}})) (\cos(2 {\tilde{\omega}}) - \gamma^2)}{1+\gamma^4-2\gamma^2 \cos(2{\tilde{\omega}})} \Bigr\} , \nonumber\end{aligned}$$ and we have introduced dimensionless variables ${\tilde{x}} = x/L$, ${\tilde{y}} = y/L$, and ${\tilde{\omega}}=\omega/\omega_L$ with $\omega_L=v_w/L$. It is straightforward to do the two remaining integrals in Eq. (\[W1\]) and the final result reads $$\begin{aligned} \label{W_result} W(\omega) &=& g_w \frac{(g_e \mu_B \Delta B)^2}{2h} \left( \frac{\sin ({\tilde{\omega}}/2)}{{\tilde{\omega}}/2} \right)^2 \\ &\times& \frac{1-\gamma^4 + 2 \gamma (1-\gamma^2) \cos({\tilde{\omega}})}{1+\gamma^4-2\gamma^2 \cos(2{\tilde{\omega}})} . \nonumber\end{aligned}$$ This is the main result of our work. It demonstrates that a measurement of the absorbed power due to ac response of the quantum spin chain is a simple and feasible way to measure interaction dependent coefficients such as $g_w$ and $\gamma$. In Eq. (\[W\_result\]), these coefficients just appear as pre-factors and not in a complicated power-law fashion as it is usually the case in observable quantities of systems described by LL physics. In Fig. \[fig\_wofom\], we show the interaction dependence of the absorbed power $W(\omega)$. This demonstrate that stronger repulsive interactions inside the wire with respect to the leads suppress the dissipative power. If we compare Eqs. (\[imfinal\]) and (\[W\_result\]) we observe an interesting finite-size effect, namely that $W(\omega)$ vanishes as $(\sin ({\tilde{\omega}}/2))^2$ close to $\tilde{\omega} \approx 2 \pi$ whereas the leading contribution to $I_m^{({\rm cw})} (x,t)$ vanishes only as $\sin ({\tilde{\omega}}/2)$ close to that driving frequency. Thus, the power absorption is more strongly suppressed than the magnetization current at frequencies close to $2 \pi \omega_L$. This feature can be used in future devices to transfer data at special frequencies with low power dissipation. ![(color online) The absorbed power is shown in units of $W_0 \equiv (g_e \mu_B \Delta B)^2/2h$ as a function of the ac frequency $\omega$ in units of the ballistic frequency $\omega_L=v_w/L$. It is clearly visible that stronger repulsive interactions inside the wire decrease the absorbed power in the system.[]{data-label="fig_wofom"}](wofomega){width="7.5cm"} In the limit $\omega \rightarrow 0$, we obtain $W(0) = g_l (g_e \mu_B \Delta B)^2/2h$ corresponding to Joule heating where $W(0) = I_m^2(\omega=0)/(2G_s)$. We now address the robustness of our main result (\[W\_result\]) against impurity scattering. An impurity can be modeled as an altered link in the $H_{\rm XXZ}$ chain, i.e. a local change in $J$ on a nearest-neighbor link [@kane1992; @eggert1992]. Within bosonization, such a scatterer at position $x_0$ in the system can be written as $H_I = \lambda \cos [ \sqrt{4 \pi} \varphi(x_0,t) + 2 k_B x_0 ]$. If one of the two energy scales $\hbar v_w/L$ or $\hbar \omega$ is larger than $\lambda$ (the bare impurity strength), we can treat $H_I$ perturbatively up to lowest non-trivial order (which is second order in $\lambda$). In the presence of impurity scattering, the spin conductivity that enters into the calculation of Eq. (\[W1\]) is subject to a (small) correction $\sigma_I(x,y,\omega)$ which has been derived for the corresponding electric case in Ref. [@dolcini2005]. For finite frequencies, $\sigma_I(x,y,\omega)$ needs to be evaluated numerically. In the zero frequency limit, one finds power-law corrections to the spin conductance [@maslov1995b; @safi1999b] resulting in power-law corrections to the absorbed power. In any case, as long as either $\hbar v_w/L$ or $\hbar \omega$ are larger than the local change in $J$ of the sample, the effect of impurity scattering is weak. The system which we considered previously consists of a spin chain smoothly connected to reservoirs. One may wonder how the previous result gets modified for isolated finite size spin chains, to which a time-dependent oscillating magnetic field is applied along the chain (such that $dB(x,t)/dx= \Delta B\cos(\omega t)$). For long Heisenberg chains, $H_{\rm XXZ}$ still maps onto a LL of spinless fermions as in Eq. (\[hll\]) but with open boundary conditions (OBC). Following Ref. [@mattsson], we can establish that ${\rm Re}\, \sigma_0^{OBC}(x,y,\omega) = 2g_w\frac{(g_e\mu_B)^2}{h}\sin(\omega x/v_w)\sin(\omega y/v_w)$ for $\omega=\omega_n \equiv \pi n v_w/L$ ($n=1,\cdots, (L-a)/a$) and $0$ otherwise. From this expression, we can infer directly the power needed to spatially shake the spin chain, using Eq. (\[W1\]), $$\label{W_OBC} W_{\rm OBC}(\omega) = g_w \frac{(g_e \mu_B \Delta B)^2}{h} \left( \frac{\sin ({\tilde{\omega}}/2)}{{\tilde{\omega}}/2} \right)^2 \sin^2({\tilde{\omega}}/2),$$ for $\tilde \omega= \omega_n/\omega_L$ and $0$ otherwise. Note that this power cannot be identified as dissipative power because a disconnected LL does not contain a dissipative term. Instead, $W_{\rm OBC}(\omega)$ is the work per unit time needed to shake the system. This is the major difference to the case with leads, i.e. Eq. (\[W\_result\]), where dissipation happens in the reservoirs. In the limit $\omega\to 0$, $W_{\rm OBC}\to 0$ due to the absence of reservoirs. Let us now compare typical values for the absorbed power in electric systems versus magnetic systems. We set $g_l=g_w=1$ for simplicity but keep in mind how finite interactions change the power absorption according to Eq. (\[W\_result\]). The absorbed electric power in the dc limit is given by $W_{\rm el}=(e \Delta V)^2/h$. For a typical electric bias of $\Delta V=1$mV, we obtain $W_{\rm el}\approx 3.87 \cdot 10^{-11}$Js$^{-1}$ whereas the absorbed magnetic power for a typical magnetic bias of $\Delta B=0.1$T is $W \approx 2.59 \cdot 10^{-15}$Js$^{-1}$ (assuming $g_e=2$) which is four orders of magnitude smaller. The rule of the thumb is $W_{\rm el}(\Delta V=0.1 {\rm mV}) \sim W (\Delta B=1 {\rm T})$. Thus, we expect substantial advantages of magnetic systems versus electric systems as far as power consumption is concerned. In summary, we have analyzed the magnetization current and the power absorption of quantum spin chains coupled to magnetization reservoirs with a time-dependent magnetic field applied to the reservoirs. Both physical quantities depend crucially on the difference of the exchange interactions within the wire as compared to the magnetization leads. In fact, we envision to use this dependence as a way to control power dissipation in non-itinerant quantum systems in which magnetization transport occurs via spinons. Finally, we have briefly described the case of a finite size chain and the influence of impurity scattering on spin current. We acknowledge financial support by the Swiss NSF, NCCR Nanoscience, and JST ICORP. [27]{} K.C. Hall and M.E. Flatté, Appl. Phys. Lett. [**88**]{}, 162503 (2006). I.V. Ovchinnikov and K.L. Wang, Appl. Phys. Lett. [**92**]{}, 093503 (2008). S.A. Wolf [*et al.*]{}, Science [**294**]{}, 1488 (2001). , edited by D.D. Awschalom, D. Loss, and N. Samarth (Springer-Verlag, Berlin, 2002). D.D. Awschalom and M.E. Flatté, Nature Phys. [**3**]{}, 153 (2007). F. Meier and D. Loss, Phys. Rev. Lett. [**90**]{}, 167204 (2003). D.L. Maslov and M. Stone, Phys. Rev. B [**52**]{}, R5539 (1995). V.V. Ponomarenko, Phys. Rev. B [**52**]{}, R8666 (1995). I. Safi and H.J. Schulz, Phys. Rev. B [**52**]{}, R17040 (1995). D.A. Tennant [*et al.*]{}, Phys. Rev. B [**52**]{}, 13368 (1995). A.V. Sologubenko [*et al.*]{}, Phys. Rev. B [**64**]{}, 054412 (2001). C. Hess [*et al.*]{}, Phys. Rev. B [**64**]{}, 184305 (2001). F.D.M. Haldane, Phys. Rev. Lett. [**45**]{}, 1358 (1980). I. Affleck, J. Phys. Condens. Matter [**1**]{}, 3047 (1989). E. Fradkin, [*Field Theories of Condensed Matter Systems*]{} (Addison-Wesley, Reading, 1991). The Umklapp scattering term $H_U = \lambda_U \int dx \cos (\sqrt{16 \pi} \varphi(x))$, where $\lambda_U = -\hbar v_B/(\pi^2 a^2)$, that we have ignored in Eq. (\[hll\]), is an irrelevant term (in a renormalization group sense) for $1/2 < g \leq 1$ which corresponds to $\Delta<1$. A.O. Gogolin, A.A. Nersesyan, and A.M. Tsvelik, [*Bosonization and Strongly Correlated Systems*]{} (Cambridge University Press, Cambridge, 1999). T. Giamarchi, [*Quantum Physics in One Dimension*]{} (Oxford University Press, Oxford, 2004). C.S. Peca, L. Balents, and K.J. Wiese, Phys. Rev. B [**68**]{}, 205423 (2003). F. Dolcini [*et al.*]{}, Phys. Rev. Lett. [**91**]{}, 266402 (2003). B. Trauzettel [*et al.*]{}, Phys. Rev. Lett. [**92**]{}, 226405 (2004). F. Dolcini [*et al.*]{}, Phys. Rev. B [**71**]{}, 165309 (2005). P. Recher, N.Y. Kim, and Y. Yamamoto, Phys. Rev. B [**74**]{}, 235438 (2006). G. Cuniberti, M. Sassetti, and B. Kramer, Phys. Rev. B [**57**]{}, 1515 (1998). I. Safi, Eur. Phys. J. B [**12**]{}, 451 (1999). We assume that $1/\omega$ is a long time-scale as compared to typical relaxation times in the reservoirs such that a local thermal equilibrium is established in both reservoirs. Furthermore, we request that $\omega \ll \omega_c = v_B/a$, where $\omega_c$ is the high-energy cutoff frequency of the LL model. Additionally, we assume that the wire is isolated and the spinon number is conserved. C.L. Kane and M.P.A. Fisher, Phys. Rev. B [**46**]{}, 15233 (1992). S. Eggert and I. Affleck, Phys. Rev. B [**46**]{}, 10866 (1992). D.L. Maslov, Phys. Rev. B [**52**]{}, R14368 (1995). I. Safi and H.J. Schulz, Phys. Rev. B [**59**]{}, 3040 (1999). A. E. Mattsson, S. Eggert, and H. Johannesson, Phys. Rev. B [**56**]{}, 15615 (1997).

The invention is based on a priority application DE 01440015 that is hereby incorporated by reference. The invention is related to a method for adjusting time delays between at least two channels in an optical WDM (wavelength division multiplex) transmission system comprising the following steps: Demultiplexing the signals, delaying the signals individually between channels and multiplexing the signals again for the next step (Block 1) remodulating the multiplexed signal with a clock signal of high frequency (Block 2) monitoring the remodulated signal with a low frequency photodetector unit (Block 3) measuring, analyzing the photocurrent of the photodetector, adjusting via an electronic circuit the time delays between the channels (Block 4). The invention is also related to devices for the synchronization of data in an optical WDM transmission system, consisting of the following parts: A wavelength demultiplexer (1) for demultiplexing the incoming data stream in the synchronizer, delay lines (2) for the individual wavelength channels, a multiplexer (100, a modulator (3) modulated by high frequency clock signal (5) and at least one photodetector (4) tapped to output line (B) where the photodetector (4) is connected to an electronic control circuit (6) which is connected to the individual delay lines (2) for an automatic adaption. Wavelength division multiplex transmission systems allows to transmit a high data rate at several wavelengths of a definite wavelength grid. The transmission over large transmission distances occurs the problem of degradation of signals power, signals shapes and signal position in relation to the clock signal. To overcome these problems the signals must be regenerated during the transmission. The invention is related to the regeneration issue of signals and especially for the position recovery of the signals in the digital bit stream. Regeneration of WDM signals has been demonstrated in a solution-based regenerator up to 4×40 Gb/s in the publication “Simultaneously regenerated 4×40 Gbit/s dense WDM transmission over 10,000 km using a single 40 GHz InP Mach Zehnder modulator”, O. Leclerc et al, Elect. Letters; Vol. 36, n° 18. This prior art shows a synchronization of the four channels of different wavelengths. For the remodulation of the signals the signals are multiplexed and fed in a Mach Zehnder modulator driven by a clock signal that was extracted from an individual wavelength channel. Optical delay lines are inserts for the individual wavelength to insure that the pulse signals of the four channels remain time coincident in the modulator. The delay lines are adapted manually to optimize the performance of the transmission system. The arrangement in the prior art document shows a laboratory solution. For a practically solution in a regeneration tool of a transmission system an automatically synchronization in the time domain between several wavelength channels is necessary. It is also known from prior art to synchronize a bit stream signals with help of a clock signal. In the French Patent 2,706,710 a method is described for an automatically synchronization of a single signal by using an electrooptical absorption modulator and a signal derived from the modulator itself. This method can only be applied using an electro-optical absorption modulator and only for one optical channel.

The usage of multi-level elements for current steering digital to analog converters (DACs) is a recent innovation which minimizes the amount of noise current switched to the DAC output at low signal levels. A multi-level e.g. tri-level element is similar to a bi-level element (which can be on or off i.e. 1 or 0) except that its output is reversible resulting in three possible levels (−1, 0, +1). Standard thermometer encoding and data directed scrambling techniques are not applicable to a DAC constructed with tri-level elements. A new scheme, patented by Nguyen et al. (U.S. Pat. No. 7,079,063B1) addresses this problem using data directed scrambling. However, this solution doesn't account for the reversal of current source elements during crossover between the positive and negative domains. The result is low level distortion products. The problem results from the elements being scrambled or shuffled without regard to whether they are output in the positive or negative sense.

Soul on Skin Our Process of Creating Living Art Livingbrush’s “Soul-On-Skin” approach is a bodypainting philosophy that marks one of our original contributions to this modern art form, developed as a result of our unique artistic perspective. “Soul-On-Skin” is our preferred way of creating these one-of-a-kind, fine art pieces, allowing the work to flow organically, in the fully aware and present moment. Livingbrush’s Scott Fray likens it to a practice popular in eastern spirituality known as “Darshan” (or “Soul Seeing”). This technique involves spending a quiet moment with the subject of the painting at the outset, with no clear direction for the art about to be created. This is done in order to allow inspiration to be drawn directly from the model, asking for higher dimensional guidance throughout the process. The art resulting from this practice has yielded dynamic and sometimes surprisingly personal, meaningful results. Scott and Madelyn have many anecdotes related to these types of experiences, often emotionally cathartic and empowering. Is is possible to book them to speak of their experiences to groups of any size, accompanied by rich and beautiful supporting visuals for presentation.

Russia angry, Europe worried after US announces treaty exit Russian politicians accuse the United States on Friday of undermining global security by ending compliance with a nuclear arms treaty; NATO says Russia is at fault for the pact's demise and European countries watch with dismay MOSCOW -- Russian politicians accused the United States on Friday of undermining global security by ending compliance with a nuclear arms treaty, while NATO said Russia was at fault for the pact's demise and European countries watched with dismay. The U.S. announced it would stop observing the Intermediate-Range Nuclear Forces treaty as of Saturday and would withdraw within six months from the pact, a cornerstone of international security since 1987. The treaty signed by the United States and the Soviet Union bans the development, deployment and testing of land-based nuclear weapons with a range of 500 to 5,500 kilometers (310-3400 miles). Moscow and Washington have for years traded claims of the other party being in violation. Before Friday's announcement, the United States alleged that a new Russian missile breached the treaty. Russia in turn accused the United States of unilaterally seeking to neuter the agreement and of resisting Russian attempts to resolve the dispute. "I 'congratulate' the whole world; the United States has taken another step toward its destruction today," Konstantin Kosachev, head of the foreign affairs committee in the upper house of Russia's parliament, said. Another Russian senator, Igor Morozov, alleged the move "carries a threat to the entire system of international security, but first of all for Russia, because after leaving the INF the Americans will deploy these missiles in European countries," However, the end of the treaty could also serve Russia's strategic interests, removing any obstacle to Moscow deploying intermediate-range missiles that could reach Europe and China. U.S. officials had expressed worry that China was gaining a significant military advantage in Asia by deploying large numbers of missiles with ranges beyond the treaty's limit. Leaving the treaty with Russia would allow the United States to counter the Chinese, but it's unclear how the Pentagon might try to do that. Washington's decision was received with anxiety in Europe despite an assertion by the head of NATO that Russia has been in violation of the treaty for several years. "All NATO allies support the U.S. decision today to start the withdrawal process, but it will take six months before that process is completed," NATO Secretary General Jens Stoltenberg told The Associated Press in an interview Friday. "We continue, therefore, to call on Russia to come back into compliance and fully respect the INF Treaty." Stoltenberg said the Russian missile system at the center of the current dispute "can reach most of Europe, and that's exactly why European allies are so extremely concerned." The Europeans are keen to avoid a repeat of a crisis in 1983, when NATO allies decided to deploy U.S. cruise and Pershing 2 ballistic missiles as negotiations with Moscow faltered over Russia's stationing of SS-20 missiles in Eastern Europe. Before word of the U.S. withdrawal came from Washington, European Union foreign policy chief Federica Mogherini called on both countries to stick to the treaty. "What we definitely don't want to see is our continent going back to being a battlefield or a place where other superpowers confront themselves," Mogherini told reporters in Romania. An independent Russian military analyst, Pavel Felgenhauer, told The Associated Press that in order "not to get the Europeans too angry," Russia "will deploy (intermediate-range missiles) on a not very quick basis. "So there most likely will no immediate arms race," Felgenhauer said. ——— Alison Mutler in Bucharest, Lorne Cook and Raf Casert in Brussels, David Rising in Berlin and Danica Kirka in London contributed.

Matthias Bartke Matthias Bartke (born 16 January 1959) is a German politician of the Social Democratic Party of Germany (SPD). He was elected a member of the German parliament (Bundestag) in the federal election of 2013. Since January 2016 he has been the legal advisor and thus a member of the executive board of the SPD Parliamentary Group. Early life and education Bartke grew up in Fischerhude near Bremen. After his Abitur in 1978, he finished his military service in Rotenburg an der Wümme. He studied law in University of Hamburg (1981-1987). After that he worked as a lawyer in Altona, Hamburg. From 1987 till 1991 he was a research consultant at the Institute for Peace Research and Security Policy (IFSH) at the University of Hamburg. He holds a doctoral degree in law. He complete his PhD (Thesis: "Defence mission of the Bundeswehr: a constitutional law analysis" („Verteidigungsauftrag der Bundeswehr: eine verfassungsrechtliche Analyse“) in 1991. Early career In 1991 Bartke entered the civil service in Hamburg. He had various executive positions at the Social Security Office of Hamburg at the department for Labour and Social affairs, Family and Integration. After the Hamburg state election of 2011, he was the office manager of Senator for Social Affairs, Detlef Scheele. From January 1, 2013 until his election as a Member of the German Bundestag Bartke was the manager of the legal department of the Social Security Office of Hamburg. Until 2014 he was the board chairman of the Foundation Lawaetz. Political career Bartke has been a member of the SPD since 1978. He was an active member of the Jusos and a member of the district committee of Jusos in Altona. Bartke was a member of the district assembly of Altona, Hamburg from 1986 till 1989. He was then elected as the chairman of the SPD Altona North-District. In 1996 he was elected as a member of the SPD Altona-District Executive, where he served temporarily as Chairman in 2008. Bartke was a member of the SPD-state board between 2008 and 2010. He was the founder chairman of the consortium "Selbst aktiv" for people with disabilities in SPD Hamburg. Member of the German Bundestag, 2013–present Bartke has been a Member of the German Bundestag since the 2013 federal elections, after winning in the electoral district of Altona, Hamburg with 34.9% of the first votes. Bartke has since been serving on the Committee for Labour and Social Affairs, with a main focus on labour and disability policy; he was elected chairman of the committee in March 2018. In addition, Bartke has been a member of the parliament’s Council of Elders and of the Committee for the Scrutiny of Elections, Immunity and the Rules of Procedure since January 2016. From 2013 until 2017, he was also a member of the Committee on Legal Affairs and Consumer Protection, where he served as his parliamentary group’s rapporteur on human trafficking, conservatorship and cooperatives, and a substitute member of the Committee on Foreign Affairs. In addition to his committee assignments, Bartke also serves as vice-chairman of the German-Japanese Parliamentary Friendship Group. Within the SPD parliamentary group, he belongs to the Parliamentary Left, a left-wing movement. Other activities Sozialverband Deutschland, Member German United Services Trade Union (ver.di), Member Arbeiterwohlfahrt, Member Personal life Bartke is married and has one son. References External links Homepage of Matthias Bartke (in German) Biography, speeches and vote history of Matthias Bartke on the Website of the German Bundestag (in German) Facebook page of Matthias Bartke Category:1959 births Category:Social Democratic Party of Germany politicians Category:University of Hamburg alumni Category:Living people

Q: Cant overriding class when mapping with NHibernate I have one class "MyClass" mapping with NHibernate but at my database table name is upper case("MYCLASS"). I'm trying to make a integrated test, and when execute my test i got sql error ("Dynamic Sql Error"), i check the problem and my query is comming with double quotes at table name. public class MyClass { public virtual int ID { get; set; } public virtual int NAME { get; set; } } How can i change NHibernate for dont use double quotes in table name query? A: I found a solution, in mapping just have to add a property Table("TableName"). public class MapMyClass() : ClassMap<MyClass> { public MapMyClass{ Table("MYTABLE"); Id(c => c.ID); Map(c => c.NAME); } }

List of sport venues in Cardiff This is a list of sport venues in the city of Cardiff, capital of Wales. Cardiff Arena The Cardiff Arena, also known as the Cardiff Bay Ice Arena, is a temporary public ice rink that is part of the Cardiff International Sports Village (ISV) in Cardiff Bay. It has a capacity of 2,500 for ice hockey and is the home venue of the Cardiff Devils. The Ice Arena, which replaced the Wales National Ice Rink demolished – as part of the Cardiff city centre St David's 2 retail scheme – opened on 6 December 2006, after a number of delays. Cardiff Arena, operated by Planet Ice, is a temporary structure that will remain open while a new arena is built in the ISV. Development of the new permanent rink design is due to start in late September 2010, and work is due to begin in early 2011, subject to planning, with the ice arena to be completed by February 2012. Planet Ice will run the rink as well as design and build it. Cardiff Arms Park Cardiff Arms Park is a rugby union stadium situated in the city centre. One of rugby union's most famous stadiums, it is home to Cardiff RFC and (until 2009 when they moved to the Cardiff City Stadium) was also home to the Cardiff Blues. Previously the site had two stadiums: the Cardiff Rugby Ground and also the National Stadium. Until 1966 it was also home to the only Welsh first-class cricket club, Glamorgan County Cricket Club. The Arms Park officially opened on 7 April 1984, but by 1999 the Millennium Stadium, which was the fourth redevelopment of the Cardiff Arms Park site since 1881, had replaced it as the national stadium of Wales. The future of the remaining Cardiff Rugby Ground has been in doubt since the announcement in 2007 that the Cardiff Blues would be moving to the new Cardiff City stadium. The site has been host to many sports apart from rugby union and cricket, including athletics, association football, greyhound racing, tennis, British baseball and boxing. The National Stadium also hosted many music concerts including The Rolling Stones, U2 and Michael Jackson. Cardiff City Stadium Cardiff City Stadium () is a 33,250 all-seated ground in the Leckwith area of the city, which is the home of Cardiff City Football Club. Owned and operated by Cardiff City F.C., the stadium also hosts the home matches of the Cardiff Blues rugby union team until 2029. After the Millennium Stadium, it is the second largest stadium in Cardiff and in Wales. The stadium is part of the Leckwith development. A branded sponsor name will be assigned as and when the naming rights sell. The stadium was officially opened on 22 July 2009, with Cardiff City drawing 0–0 in a friendly against Celtic. Municipal leisure centres Channel View Leisure Centre in Grangetown has been open since 2002. The centre includes three badminton courts, a squash court, a climbing wall, a fitness suite and an outdoor all weather 5-a-side pitch. Other activities available at the centre include badminton and netball. Eastern Leisure Centre () in Llanrumney has been open since 1982. The centre comprises a swimming pool, six badminton and five squash courts, a multi-use sports hall, a fitness suite and an outdoor tarmac 5-a-side pitch. Other activities available at the centre include bowls, netball, table tennis, trampolining and gymnastics. Sports clubs using the Eastern Leisure Centre include City of Cardiff Swimming Club and Cardiff Volleyball Club. Fairwater Leisure Centre () opened in 1983. The centre comprises a swimming pool, four badminton and four squash courts, a sports hall, a fitness suite and an outdoor skate park. Other activities available at the centre include gymnastics, trampolining and soccer. Sports clubs either based at, or using Fairwater Leisure Centre include the BBC football club, Cardiff Triathletes and City of Cardiff Swimming Club. Llanishen Leisure Centre (), the county's largest, opened in 1987. The centre comprises a leisure pool with wave machine, six badminton and three squash courts, a multi-use sports hall, a fitness suite and mini gym. Other activities available at the centre include gymnastics, trampolining and soccer. Pentwyn Leisure Centre () opened in 1989. The centre comprises a leisure pool with wave machine, three badminton and three squash courts, a multi-use sports hall, a fitness suite and an outdoor skate park. Other activities available at the centre include basketball, bowls, gymnastics and trampolining. Star Centre () in Splott opened in 1981 and was taken over, and refurbished, by Cardiff council in 2001. The centre includes six badminton courts, basketball, netball and indoor 5-a-side courts, a gymnasium and a fitness suite. Other activities available at the centre include trampolining and table tennis. Sports clubs based at the Star Centre include the Capital Gymnastics Club. Western Leisure Centre () in Caerau opened in 1979 and was refurbished in 2008. The centre comprises a swimming pool, a gymnasium/fitness suite and an outdoor floodlit multi-use games area (MUGA). Activities available at the centre include basketball, football, gymnastics, tennis and trampolining. Sports clubs based at the Western Leisure Centre include Western Warriors Swimming Club. Cardiff City House of Sport There is a further plan to develop HOS3 which will provide additional disability and niche sport facility provision to the City of Cardiff and will also serve to help grow the current sports education provision at the House of Sport. The Phase III Hall will extend and build on the principles and philosophies of the two current successful facilities and will adjoin phases I and II, expanding House of Sport coaching centre into new and niche sporting areas. The new House of Sport Hall will be constructed for a capital cost of £1.5m. Cardiff Gol Football Centre Gol Cardiff is Cardiff's and Wales' only indigenous 5-a-side and 7-a-side company and launched the country's first purpose-built football facility in Cardiff in January 2006. They were also the first company in Wales to make 3G rubber crumb pitches publicly available. In April 2016, Gol Cardiff introduced innovative video technology which has allowed them to capture up to 10 league games per night, with all clips captured uploaded to YouTube. Cardiff International Sports Stadium The Cardiff International Sports Stadium, opened 19 January 2009, replacing the Cardiff Athletics Stadium (demolished to make way for the Cardiff City Stadium) is a 4953 capacity, multi sport/special event venue, offering fully certificated international track and field facilities, including an international standard external throws area. The stadium houses the Headquarters of Welsh Athletics – the sport's governing body for Wales – and the Cardiff Amateur Athletic Club (Cardiff AAC). Cardiff Council has approved a proposal put forward by Cardiff and Vale College and the Cardiff City House of Sport to lease Cardiff International Sports Stadium. Cardiff International Sports Village When complete, in addition to the Cardiff International Pool, the International Sports Village (ISV) complex will provide Olympic standard facilities for sports including boxing and fencing, gymnastics, judo, white water events (including canoeing and kayaking) and wrestling as well as a snow dome with real snow for skiing and snowboarding, an arena for public ice skating and ice hockey, and a hotel. Some of the facilities at the ISV were used as training venues for the London 2012 Olympics. Cardiff International Pool The GBP32m Cardiff International Pool in Cardiff Bay – part of the GBP1bn International Sports Village (ISV) – is the only Olympic-standard swimming pool in Wales. It opened to the public on 12 January 2008 and was officially opened on 26 February 2008 by Duncan Goodhew. The building includes two pools: an Olympic size 10-lane competition swimming pool with seating for 1,000 spectators, and a 4-lane indoor waterpark with flume rides, a beach area with water slides, a lazy river and jacuzzi. The centre also has a fitness suite and studios, conference rooms and a café. Cardiff International White Water Cardiff International White Water is a £13.3m Olympic standard canoeing and kayaking centre that opens on 27 March 2010 as part of the Sports Village. It is expected to attract 50,000 visitors a year and play a part in the London 2012 Olympics. Coronation Park Coronation Park, adjacent to Sloper Road, Grangetown is the home of Grange Albion Football Club, who play in the Cardiff and District Premier Division. It includes changing facilities, built in 1997. Guildford Crescent Swimming Baths The Corporation Baths at Guildford Crescent were opened in April 1862, including a first class and a second class swimming pool. It was given over exclusively to children after the Empire Pool opened in 1958. The baths eventually closed in March 1984 and were demolished. Maindy Centre The Maindy Centre () comprises a full size football pitch within a floodlit outdoor cycling velodrome, BMX pump track, fitness suite, dance studio, outdoor tarmac 5−a−side pitch and a six lane swimming pool. The cycle track (previously known as Maindy Stadium) was relaid in 2006. It was one of the venues used in the 1958 British Empire and Commonwealth Games, when the site included a six lane running track (since removed). The swimming pool opened in 1993. The Maindy Centre is home to several sports clubs, including the Maindy Flyers Youth Cycling Club, Squid Flyers Swimming Club, Maindy Corries Football Club, Maindy Higashi Karate Club, Maindy Triathlon Club, and Maindy Rookie Lifesaving Club. Millennium Stadium The city features an international sporting venue, the 74,500 capacity national Millennium Stadium (), where Wales' national rugby and football teams play. The Millennium Stadium was built on the site of the former National Stadium, Cardiff Arms Park and was opened in 1999, in time to host the 1999 Rugby World Cup, including the final. The Millennium Stadium also doubles up as a venue for other concerts and events such as motorsport's World Rally Championship as part of Wales Rally GB, with the first ever indoor special stages of the World Rally Championship being held at the Millennium Stadium in September 2005. It has continued to host this annual event. One of the annual Speedway Grands Prix is staged on a purpose built full size track in the Millennium Stadium. The Grand Prix is a round of the World Speedway Championship event. Speedway was first staged at Cardiff White City greyhound stadium during the pre-war era with the first meeting being staged around Christmas 1928. In the early 1950s, a dedicated speedway stadium was constructed in Penarth Road and the Cardiff Dragons raced in the National League Division Three for a short spell. The Millennium Stadium has been selected as one of the football venues for the London 2012 Olympics, according to the chairman of the Organising Committee, Lord Coe. National Indoor Athletics Centre The city's indoor track and field athletics sports venue is the National Indoor Athletics Centre, an international athletics and multi sports centre at the University of Wales Institute (UWIC) campus, Cyncoed. The track facilities include: 200m, 4 lane banked track 60m, 8 lane straight track 120m, 6 lane straight track which finishes outside the main arena. Sophia Gardens Sophia Gardens is a 16,000 capacity, cricket stadium on the west bank of the River Taff in Cardiff, about one mile (1.6 km) north west of the Millennium Stadium. Sophia Gardens is home to the Glamorgan County Cricket Club. The cricket club has played first-class cricket matches at the venue since 1966, after moving away from Cardiff Arms Park. A 125-year lease of the ground was acquired in 1995, after the previous leaseholders, Cardiff Athletic Club, moved to their cricket section to the Diamond Ground in Whitchurch, Cardiff. The ground was the venue for the first test match of the Ashes series between England and Australia, played from 8 to 12 July 2009. From March 2008 to April 2018 the grounds were known as SWALEC Stadium for sponsorship reasons. Beside the cricket ground is the large sports hall complex of the Sport Wales National Centre. Cardiff Corinthians F.C. previously used the area for football. Sport Wales National Centre The Sport Wales National Centre () was established in 1972 to provide facilities to help develop excellence in Welsh sport. The institute has indoor sports halls, next to Glamorgan CCC's SWALEC Stadium in Sophia Gardens. Sports activities in the Main Hall include gymnastics, table tennis, trampoline, badminton, netball, basketball, archery, martial arts, fencing, dance and boxing. The site also contains squash courts and weight training rooms. Outdoors, the Institute has an international standard permeable artificial pitch, which is one of the home international venues for Welsh hockey. The pitch is also used for lacrosse and football. Their outdoor tennis courts are also used for netball and five-a-side football. Welsh national teams that train at the Sport Wales National Centre include the Welsh National Rugby team (on the institute's full-size, floodlit rugby pitch), Welsh National Badminton team, the Women's Welsh National Netball Team and the Welsh National Gymnastic Team. Wales Empire Pool The Empire Pool was an international standard swimming pool building, constructed in the city centre for the 1958 British Empire and Commonwealth Games (hosted by Cardiff). It was demolished in 1998 to make way for construction work on the new Millennium Stadium. See also List of places in Cardiff Sport in Cardiff References Sport venues Category:Lists of sports venues by city

In Door Wide Open: A Beat Love Affair in Letters, 1957-1958 by Jack Kerouac and Joyce Johnson, Kerouac writes to Joyce, “It was a good thing you didn’t come back on the ship with me because it only went to big gas tank barges off Perth Amboy.” Kerouac was headed on the Yugoslavian freighter to North Africa on a Sunday, February 15, 1957, and would meet William Burroughs in Tangier. Joyce Johnson writes in Minor Characters: A Beat Memoir, “I was going to stay on board all night and leave in the morning before the Slovenia went on to Perth Amboy to take in fuel.” Perth Amboy, New Jersey: tankers, tugs, barges, oil refineries, storage tanks and towers, a massive smelting and refinery company, cooper works, cable works, dry docks. What type of date would Joyce and Jack have had in the late 1950s? Being that he was mostly always broke, she could have bought him hot dogs downtown at the Coney Island restaurant or from a pushcart. They could have walked along the waterfront on the boat basin wooden piers and climbed the stairs of Bayview Park, ambled along streets lined with big old houses and mature trees or strolled on the beach, checked out the colonial cemetery at St. Peter’s Episcopal Church (1685), or taken a look at numerous synagogues, Catholic churches, Greek and Russian Orthodox churches, Byzantine rite churches, Methodist, Presbyterian, or Lutheran churches. They could have stopped at taverns and saloons and bars, plenty of those. In fact, Harbor Light tavern was right on the waterfront with a backyard and boat slip looking out at Raritan Bay across from Staten Island. Jack probably would have felt quite at home and the drinks were cheap, cheaper than New York. With its immigrant mix: Irish, Hungarian, Ukrainian, Russian, Polish, Slavic, Scandinavian, Jewish, Italian, established African Americans, newly arrived Puerto Ricans, and even a few French -Canadians, in some ways with its red-brick factories, Perth Amboy had similarities to Lowell, both Northeastern industrial cities (Lowell twice as large in area and population) with all-important rivers that provided both an identity and a livelihood for its residents. Joyce could have gone shopping in the downtown area where there were several furriers, hat shops, dress shops, lingerie shops, jewelers, fabric stores, a department store, furniture stores, hardware stores, five-and-tens, bakeries—a Jewish bakery that sold famed rye bread and kosher butchers—but being that Joyce was bohemian and secular, Jack and Joyce could have spent time digging the locals at the train station with trains headed to New York City or south to the shore, and they may have seen bums or even a hobo—they certainly would have seen rough characters—or they could have walked over the Outerbridge or taken the ferry to Staten Island and bought farm-fresh eggs or gone horseback riding. Or they could have hopped on a bus and gone back to New York (about twenty-five miles north). They could have browsed in the record store or stopped at a coffee shop or a soda fountain or maybe the farmer’s market to buy a chicken or vegetables. Whatever they did, there would have been things to do and something to write about. Or being that Jack and Joyce were bookish, they could have gone to the Perth Amboy Library and read the newspapers. And if Jack was looking (who, Jack?), he probably would have seen a few dark fellaheen beauties. On Jack’s ocean-bound ship from New York, perhaps the route taken was through the Kill Van Kull—a tidal strait between Staten Island and Bayonne that connects Newark Bay with Upper New York Bay—past the Arthur Kill ship graveyard, and through the Arthur Kill—a major navigational channel of the Port of New York and New Jersey, with its numerous fuel and chemical storage facilities. After the ship fueled up, it headed for the high seas from Raritan Bay to the open Atlantic. “The barge…was beaten…beat…” Antony and Cleopatra Act II, Scene II (GK Stritch was raised in Perth Amboy, New Jersey, and her family has lived there for four generations.) (“Headed for the High Seas” www.studiostu.biz/highseas groovy jazz by seaman Victor Deribeprey)

Q: Heartbleed bug and Altcoins Bitcoin recently released V 0.9.1 patching vulnerabilities from the Heartbleed bug, however I have not seen anything from any alt coin. What are the possible security risks associated with using these coins? And what are the risks to the coins themselves? A: I've done a little research on this as it was a big concern, not to worry! This is only an issue if you have a bitcoin (or altcoin) daemon set up with RPC over HTTPS. This would only be used if say, you have a daemon running on one VPS and another node which asks it to send money. Source: http://www.cryptocoinsnews.com/news/openssl-heartbleed-security-bug/2014/04/08 This is disabled by default and unless you were using RPC over SSL there is no need to worry :) If you have been using RPC for any coin I would say a good practice would be to generate a new wallet and send funds there.

13 = 0. Is l a multiple of 72? True Let r(k) = 5*k**2 + 5*k + 5. Let p be r(-1). Is 25 a factor of 398/((-55)/(-10) - p) + 4? True Let z be (-1)/(4/(-6)*9/12). Suppose -f - 326 = -4*s + z*s, 4*f = 5*s - 818. Suppose 6*c - 12*c = -s. Is c a multiple of 7? False Is 201603/85 - 8/(-40) a multiple of 8? False Let r = -997 + 3838. Does 23 divide r? False Suppose -41*g + 21*g - 24*g = -453376. Does 8 divide g? True Let c = 269 - 266. Let v be 1/6 + 509/6. Suppose -c*z = -v - 14. Is z a multiple of 2? False Suppose -163*l = -162*l - 2. Is 17 a factor of l/(-15) + (-41205)/(-225)? False Suppose 150 = -2*v + 40. Let c = -25 - v. Let t = 40 - c. Is 10 a factor of t? True Let z(w) = -522*w - 29. Suppose 0 = 95*k - 93*k + 2. Is z(k) a multiple of 17? True Let m = 38541 - 23376. Is 27 a factor of m? False Suppose 1080 = 25*x - 10*x. Is 15 a factor of (123/9 - 7)*x? True Let d be -5 - ((-40725)/36 + 3/12). Suppose 2*k - 5547 = -5*p, 3*p - d - 2227 = 5*k. Is p a multiple of 35? False Suppose 489*j - 412*j - 1715560 = 0. Is 20 a factor of j? True Let v = -132 - -237. Let b = 11 - 8. Suppose -4*c - s = -454, -s - v = -c + b*s. Is 18 a factor of c? False Suppose -7*z = -11*z + 5660. Let b = z + -665. Does 26 divide b? False Let g be (396/(-231))/((-2)/7). Let o(w) = 24*w - 102. Is o(g) a multiple of 42? True Suppose 3*o + 43 = 2*o + 2*p, p + 204 = -5*o. Let d(x) = x**2 + 41*x + 108. Does 4 divide d(o)? True Suppose 0 = -2*h - 4*x + 40, -27 - 40 = -5*h + x. Suppose -1381 = -h*l + 1979. Does 8 divide l? True Let t(m) = 3*m**2 - 10. Suppose 0*a = q + 2*a, -5*a - 10 = 0. Let v be t(q). Suppose -x + 146 = v. Is x a multiple of 54? True Suppose -2*c - 390 = 2*f, 2*f = 3*c - c - 398. Suppose -4*s + 2*i = 1410, -i - 1250 + 190 = 3*s. Let u = f - s. Does 39 divide u? True Suppose -87 = -4*k + 9. Suppose 7*t + k = 108. Is (t/7)/((-14)/(-147)) a multiple of 4? False Let f = 356 + -359. Is 21/(-3) + (-219)/f a multiple of 2? True Let c = -10285 + 18725. Does 40 divide c? True Is (-13 - 4302/10)/(12/(-210)) a multiple of 28? True Suppose -2*c + 3232 = 139*b - 143*b, -2*b = -13*c + 20888. Does 10 divide c? False Let x be (66/18)/((-4)/(-24)). Suppose -69*i - x = -70*i. Is i a multiple of 8? False Let w = -7 + 10. Let s = 749 + -626. Suppose -w*b + 96 + s = 0. Is 20 a factor of b? False Let o = 4644 + -4064. Is o a multiple of 116? True Suppose -13*j + 20422 + 11402 = 0. Is j a multiple of 48? True Let k(d) = 14*d + 6174. Does 205 divide k(-90)? False Let a = 2249 - -22857. Is 204 a factor of a? False Let k be 3/(((-8 + 5)/(-3))/(-463)). Let t = -911 - k. Is 47 a factor of t? False Let c = -75 + -318. Let f = -215 - c. Does 4 divide f? False Let j = 3030 - -1968. Is 7 a factor of j? True Suppose -6*q = 8*q - 2156. Suppose q*a = 155*a - 39. Does 13 divide a? True Let s(p) = 2*p + 13. Let t be s(-4). Suppose t*f + h + 267 - 23 = 0, 0 = -f - 5*h - 44. Let l = -12 - f. Is 14 a factor of l? False Suppose 574*g = 579*g - 1195. Is 28 a factor of g? False Let m = -2271 - -4834. Does 11 divide m? True Suppose -91*s + 60198 = -32*s - 284716. Does 3 divide s? False Is 21 a factor of 4900 - ((-2)/(-13) - (-336)/182)? False Let o be (56/5)/((-46)/(-115)). Let d = -26 + o. Suppose -4*t + 532 = d*r, -222 - 29 = -r + t. Is r a multiple of 34? False Suppose -831*k = -827*k + d - 49712, -4*d = -5*k + 62140. Is 13 a factor of k? True Let a = 17977 + -15436. Does 69 divide a? False Let o(y) = 24*y - 1. Let h(l) = -l**3 + 9*l**2 - 6*l - 9. Let g be h(8). Suppose -d - g*j + 5 = -3*j, j = d. Does 10 divide o(d)? False Suppose -27*i + 462988 + 126146 = 15*i. Is i a multiple of 13? True Let r be -4*(173 + -5 + (-44)/(-8)). Let g = -544 - r. Is 50 a factor of g? True Let w = 971 + 508. Suppose 57*b - w = 54*b. Is b a multiple of 49? False Let k(h) be the third derivative of -21*h**4/2 + 33*h**3/2 - 19*h**2. Let j(w) = -63*w + 25. Let n(p) = 15*j(p) - 4*k(p). Does 21 divide n(3)? True Suppose -2*h - 13 = -3*f + 290, -h = 2*f + 155. Let z = h + 187. Is z a multiple of 18? False Suppose -q - 4640 - 7352 = -9*q. Is 275 a factor of q? False Does 7 divide 2 + 20/(-8) - 52355/(-74)? True Let y = 874 + -426. Suppose -1312 = -32*s + y. Is s a multiple of 5? True Suppose 0 = -81*x + 502524 + 168966. Does 20 divide x? False Let x be 11286/55 + (-1)/5. Suppose 16*g - x = 11*g. Is g a multiple of 7? False Suppose -b = -4*d + 3620, -41*d - 3*b - 3628 = -45*d. Is 84 a factor of d? False Let m = 66 + -17. Let i(u) = u**2 + 46*u + 518. Let n be i(-20). Let r = n + m. Is 4 a factor of r? False Let s(f) = -f - 3. Let o be s(-5). Suppose -o*g - k - 7 = 0, -5*g + 5*k + 0 + 5 = 0. Is (-8)/(-4)*9 + g a multiple of 4? True Let g = -141 + 141. Suppose -8*q + 608 + 1488 = g. Does 9 divide q? False Suppose q = -2*f + 3661, f + 2*q + 3915 = 5747. Is f a multiple of 30? True Let f = 38712 - 22540. Is 32 a factor of f? False Does 264 divide (-1)/4 + 14070638/568? False Suppose -z + 15 = 10. Suppose 0 = z*y - 20, 5*f + 0*y = -3*y + 22. Does 23 divide (3 + (-15)/6 + 11)*f? True Let x(j) = 3*j - 2*j + 26*j. Let m be x(4). Suppose -3*p + m = -0*p. Does 11 divide p? False Let q(x) = x**3 + 11*x**2 + 2*x + 25. Let w = 10 + -21. Let u be q(w). Suppose 13*b - u*b - 1620 = 0. Is b a multiple of 18? True Suppose -4*q - c + 144483 = 0, -3*q - 45*c + 43*c = -108361. Is q a multiple of 31? False Let t(h) = 76*h**3 + 12*h**2 - 122*h + 20. Does 70 divide t(6)? False Suppose 0*i + 2*i + 76 = 0. Let x = -33 - i. Suppose x*s + 5*h - 175 = 0, -4*s + 3*h + 170 = h. Is s a multiple of 8? True Let c(m) = m**3 - m**2 + 2. Let k be c(0). Suppose -3*y = -0*y + k*f, -5*y + 4*f = -22. Suppose 53 = y*l - 87. Does 7 divide l? True Let b be (-1)/8 - (-10761)/136. Suppose 82*g - b*g - 4*d - 354 = 0, -5*d = 0. Is g a multiple of 59? True Let c(h) = 0*h**2 - 2*h**2 + 13*h - 3*h**2 + 4*h**2 + 11. Let j be c(10). Let d = j - 30. Is 2 a factor of d? False Let x(q) = 5*q**3 + 5*q + 2 + 4 + 9*q**2 + 3 + 4*q. Let y be x(-4). Let m = y - -503. Does 25 divide m? True Suppose 162 = -17*b + 77. Is 24 a factor of (-1915)/b - -1 - -5? False Suppose j = 3*z - 4, -2*j = z + j - 18. Suppose 2231 = z*w - p + 3*p, -3689 = -5*w + 4*p. Does 10 divide w? False Suppose 28 = -2*u + 20, 0 = -3*z + u + 127. Let b = z + -14. Is b a multiple of 2? False Suppose -18016 = -4*m - 2*v, 0 = 5*m + 3*v + 13744 - 36268. Is m a multiple of 15? True Let b(k) = 16*k - 13. Let v be b(1). Suppose v*o = -3*h + 285, 5*h - 152 = 3*o + 283. Does 10 divide h? True Let v = 4363 - 3788. Does 2 divide v? False Suppose 4800 = 59*i - 1985. Is 50 a factor of i? False Let x = 353 + -967. Let l be (-2)/54*-6 - x/(-9). Let t = l + 171. Is 14 a factor of t? False Let q = 42 + -54. Let f = q + 9. Does 10 divide (44/12)/(f/(-63))? False Is 2 a factor of 1260 - 88/16*-2? False Let t = 58582 + -32992. Does 151 divide t? False Is 1170/((70/(-21) - -2) + 2) a multiple of 16? False Suppose 10836*l = 10859*l - 200031. Does 130 divide l? False Suppose 2*n = 3*q + 16 + 13, n + q - 12 = 0. Let d(j) = n + 3*j - 9*j + 12 + 5. Is d(-9) a multiple of 12? True Suppose 2*g - u - 177 = 0, 5*g = 2*g + u + 266. Let t = -44 + g. Let q = -13 + t. Is 11 a factor of q? False Let l = -49 - -52. Is 49 + 0 + l*(-2 - -3) a multiple of 5? False Let s(v) = v**3 + 78*v**2 - 67*v - 384. Is 324 a factor of s(-29)? True Is 10 - (8 + -2562 + -1) a multiple of 57? True Let d(y) = 4*y + 73. Let t be d(-17). Suppose -h + 470 = -t*p, 0*p - 1370 = -3*h - 5*p. Is h a multiple of 10? True Suppose -2*a = 0, -4*a - 1 = -i - 4. Does 19 divide 0 + (i + (3 - 6))*-19? True Let a = 2988 - 2826. Is a a multiple of 6? True Suppose 250 + 492 = 4*o - 794. Does 96 divide o? True Suppose 3*j + 15031 = c, 0*c - c - j = -15031. Is 78 a factor of c? False Let f = -17480 - -17835. Is 3 a factor of f? False Let n = -7064 + 10424. Is n a multiple of 160? True Let a(p) = 61*p - 301. Suppose -2*x + 2 = -16. Is a(x) a multiple of 11? False Suppose 7*i = 4*i - 39. Let p = -14 + i. Let x(n) = -n**3 - 27*n**2 - 7*n + 1. Is 22 a factor of x(p)? False Suppose -7896*n + 7905*n = 439649 + 260686. Is 25 a factor of n? False Let n(c) = -654*c + 7276. Is 37 a factor of n(-91)? False Is 112 a factor of 14614 - (-30 - (7 - 30))? False Let w be (-5)/(5/(-294)) - 0. Suppose r + 4 = 3*i,

= -i - 318. Let n = 62 - i. Suppose n*g + 1165 = 328. Round g to the nearest ten. -90 Suppose 0 = 66*n - 67*n - 3*m + 3024, -6018 = -2*n + 4*m. What is n rounded to the nearest 10? 3020 Let p be (-458976)/(-30) + (-8)/(-10). Round p to the nearest one hundred thousand. 0 Let s = -46797.99999950729 + 46798. Round s to seven dps. 0.0000005 Let y(j) = -4*j**3 + 8*j**2 - 11*j + 6. Let v be y(-11). Let z = v + -3899. What is z rounded to the nearest 1000? 3000 Let r = -286 - -307. Let n = 18976 + -18955.622. Let q = r - n. What is q rounded to 1 dp? 0.6 Let k = -14586.975827 + 14505.9759. Let x = 82.2 + -1.2. Let o = x + k. What is o rounded to four dps? 0.0001 Let z = -2.6961043393 - -2.6961. Round z to six decimal places. -0.000004 Suppose 82*a + 68523642 = -169276358. What is a rounded to the nearest one hundred thousand? -2900000 Let m = -14642143 + 24475543. What is m rounded to the nearest 100000? 9800000 Let w = 5.0365 + -5.03650108265. Round w to seven dps. -0.0000011 Let j = -1.2 + -47.8. Let h = -49.0000018 - j. Round h to 6 decimal places. -0.000002 Let g = 2.5657 - 2.5657040396. Round g to 6 dps. -0.000004 Let o = 166321 - 167363.69. What is o rounded to the nearest one hundred? -1000 Let i = 509 + -539. Let j = 2939.4 - 2909.3965. Let o = j + i. Round o to four decimal places. 0.0035 Let x = -250837 + 161707. What is x rounded to the nearest 1000? -89000 Let w(n) be the third derivative of 10657*n**5/60 - 2*n**4/3 + 40*n**3/3 + 3*n**2 - 11*n. Let v be w(8). Round v to the nearest 100000. 700000 Let n = -0.18233 + 973.06233. Let z = 930 - n. Round z to the nearest ten. -40 Let y = -42 - -44. Let w = -35.5 + y. What is w rounded to the nearest integer? -34 Let q(z) = z**2 + 36*z - 144. Let g be q(-36). Let j be ((-1900)/20)/(2/g). Round j to the nearest 10000. 10000 Let z be 1840 + (-51)/18 + 9/(-54). Round z to the nearest one thousand. 2000 Let f = -223985.16003 + 226570.451. Let c = -2439.2902 + f. Let n = c - 146. What is n rounded to 4 decimal places? 0.0008 Let m be ((-88838208)/(-20))/(-24) - (-6)/(-15). What is m rounded to the nearest 10000? -190000 Suppose -y = -4*x + 20, x = -3*y + 7 + 11. Suppose 4*t - x - 2 = 0. Let z be 2 + t - 2032/(-2). Round z to the nearest one hundred. 1000 Let z = 1624 - 1452.7. Let o = z - 179.97. Round o to one decimal place. -8.7 Let w = 5110 + -5112.284. What is w rounded to one dp? -2.3 Let v(f) = 4*f**2 - 36*f - 30. Let h be v(9). Let d be 4/8*h*(-1000000)/(-6). What is d rounded to the nearest one hundred thousand? -2500000 Let n = -52345.9 - -49408. Round n to the nearest ten. -2940 Let d = -33 + 37. Let u be 190/19*d/(-5). Let l(p) = 236*p - 32. Let y be l(u). Round y to the nearest 100. -1900 Suppose 0 = -4*r + 4*p - 61500, 6*p + 15395 = -r + 3*p. Round r to the nearest ten thousand. -20000 Let f = 350.5 - 350.499999801. What is f rounded to six dps? 0 Let g be (744/(-10))/(459/406980). Round g to the nearest ten thousand. -70000 Let c = 42.9 + 3.1. Let a = c - -12.25. Let r = 58 - a. Round r to two decimal places. -0.25 Let b = -78 + 113. Let z = -35.15412606 + 0.15412506. Let n = b + z. Round n to seven decimal places. -0.000001 Suppose 0 = 28*c - 34387 - 2466349. What is c rounded to the nearest ten thousand? 90000 Let t = -499.7696 - -491.69. What is t rounded to 2 decimal places? -8.08 Suppose 2 = v - 0*p - p, -10 = -v + 5*p. Suppose -5*h = -3*h - r - 1619995, v = -h - r + 810005. Round h to the nearest one hundred thousand. 800000 Let h = 0.26289 - 265.80289. Let j = 1714 + -1983. Let c = h - j. Round c to 1 dp. 3.5 Let u = 9.1882 + -9.06. Let h = -0.1280869 + u. What is h rounded to five dps? 0.00011 Let o = 40035976515 + -61230209317. Let t = o - -21194231786.9999409. Let s = -1015 - t. Round s to 5 dps. 0.00006 Let r = 58 + -542. Let f = r + 483.999999061. Round f to 7 dps. -0.0000009 Let v = 10609.75745 + -10610. What is v rounded to 3 dps? -0.243 Let b(z) be the second derivative of 1213/12*z**4 + 5/6*z**3 + 0 + 0*z**2 + 16*z. Let d be b(15). What is d rounded to the nearest 10000? 270000 Let v = 10.4659582 - 10.71797. Let w = v - -0.252. Round w to six dps. -0.000012 Let n = -0.1297 + -0.1045. Let u = n - -0.2340887. What is u rounded to 5 dps? -0.00011 Let u = 21.12 - 21.35. Let y = 1361468.2299934 + -1361468. Let d = u + y. What is d rounded to 6 decimal places? -0.000007 Let t = 14.6655 - -0.3985. Let n = t + -15. Let y = -7.164 + n. Round y to zero dps. -7 Let g = 22682.5 - 17941. Round g to the nearest ten. 4740 Let z = -3446.95 + 3449.04321. What is z rounded to two dps? 2.09 Let r = -4240884 - -9662684. Round r to the nearest one million. 5000000 Let x = 219 + -613. Let f = x + 393.9175. Round f to three dps. -0.083 Let m = -46 - -360. Let t = -314.000274 + m. Round t to five dps. -0.00027 Let n = 0.158 - 98.158. Let t = n - -97.67. Let y = t + 0.3299646. Round y to 5 dps. -0.00004 Let x be 0/(12/(-6 - -2)). Suppose x = -4*t + 4*a + 5048 + 3164, 4*t - 8217 = -a. Suppose -3*d = 2*r - 1234, -5*d + 2*r + t = 4*r. Round d to the nearest 10. 410 Let p be (12/(-2))/(5 - 7). Suppose p*t = -3 + 39. Suppose -t*x = 31034 + 568966. Round x to the nearest 10000. -50000 Let q = -11016 - -11013.3266. Let c = -127 - -124.35. Let r = c - q. What is r rounded to three dps? 0.023 Let x = -81827.8726 - -81839. Let l = x - 11.2. Let m = l - -0.066. Round m to three decimal places. -0.007 Suppose -4*f - 9355772 = 3*m, 5*f - 2107586 = -4*m - 14581951. What is m rounded to the nearest ten thousand? -3120000 Let h = 73.4 - 73.7596. Round h to one dp. -0.4 Let j = -114 - -125.2. Let i = 42.8 + j. Let y = -54.000000144 + i. What is y rounded to seven decimal places? -0.0000001 Suppose -v = 3*q - 1147679994, 2*v - 1289664575 = -5*q + 623135413. Round q to the nearest one million. 383000000 Let c = -321.9346 - -322. Let q = c - -1016.9346. Let a = -1017.0000681 + q. What is a rounded to six dps? -0.000068 Let p = -628.129 + 0.129. Let s = -630.103 - p. What is s rounded to one decimal place? -2.1 Let w = -1476.7191 - 0.2809. Let v = w - -1477.000002684. Round v to seven dps. 0.0000027 Let s = -1713.973 + 1643.9. Round s to one decimal place. -70.1 Let p = -257.853 - -262. Round p to two decimal places. 4.15 Suppose 103*v - 513434 = 85*v + 3980806. What is v rounded to the nearest 10000? 250000 Let p = 83.479664 - 83.46. What is p rounded to 4 decimal places? 0.0197 Let f(s) = 204*s**3 - 20*s**2 + s + 7. Let w be f(-10). Suppose 2*i = 8, 5*c = -0*c + 4*i - 11. Let k be w + (8 - (c + 4)). Round k to the nearest 10000. -210000 Let i = 25948.0000037386 + -25948. Round i to seven decimal places. 0.0000037 Suppose -146057 = -2*u - t + 151279, -3*t - 594692 = -4*u. Round u to the nearest 1000. 149000 Let f = 35 + 31. Let g = 38 - f. Let h = 28.33 + g. Round h to one decimal place. 0.3 Let w = 0.0173 + -94.1773. What is w rounded to the nearest integer? -94 Let c = 252670.1 + -252531.09385. Let k = c + -139. What is k rounded to four decimal places? 0.0062 Let v = 163.582959 + -163.59. Round v to three dps. -0.007 Let h = -17.4 + -100.6. Let o = h + 118.000000078. What is o rounded to 7 decimal places? 0.0000001 Let c = -21661 + 21661.071394. Round c to three dps. 0.071 Let y(u) = -100*u**3 + 4*u**2 - 8*u - 15. Let m be y(-5). Suppose 0 = -4*d + 3*x - 0*x - 25185, m = -2*d - 5*x. What is d rounded to the nearest one thousand? -6000 Let j(v) = v**2 + v - 2216495. Let q be j(0). Let f = 1314495 + q. Round f to the nearest one hundred thousand. -900000 Suppose l + 9 = -5*x, -8 = -4*l - 0*l + 2*x. Let m be (12/(-8))/(l/(-50)). Let s be (-10)/m - (-285004)/30. Round s to the nearest 1000. 10000 Let a = -1282.7 + -308.3. Let l = a - -1591.001049. Round l to four decimal places. 0.001 Let i = 6779867797 - 6779867893.00000078. Let a = 0.115 - -95.885. Let j = a + i. Round j to seven decimal places. -0.0000008 Let q = -23967.72990945 + 23967.8. Let i = q + -0.0701. What is i rounded to seven dps? -0.0000095 Suppose m - 7 = -y, -2*m - 7 = m - 4*y. Suppose -2 = -s, m*s = -w - 2*s - 644990. What is w rounded to the nearest one hundred thousand? -600000 Let a = 2459849733487669 + -2459849720044939.14299787. Let w = a - 13442730. Let c = -0.143 - w. Round c to 7 dps. -0.0000021 Let a = -1250 - -1277.28. Let s = 32.6

how's it going everybody if I if I talk like this can everyone hear me if I speak loudly it'll go on the microphone it's all good I always like think when I when I do like talks at conferences people are like why is this homeless person like up on the stage talking to us about data science I basically dress like a high school sophomore still so this is me my name is Josh Wills the head of data engineering at Slack ... I've been in Slack for about seven months before that I was at Cloudera and I was at Google and I was other places I'm like most people I'm famous and important because I wrote a tweet once but I'm kind of tired of talking about it if you're really interested you can google me and find the tweet it's totally fine and that is the only hat I own which unfortunately I did not bring with me today ... at Cloudera and Google and other places I have run both data engineering teams and data science teams and so now I'm back doing data engineering at Slack and I want to talk about the relationship between data science and data engineering and how we can make it better and the first natural question whenever someone wants to do this is say why bother is there really any upside to actually improving the relationship between data scientists between people who analyze data and the engineers who provide them with it we are sort of like a very sort of unhappy married couple who ... like need to go to couples therapy or something like that just in order to be able to honestly look at one another like it's a really really bad relationship in the grand scheme of things except apparently at Netflix as Kurt Brown will tell us later and this is really kind of sad to me this is sort of heartbreaking because I like ... I kind of think like for my next career I want to be like a therapist for data engineers like I actually I sort of think that I could actually make much more money if I was just like ... ... sort of the executive coach or whatever for like data engineers because I swear to God if I had a nickel for every time some like the first data engineer or the first data scientist at some little startup emails me or sends me a LinkedIn message and is like hey I could use some advice on what it's like to be the first person at whatever and they're all like really kind of sad and miserable like it's just they're very unhappy um you either have like a data engineer who's spending all their time like writing SQL queries and creating dashboards and answering questions for business users when they really want to be doing cool data engineering stuff or you have a data science analytics type person who is spending all their time running around logging collecting data trying to run experiments trying to convince engineers to do stuff for them and they would just really give anything for a data engineer so like data scientist data engineer they would really like when it's just them by themselves they're very lonely and and so that's sad and they kind of want they want like each other they want that good relationship but somehow things go wrong and I I think about like why why do things go wrong it's fundamentally because we really want different things data engineers and data analysts we really want different stuff um data analysts want to basically do really interesting analytics and find insights and build machine learning models because those are the things you do to get to come talk at conferences like this and look really cool in front of all the other data scientists data engineers on the other hand they want scalability because scalability is like the word we're doing stuff at scale scale this doesn't matter what it is we're doing we just long as we're doing it at scale I can go to a conference like this and talk about it how awesome I am that I'm doing whatever at scale it's just so stupid guys really like anyway this is like the world we live in though we want sort of fundamentally different things and the fact that we want different things causes tension I've sort of given this talk a couple of times now people always resonate with this slide so let's kind of go around seriously I think it's funny and everything but it's also super important because this is like a real this is a real ... like photos and stuff like that I appreciate that let's go around the infinite loop of sadness let's talk about how the infinite loop of sadness works basically sort of this way around the loop like basically what happens is the business makes unreasonable ridiculous requests of the data science team the data science team makes unreasonable ridiculous requests of the data engineering team the data engineering team makes ridiculous unreasonable requests of the ops team and the ops team in goes to the business that says hey we need a crapload of money to support all of the ridiculous unreasonable requests we've received and it just goes on and on and on like this basically forever this is the infinite loop of sadness it basically ... literally spirals out of control it's funny but in that kind of like cringe inducing way it's funny right this is this is funny except unless you've lived through it and then it's just you know infinitely sad alright so as a result of this kind of stuff as a result of our different goals and as a result of the way that we are structured and the kind of incentives we have we end up like alone together we're just sort of like there and we're together and maybe we have lunch together sometimes but fundamentally we're just you know kind of living these independent lives next to each other and it's very sad and way less good than it could be so let's go back to first principles let's talk about how we can repair this relationship and some thoughts on this kind of stuff and first principle one for data engineering by far in order to build data infrastructure you only need to understand and appreciate two things Apache Kafka and Franz Kafka I think the Apache Kafka part is pretty obvious to everyone at this point but the Franz Kafka part for that I'm gonna I'm going to turn to my old friend David Foster Wallace who wrote this great great article sort of one of his books about Kafka's humor like how funny Kafka is and how how students how college students can have a hard time understanding Kafka's humor because people are trained to think of humor as something you get the same way that we're taught that a self is something that you just have and so you can't really appreciate the truly central Kafka joke that the horrific struggle to establish a human self results in a self whose humanity is inseparable from that horrific struggle in the same way the horrific struggle to build data infrastructure results in a data infrastructure that is inseparable from that horrific struggle everything in data is terrible like it's just a big you know steaming dumpster ... dumpster fire of garbage it's just awful but we make it work and again it's it's you're trying to always kind of escape the horribleness trying to like free yourself from the dumpster fire when you don't realize the dumpster fire is your home the dumpster fire is it's where you belong in some like non-trivial sense that is the central joke of data infrastructure and so first things first let's all appreciate that we are in basically like The Trial or The Judgment we essentially are living in a Kafkaesque universe when we're doing data stuff so that's thing one um thing two is to understand the infinite loop of sadness and replace it with the infinite loop of empathy especially for data engineering and data science understand that like from the data science ... like the data scientists need to know that the data engineers have the exact same relationship with the Ops people that the data scientists have with the data engineers and the data engineers need to know that the unreasonable requests from the data scientists are usually generated by unreasonable requests from the business we're in the same boat your problems are my problems the people are a little bit different but we really are in this boat together and so that's like the second thing we need empathy for each other we need to understand each other before we can really start working together well how do we solve this problem one of the ways really one of the shortcuts to kind of creating that that sort of bonding and that empathy between data engineering data science is to build machine learning models if you are building like full lifecycle machine learning models where you are like taking in data ... building models offline deploying them back into production that ... nothing is more effective at unifying the data engineering and data science teams than building and productionizing machine learning models because you get to really see the other person's problems in a very very visceral sense so any kind of company that's doing a lot of ad tech stuff or doing any kind of payment stuff where fraud modeling is a really big problem generally has a great data culture and that's why all the best data scientists and data engineers want to work at finance companies and ad tech companies it's because that's where data is like the central thing and it's a really really really good working environment however not all of us work at companies that have to do big like hard machine learning models but all of us working companies that have to do some form of ETL and I love this this cartoon it's just like I shouldn't swear right it's really really funny it's like everybody poops everybody ETLs no matter where you are no matter what you do everyone takes some data in one place and transforms it to another place it's just it's worth you know like Google like everybody poops funny Google Images this is worth checking out longer you guys can't see it everybody ETLs and I would ... my claim is that the way that you do ETL says a lot about your data culture and the relationship between your data engineers and your data scientists various options I've seen I'm so glad I got to reference the Bobby table's thing from the previous talk so this is this is one of the advantages of doing your slides five minutes before your talk is you get to like insert jokes at the last possible second option one is SQL centric ETL and Facebook is for me kind of the canonical example of sequel centric ETL Facebook does almost all of their ETL in Hive they do it almost all in SQL this is Hive and Presto all that kind of stuff analysts are constantly like creating new SQL jobs generating new tables big complicated pipelines and the data engineers are ... indentured servant isn't like the right term but it's something like that it's if you ever if you ever come across a facebook data engineer like give them a hug they have a they have a terrible job is anyone here a facebook data engineer you don't want to admit it I understand it's okay we can have like sort of a you know come-to-Jesus kind of session for you there's a roughly roughly two to one relationship between analysts at Facebook and data engineers and the data engineer's job is to take the steaming pile a SQL garbage these data analysts write and turn it into something remotely scalable and is remotely coordinated across ... all Facebook's data pipelines they write a lot of UDF's to make things like possible and efficient and like I mean seriously writing a Hive UDF ... has anyone actually ever had to do that it is the worst it is like absolutely absolutely terrible so this is option one and a lot of companies end up in this state a lot of companies end up in the state it is a very natural very easy state for folks to slide into but it's a very very sad place to do data engineering option number two is JVM-centric ETL and I'm going to call out Twitter as sort of the the home of JVM-centric ETL at Twitter for a long time all of their ETL was done via Scalding which is a Scala DSL for writing MapReduce jobs it has all kinds of crazy like I swear to God like advanced abstract algebra concepts like sort of piled on top of it for doing various kinds of aggregations where like you need basically a graduate degree in math to like understand like what's going on and as we all know math is way harder than something stupid like physics so like any of the physicists who've talked so far would not be smart enough to work at Twitter so but like if you're if you know you're like you know you're like groups and rings and fields and principal ideal domains like Twitter is a great place to be and the result of sort of JVM-centric ETL is the data engineers basically turn into like the high priests of data right where the analyst says please data engineer be ... so kind as to modify your magical like ETL abstractions to generate the statistic that I want to analyze right and I don't necessarily know that this is a good ... I mean I sort of would like to be worshipped like a god that sounds great I didn't sort of deliver that I actually I was I made the mistake of actually being honest in the talk didn't I okay anyway but like this isn't a great sort of data engineering like data analyst relationship either like we don't really want to constrain the analysts to not be able to go off and do things and experiment with new metrics whenever they feel like it like that's not necessarily a bad thing either so let's come up with a third way third ways have sort of a general problem and that everyone kind of hates them like roughly speaking like that's sort of the way you know you're like onto a good Third Way as everyone is unhappy so I'm gonna talk a little bit about the third way that we're working on it's Slack which hasn't like succeeded yet like most third ways but I'm like reasonably optimistic about as sort of my way of kind of coming with a different sort of relationship and a different different model for data engineering and data science to interact with each other and it's based around sort of the state of the world as it is now the state of data engineering the state of data science as it is at this moment in 2016 where we find ourselves um the first sort of fact of things is the rise of Spark ... if data is the new oil Spark is the new Standard Oil ... I just I love that joke like no one else finds that funny seriously like none of this is the kind of the octopus that's got its ... anyway that kind of thing I'm Spark is like ... Spark is completely taking over everything like they are they have their tentacles and streaming stuff and GPU stuff and machine learning and ... just everything there's Hive integrations and I love it and I wish it all worked better like more than anything I love Spark and I wish it worked better ... I love Kafka do you guys love Kafka ... I love Kafka ... Kafka does its thing and it does it extraordinarily well and it doesn't do anything else and I love that Spark ... Spark there's a lot of things it does all of them pretty well like but there's always just little you know just ... it just drives me crazy anyway that said Spark is the new reality Spark is like the default go to sort of data processing engine that almost anyone is going to use at any new company anywhere you go these days Spark is taking over so that's sort of fact one fact - there are way too many streaming engines out there right now at Google we had this joke that there are two ways to solve any problem the way that is deprecated and the way that doesn't work yet wasn't actually wasn't so much a joke because it was like a statement about reality actually now that I think about it and right now batch processing is deprecated and stream processing doesn't work yet that is the world we find ourselves in there is Spark streaming Samsa Kafka's got a new thing there's Flink there's Storm there's all these different engines out there and none of them really work that well like honestly like we have not solved the streaming problem yet in any kind of remote sense and I as someone who would like to write some streaming data pipelines so I can move on to the new hotness I'm sort of left with trying to decide between all these different engines which one should I choose I have literally no idea they all seem like basically terrible terrible ideas to me I'm gonna choose one it's gonna be the wrong choice it doesn't matter which one it is like it's you know it's like Russian roulette or something like that right it's just a horrible kind of situation so there's too many streaming engines and I don't know which one is going to win and this makes me sad um ... thing three is sort of this this knowledge and this awareness of streaming design patterns and I actually give a lot of credit to the Google folks - Google's like cloud dataflow and Apache Beam and all that kind of stuff they're doing for like talking about streaming data pipelines and sort of the abstractions and ideas behind them in a way that is even like remotely intelligible to human beings like it's it takes some work it's hard but I keep having conversations with people at various companies around the valley and around San Francisco where like they are clearly onto something with this stuff like there's there's ideas here around windowing and stuff like that that resonate with a lot of different people that I'm optimistic about even though I don't know which of those different streaming open-source streaming engines I just mentioned those ideas are actually gonna truly manifest themselves in in a way that is workable operational monitorable doesn't need to be restarted every 24 hours because its garbage collection is ... anyway I don't know what's gonna happen there but I feel like we're starting to have the right conversations around how to design these systems and haven't designed these pipelines um and last but not least I think and I'm sort of hopeful that maybe for the first time ever in data engineering we can stop talking about scalability like that would just be absolutely fantastic if we could stop talking about scale because scale is like solved if you ... unless you are like Google or Facebook or LinkedIn or Twitter scale is solved use the thing that Facebook Twitter Google LinkedIn has open sourced use that it scales that's it problem solved no more conferences on scalability please right that's it No Mas the real problem is change the real problem is change the real problem is the fact that all of this stuff the underlying data the downstream metrics all the machine learning models everything is changing all the time change is the real problem how do we manage change in a sort of reasonably I'm gonna cringe when I say a scalable way we need like a different word like a better word but that's that's the real problem change is the real problem let's stop talking about scale and start talking about how we manage change all right so the approach that I've been I've been sort of talking about with my team and I've been trying to convince everyone to sort of adopt is inspired a little bit from deep learning in particular it's sort of the core deep learning libraries like Torch and Theano they all have sort of a very low-level systems implementation done in C++ or you know using CUDA libraries or whatever they're leveraged GPUs and super super high performant and then a high-level scripting language for doing most of the actual configuration stuff that you need to do to run a model and that can be Lua or Python or whatever don't really care but it's that melding of like low-level optimized systems programming for the really really hard compute intensive tasks and a high-level scripting language for all of just the real-world stuff you need to do relatively quickly that's kind of tedious and blah blah blah blah blah and I like this model a lot and I would like to adopt it for more and more of the data engineering data science work we do um one of the other things that I think this is actually one of the things I think Spark has really made possible for me like the thing I love about Spark and I think most people ... like the gateway drug for Spark is the REPL ... is being able to like load up a few terabytes of data into memory and just sit there and interactively query it and come up with an idea and like interactively query it and change your function it's magical demos incredibly well it's absolutely fantastic then you like ... it's not until like weeks later the years have to go read the like hundred long page of configuration options in order to get the damn thing to actually run at scale leave that aside it's a really really great demo and the ability to like cache data sets in memory gives us a lot more flexibility around our tooling relative to MapReduce with MapReduce pipelines I was a massive fan of static typing for everything because there's nothing worse than writing a huge complex MapReduce pipeline and having it fail at the last step because of like some stupid string to long conversion right now because I have the REPL and because I can like be caching intermediate datasets as I go if I screw up a type ... eh it's kind of annoying but it's not that big of a deal right I can just kind of fix it quickly in Python or whatever and then go on to the next problem so I'm ... more and more I think I see us moving towards this model in JavaScript in PHP via hack and stuff like that to like not quite static typing to sort of like ... loosening sort of the requirements for static typing at least a little bit around data engineering in order for folks to be able to move faster ... Slack origin myth ... Slack once upon a time was this game called Glitch so so Stewart and Kyle and the other sort of founders of Slack they have this model where they come up with these games they think are super cool and like no one agrees but they have some little cool niche feature that people say that's actually kind of cool like that's pretty cool and that happened with like Flickr and they did it again with Slack basically so so Glitch was this really cool very interesting game the Slack founders tried to make successful and failed um and one of the things that's like really cool about Glitch is that it was it was a game and that meant we had like a game engine and this game engine was written in Java and we had a sort of Rhino-based ... or sorry Nashorn-based JavaScript engine for actually like writing the levels inside of this game engine so high-level scripting language for designing levels doing the kind of like fast work that you want to do all the time very low level Java engine for doing the heavily heavily optimized systems programming stuff much like not for nothing all the deep learning libraries out there just done in Java um so what we've been playing with is taking this Java and JavaScript engine that was written for this game and applying it to our data engineering problems at Slack and in particular um creating like high level JavaScript definitions of tables that have various aggregations performed upon them all the aggregations themselves are actually done in a very low-level Java Scala library but most of the actual like high-level descriptive business logic extract this field fill in this default value performed this transform is all done in JavaScript at a high level and then we feed the JavaScript into the Java engine the Java engine goes and grabs all the JavaScipt dependencies kind of like Node.js style and then it deploys them out to the cluster and runs an optimized Spark job that is designed to compute all of the different aggregations in a single pass over a cache dataset kind of weird right yeah I'll post these slides up on the Internet so like folks can read them later and hopefully we'll open-source this thing once we you know actually get it working but nonetheless this is like the way I'm thinking about these problems it's sort of like slowly gently statically typed environment that you can still like hack in very very quickly um no one likes JavaScript like everyone hates it I think that's probably a fair statement like but everyone like knows it the nice thing about having a language everyone hates is it's like embarrassing if you can't write it you know what I mean and so it's like if you can't write it then like well what's what's wrong with you how could you consider yourself not even or not even an engineer but an analyst right everyone can write scripts and that's kind of great so table declarations can be done code can be written you can write sort of these ... this is actually like actual little snippets of the code that processes our logs which are called slogs our client logs are called clogs our job queue logs are called jogs they got a little out of hand as these naming conventions can but nonetheless um you can process these these objects which are just Thrift records via JavaScript to do whatever extractions on them you want do whatever kind of complex logic you like without having to drop down into say Java to write UDF's for Hive or whatever other language you're talking about but also not requiring that everything be in Scala or everything being whatever all the time and last but not least one of the nice things about doing all the stuff on Spark is Spark SQL again Spark SQL mostly works and when you need to basically do something simple in SQL as part of a precursor to like one of your JavaScript functions you can just do that just declare that and we will execute your SQL using Sparl SQL for you and then propagate that information so JavaScript whenever you need to do scripting whenever you need to write custom logic ... SQL when you don't ... very very cool so yeah that is roughly like the brave new world that we're aiming for and I sort of pride myself on getting conferences that are running late back on schedule and ... so with that thank you all very much ... oh yeah we're hiring any questions yeah ... we've got time for a couple of questions ... yes ma'am yes of course how you doing yeah ... okay how you doing ... mic check ... how are you ... good thank you ... so thank you for your talk ... I do what I can ... we all do we try I wanted to start off by saying I love Slack we actually ... I'm a MIDS student and we we use Slack at MIDS ... in this program ... and at the company I work at we actually started using Slack and it just took off ... I'm so glad that's wonderful yeah that's just like ... I just ... like dollar signs to me that's just fantastic ... I mean yeah I had ... I had a real question actually ... in your infinite loop of sadness or empathy or whichever one it is ... yeah ... you had a quadrant that said business ... yes ... and I work in product management ... yes ... and I wonder ... you're in that quadrant ... well I I figured you were implying that when you showed the infinite loop of sadness ... now I'm explicitly stating it ... oh yes and it is explicitly understood but my question is when you talk about kind of like reconciling that loop of sadness and making it like the hoop empathy at Slack particularly what role does product management play and the reason why I'm asking is because when you look at ... when I look at Slack or what I hear about Slack I mean you've been around for three years ... two years ... yep three ... two years ... and yeah and you have what like you're pushing I'm told like three million active users a day that's right so there's a product component there somewhere how do you fit into the mix ... oh that is a great question okay this is something like we're recording this right so so here's the problem it's like I basically think Steward Butterfield is like roughly ... and this is just gonna is his cringe-inducing and I hate that we're recording it I think he's basically like what we have he's like Steve Jobs roughly speaking for our ... he's been trying to do Slack for like 15 years like this is not a new thing for him he has always done some IRC on steroids thing and every company has ever had and it just kind of finally came together and I just I mean it's gonna sound kind of weird but I mean data doesn't like give birth to companies you need products sort of visionary like you need a vision right you can't like optimize something that doesn't exist you need product vision to guide you and this is gonna sound like a terrible answer but I mean like Slack is not really a data-driven company yet in most ways I still think Stewart has a vision that will carry us forward for like at least another 18 months or so before like really we need to get into truly scaling out the company through metrics and data and you have a question okay so yeah yeah yes yes yes but that's just like the right thing to do I mean it's like you don't need any data to tell you that's like the right thing to do ... it is it's my secret plan don't tell anybody oh my god no one please here don't say anything it'll be fine .. you did so it's fairly transparent is what you're saying okay gotcha ... it's good not a very good plan then yeah no it is and it will be and it will be one of the great data-driven companies in the world but it's not yet yeah and ... so I think it's all about hiring I think the reality is as you scale and as you grow and as the opportunity becomes bigger we hire more and more product managers who are used to working in data-driven environments as opposed to like sort of very early stage startup vision-driven environments and that's basically the transition I had this sort of ridiculous idea in my head that I could go to a company and just show up and bring data and be like here you go here's all your data and people would suddenly become data-driven as a result does not remotely work that way it's all about the hiring it's all about people in the room asking the right questions and it's just it's like the nature of a company it's just like the lifecycle of a company as it grows and changes to become much much more data-driven just cuz you have to there's not a way to scale one person's vision beyond a certain point without leveraging data ... let's take one final question sorry it was a super long question yeah how you doing ... hey Josh I'm good thank you that was awesome ... it really was ... I thought so ... I was laughing a little too much but um at the company that I work and I wanted to get your insight on this we've been transitioning for the last year so something had we named a DPaaS so data platform as a service ... and what they're trying to do is to kind of like step away from I guess the hellhole that you were describing and and basically give data tools and the ability for their product manager or data scientist who really interact with the data pipeline and not really need the the data engineer to have to like build everything ... yep so away from like the high priest kind of model roughly ... away from the high priest piece they literally just set it there and you can kind of like walk along and set up your own MapReduce job or or whatever on your own without having the knowledge of what's going on ... is that something that maybe could fit in to that brave new world you're talking about her and have you thought about something like that oh so I think we're already in that world I think roughly like I don't consider Slack to be like one of the high priest sort of shops we have like a quite a few Scala pipelines written in Spark that you've liked fairly fundamental things that you know generally like our very core logs and our very core data but downstream of that there's like a ton of SQL and the analysts are free to go write and run whatever they want like as well they should be I'm hoping like ... the problem I have with like SQL as a long-term strategy is the whole batch is deprecated thing like I would like to move them over to JavaScript and Java land if only because I want to make it easy to move the computations they define onto streaming pipelines as well as batch ones and so that's sort of like the ... tooling wise what I'm trying to aim for in terms of like the data platform stuff I feel like at least at Slack we're like already there it's not a problem for anyone to go get access to data or you know like modulo like you know basic policy and security kind of stuff like that right like no one can access like messages and stuff like that that's the sort of a no-brainer so yeah it's more of like it's a ... I guess it's a little bit higher up like once you have that platform and you have it available for everyone to use what tools should you like make available to them for the really sort of standardized canonical stuff you do because I still don't want to end up in a world where I have like 800 different tables that have slightly different columns that do slightly different things that mean slightly different things and I have to track down the person who created it to figure out what's going on it's I mean it's sort of I'm trying to like strike a balance between the high priest model and that's sort of like just crazy chaos model basically it's not necessarily superhuman driven I guess I don't really like people I work in data cool good perfect thanks very much thanks everybody

New Teaching Facility Arden's new teaching facility We are delighted to announce that the new teaching block is now fully open and operational. Building work began in February 2015 and was ready to welcome students at the start of the new academic year. We are certain our students and staff will be impressed with the new £4m building which was completed during the summer holidays. It has state of the art facilities for Mathematics, Geography, ICT and Physics. Sixth Form students will also have pupose built indepenent study spaces. In all the building will have over twenty classrooms and will be a wonderful addition to the learning environment of the school. I would like to take this opportunity to thank the Elliott Group Limited, the building contractors who have worked so tirelessly to complete the project on time. It is also important that I thank the officers and elected members of Solihull Council and the Education Funding Agency for their support in making this fantastic project possible. Mr Martin Murphy Arden Principal Letter to Residents To view the letter sent by Mr Murphy regarding the new teaching facility, please click on the icon below:

--- abstract: 'Problem of classification of parallel quantum channels for information transfer is studied by method of ladder operators. Detailed compared to http://arxiv.org/abs/quant-ph/0702076 presentation of method of ladder operators is given. Examples of paired channel and qubit-qunit pair are added. Relations between eigenvalues of density matrices of composite channel and its subchannels determining presence/absence of entanglement of arbitrary mixed state of channel are obtained.' author: - 'Constantin V. Usenko' title: 'Qubit-qunit decomposition of quantum channel' --- Introduction ============ Classical theory of information is based on possibility of decomposition of arbitrary message to finite sequence of bits. For states of quantum channels of information transfer entanglement –- impossibility of representation of state through direct product of states of subchannels is specific, this prevents decomposition of messages. Instead of that states of composite quantum channel are usually superpositions of such direct products (pure states), or mixtures of the superpositions. Properties of each specific state as to decomposition to subchannels depend of numerous factors: on the one hand, for each pure state one can choose method for decomposition of channel to subchannels such that given state is represented with direct product of states of subchannels; on the other hand the whole set of possible states of composite quantum channel at each decomposition to subchannels includes more entangled states than pure states; besides that in classical approximation entanglement as the property of state of composite channel has to vanish completely. Study of entanglement has started as early as at time of formation of quantum physics (EPR paradox) and it is continued till now as one of the most fundamental parts of quantum information theory. Measures and characteristics of entanglement developed, besides intuitive idea of concurrence [@symbqs] and partial transposition [@Horodecki96], are lately re-formulated to physically meaningful properties of covariance matrix [@Kothe]. Method of ladder operators in application to composite quantum channel [@Gdansk; @VU1e; @VU2e] is effective for investigation of the properties of density matrices of channel and its subchannels representing entanglement of state of channel. Ladder operators and algebra of observables =========================================== Finite-dimensional state spaces with practically arbitrary dimensionality in quantum-mechanical problems are studied good enough –- all of those are unitarily equivalent to spaces in which irreducible representations of group of isotropy of three-dimensional space characterized with given value of momentum $j=\frac{N-1}{2}$ are realized. Eigenvectors of operator $\hat{J}_{3}$ of momentum projection to given axis form basis associated to ladder operators $\hat{J}_{a}$. Ladder operators are expansion to multi-dimensional case of Stokes operators used recently for analysis of entanglement [@Cirac08]. Basis vectors are generated as result of sequential effect of one of ladder operators $\hat{J}_{\pm}$ on annihilating vector $\cat{\mp j}$ of the other $\hat{J}_{\mp}\cat{\mp j}=0$: $$\cat{m} \propto \hat{J}_{+}^{m + j}\cat{- j}\propto \hat{J}_{-}^{j-m}\cat{ j}.$$ It is important that ladder operators can be constructed for each orthonormal basis $\left\{\cat{k}:\ k=1\ldots N\right\}$ according to following definition: $$\label{ladder_def} \begin{array}{l} \hat{J}_+\stackrel{Def}{=} \sum^{N}_{k=1}{\sqrt{\left(N-k\right)k}\cat{k+1}\otimes\bra{k}};\\ \hat{J}_-\stackrel{Def}{=} \sum^{N}_{k=1}{\sqrt{\left(N+1-k\right)\left(k-1\right)}\cat{k-1}\otimes\bra{k}}. \end{array}$$ Operator $$\label{ladder_z} \hat{J}_3\stackrel{Def}{=} \big(\hat{J}_+\hat{J}_--\hat{J}_-\hat{J}_+\big)/2= \sum^{N}_{k=1}{\left(k-\frac{1+N}{2}\right)\cat{k}\otimes\bra{k}}$$ has basis vectors as eigenvectors. Re-definition of basis vectors by means of eigenvalues of operator $\hat{J}_{3}$ $$\cat{k}\rightarrow\cat{m=k-\frac{1+N}{2}}: m=-N/2\ldots N/2$$ completes analogy between arbitrary basis and basis of irreducible representation of group $SU(2)$. Ladder operators are the generating operators of matrix algebra in state space –- an arbitrary observable has representation with normally ordered combination of ladder operators: $$\label{O_norm} \hat{O}=\sum_{m\geq n=1}^N{\left(O_{m,n}+O^*_{n,m}\right)\hat{J}_+^m\hat{J}_-^n}.$$ Each observable that is diagonal observable in chosen basis has eigenvalues $O_k$ that are interpolated with some function $o\left(x\right)$ of eigenvalues $k-\frac{1+N}{2}$ of operator $\hat{J}_3$ and thus it is the same function of that operator: $$\label{O_diag} \hat{O}=o\left(\hat{J}_3\right);\ \mapsto \hat{O}=\sum_{\forall k}{o\left(k-\frac{1+N}{2}\right)\cat{k}\otimes\bra{k}}.$$ To observable $\hat{O}$ with non-degenerate spectrum $\left\{O_k:\ k=1\ldots N\right\}$ basis formed with system of eigenvectors corresponds. To that basis such a system of ladder operators $\hat{J}^{\left\{O\right\}}_{a}$ corresponds that operator $\hat{J}^{\left\{O\right\}}_{3}$ commutates with that observable and representation $$\hat{O} = O\left(\hat{J}^{\left\{O\right\}}_{3}\right);\ O\left(k-\frac{N+1}{2}\right)=O_k$$ takes place, for instance in form of interpolation Lagrange polynomial: $$\label{interpol} O\left(\hat{J}_3\right)=\sum_{k=1}^N{O_k\prod_{k\neq k'=1}^N{\frac{\hat{J}_3-k'-\frac{N+1}{2}}{k-k'}}}.$$ Preparation of states --------------------- In each specific event of information transfer quantum channel is prepared in one of pure states. Let us suppose that state system is orthogonal, general state of quantum channel is a weighted sum of states from that basis and each pure substate $\roa{k}$ has weight set in process of preparation $p_k$. So, system of eigenstates of density matrix as well as eigenvalues of the matrix characterize the process of preparation of state. Sequence of states can be intentional if the channel is used for information transfer, it can be random in the case of control of channel states being absent or partially random if quality of control is not enough for total control of channel. In the last case one can expect that several states corresponding to one value of information being transferred are prepared with same probability. General state is represented by diagonal density matrix with $N$ set parameters $p_k$ to which normalization condition is applied: $$\hat{\rho} = \sum_{k=1}^N{p_k\roa{k}};\ \sum_{k=1}^N{p_k}=1.$$ This matrix has representation with polynomial $\rho\left(z\right)$ of degree $N-1$ from ladder operator $\hat{J}_{3}$, that satisfies system of interpolation equations: $$\hat{\rho} = \rho\left(\hat{J}_{3}\right);\ \rho\left(k-\frac{N+1}{2}\right)=p_k.$$ In arbitrary basis density matrix of quantum channel is not diagonal, it differs additionally by values $N\left(N-1\right)$ of free parameters of transformation matrix from group $SU(N)$, therefore in general density matrix in arbitrary basis of state space has $N^2-1$ free parameters: eigenvalues of density matrix and characteristics of basis of its eigenvectors. Information completeness of state can be calculated by formula for von Neumann entropy $$S_N=-\tr{\hat{\rho}\log_2 \hat{\rho}}.$$ Since in basis of eigenvectors density matrix is diagonal value of entropy is calculated explicitly: $$S_N=-\sum_{k=1}^N{p_k\log_2 p_k}.$$ Measurement of states --------------------- Process of measurement of state of quantum channel of information transfer in each specific event is carried out in two stages. At first stage interaction of channel with analyzer and reduction of density matrix of system to mix of states determined by analyzer take place. Mathematic representation of analyzer is orthogonal resolution of identity: complete system of orthogonal projectors $\left\{\roa{k}:\ k=1\ldots N\right\}$ projecting state after interaction with analyzer, or ladder operator $\hat{J}_3$ related to those projectors. The ladder operator can be respectively considered as operator of observable. After choice of analyzer as result of measurement there can be either distribution of probabilities: $$p_k=\tr{\hat{\rho}\hat{J}_3},\ k=1\ldots N-1,$$ that give $N-1$ real values: diagonal components of density matrix of measured state, or $N-1$ moments of observable: $$\aver{\hat{J}^k_3}=\tr{\hat{\rho}\hat{J}^k_3},\ k=1\ldots N-1,$$ values of which make it possible to determine same diagonal components of density matrix. Since $N$-th moment of observable depends on previous $N-1$ moments such result corresponds to complete measurement for each observable compatible with analyzer, i.e. such one that its matrix has eigenvectors same to those of analyzer. Arbitrary density matrix has $N^2-1$ independent real parameters, therefore one series of measurements can not determine state of system under consideration; an exception is observable, which basis of eigenvectors is identical to system of states in which quantum state of information transfer is prepared. In general case $N+1$ series of measurements are needed that use essentially different bases, i.e. such ones that do not transform to each other with simple permutation of vectors. For such bases operators $\hat{J}_3^{\left\{m\right\}}$ have not to commutate one with another. Sequence of mutually non-commutative operators one can easily construct having defined sequence of angles $\phi^{\left\{m\right\}}=m\pi/(N+1)$. Sequence of $N+1$ operators: $$\label{tomo} \hat{J}_3^{\left\{m\right\}} =\cos{\phi^{\left\{m\right\}}}\hat{J}_3 +\sin{\phi^{\left\{m\right\}}}\left(\hat{J}_++\hat{J}_-\right)/2:\ m=0\ldots N$$ that do not commutate one with another $$\Big[\hat{J}_3^{\left\{m\right\}}\hat{J}_3^{\left\{n\right\}}\Big]= \sin{\phi^{\left\{m-n\right\}}}\left(\hat{J}_+-\hat{J}_-\right)/2$$ has as eigenvectors sequence of needed bases, and results of measurements of each of observables $\hat{J}_3^{\left\{m\right\}}$ additionally define $N-1$ real numbers, independent characteristics of density matrix of measured state. General number of measurables coincides with number of real parameters of density matrix and in such way one obtains complete information of statistical properties of state of quantum channel. The scheme described sets realization of method of quantum tomography in application to arbitrary quantum system with finite-dimensional state space. Its advantage compared to standard schemes [@Lidar08] is in coordination with properties of source and/or detector since ladder operators are coordinated with system of basis vectors generated with properties of specific quantum channel of information transfer. Algebra of observables of paired channel ======================================== Hereinafter $N=N_A\cdot N_B$ denotes dimensionality of state space $\mathcal{H}=\mathcal{H}_A\otimes \mathcal{H}_B$ of composite (paired) channel of information transfer, $N_A$ – of state space $\mathcal{H}_A$ of smaller subchannel, $N_B$ – of state space $\mathcal{H}_B$ of the larger one. Observed values of paired channel are represented by matrices $N\times N=N_A\cdot N_B\times N_A\cdot N_B$ in common state space, of first subchannel – by matrices $N_A\times N_A$, of the second one – by $N_B\times N_B$. Arbitrary observable of paired channel is some algebraic combination of subchannels observables. To arbitrary basis of state space of paired channel $\left\{\catt{k}:\ k=1\ldots N\right\}$ ladder operators $\hat{J}_a$ are associated. In induced basis $\catt{m,n}=\cat{m}\otimes\catr{n}$ observables of composite channel are represented by matrices with double indices: $$O_{mn,m'n'}=\matt{m,n}{\hat{O}}{m',n'};\ \hat{O}=\sum_{\forall n,m,n',m'}{O_{mn,m'n'}\pro{m,n}{m',n'}}.$$ One can separate among observables of channel the observables hat depend on state of subchannel $A$ or $B$ only: $$A_{mn,m'n'}=A_{m,m'}\delta_{n,n'};\ B_{mn,m'n'}=\delta_{m,m'}B_{n,n'}.$$ Invariant form of observables of subchannels: $$\hat{A}=\sum_{\forall m,m'}{A_{m,m'}\ro{m}{m'}}\otimes \hat{I};\ \hat{B}= \hat{I}\otimes\sum_{\forall n,n'}{B_{n,n'}\ror{n}{n'}}.$$ Ladder operators of subchannels ------------------------------- Let us denote, with similarity to rule of angular moment addition in mind, $s=\frac{N_A-1}{2}$ and $l=\frac{N_B-1}{2}$ the ranks of state spaces of subchannels, and put into correspondence to bases of subchannels $\left\{\cat{m}\right\}$ and $\left\{\catr{n}\right\}$ sets of ladder operators. - Subchannel A: $$\label{ladder_defS} \begin{array}{l} \hat{S}_+\stackrel{Def}{=} \sum^{N_A}_{m=1}{\sqrt{\left(N_A-m\right)m}\cat{m+1}\otimes\bra{m}};\\ \hat{S}_-\stackrel{Def}{=} \sum^{N_A}_{m=1}{\sqrt{\left(N_A+1-m\right)\left(m-1\right)}\cat{m-1}\otimes\bra{m}}; \\ \hat{S}_3\stackrel{Def}{=} \big(\hat{S}_+\hat{S}_--\hat{S}_-\hat{S}_+\big)/2= \sum^{N_A}_{m=1}{\left(m-\frac{1+N_A}{2}\right)\cat{m}\otimes\bra{m}}; \end{array}$$ - Subchannel B: $$\label{ladder_defL} \begin{array}{l} \hat{L}_+\stackrel{Def}{=} \sum^{N_B}_{n=1}{\sqrt{\left(N_B-n\right)n}\ecat{n+1}\otimes\ebra{n}};\\ \hat{L}_-\stackrel{Def}{=} \sum^{N_B}_{n=1}{\sqrt{\left(N_B+1-n\right)\left(n-1\right)}\ecat{n-1}\otimes\ebra{n}}; \\ \hat{L}_3\stackrel{Def}{=} \big(\hat{L}_+\hat{L}_--\hat{L}_-\hat{L}_+\big)/2= \sum^{N_B}_{n=1}{\left(n-\frac{1+N_B}{2}\right)\ecat{n}\otimes\ebra{n}}. \end{array}$$ Each of the sets separately is generating for algebra of observables of respective subchannel, along with that they realize irreducible representations of group $SU(2)$, thus direct sum of those : $$\label{sub_ladder} \hat{J}^{\left\{ind\right\}}_a=\hat{S}_a\otimes \hat{I}+\hat{I}\otimes \hat{L}_a;$$ realizes as well representation of the same group in state space of channel and generates induced ladder operators of paired channel. This representation is direct sum of irreducible representations of ranks $\left\{l-s \ldots l+s\right\}$. Eigenvectors $\catt{j,m}$ of induced operator of ladder operator of composite channel$\hat{J}^{\left\{ind\right\}}_3$ are formed by rule of momentum adding: $$\label{clebsh} \catt{j,m} =\sum_{m_s=-s\ldots s}{C_{j,m;m_s}\cat{m_s}\otimes\catr{m-m_s}}.$$ Here for Clebsch-Gordan coefficients denotation $ C_{j,m;m_s}=\bracatt{s,l,m_s,m-m_s}{j,m} $ is used. Induced ladder operators differ from ladder operators of channel at least because of the fact that operator $\hat{J}^{\left\{ind\right\}}_3=\hat{S}_3\otimes \hat{I}+\hat{I}\otimes \hat{L}_3$ is degenerate: part of its eigenvalues are same. Thus paired channel differs from one-part one by existence of two sets of ladder operators – irreducible set $\hat{J}_a$ of operators that are generating for algebra of observables of the channel in general and induced set $\hat{J}^{\left\{ind\right\}}_a$ formed by direct sums of ladder operators of subchannels . Diagonalization of density matrices ----------------------------------- States of paired quantum channel of information transfer are characterized by three density matrces: - Density matrix of composite channel: $\hat{\rho}=\sum_{j=l-s}^{l+s}{\sum_{m=-j}^j{p_{j,m}\proa{j,m}}}$; - Density matrix of subchannel $A$: $\hat{\rho}^{\left\{A\right\}}= \sum_{m_s=-s}^s{p_{m_s}\roa{m_s}}$; - Density matrix of subchannel $B$: $\hat{\rho}^{\left\{B\right\}}= \sum_{m_l=-l}^l{p_{m_l}\eroa{m_l}}$. In non-degenerate case each of those matrices has single set of eigenvectors and from it follows [@Gdansk; @VU1e; @VU2e], that in case of system of vectors being eigen system for density matrix of composite channel it is eigen system for density matrices of both subchannels. Eigenvalues $p_{j,m}$ of density matrix of composite quantum channel of information transfer determine probability of formation of respective state $\catt{j,m}$ by channel source and are properties of not the channel but the source. Similarly, system of eigenvectors of density matrix is characteristic of source of channel since eigenvectors of density matrix are vectors of pure states formed by source in each separate event of information transfer by channel. Properties of medium of channel and its decomposition to subchannels determine the system of eigenvectors of subchannels and representation of basis vectors of the channel. Eigenvalues of density matrices of subchannels are: $$\label{PS} p^{\left\{A\right\}}_n=\sum_{j=l-s}^{l+s}{\sum_{m=-j}^{ j}{p_{j,m}C_{j,m;n}^2}};$$ $$\label{PL} p^{\left\{B\right\}}_k=\sum_{j=l-s}^{l+s}{\sum_{m=-j}^{ j}{p_{j,m}C_{j,m;m-k}^2}}.$$ Those determine probabilities of registration of respective states of subchannels. To simultaneous measurement of both subchannels operation of some $m$-th detector of subchannel $A$ and $n$-th detector of subchannel $B$ simultaneousely corresponds. Result of simultaneous measurement of both subchannels is in joint probability distribution that can be calculated by density matrix of composite channel as trace of product of density matrix of paired channel and projectors to eigenstates of subchannels: $$P_{m,n}=\tr{\hat{\rho}\hat{P}^{\left\{A\right\}}_m\hat{P}^{\left\{B\right\}}_n} =\sum_{j=l-s}^{l+s}{p_{j,m+n}C^2_{j,m+n;m}}.$$ Properties of entangled states ------------------------------ Density matrix of paired quantum channel of information transfer is characterized in basis of eigenvectors $N$ by probabilities $p_k$ sum of which is equal to one, thus in basis of eigenvectors is $N-1=N_AN_B-1$ characteristics of state. Along with that density matrixes of subchannels are characterized with $N_A-1+N_B-1=N_A+N_B-2$ probabilities of eigenstates of density matrices of subchannels only. Thus, in general case density matrix can not be determined by results of independent measurements of density matrices of each subchannel. Exceptions are degenerate states for which density matrix is function of induced operator $\hat{J}^{\left\{ind\right\}}_3$: $$\hat{\rho}^{deg}=\rho\left(\hat{J}^{\left\{ind\right\}}_3\right).$$ In fact the induced operator has $2\left(l+s\right)+1=N_A+N_B-1$ different eigenvalues only, and with account of condition for sum of eigenvalues this number completely coincides with number of eigenvalues of density of subchannels. $$\label{dia} \hat{\rho}_{sys}=\sum_{j=l-s}^{l+s}{\sum_{m=-j}^{j}{ p_{j,m}\proa{j,m} }}.$$ Measurement of states of paired channel ======================================= Complete measurement of state of composite quantum channel of information transfer is to determine $N^2-1$ real values – components of density matrix. Complete measurements of states of each of subchannels give $N_A^2-1$ and $N_B^2-1$ real parameters – and $\left(N_AN_B\right)^2-1-\left(N_A^2-1\right)-\left(N_B^2-1\right)=\left(N_A^2-1\right)\left(N_B^2-1\right)$ characteristics of state remain not determined. Additional characteristics of state are components of covariance matrix $Q=\aver{\hat{O}_A\otimes \hat{O}_B} -\aver{\hat{O}_A}\aver{\hat{O}_B}$, that are to be measured in number equal for determination of all not determined parameters. Method of ladder operators makes it possible to construct system of observables needed for complete determination of all covariance matrix similar to the one used for method of quantum tomography . Let us denote angles $\phi=\frac{2\pi}{N_B}$ and $\psi=\frac{2\pi}{N_A}$. Systems of noncommuting in pairs operators: $$\hat{L}_3^{\left\{m\right\}} =\cos{\phi^{\left\{m\right\}}}\hat{L}_3 +\sin{\phi^{\left\{m\right\}}}\left(\hat{L}_++\hat{L}_-\right)/2:\ m=0\ldots N_B,$$ and $$\hat{S}_3^{\left\{n\right\}} =\cos{\psi^{\left\{n\right\}}}\hat{S}_3 +\sin{\psi^{\left\{n\right\}}}\left(\hat{S}_++\hat{S}_-\right)/2:\ n=0\ldots N_A,$$ determine complete sets of observables of the method of quantum tomography for each of subchannels. Therefore the system $\left(N_A^2-1\right)\left(N_B^2-1\right)$ of components of covariance matrix $$\label{tomo-pair} {Q}_{m,n}=\aver{\hat{L}_3^{\left\{m\right\}}\otimes \hat{S}_3^{\left\{n\right\}}} -\aver{\hat{L}_3^{\left\{m\right\}}}\aver{\hat{S}_3^{\left\{n\right\}}}.$$ completes the observables of each of subchannels and makes it possible to determine completely state of composite quantum channel. By analogy with method of quantum tomography in application to separate quantum channel of information transfer, method for determination of state of paired quantum channel through measurement of coefficients of covariance matrix should also be named paired quantum tomography . Measurement of pure states -------------------------- Pure states are the states with density matrix that has only one non-zero eigenvalue $\rho_{j,m}=1$ $$\label{diag} \hat{\rho}_{j,m}=\proa{j,m}=\sum_{k,n=-s\ldots s}{C_{j,m;k}C_{j,m;n} \cat{m-k}\bra{m-n}\otimes\ecat{k}\ebra{n} }$$ Result of measurement of state of one of subchannels is reduction of density matrix of state of composite channel in general and density matrix of the other subchannel. If the state of the channel is not direct product of states of subchannels measurement destroys pure state with its transformation into mix: $$\hat{\rho}_{j,m}=\sum_{m_s=-s\ldots s}{C_{j,m;m_s}^2 \roa{m-m_s}\otimes\eroa{m_s}};$$ Matrices of state densities of subchannels$$\hat{\rho}^{\left\{B\right\}}_{j,m}=\sum_{m_s=-s\ldots s}{C_{j,m;m_s}^2 \roa{m-m_s}};$$ $$\hat{\rho}^{\left\{A\right\}}_{j,m} =\sum_{m_s=-s\ldots s}{C_{j,m;m_s}^2 \eroa{m_s}}.$$ are similar and can be represented by matrix$$\label{sub_rho} \hat{\rho}^{\left\{sub\right\}}_{j,m}=\sum_{n=-s\ldots s}{\rho_{j,m;n} \roa{n}};\ \rho_{j,m;n}=C_{j,m;n}^2.$$ Density matrix of state of subchannel has rank that is equal to dimension of the smaller of subchannels. Correlation properties are determined by non-diagonal terms , thus by terms of double sum with different indices $k\neq n$. Probability $P_{n}$ of registration of one of subchannels in state $n$ is equal: $$P_{n}^{\left\{A\right\}}=C_{j,m;m-n}^2;\ P_{n}^{\left\{B\right\}}=C_{j,m;n}^2.$$ Probability $P_{j,m}\left(k,n\right)$ of simultaneous registration of one subchannels in state $k$ and the other one in state $n$ is equal: $$P_{j,m}\left(k,n\right)=C_{j,m;n}^2 \delta_{m-n,k},$$ and conditional probability is equal: $$P_{j,m}\left(k|n\right)=\delta_{m-n,k}.$$ Thus states of subchannels are completely correlated if composite quantum channel of information transfer is in one of pure states. There exist exactly two independent pure states for which statistical distribution of results of measurement is absent: $$\catt{j,\pm j}=\cat{s,\pm s}\otimes\catr{l,\pm l},$$ all the other pure states are entangled. Entropy of entanglement ----------------------- Von Neumann entropy of composite quantum channel of information transfer is determined by function of density matrix of channel: $$\label{S_full} S_N=-\sum_{j,m}{p_{j,m}\log_2 p_{j,m}},$$ and is characteristic of the method of preparation of states of channel. For pure state it is equal to zero, for equilibrium mix of all possible states it takes the largest value $\log_2 N $. Degeneration of state is accompanied by increase of entropy. In fact, if two eigenvalues of density matrix almost coincide one can use substitution $p_1=p_m+d$, $p_2=p_m-d$, then normalization condition $$p_1+p_2+ \sum_{k=3}{p_k} =2p_m+\sum_{k=3}{p_k}$$ does not include input from difference of eigenvalues and therefore derivatives of entropy as functions of difference of eigenvalues are determined with two terms only: $$\frac{\partial S}{\partial d}= \frac{\partial }{\partial d}\left(-\left(p_m+d\right)\log_2 \left(p_m+d\right)-\left(p_m-d\right)\log_2 \left(p_m-d\right)\right),$$ and are equal: $$\frac{\partial S}{\partial d}=\log_2 \frac{p_m-d}{p_m+d};\ \frac{\partial^2 S}{\partial d^2}=- \frac{2p_m}{p_m^2-d^2}.$$ One can see that at degeneration $d \mapsto 0$ first derivative tends to zero whereas second derivative remains negative. Values of von Neumann entropy for subchannels are determined by distributions and of probabilities of registration of each of engenstates of subchannels: $$\label{def_ss} S^{\left\{A\right\}}=-\sum_{m}{ p^{\left\{A\right\}}_{m}\log_2 p^{\left\{A\right\}}_{m}};\ S^{\left\{B\right\}}=-\sum_{m}{ p^{\left\{B\right\}}_{m}\log_2 p^{\left\{B\right\}}_{m}}$$ Naturally, Shannon entropy for each of subchannels can differ due to inadequate choice of measuring devices. Since even in the case of pure state $\catt{j,M}$ of composite channel states of subchannels are usually mixed, conditional entropies $S_{j,M}$ differ from zero and are determined by respective Clebsch-Gordan coefficients: $$\label{def_sp} S_{j,M}= S^{\left\{A\right\}}_{j,M}= S^{\left\{B\right\}}_{j,M}=-\sum_{m=-s\ldots s}{ C_{j,M;m}^2\log_2 C_{j,M;m}^2}.$$ This expression determines entropy of entanglement [@VP; @RHMH] of arbitrary pure state of composite quantum channel, and thus information on state of subchannel that can be obtained as result of measurement of state of the second subchannel. Value of entropy of entanglement is bounded from above with dimension of the smaller of the subchannels. Really, each of the sums includes not more than $2s+1$ terms, respectively to dimensionality of state space of the smaller subchannel, thus one has evaluation: $$S_{ent}\leq \log_2N_A=\log_2\left(2s+1\right).$$ Entropy of entanglement is generated with process of reduction due to measurement of pure state of paired channel. Input of that value to information capacity of paired channel depends on the method of measurement. In the case of measurement carried out only in one (the larger, for certainty) subchannel, given state of subchannel $\cat{m_l}$ can be obtained if the state of the channel belongs to the set: $$\left\{\catt{j,m_l+m_s}:\ m_s=-s\ldots s,\ j=\max\left(l-s,\left|m_l+m_s\right|\right)\ldots l+s\right\}.$$ Number of those sets is somewhat smaller than $\left(2s+1\right)^2=N^2_A$, thus the upper boundary of information on state of channel (Holevo limit) is equal: $$H=S_N-\sum_{j,m}{S_{j,M}} \geq S_N-2\log_2N_A.$$ For uniformly distributed channel the right-hand part is exactly equal to maximally possible value $\log_2N_B$ of information obtained by the larger sub-channel. In the case of measurement carried out independently in both channels (without account of correlation of results of measurements in subchannels)loss of entropy as result of measurement of pure state is $2S_{j,M}$ and Holevo limit becomes smaller than the one admissible for the larger subchannel. Measurements with account of correlation between subchannels give incomplete determination of state as well since the same pair of eigenvalues $m_l$ and $m_s$ of operators of observables of subchannels one can obtain for $2s+1$ (or a bit less) different states $\left\{\catt{j,m_l+m_s}:\ j=\max\left(l-s,\left|m_l+m_s\right|\right)\ldots l+s\right\}$. Respective Holevo limit can be estimated as $S_N-\log_2N_A$. Examples ======== General expressions of Clebsch-Gordan coefficients are not enough for explicit determination of all the properties of paired quantum channels of information transfer. Hereinafter examples demonstrating general properties of paired channel are studied in more detail. Similar subchannels ------------------- Let us suppose that paired quantum channel is divided into two parts with isomorphous state spaces $\mathcal{H}_A=\mathcal{H}_B$. Respectively, state space of composite channel is space of recond rank tensors on states of each of the channels $\mathcal{H}=\mathcal{H}_A\otimes\mathcal{H}_B=\mathcal{H}_A\otimes\mathcal{H}_A$. Such a channel we call here a dual one. Eigenvectors of density matrix of dual channel are following linear combinations of vectors of induced basis: $$\catt{j,m}=\sum_{m_s=-l}^l{C_{j,m;m_s}\cat{m_s}\otimes\ecat{m-m_s}};\ m=-j\ldots j; j=0\ldots 2l.$$ Density matrix of arbitrary mixed state: $$\hat{\rho}=\sum_{j=0}^{2l}{\sum_{m=-j}^j{p_{j,m}\proa{j,m}}}.$$ The state remains entangled till density matrix is not degenerate. To disentangled states density matrix correspond in which all the eigenvalues with same quantum number $m$ are the same: $$p_{\left|m\right|,m}=p_{\left|m\right|+1,m}=\ldots =p_{2l,m};\ m=-2l\ldots 2l.$$ Now let us consider a more specific non-trivial example $l=1$ (subchannels with smaller dimensionality are just a pair of qubits). The basis is formed by the following entangled state vectors: Completely entangled state ($j=0$) includes all the basis vectors of state spaces of subchannels: $$\catt{0,0}=\frac{1}{\sqrt{3}}\cat{-1}\otimes\ecat{1} -\frac{1}{\sqrt{3}}\cat{0}\otimes\ecat{0}+\frac{1}{\sqrt{3}}\cat{1}\otimes\ecat{-1},$$ Entropy of entanglement of the state $S_{0,0}=\log_23$. Three partially entangled states ($j=1$) include only a pair of basis vectors of state spaces of subchannels each: $$\begin{array}{l} \catt{1,-1}=\frac{1}{\sqrt{2}}\cat{-1}\otimes\ecat{0} -\frac{1}{\sqrt{2}}\cat{0}\otimes\ecat{-1}\\ \catt{1,0}=\frac{1}{\sqrt{2}}\cat{-1}\otimes\ecat{1} -\frac{1}{\sqrt{2}}\cat{1}\otimes\ecat{-1}\\ \catt{1,1}=\frac{1}{\sqrt{2}}\cat{1}\otimes\ecat{0} -\frac{1}{\sqrt{2}}\cat{0}\otimes\ecat{1}\\ \end{array}$$ Entropy of entanglement of each of the states $S_{1,m}=1$. Three entangled states ($j=2$): two include only pair of basis vectors of state spaces of subchannels each whereas the third is completely entangled: $$\begin{array}{l} \catt{2,-1}=\frac{1}{\sqrt{2}}\cat{-1}\otimes\ecat{0}+\frac{1}{\sqrt{2}}\cat{0}\otimes\ecat{-1}\\ \catt{2,0}=\frac{1}{\sqrt{6}}\cat{-1}\otimes\ecat{1} +\frac{2}{\sqrt{6}}\cat{0}\otimes\ecat{0}+\frac{1}{\sqrt{6}}\cat{1}\otimes\ecat{-1}\\ \catt{2,1}=\frac{1}{\sqrt{2}}\cat{1}\otimes\ecat{0}+\frac{1}{\sqrt{2}}\cat{0}\otimes\ecat{1}\\ \end{array}$$ Entropy of entanglement of two states $S_{2,\pm 1}=1$, of the third one – $S_{2,0}=\log_23-1/3$. Two not entangled states ($j=2$) include only one basis vector of state spaces of subchannels each: $$\catt{2,-2}=\cat{-1}\otimes\ecat{-1};\ \catt{2,2}=\cat{1}\otimes\ecat{1}.$$ For uniformly distributed state $p_k=1/9$ and Holevo limit: $$H=\log_29-\frac{5+3\log_23-1/3}{9},$$ is equal to 3.88 bits instead of 4.755 bits for one-particle channel. Bisection of composite channel ------------------------------ Method of bisection is one of the most efficient methods of classical information theory since just with that method finite set of events is represented by subset of some power of Boolean algebra and points of event set – with sequence of zeroes and unities. State space of quantum channel of information transfer of paired dimensionality at application of bisection method gets representation with direct product of two-dimensional state space of the smaller subchannel – qubit and $\frac{N}{2} =2l+1$ – dimensional state space of the larger subchannel. In the case of state space of composite channel having dimensionality $2^d$ such separation of qubits can be continued $d$ times till the state space of the second subchannel is left two-dimensional – decomposition of quantum channel of information transfer to multi-qubit takes place. In the case of state space of composite channel having other dimensionality it can always be embedded to space dimensionality of which is power of two and be considered as subspace of multi-qubit state space. In spite of state space separate state of quantum channel not always can be given by composition of qubits, that for it is needed for construction of channel to admit simultaneous measurement of each of qubits. So, quantum channel in which information carrier is one electron that can be in several potential wells is not a composite channel since concurrently only one measurable can be measured. Two electrons with arbitrary spin in two or more wells form a pair of qubits, and in four wells for decomposition into three qubits three electrons are needed. Here properties of composite channel in which one of subchannels has two-dimensional state space, and the other one, arbitrary, are studied. ### Paragubit The simplest example of such channel is a paraqubit that consists of two parts and has four-dimensional state of common states. That state space is divided into three-dimensional irreducible subspace (triplet one) with basis of eigenvectors of operator $J^{\left\{ind\right\}}_3$: $$\catt{1,1}=\cat{1/2}\otimes\catr{1/2};\ \catt{1,-1}=\cat{-1/2}\otimes\catr{-1/2}$$ $$\catt{1,0}=\frac{1}{\sqrt{2}}\cat{1/2}\otimes\catr{-1/2}+\frac{1}{\sqrt{2}}\cat{-1/2}\otimes\catr{1/2},$$ and one-dimensional (singlet) with basis: $$\catt{0,0}=\frac{1}{\sqrt{2}}\cat{1/2}\otimes\catr{-1/2}-\frac{1}{\sqrt{2}}\cat{-1/2}\otimes\catr{1/2}.$$ Two states are non entangled, and two entangled states of paraqubit give for the particles same uniformly distributed mixed states with degenerate density matrices: $$\hat{\rho}^{\left\{A,B\right\}}=\frac{1}{2}\hat{1}.$$ In realization of paraquibit with pair of electrons asymmetry of states with respect to permutation decreases state space of composite channel to one-dimensional, always entangled. Realization with pair of photons has three-dimensional state space with one entangled and two not entangled states. Complete four-dimensional state space is possible in the case of use of different parts as one and the other qubits only. ### Qubit-qutrit The following example is pair of particles with six possible states. Result of separation of qubit is subchannel with three states – qutrit. Six-dimensional state space is separated into four-dimensional and two-dimensional irreducible subspaces. Four-dimensional irreducible subspace of state space of composite channel has two not entangled states with basis vectors: $$\catt{3/2,3/2}=\cat{1/2}\otimes\ecat{1};\ \catt{3/2,-3/2}=\cat{-1/2}\otimes\ecat{-1},$$ and two entangled ones$$\begin{array}{l} \catt{3/2,1/2}=\sqrt{\frac{2}{3}}\cat{1/2}\otimes\ecat{0}+ \sqrt{\frac{1}{3}}\cat{-1/2}\otimes\ecat{1};\\ \catt{3/2,-1/2}=\sqrt{\frac{1}{3}}\cat{1/2}\otimes\ecat{-1}+ \sqrt{\frac{2}{3}}\cat{-1/2}\otimes\ecat{0}.\\ \end{array}$$ Two-dimensional subspace has two entangled states: $$\begin{array}{l} \catt{1/2,1/2}=\sqrt{\frac{1}{3}}\cat{1/2}\otimes\ecat{0}- \sqrt{\frac{2}{3}}\cat{-1/2}\otimes\ecat{1};\\ \catt{1/2,-1/2}=\sqrt{\frac{2}{3}}\cat{1/2}\otimes\ecat{-1}- \sqrt{\frac{1}{3}}\cat{-1/2}\otimes\ecat{0};\\ \end{array}$$ Entangled states have following one-particle density matrices: $$\begin{array}{lll} \catt{\frac{1}{2},\pm\frac{1}{2}}:& \frac{1}{3}\roa{0}+\frac{2}{3}\roa{\pm1};& \frac{1}{3}\eroa{\pm\frac{1}{2}}+\frac{2}{3}\eroa{\mp\frac{1}{2}}\\ \catt{\frac{3}{2},\pm\frac{1}{2}}:& \frac{2}{3}\roa{0}+\frac{1}{3}\roa{\pm1};& \frac{2}{3}\eroa{\pm\frac{1}{2}}+\frac{1}{3}\eroa{\mp\frac{1}{2}} \end{array}$$ In each of entangled pure states state density matrices of each of the parts of the qutrit have only two non-zero eigenvalues each, and there is no state equidistribution. ### Qubit in multi-state channel Let us now consider bisection of composite channel with arbitrary given dimensionality $N=2N_B$. Under consideration that the smaller subchannel is a qubit, i.e. has two-dimensional state space, quantum number of the larger subchannel is $l=\frac{N_B-1}{2}$, and eigenvalues of the induced ladder operator $J_3^{\left\{ind\right\}}$ are the following combinations of the vectors of induced basis: $$\begin{array}{l} \catt{l+1/2,l+1/2}=\cat{1/2}\otimes\ecat{l}; \\ \catt{l+1/2,-l-1/2}=\cat{-1/2}\otimes\ecat{-l};\\ m=-l+1/2\ldots l-1/2:\\ \catt{l+1/2,m}=\sqrt{\frac{l+1/2+m}{2l+1}}\cat{1/2}\otimes\ecat{m-1/2}+ \sqrt{\frac{l+1/2-m}{2l+1}}\cat{-1/2}\otimes\ecat{m+1/2};\\ \catt{l-1/2,m}=-\sqrt{\frac{l+1/2-m}{2l+1}}\cat{1/2}\otimes\ecat{m-1/2}+ \sqrt{\frac{l+1/2+m}{2l+1}}\cat{-1/2}\otimes\ecat{m+1/2}. \end{array}$$ There are only two not entangled states, those correspond to combination of the end states of both subchannels. Input of each of entangled states to density matrix of composite channel is given with the expressions: $$\begin{array}{l} \proa{l+1/2,m}=\\ \frac{l+1/2+m}{2l+1}\proa{1/2,m-1/2}+ \frac{l+1/2-m}{2l+1}\proa{-1/2,m+1/2}\\ - \frac{\sqrt{\left(l+1/2+m\right)\left(l+1/2-m\right)}}{2l+1}\times\\ \left(\pro{1/2,m-1/2}{-1/2,m+1/2}+\pro{-1/2,m+1/2}{1/2,m-1/2}\right);\\ \proa{l-1/2,m}=\\ \frac{l+1/2-m}{2l+1}\proa{1/2,m-1/2}+ \frac{l+1/2+m}{2l+1}\proa{-1/2,m+1/2}\\ + \frac{\sqrt{\left(l+1/2+m\right)\left(l+1/2-m\right)}}{2l+1}\times\\ \left(\pro{1/2,m-1/2}{-1/2,m+1/2}+\pro{-1/2,m+1/2}{1/2,m-1/2}\right).\\ \end{array}$$ Inputs from states with same quantum number $m$ are same one to another. Those include with given coefficients diagonal in induced basis terms that generate similar terms in density matrices of subchannels: $$\begin{array}{l} \hat{\rho}^{\left\{A\right\}}_{l+1/2,m}= \frac{l+m+1/2}{2l+1}\roa{1/2}+ \frac{l+1/2-m}{2l+1}\roa{-1/2};\\ \hat{\rho}^{\left\{A\right\}}_{l-1/2,m}= \frac{l+1/2-m}{2l+1}\roa{1/2}+ \frac{l+1/2+m}{2l+1}\roa{-1/2}; \end{array}$$ $$\begin{array}{l} \hat{\rho}^{\left\{B\right\}}_{l+1/2,m}= \frac{l+m+1/2}{2l+1}\eroa{m-1/2}+ \frac{l+1/2-m}{2l+1}\eroa{m+1/2};\\ \hat{\rho}^{\left\{B\right\}}_{l-1/2,m}= \frac{l+1/2-m}{2l+1}\eroa{m-1/2}+ \frac{l+1/2+m}{2l+1}\eroa{m+1/2}. \end{array}$$ Inputs to density matrix of composite channel from cross terms $$\begin{array}{l} \pm \frac{\sqrt{\left(l+1/2+m\right)\left(l+1/2-m\right)}}{2l+1}\times\\ \left(\pro{1/2,m-1/2}{-1/2,m+1/2}+\pro{-1/2,m+1/2}{1/2,m-1/2}\right)\\ \end{array}$$ differ with sign only. Just the cross terms are responsible for entanglement of states, thus state of composite channel is disentangled only in the case of compensation of all the cross terms, this is provided if all the differences of eigenvalues $p_{l+1/2,m}-p_{l-1/2,m}$ go to zero: $$q_m=p_{l+1/2,m}-p_{l-1/2,m}; m=-l+1/2\ldots l-1/2.$$ Reduction to zero of all the differences is condition of disentanglement of arbitrary mixed state. Density matrices of subchannels are diagonal $$\hat{\rho}^{\left\{A\right\}}=\frac{1}{2}\hat{I}+\frac{q}{2}\hat{\sigma}_z;\ \hat{\rho}^{\left\{B\right\}}=\sum_{\mu=-l}^l{ p_\mu\eroa{\mu}}$$ Density matrix of the smaller subchannel is characterized with one parameter $q$ – deflection from equilibrium state: $$\label{rule_q} q=\sum_{m=-l+1/2}^{l-1/2}{\frac{2m}{2l+1}q_m}+\frac{1}{2}p_{l+1/2,l+1/2}-\frac{1}{2}p_{l+1/2,-l-1/2},$$ therefore weighted average value of parameters of entanglement $q_m$ for each pair of modes is equal $$\label{rule_qs} \sum_{m=-l+1/2}^{l-1/2}{\frac{m}{2l+1}q_m}=q-\frac{1}{2}p_{l+1/2,l+1/2}+\frac{1}{2}p_{l+1/2,-l-1/2}.$$ This sum is not equal to zero if at least some cross terms are not compensated and the state is entangled. Eigenvalues of density matrix of the larger subchannel are determined by combinations of four adjacent eigenvalues of density matrix of the channel: $$p_\mu= \frac{l+1+\mu}{2l+1}p_{l+1/2,\mu+1/2}+\frac{l+1+\mu}{2l+1}p_{l+1/2,\mu-1/2}+$$ $$\frac{l+1+\mu}{2l+1}p_{l+1/2,\mu+1/2}+\frac{l-\mu}{2l+1}p_{l-1/2,\mu-1/2},$$ and have following representation: $$\label{rule_sum} p_\mu=p_{l+1/2,\mu+1/2}+p_{l+1/2,\mu-1/2}-\frac{l-\mu}{2l+1}q_{\mu+1/2}-\frac{l+\mu}{2l+1}q_{\mu-1/2}.$$ Disentanglement of all the pairs of states of composite channel with same values $m$ is accompanied with transformation of density matrix of qubit to equilibrium one. At that density matrix of the larger channel remains almost arbitrary: its eigenvalues become sums of neighboring eigenvalues of density matrix of composite channel: $$\label{rule_sum2} p_\mu=p_{l+1/2,\mu+1/2}+p_{l+1/2,\mu-1/2};\ \mu=-l \ldots l,$$ though one should not expect any additional degeneration independent of properties of density matrix of not entangled composite channel. Sequence of relations can be used as indication of entanglement of mixed state of composite channel. In fact, each non-zero value in sequence: $$\label{rule_dif} dp_\mu= p_\mu-p_{l+1/2,\mu+1/2}-p_{l+1/2,\mu-1/2};\ \mu=-l \ldots l,$$ makes evidence of absence of disentanglement of one of $\left[l-1/2\right]$ pairs of states. #### Indications of entanglement of qubit in composite channel. As the result, study of bisection of composite quantum channel of information transfer carried out by method of ladder operators has the following indications of entanglement of qubit state with the state of the second cubchannel: - deflection from equilibrium of density matrix of qubit, according to formula , is indication of entanglement, though absence of such deflection is not indication of disentanglement of state; - absence of $\frac{N}{2}-1$ pairs of same eigenvalues of density matrix of composite quantum channel of information transfer is indication of entanglement of state; - for each four eigenstates of density matrix of composite quantum channel that make input to some state $\eroa{\mu}$ of the larger subchannel the expression makes it possible to check absence or presence of effect of entanglement of those states on the state of the channel. Entropy of composite channel with qubit --------------------------------------- Let us begin from the simpliest example. Entropy of arbitrary mixed state of pair of qubits is determined by eigenvalues of density matrix: $$\label{full_pq} \hat{\rho}=p_s \hat{\rho}_s + p_{0}\proa{0,0}+ p_{1}\proa{1,1}+ p_{t}\proa{t}$$ with portion $p_s$ of singlet state, portions $p_{0}$ and $p_{1}$ of states of independent parts and portion $p_{t}$ of entangled triplet state. Probabilities of states satisfy the conditions $$p_s =1- p_{0}- p_{1}- p_{t};\ p_{0}\geq0;\ p_{1}\geq0;\ p_{t}\geq0;\ p_s\geq0.$$ In induced basis that very matrix looks like $$\label{full_pqs} \begin{array}{l} \hat{\rho}= p_{0}\roa{0}\otimes\eroa{0}+p_{1}\roa{1}\otimes\eroa{1}\\ + \frac{p_{t}+p_s}{2}\big(\roa{0}\otimes\eroa{1}+\roa{1}\otimes\eroa{0}\big)\\ + \frac{p_{t}-p_s}{2}\big( \cat{0}\bra{1}\otimes\ecat{1}\ebra{0}+ \cat{1}\bra{0}\otimes\ecat{0}\ebra{1} \big) \end{array},$$ where one can easily see the part responsible for entanglement of states (the last line). This part vanishes in the case of coincidence of portion of singlet and entangled triplet states, $p_s=p_{t}$. Let us denote: $$p_0=\frac{1-d}{2}\frac{1-r}{2};\ p_1=\frac{1-d}{2}\frac{1+r}{2};\ p_t=\frac{1+d}{2}\frac{1-q}{2};\ p_s=\frac{1+d}{2}\frac{1+q}{2};$$ $$h\left(x\right)=-\frac{1+x}{2}\log_2\frac{1+x}{2}-\frac{1-x}{2}\log_2\frac{1-x}{2}.$$ In those denotations entropy of arbitrary state of pair of qubits is: $$S=h\left(d\right)+\frac{1-d}{2}h\left(r\right)+\frac{1+d}{2}h\left(q\right),$$ while entropy of one of qubits is given by expression: $$S=h\left(\frac{1-d}{2}r\right).$$ If the portion $\frac{1+d}{2}$ of entangled states is large enough, entropy of each of qubits exceeds entropy of composite state, as one can see from fig. \[S\_bitQ\]. The upper solid curve and the upper dotted curve represent dependence on parameter of mixing of entropy of state for pair of qubits. Horizontal solid line and dotted line represent entropies of each of the qubits of the pair. Till there is no admixture of not entangled states ($d=1$), entropy of each qubit separately is larger than entropy of pair. For such states process of measurement of one of qubits creates information on state of the other one. In the case of state of channel having noticeable admixture of one or both not entangled states of the pair entropy of one qubit can exceed entropy of pair only in the case of noticeable shift to one of entangled states. ![\[S\_bitQ\]Dependence of entropy of qubit pair on difference of portions of triplet and singlet states. Firm lines show mixed state with noticeable admixture of not entangled states ($r=0.9,d=0.6$), dotted lines – mix of triplet and singlet states. Left edge of the graph corresponds to singlet state, the right edge – to triplet one.](SbitQ) Vanishing of entanglement of states in the example given above takes place due to degeneration of density matrix: coincidence of eigenvalues $p_s$ and $p_{t}$ corresponding to entangled states. Along with that coincidence of other pairs of eigenvalues does not bring to existence disentanglement of states. #### Qubit with qutrit. Arbitrary state of composition of qubit with qutrit is weighted mix of pure states and can be represented as $$\begin{array}{r} \hat{\rho}_{p}= \sum_{m=\pm1/2}{p_{1/2,m}\proa{1/2,m}}\\ +\sum_{m=\pm1/2,\pm3/2}{p_{3/2,m}\proa{3/2,m}} \end{array}$$ In induced basis $$\begin{array}{lr} \hat{\rho}_{p}& =p_{3/2,+3/2}\roa{1}\otimes\eroa{1/2}+p_{3/2,-3/2}\roa{-1}\otimes\eroa{-1/2}\\ +&\left(\frac{1}{3}p_{3/2,1/2}+\frac{2}{3}p_{1/2,1/2}\right)\roa{1}\otimes\eroa{-1/2}\\ +&\left(\frac{1}{3}p_{3/2,-1/2}+\frac{2}{3}p_{1/2,-1/2}\right)\roa{-1}\otimes\eroa{1/2}\\ +&\left(\frac{2}{3}p_{3/2,1/2}+\frac{1}{3}p_{1/2,1/2}\right)\roa{0}\otimes\eroa{1/2}\\ +&\left(\frac{2}{3}p_{3/2,-1/2}+\frac{1}{3}p_{1/2,-1/2}\right)\roa{0}\otimes\eroa{-1/2}\\ +& \left[\frac{\sqrt{2}}{3} \left(p_{3/2,1/2}-p_{1/2,1/2}\right) \left(\cat{1}\bra{0}\otimes\ecat{-1/2}\ebra{1/2} +\cat{0}\bra{1}\otimes\ecat{1/2}\ebra{-1/2}\right)\right. \\ +&\left.\frac{\sqrt{2}}{3} \left(p_{3/2,-1/2}-p_{1/2,-1/2}\right) \left(\cat{-1}\bra{0}\otimes\ecat{1/2}\ebra{-1/2} +\cat{0}\bra{-1}\otimes\ecat{-1/2}\ebra{1/2}\right) \right] \end{array}$$ In square brackets in two last rows terms responsible for entanglement of states are separated. There is possible partial ($p_{3/2,\pm1/2}=p_{1/2,\pm1/2};\ p_{3/2,\mp1/2}\neq p_{1/2,\mp1/2}$) or total ($p_{3/2,1/2}=p_{1/2,1/2};\ p_{3/2,-1/2}= p_{1/2,-1/2}$) disentanglement of states. Among partially degenerate states the ones in which input of two basis states only is left are notable, for instance mix of states $\proa{3/2,3/2}$ and $\proa{3/2,1/2}$ with probabilities $(1\pm d)/2$. $$\begin{array}{r} \hat{\rho}_{p}= +\frac{1}{2}\left(1-d/3)\right)\roa{1}\otimes\eroa{-1/2} +\frac{1}{2}\left(1+d/3)\right)\roa{0}\otimes\eroa{1/2}\\ +\frac{\sqrt{2}}{3}d \Big[ \cat{1}\bra{0}\otimes\ecat{-1/2}\ebra{1/2} +\cat{0}\bra{1}\otimes\ecat{1/2}\ebra{-1/2} \Big] \end{array}$$ ![Dependence of entropy of paraqutrit and its qubit on non-degeneracy of state. []{data-label="fig"}](S3bit){width="3in"} Entropy of such state and its subchannels is $$S_{sys}=\sth{\frac{1+d}{2}},$$ $$S_{A}=S_{B}=\sth{\frac{1+d/3}{2}}.$$ To total degeneration of eigenvalues of density matrix value of non-degeneracy measure $d=0$ corresponds. Graph in figure \[fig\] represents dependence of entropy of paraqutrit and its qubit on measure of non-degeneracy of state. To completely degenerate state same value of entropy of paraqutrit and its qubit corresponds, while arbitrary deflection from degeneration is accompanied with entropy of qubit exceeding entropy of channel. #### Qubit with qunit. For non-degenerate states of channel entropy of composite channel is: $$\label{S_bi} S=-\sum_{m=-l-1/2}^{l+1/2}{p_{l+1/2,m}\log_2p_{l+1/2,m}}-\sum_{m=-l+1/2}^{l-1/2}{p_{l-1/2,m}\log_2p_{l-1/2,m}}.$$ General expression for entropy of the smaller subchannel – qubit – can easily be obtained from the expression : $$S_s=h\left(q\right),$$ similarly the expression for entropy of the larger subchannel – from expression : $$S_s=-\sum_{\mu=-l}^l{p_\mu\log_2p_\mu}$$ Effect of degeneration one can easily analyze in the case of bringing together two sums in : $$\label{S_biu} \begin{array}{l} S=-{p_{l+1/2,l+1/2}\log_2p_{l+1/2,l+1/2}}-{p_{l+1/2,-l-1/2}\log_2p_{l+1/2,-l-1/2}}\\ -\sum_{m=-l+1/2}^{l-1/2}{\left(p_{l+1/2,m}\log_2p_{l+1/2,m}+p_{l-1/2,m}\log_2p_{l-1/2,m}\right)}. \end{array}$$ Degeneration of pair of eigenvalues $p_{l-1/2,m}\mapsto p_{l+1/2,m}$ can take place irrespectively from all the other eigenvalues of density matrix and is accompanied with increase of entropy to conditional maximum. Conclusions =========== Method of ladder operators gives detailed information on properties of composite quantum channels. Measurement of state of paired quantum channels of information transfer requires determination of not only density matrices of each of subchannels but covariance matrix as well. The method of paired quantum tomography proposed makes it possible to determine completely state of paired quantum channel of information transfer with measurement of minimal needed number of incompatible observables. Number $\left(N_A+2\right)\left(N_B+2\right)-1$ of needed incompatible observables is large enough, therefore indications of entanglement of states that would require measurement of substantially smaller number of observables are needed. In practical example of paired channel one of subchannels of which is qubit the following properties of density matrices of subchannels that are indications of entanglement of state exist: - deflection from equilibrium of density matrix of qubit, according to formula , is indication of entanglement, though absence of such deflection is not an evidence of disentanglement of state; - absence of $\frac{N}{2}-1$ pairs of same eigenvalues of density matrix of composite quantum channel of information transfer is indication of entanglement of state; - For each four eigenstates of density matrix of composite quantum channel that make input to some state $\eroa{\mu}$ of the larger subchannel the expression for eigenvalues of composite state and the larger subchannel makes it possible to check absence or presence of entanglement of that very states. [10]{} \#1[ date\#1l@\#1]{} \#1[[\#1]{}]{}\#1[[\#1](#1)]{}\#1\#1[*\#1*]{} Entanglement of formation of an arbitrary state of two qubits // “— 1998. ”— Vol. 80. “— Pp. 2245–2248. ”— bipartite qubit states. Separability of mixed states: necessary and sufficient conditions // . “— 1996. ”— Vol. 223. "— Pp. 1–8. Entanglement quantification through local observable correlations // “— 2007. ”— Vol. 75, no. 1. "— P. 012336. . Production of information and entropy in measurement of entangled states // Proc. of the NATO ARW “Quantum Communication and Security”, 10-13 September 2006,. “— Gdansk, Poland: 2007. ”— Pp. 206–214. Classification of two-particle quantum channels of information transfer: part 1 // . “— 2007. ”— no. 1. "— Pp. 415–425. Classification of two-particle quantum channels of information transfer: part 2 // . “— 2007. ”— no. 2. “— Pp. 358–366. ”— quant-ph/0702076. Detecting entanglement in two mode squeezed states by particle counting. “— 2008. ”— P. 6. . Quantum-process tomography: Resource analysis of different strategies // . “— 2008. ”— Vol. 77. "— Pp. 032322–032337. . Entanglement measures and purification procedures // . “— 1998. ”— Vol. 57. “— Pp. 1619–1633. ”— quant-ph/9707035. Entanglement processing and statistical inference: The jaynes principle can produce fake entanglement // . “— 1999. ”— Vol. 59. “— Pp. 1799 – 1803. ”— quant-ph/9709010\[Issue 3 – March 1999\].

A few days ago, to promote "Israel Apartheid Week," Columbia University's chapter of Students for Justice in Palestine, along with two other like-minded groups, disseminated a flyer around campus showing an Israeli soldier with what appear to be horns on his head. Students Supporting Israel at Columbia put the shameful depiction into context. "This kind of repugnant caricature of Jews is a sore reminder of blatant anti-Semitism from the dark ages of medieval Europe when anti-Semitic propaganda depicted Jews as satanic consorts and an incarnation of absolute evil," the group wrote on Facebook. "Physically, Jews were portrayed as menacing, hirsute, with boils, warts, and other deformities, sometimes with horns, cloven hoofs, and tails. It is extremely painful to see that the same rhetoric is being used on the campus of an Ivy League university in the United States." But do not worry: the horns are on an Israeli, not a Jew, so no anti-Semitism to see here. Last weekend, Hamid Dabashi, a professor of Iranian studies and comparative literature at Columbia, compared Israel to the Islamic State in a Facebook post. "What's the difference between ISIS and ISRAEL? … ISIS murderous thugs conquered parts of Syria and declared a ‘caliphate,' no decent human being on planet earth recognized their armed robbery or their ‘caliphate' – their ISRAELI counterparts meanwhile conquered parts of Syria and declared it part of their Zionist settler colony – no decent human being on planet earth recognizes their armed robbery …" Dabashi wrote in a post he later deleted, before answering his own question. "ISIS does not have a platoon of clean shaven and well coiffured columnists at the New York Times propagating the cause of the terrorist outfit as the Zionists columnists do on a regular basis." Again, do not worry: he is talking about Zionists, not Jews, so no anti-Semitism to see here. A good rule of thumb is that, if you can take a statement and replace the words "Israel," "Israeli," and "Zionist" with "Jew," "Jewish," and "Jewish people," and that statement then sounds like it came straight out of the Dark Ages or Nazi Germany, it is probably anti-Semitic. The same goes for replacing "Zionism" with "Judaism." Look at what happened to Alain Finkielkraut, the French Jewish intellectual, last month in central Paris. Finkielkraut was walking in the street when a group of protesters in the Yellow Vest movement cornered him. "Dirty Zionist, you're going to die!" they yelled at the philosopher, along with "Go back to Tel Aviv!," "Get lost, dirty Zionist shit!," and "France is ours!" Now, it is possible that the protesters just hate and want to expel from France those who believe in Israel's right to exist as a Jewish state, and not Jews themselves. After all, they did call Finkielkraut a Zionist. But, just to entertain me, try applying our rule, and come to your own conclusion. All of the aforementioned incidents are, of course, anti-Semitic. Those who say otherwise have a very dark sense of humor, are hopelessly ignorant, or are probably the ones making such anti-Semitic comments in the first place. And that third group is no longer comprised only of fringe elements on the political left and right—the radical tenured professor and the former KKK leader, both of whom almost always share the same views on the Jewish state and the Jewish people. Just look at Jeremy Corbyn, leader of the United Kingdom's Labour Party, who in 2013 accused British "Zionists" of having two problems. "One is they don't want to study history, and secondly, having lived in this country for a very long time, probably all their lives, they don't understand English irony either," Corbyn said at a conference promoted by Hamas, the Islamist Palestinian terror group. "They needed two lessons, which we could perhaps help them with." And then there is Rep. Ilhan Omar, who in 2012 tweeted, "Israel has hypnotized the world, may Allah awaken the people and help them see the evil doings of Israel." Omar has also accused American politicians of supporting Israel because of the influence of Jewish money, and has insinuated that American Jews are guilty of "allegiance to a foreign country," meaning Israel. Neo-Nazis and white supremacists, such as David Duke, use the words Zionist and Jew interchangeably. So do Omar, Corbyn, the Students for Justice in Palestine, and other like-minded progressives who despise Israel and do not believe in its right to exist as a Jewish state. In each case, one can see the bizarre, illogical obsession with, and the visceral, ingrained hatred of, Israel and Zionism. One can also see the conspiracy theories concerning the Jewish state. Israel secretly controls the media, the banks, and American foreign policy, according to these voices. It is a devilish state, somehow committing genocide against a Palestinian population that has actually grown since Israel's founding. Israel is the Jew among nations, singularly worthy of scorn for its very existence. But, remember, we are supposed to buy that none of this is anti-Semitism, because, supposedly, none of this is about Jews, just Israel and Zionists. Indeed, Western progressives will say their hostility toward Israel is actually about legitimate criticism of the Israeli government, despite all of its overlaps with traditional anti-Semitism. Do they not realize that judging Israel by a standard different from that applied to all other countries and accusing the Jewish state of cosmic evil are the two key features of anti-Semitism, at least now that hatred and persecution of Jews are based primarily on their nation-state, not their race or religion? And do they not realize that supporting efforts that seek Israel's destruction as a Jewish state, like the Boycott, Divestment, and Sanctions movement, is inherently anti-Semitic? Apparently not. The worst part of this thinly disguised anti-Semitism is that Western society has accepted, even normalized, it. One can get tenure at an elite university, or enter Congress or Parliament, or even become a prominent pundit, by using blatantly anti-Semitic language. Just replace Jewish with Zionist and the Jewish people with Israel, and you are probably set. In some circles, you are an intellectual giant, an inspiration. And people wonder why most Jews think Israel is so important.

Q: Why was there no concerted effort to end the Barbary pirate raids until the 1800's? Barbary pirate raids on the Mediterranean coast led to widespread depopulation of the coasts from Venice to Malaga with the obvious exception of the larger cities. The pirate raids also seem to be the most frequent during the 17th-18th centuries, when many European countries were on the rise. France, who reached her apogee in the late 17th century, did almost nothing to safeguard her citizens on the south coast. Britain, instead of using her Naval supremacy to crush the pirates, struck a deal with them whereby no ship under the British flag would be a target in return for a tribute (although this was probably a case of Realpolitik; the British realized that the Barbary pirates did far more damage to their adversaries than to them). So why was there no concerted effort by the Europeans to stamp out the Barbary pirates in the 17th-18th centuries? A: Privateering is a tool of international conflict Read wikipedia; until forbidden by international law, privateering was a tool of international cold war. France encouraged the corsairs against Spain, and later Britain and Holland supported them against France. By the second half of the 17th century the greater European naval powers were able to strike back effectively enough to intimidate the Barbary States into making peace with them. However, those countries' commercial interests then benefited from the impact of continuing attacks on their competitors, and as a result there was little interest in imposing a more general cessation of corsair activity. The snarky answer Because I assumed that the OP had done the basic reasearch, I didn't consult wikipedia until I had to answer @Schwit Janwityanujit's comment. Consequently I drafted this answer, which I'll leave intact. Why should they? The Barbary Pirates were a protection racket; if you paid tribute, you were not attacked. After the United States won its independence in the treaty of 1783, it had to protect its own commerce against dangers such as the Barbary pirates. As early as 1784 Congress followed the tradition of the European shipping powers and appropriated $80,000 as tribute to the Barbary states, directing its ministers in Europe, Thomas Jefferson and John Adams, to begin negotiations with them. Trouble began the next year, in July 1785, when Algerians captured two American ships and the dey of Algiers held their crews of twenty-one people for a ransom of nearly $60,000. Thomas Jefferson Papers Wars cost money. If the fee charged by the Barbary Pirates for their protection racket is less than the cost of the war, and if you're suffering from the Seven Years War (which arguably was the first world war), and seeking to build an empire in the face of active competition, why not pay the price? Tribute is cheaper. Also note that large, powerful nations were immune. The Barbary Pirates were smart enough not to molest British ships, nor those of nations allied with France. The United States however was an ideal target - small, heavily in debt, on the verge of war with Britain and lacking a blue water navy able to project power. Sadly, in this case, the calculations of the Barbary Pirates were flawed. They were the first in a long line of people who made the fatal flaw of underestimating the U.S. Marines. update: I've had to retract an earlier statement I made here; Jefferson supported a stronger navy After all, as Thomas Jefferson had once observed, "a naval force can never endanger our liberties, nor occasion bloodshed; a land force would do both";2 or, as James Madison would argue in favor of ratification of the Constitution, a navy could "never be turned by a perfidious government against our liberties." "The Federalist Number 41," in The Papers of James Madison, edited by William T. Hutchinson et al., 17 vols. to date (Chicago: University of Chicago Press, 1962-), 10: 395. and The pro-navy side was strengthened when the President sent documentation supporting his view that a navy was essential, * history.navy.mil Aside: I believe the situation was more complex than these quotes indicate but Jefferson's ideological committment to utopian Republicanism is outside the scope of this question. England was emphatically not the only power safe from the Barbary Pirates - Portugal's navy suppressed the pirates. In 1793 Portugal, whose navy had been keeping the Algerine corsairs within the confines of the Mediterranean, signed a truce with Algiers. And from wikipedia In addition to seizing ships, they engaged in Razzias, raids on European coastal towns and villages, mainly in Italy, France, Spain, and Portugal, but also in Great Britain and Ireland, the Netherlands and as far away as Iceland. The main purpose of their attacks was to capture Christian slaves for the Ottoman slave trade as well as the general Muslim market in North Africa and the Middle East. *http://www.bbc.co.uk/history/british/empire_seapower/white_slaves_01.shtml#two* A: There were made efforts to end the Barbary pirate raids. The only problem in this picture is that you are seeing England, France, Spain and the Netherlands (my country) as fully developed countries which in that time they were not. Civilians were not important and losses were just part of the risk a sailer had to take. The big sailing companies had no worries about pirates unless they formed a economical threat to their profits. And when that happened believe me they would dealt with the problem. There have been many punitive expeditions (In my country for example a famous admiral "Michiel de Ruyter" had lead many such expeditions). And you should see the Barbary states as one big anarchy of private parties trying to earn with piracy. Something not only they but england, the netherlands, france, spain etc. did. This is a very difficult situation with complex relations between pirates, companies and governments. Why forbid or fight piracy in common when they hunt your competition. First of all there is a difference in private ships and government ships. And the border is often very shady. Who is or was responsible for the security of the trade ships? The government's or the companies. For example in my country the government gave the companies the power and the rights to use military force and maintain their own militias and naval's. They only protected their own interests. In fact it were mostly small sailing companies, fisherman or cost villages which were taken prisoner. Because the big boys had fleets with protection and even the ships that sailed alone had soldiers and cannons (If you were a pirate you would try to take the most easy target). Secondly if you know that there is no good upper layer organization which cares about a small percentage of all its citizens being taken captive it will take a long time considering the speed of communication in that time to change the minds of Kings or other powerful influences to take action. In the end why would you care. Only when there was an economical reason there would be a effort to end or fight the barbary piracy. But what if you do. Than the spanish and french ships would be saved from such terrors as well. Not considering the competition which is sailing under the same flag. To me the only reason to end barbary piracy or even better to conquer their lands and turn them into slaves is because of principle. They were muslims and the europeans were christians. Its like water and fire but you forget that inside christianity there is been a struggle between Protestant and Catholic. Europe was not united and there was no clear common enemy named barbary states. That is the main reason there were no main efforts to end the Barbary pirate raids.

The Local takes new owner Readers, contributors hope alternative paper stays the same Steamboat Springs — Owners and co-publishers Paulie Anderson and Scott Glackman have sold The Local - an alternative Steamboat Springs newspaper that is published every two weeks - to Thomas Reuter Jr. Reuter confirmed the sale Wednesday evening, but Thursday, Reuter, Anderson and Glackman declined any further comment. They said the sale will be announced in the next edition of The Local, which publishes Aug. 28. Scott Ford, The Local's business counselor and longtime columnist, said he has not spoken to Reuter since the purchase. Ford said he was happy for Anderson and Glackman and curious to see what Reuter's new direction will be. "I really enjoyed the opportunity to write for them," Ford said. "The Local, in the capacity it has served, has been a service to the community : I'm always surprised at the breadth of the community that's reading it. I don't know if we're all kind of latently hippies or what." Ford first became involved with The Local as a counselor at Colorado Mountain College's Small Business Resource Center. "They came into the business incubator when they were still printing their paper via photocopier," Ford recalled. Ford said he first started writing for The Local as a favor because it suffered from a lack of editorial content. It since has evolved into a labor of love. He's not alone. Whether they are contributors or readers, people interviewed in Steamboat Springs on Thursday expressed hope that The Local will change little under new ownership. Erica Thorng, who works at Azteca Taqueria, said her favorite parts of the newspaper are its regular "Props, Gripes and Smidgens" feature and two-page color photo spread of locals. "I think it's pretty good the way it is," Thorng said. Tom Shedrick, who reads and also has written for The Local, agrees. "I like them because they're a little outside the box," Shedrick said. "I'm a little outside the box." Dave Caddell, who has written music reviews for The Local for four years, said it is a testament to the publication - as well as to Anderson and Glackman - that all of its content comes from volunteer writers whose only compensation is a forum for free, uncensored expression. "There's a spirit to The Local, and it comes from the writers," Caddell said. "As long as the new publishers realize that's the real value of (The Local), that's not going to change." Like Ford, Caddell had nothing but praise for Anderson and Glackman and congratulated them on the sale. "Those guys are rock stars, in my opinion," Caddell said. "I'm so proud to have been involved with these guys. The next thing they move on to is going to be great." Reuter is a Steamboat Springs High School graduate and the son of Tom Reuter Cars owner Tom Reuter. In 2007, he began circulating a recall petition against 14th Judicial District Attorney Bonnie Roesink, citing systemic errors, bad judgment, poor management and inconsistent prosecution. It was the second recall attempt made against Roesink that year. Both efforts failed. Ford used to provide career courses and counseling at Steamboat Springs High School when Reuter was a student there, and he remembers Reuter having entrepreneurial talents even then. "You're always born with the entrepreneurial bent," Ford said. "You just have to find an outlet for it."

Q: How much protection do the various shields give With the new levels of shields available as of 3 June 2013, is there an indication of how much protection each shield will give a portal? Similarly, do they contribute to the XM drain on the attacker in any way? For info on the new buffed shields, check out decodeingress: Brandon Badger published on 31st of May that Portal Shields feel stronger now. But there is a catch, only new obtained portal shields are stronger. If you farmed those shields in last few months they have same stats as old shields. Only new farmed shields have new stats: Old shields: Common +6 Rare +8 Very Rare +10 New shields: Common +10 Rare +20 Very Rare +30 A: As you assumed, new shields mitigations are : common shield : 30 rare shield : 40 very rare shield : 60 AXA shield : 70 You can see those values in the app when upgrading shields. Note that those values are for newly obtained shields, old one will still have old mitigation's values. The mitigation of the shields is a percentage of absorption of damages. A (common) shield with a mitigation of 10 will absorb 10% of the damages made by the buster. A second (common) shield with mitigation 10 will catch 10% of the remaining damages. For example, let's imagine a burster making 100 of damages on a resonator. First common shield will absorb 10% so damages will be reduced to 90. A second common shield will absorb 10% of the 90 damages and will reduce damages to 81... In the worst/better case with 4 very rare shields mitigation 30, a burster making 100 damages will be reduced to 24. To compute the total mitigation of shields on a portal you have to just multiply the percentages. A very rare shield will eat 30%, to compute the effects you'll have to do X - (X * 30 / 100) that will reduce to X * 0.7. So a very rare shield is equal to a 0.7 factor applied on the burster's damage, a rare shield is equal to 0.8 and a common to 0.9. So the way of computing damages is : RESULTING_DAMAGES = BURSTER_DAMAGES * SHIELD_1_FACTOR * SHIELD_2_FACTOR * SHIELD_3_FACTOR * SHIELD_4_FACTOR And no matter the order of the shields, the result of a * is always the same :)

--- abstract: 'Lipari and Stanev developed a method for range fluctuation of high energy muons, stressing the importance of accounting for the fluctuations of the energy loss in radiative processes in 1991 and, now, their method has become the basement for the energy determination of high energy muons through the measurement of the Cherenkov light yields due to those muons in KM3 physics. Once, Takahashi et al. developed a method for the investigation on the depth intensity relation of high energy muons in which all the stochastic processes concerned are taken into account exactly (1983). Now, we make the method by Takahashi et al. revival for the same purpose of the application to the analysis of future KM3 physics. In the present paper, our concern is restricted to the introduction to the fundamental of our method and some subsequent results thereby in which the real simulated behaviors of high energy muons from $10^{12}$eV to $10^{18}$eV, the survival probabilities of high energy and so on are included. The discussion around the practical application of our method to the KM3 physics is entrusted in the subsequent papers. As far as the survival probability of high energy muons is concerned, our method gives nearly the same results to Lipari and Stanev’s in some regions and gives the deviated results from theirs in another ones. Thus, we examine the application limit of their method and clarify the reason why, comparing with our method. The most distinct difference in the both methods may become apparent in the treatment on the Cherenkov light yields spectrum by which one may estimate the energies of the muons concerned. We will mention to them in subsequent papers.' address: - 'Graduate School of Science and Technology Hirosaki University, Hirosaki, 036-8561, Japan' - 'Innovative Research Organization, Saitama University, Saitama, 338-8570, Japan' - 'The Institute for China-Japan Culture Study, Mitaka, Tokyo, 113-0004, Japan' author: - 'Y.Okumura' - 'N.Takahashi' - 'A.Misaki' bibliography: - '&lt;your-bib-database&gt;.bib' title: 'A fundamental theory based on the Monte Carlo *Time Sequential Procedure* for the range fluctuations of high energy muons' --- High energy muon , Muon range fluctuation , Muon energy loss ,Muon propagation simulation Introduction {#intro} ============ The studies on depth intensity problem of high energy muons have been one of the most important subjects in traditional cosmic ray physics, relating to elucidation on unknown character of high energy cosmic ray muons, and still have never been lost its importance. Menon and Ramana Murthy [@Menon] wrote an excellent review on this subject at greater depths which describes from the first experiment carried out Simizu tunnel in Japan (1940-1945) [@Miyaz] to the last experiment related to the neutrino carried out in Kolar Gold Mine, India (Up to 1964) [@Miyake1]. Bugaev et al. [@Buga] have discussed this problem related to the charm production mechanism, adding new data, from, such as, DUMAND, Baikal, MACRO, LVD, NESTOR and others up to 1977. Now, the gigantic projects for neutrino astrophysics called as KM3 detectors are now being developed in the lake, Antarctic and Ocean. In the analysis of these KM3 detectors, the depth intensity relation for high energy muon is utilized for the confirmation of their experimental reliabilities related to other experiments different depths [^1]. The theories of range fluctuation of high energy muons are indispensable means in the analysis of the depth intensity relation of high energy muons at certain depths. The theories of range fluctuation are studied in three different manners. The first one is analytical manner [@Mand1]- [@Naumov], the second one is numerical one [@Oda] and the third one is the Monte Carlo manner [@Bolin]- [@Chirkin]. At the same time, the theories of range fluctuation of high energy muons offer essential tools for energy determination of high energy muon events from neutrino interactions in KM3 detectors. Their energies, in particular higher energies, are estimated from Cherenkov light signals from muon induced electromagnetic cascade showers, not rather than from muons themselves, but, in spite of this situation, examination of behaviors of muons themselves are essentially important, because they are origins of electromagnetic cascade showers from different modes of interactions due to muons. At present time, studies on the fluctuation of high energy muons have been made by the Monte Carlo method, using electronic computers with great performance, because only this method can clarify fluctuation characters of muons correctly, while the analytical method and numerical one provide essentially their average behavior. The detailed studies around fluctuation of high energy muon events are inevitable, owing to small number of physical events concerned in addition to sharp steepness of the parent neutrino energy spectrum which are the origin of fluctuation. The studies on the range fluctuation of high energy muons by Monte Carlo method had been made even before appearance of electronic computer with great performance [@Bolin]- [@Miyake2]. However, then, they were forced to put more simplified, even more artificially assumptions on their stochastic processes concerned for saving both man powers and computer ones at the period for computation. In 1983 to 84, Takahashi et al. [@Taka1; @Taka2] had developed a new Monte Carlo technique where every stochastic process for high energy muon concerned is treated exactly from the stochastic point of view. Namely, the interaction points and the energy division due to interactions concerned (bremsstrahlung, direct electron-positron pair production and photonuclear interaction) are exactly treated in stochastic manner. In the present paper, we call it tentatively *the Time Sequential Procedure*. In 1991, Lipari and Stanev [@Lipari] developed another technique, from a point of the philosophy of Monte Carlo method. They put the diffusion equation on the fluctuation in the form of differential-integral equation and treat it by Monte Carlo technique. They divided the part which is the origin of fluctuation into two parts, namely, the “hard” part (radiation loss part) and the “soft” part (“continuous” energy loss part). In radiation loss part only, they treat fluctuation in Monte Carlo way, but in the “soft” part they deal with the part as “continuous” energy loss. This technique has been adopted by subsequent authors [@Antoni]- [@Chirkin]. In the present paper, we call it tentatively *the* $V_{cut}$ *Procedure*. Now, *the* $V_{cut}$ *Procedure* [@Lipari]- [@Chirkin] has been extensively utilized in the analysis of muon neutrino events in KM3 detectors \[for example, footnote 1\]. However, in our opinion, taking into account of the fact that Cherenkov light signals due to high energy muons mostly come from the muon induced electromagnetic cascade showers whose origin is either bremsstrahlung or direct electron-positron pair production or photonuclear interaction than from muons themselves in KM3 detector, the energy determinations of high energy muon events inevitably include more ambiguity in the case of *the* $V_{cut}$ *Procedure*, compared with the case of *the Time Sequential Procedure* (see, the section 3 and 4 Conclusion and Outlook ). In the present paper, we try to revitalize *the Time Sequential Procedure* in 1983 for the more accurate analysis of high energy muon events in KM3 detector, comparing to the results obtained by *the* $V_{cut}$ *Procedure* which has been well distributed. Here, we restrict our concern to the fundamental and its application will be reported in subsequent papers. In the present paper, we propose a new method for more accurate calculation on the range fluctuation of high energy muons and conjecture the possible application of this method to the measurements on Cherenkov light in KM3 physics, but we never propose any kind of the code for the practical applications, which is out of the scope of the present paper and it will be discussed in subsequent papers, if necessary. Fundamental Structure of *the Time Sequential Procedure* and its Validity {#sec:2} ========================================================================= Here, in order to clarify characteristics of *the Time Sequential Procedure* in contrast to *the* $V_{cut}$ *Procedure*, we reproduce our procedure which had already been published in 1984 (in Japanese) [@Taka2]. The mean free paths for stochastic processes and their resultant mean free path {#sec:2.1} ------------------------------------------------------------------------------- Behaviors of high energy muons are stochastically determined from the elementary processes of bremsstrahlung [@Kelner], direct electron-positron pair production [@Kokoulin] and photonuclear interaction processes [@Borg]. Further information on the cross sections concerned is found in [@Groom]. We treat these processes as stochastic ones as exactly as possible, without introducing any approximation in the energy region in which we are interested [^2]. In our procedure, these stochastic processes are prepared as independent ones and, therefore, they are easily replaced by the most advanced ones, if necessary, keeping exactness of our logical structure. Let us denote, differential cross sections for bremsstrahlung, direct electron-positron pair production, and photonuclear interaction, $\sigma_{b}\left(E,E_{b}\right)dE_{b}$, $\sigma_{d}\left(E,E_{d}\right)dE_{d}$ and $\sigma_{n}\left(E,E_{n}\right)dE_{n}$, respectively. Here, $E$ denotes the energy of muon concerned, $E_{b}$, the energy of photon due to bremsstrahlung, $E_{d}$, the energy of electron pair due to direct electron-positron pair production, $E_{n}$, the energy of the hadronic part due to photonuclear interaction, respectively. Then, the mean free paths for different stochastic processes are energy dependent of the muon concerned and they are given as follows:\ For bremsstrahlung processes, $$% Eq.01 \lambda_{b}\left(E\right)= \frac{1}{\frac{N}{A}\int_{E_{b,min}}^{E_{b,max}} \sigma_{b}\left(E,E_{b}\right)dE_{b}}\\$$ Here, $E_{b,min}$, the lower limit of the integral of Eq.(1), the minimum energy for the emitted photons, is taken $1.02$ MeV which denotes the minimum energy for electron pair production by photon. The integrations for direct electron-positron pair production and photonuclear interaction are performed over kinematically allowable ranges.\ For direct electron-positron pair production processes, $$% Eq.02 \lambda_{d}\left(E\right)= \frac{1}{\frac{N}{A}\int_{E_{d,min}}^{E_{d,max}} \sigma_{d}\left(E,E_{d}\right)dE_{d}}\\$$ For photonuclear interaction processes, $$% Eq.03 \lambda_{n}\left(E\right)= \frac{1}{\frac{N}{A}\int_{E_{n,min}}^{E_{n,max}} \sigma_{n}\left(E,E_{n}\right)dE_{n}}\\$$ , where $N$ and $A$ denote Avogadro number and atomic mass number, respectively. Similarly, $E_{d,min}/E$ and $E_{n,min}/E$ are always chosen in such a way that the differential cross sections concerned are expressed exactly above $E_{min}$. Also, $\lambda_{total}\left(E\right)$, the resultant mean free path for these stochastic processes are given as, $$% Eq.04 \frac{1}{\lambda_{total}\left(E\right)}= \frac{1}{\lambda_{b}\left(E\right)}+\frac{1}{\lambda_{d}\left(E\right)}+\frac{1}{\lambda_{n}\left(E\right)}$$ Determination of the kind of the stochastic process and the real free path for the stochastic process concerned {#sec:2.2} --------------------------------------------------------------------------------------------------------------- By using Eq.(1) to (4), we can determine the interaction points of muons for different stochastic processes in the following. The first, for the purpose, lets us define $\xi_{b}\left(E\right)$ and $\xi_{d}\left(E\right)$ as follows; $$% Eq.05 \xi_{b}\left(E\right)=\frac{1/\lambda_{b}\left(E\right)}{1/\lambda_{total}\left(E\right)}$$ $$% Eq.06 \xi_{d}\left(E\right)=\frac{1/\lambda_{b}\left(E\right)+1/\lambda_{d}\left(E\right)}{1/\lambda_{total}\left(E\right)}$$ The second, we sample randomly $\xi_{1}$, a uniform random number between (0,1). If $\xi_{1} \le \xi_{b}\left(E\right)$, then we recognize the interaction occurs due to bremsstrahlung. If $\xi_{b}\left(E\right) < \xi_{1} \le \xi_{d}\left(E\right)$, then, we understand the direct electron-positron pair production occurs. If $\xi_{1} > \xi_{d}\left(E\right)$, then, we understand that photonuclear interaction occurs. Again, we sample a new $\xi_{2}$, randomly from uniform random number between (0,1). Then, we can determine the interaction points $\Delta t\left(E\right)$ for the specified stochastic processes according the following criterion. In the case of the occurrence of bremsstrahlung processes ( for $\xi_{1} \le \xi_{b}\left(E\right)$ ), $$% Eq.07 \Delta t_{b}\left(E\right) = -\lambda_{total}\left(E\right)log\xi_{2}$$ In the case of the occurrence of direct electron-positron pair production processes (for $\xi_{b}\left(E\right) < \xi_{1} \le \xi_{d}\left(E\right)$ ), $$% Eq.08 \Delta t_{d}\left(E\right) = -\lambda_{total}\left(E\right)log\xi_{2}$$ In the case of the occurrence of photonuclear interaction processes ( for $\xi_{1} > \xi_{d}\left(E\right)$ ) $$% Eq.09 \Delta t_{n}\left(E\right) = -\lambda_{total}\left(E\right)log\xi_{2}$$ The effect of both the “continuous” energy losses and the usual ionization loss over the muon propagation in the Time Sequential Procedure. ------------------------------------------------------------------------------------------------------------------------------------------- We are taken into account of the “continuous” energy loss (the first term (the “soft” part) of Eq.(14)) in addition to the usual ionization loss. The effect of the “continuous” energy loss may be evaluated in two ways. One is Tamura’s method [@Tamura] in which “continuous” energy loss is treated together with the usual ionization loss. The other is Adachi’s method [@Adachi] in which bremsstrahlung cross section is deformed so as to neglect the “continuous” energy loss [@Adachi]. Then, the effect due to the “soft” part the first term of Eq.(14) is compensated by the increase of the “hard” part due to bremsstrahlung. Then, we adopt the Tamura’s method which is essentially the same as Lipari and Stanev [@Lipari]. In $the Time Sequential Procedure$, $v_{cut}$ is defined in the same way as *the* $V_{cut}$ *Procedure* and $ v_{cut} = E_{b,min}/E$, where $E$ and $E_{b,min}$, denote the energy of the muon concerned and the minimum energy of the emitted photons due to bremsstrahlung, respectively. Due to the adoption of $1.02$ MeV ($\sim 10^{6}$ eV) as the lower limit of the integrals of Eqs.(1) and (10), the “continuous” energy loss per muon radiation length($\sim 1500$ meter in water) is $1.02$ MeV ($\sim 10^{6}$ eV) by the definition, irrespective of the energies of the muons concerned, which is far smaller compared with the usual ionization loss, $\sim 3\times 10^{11}$ eV per muon radiation length ($\sim 2$ MeV/(g/cm$^{2}$)) by the five order of the magnitude. Consequently, we can completely neglect the “continuous” energy loss due to bremsstrahlung even compared with the usual ionization loss, irrespective of the energies of the muons concerned. Furthermore, it should be noticed that we have concern in the behaviors of the muons whose primary energies extend from $10^{9}$ eV ($1$ GeV) to $10^{18}$ eV for KM3 physics. Considering the dimension of the KM3 detector is of one kilometer, we can neglect the usual ionization for the muons above $10^{13}$ eV. However, we consider the usual ionization loss as well as the “continuous” energy loss in our procedure. Thus, we can state that the energy losses due to muons come essentially from the “radiative” processes (bremsstrahlung, direct electron-positron pair production and photo nuclear interaction) in our procedure. Namely, we can simulate exactly the energies of the emitted photons down to $1$ MeV (due to bremsstrahlung and photo nuclear interaction) as well as the electrons (positrons) (due to direct electron-positron pair production). Thus, these emitted energies of the particles (electrons and photons) induce the photon initiated electromagnetic cascade showers and the electron(positron) initiated electromagnetic cascade showers which are the sources of the Cherenkov light yields. The capability of the complete neglect of the “continuous” energy loss is the characteristics of our *Time Sequential Procedure* by which our algorithm makes it possible to be constructed in consistent manner. The main subject of the present paper is to discuss the behavior of the muon and, therefore, the behaviors of the electromagnetic showers as well as those of the subsequent Cherenkov light yields will be examined in the subsequent papers. Determination of the emitted energy loss ($E_{b}$ or $E_{d}$ or $E_{n}$) from the specified stochastic processes {#sec:2.3} ---------------------------------------------------------------------------------------------------------------- Under the determination of the interaction points due to the specified stochastic processes, by using $\xi_{1}$ and $\xi_{2}$, in the previous subsection, here, the energy losses $E_{b}$ , $E_{d}$ and $E_{n}$ from the specified stochastic processes are given as follows. For sampled $\xi_{3}$ which is obtained randomly from the uniform random number between (0,1), we solve the following equations for respective interactions in order to obtain $E_{b}$ or $E_{d}$ or $E_{n}$. For bremsstrahlung process, $$% Eq.10 \label{xi_b} \xi_{3} = \frac{\int_{E_{b,min}}^{E_{b}} \sigma_{b}\left(E,E_{b}\right)dE_{b}}{\int_{E_{b,min}}^{E_{b,max}} \sigma_{b}\left(E,E_{b}\right)dE_{b}}$$ $E_{b}$, the emitted photon stochastically sampled from Eq.(10), is expected to generate the electromagnetic cascade shower. The reason why the minimum energy is taken $1.02$ MeV is that the minimum of the electromagnetic cascade shower initiated photons is of two electrons from the electron pair production by photons. The energy dissipation below $E_{b,min}$, $1.02$ MeV, is treated in the same way like the soft term (the “continuous” energy loss) in the \[$dE/dx$\] method (see, the soft term of Eq.(14) in the present paper) For direct electron-positron pair production, $$% Eq.11 \label{xi_d} \xi_{3} = \frac{\int_{E_{d,min}}^{E_{d}} \sigma_{d}\left(E,E_{d}\right)dE_{d}}{\int_{E_{d,min}}^{E_{d,max}} \sigma_{d}\left(E,E_{d}\right)dE_{d}}$$ For photonuclear interaction, $$% Eq.12 \label{xi_n} \xi_{3} = \frac{\int_{E_{n,min}}^{E_{n}} \sigma_{n}\left(E,E_{n}\right)dE_{n}}{\int_{E_{n,min}}^{E_{n,max}} \sigma_{n}\left(E,E_{n}\right)dE_{n}}$$ In Eq.(10) to (12) for respective interaction, the quantities to be obtained are $E_{b,d,n}$, emitted energy losses for given $E$, energy of the muon concerned. The quantities of $E_{b,d,n}$ are extended to $E_{b,d,n,min}$ to $E_{b.d,n,max}$. For sampled $\xi_{3}$, we can solve these equation numerically and obtain $E_{b,d,n}$ finally. Thus, we can determine $E_{b,d,n}$, the energy losses for the specified stochastic process at determined interaction point. A flow chart for the fundamental structure of *the Time Sequential Procedure* is given Fig.1. On the validity of *the Time Sequential Procedure* {#sec:2.4} -------------------------------------------------- Generally speaking, the verification of the validity of the Monte Carlo method concerned is pretty difficult. For the verification of our procedure, it is desirable to compare the physical results obtained by *the Time Sequential Procedure* with the corresponding results obtained by the analytical method which is methodologically independent of the Monte Carlo method concerned. Once, Misaki and Nishimura [@Misaki1] had developed an analytical theory for range fluctuation of high energy cosmic ray muons based on the Nishimura-Kamata formalism on electron shower theory to apply to study depth intensity relation muon underground. The analytical theory could be solved rigorously only under the incident muon energy spectrum whose indices (in integral) $\gamma $= 2, 3, 4, , , . For the comparison of the results obtained by *the Time Sequential Procedure* with those obtained by the analytical theory, Takahashi et al. [@Taka1; @Taka2] had calculated the depth dependence of the average energies of muons at various depths under the same incident muon energy spectrum which the analytical theory utilized and compared their results with corresponding ones obtained by the analytical theory. We reproduce them in Fig.2 from the previous work [@Taka2]. The agreement between them is quite well, taking into account of the difference in both the cross sections concerned and their numerical evaluation method. Namely, we can say the logical structure of *the Time Sequential Procedure* is well established from the point of the validity of Monte Carlo method concerned. It is needless to say that *the Time Sequential Procedure* can be applicable to any incident muon energy spectrum. Results directly derived by *the Time Sequential Procedure* ----------------------------------------------------------- ### The diversity of individual muon behavior ’Needle’ structure of the energy losses from high energy muons {#sec:2.4.1} In subsections *2.2* and *2.3*, by random sampling procedure, we show how to determine both interaction points for the specified stochastic processes and subsequent their energy losses for the interactions concerned. In the present subsections, we show some examples of the energy losses along the passage of the high energy muons. In Fig.3 to Fig.13, we show three different categories of the ’Needle’ structure of the energy losses for the same primary energies. ’Needles’ denote fractional energy losses due to a specified stochastic processed such as, bremsstrahlung, direct electron-positron pair production or photonuclear interaction at respective interaction points. We illustrate several typical structures of the energy loss of muons which start, having primary energy $E_{0}$ and reaching $E_{min}$, namely the behaviors of the muons with *the shortest range*, with *the longest range* and with *the average-like range* for the same primary energy and the same starting point. *The shortest range* denotes the muon with the shortest range among all sampled muons, while *the longest range* does the muon with the longest range among all sampled muons, and *the average-like range* does the muon with the range whose is the nearest to the averaged range among all sampled muons. Total sampling numbers per respective primary energy are 100,000. In these figures, we can recognize the diversities of muon behaviors for the same primary muon energies with regard to their ranges (or their energy losses). All interaction points due to the processes of bremsstrahlung, direct electron-positron pair production and photonuclear interaction and all energy losses due to these elementary processes at respective points due to these processes are recorded. In order to clarify the diversities among the real range distributions (or real energy loss distributions), we examine the muons with *the shortest range*, the muons with *the longest range* and the muons with *the average-like range* in more detail. \[0.85\] [c|c|c|c|c|c|c|c]{} & Range & Energy loss & Number of & Energy loss by & Number of & Energy loss & Number of\ $E_{0}=10^{12}eV$ & \[km\] & by brems\[eV\] & interaction & direct pair\[eV\] & interaction & by nuclear\[eV\] & interaction\ $<$Average$>$ & 2.43 & 1.10$\times 10^{11}$ & 4.74 & 1.57$\times 10^{11}$ & 243 & 4.54$\times 10^{10}$ & 3.44\ Average-like & 2.43 & 8.97$\times 10^{10}$ & 4 & 1.34$\times 10^{11}$ & 221 & 8.86$\times 10^{10}$ & 3\ Shortest & 2.09 & 2.15$\times 10^{11}$ & 6 & 1.52$\times 10^{11}$ & 208 & 3.72$\times 10^{10}$ & 3\ Longest & 3.14 & 3.80$\times 10^{9}$ & 5 & 1.04$\times 10^{11}$ & 299 & 1.19$\times 10^{9}$ & 3\ $E_{0}=10^{15}eV$\ $<$Average$>$ & 1.78$\times 10^{1}$ & 3.53$\times 10^{14}$ & 48.1 & 4.74$\times 10^{14}$ & 6.80$\times 10^{3}$ & 1.67$\times 10^{14}$ & 5.50$\times 10^{1}$\ Average-like & 1.78$\times 10^{1}$ & 7.50$\times 10^{14}$ & 49 & 2.35$\times 10^{14}$ & 5489 & 9.31$\times 10^{12}$ & 37\ Shortest & 9.44$\times 10^{-1}$ & 8.66$\times 10^{14}$ & 2 & 1.34$\times 10^{14}$ & 367 & 5.90$\times 10^{10}$ & 1\ Longest & 3.50$\times 10^{1}$ & 7.53$\times 10^{13}$ & 71 & 8.02$\times 10^{14}$ & 13722 & 1.11$\times 10^{14}$ & 105\ $E_{0}=10^{18}eV$\ $<$Average$>$ & 3.28$\times 10^{1}$ & 3.37$\times 10^{17}$ & 1.08$\times 10^{2}$ & 4.39$\times 10^{17}$ & 2.57$\times 10^{4}$ & 2.25$\times 10^{17}$ & 1.72$\times 10^{2}$\ Average-like & 3.28$\times 10^{1}$ & 1.68$\times 10^{17}$ & 118 & 5.58$\times 10^{17}$ & 29321 & 2.74$\times 10^{17}$ & 196\ Shortest & 7.72$\times 10^{0}$ & 8.75$\times 10^{17}$ & 28 & 1.19$\times 10^{17}$ & 5760 & 6.23$\times 10^{15}$ & 40\ Longest & 5.78$\times 10^{1}$ & 5.71$\times 10^{16}$ & 162 & 5.77$\times 10^{17}$ & 46542 & 3.66$\times 10^{17}$ & 277\ In Table 1, we show numerically the characteristics of an individual muon with *the shortest range*, *the average-like range*, *the longest range*, in addition to their average range for $10^{12}$eV, $10^{15}$eV and $10^{18}$eV. In Fig.3 to Fig.5, we give the characteristic behaviors with *the shortest range*, *the average-like range* and *the longest range*, that is, their energy loss for the specified interaction as the function of the depth traversed for the primary energy of $10^{12}$eV in water [^3] . In these figures, we utilize the same scale in depth to clarify the diverse behaviors by the same incident energies, namely, those with *the shortest range*, with *the average-like range* and with *the longest range*, respectively. In figures, the abscissa denotes the depths where the specified interactions occur. The ’needles’ (expressed in ordinate) with different colors at different depths denote ratios of the energy losses due to direct electron-positron pair production (green, **d**), bremsstrahlung (red, **b**) and photonuclear interaction (blue, **n**) to their primary energy, respectively. The abrupt changes in them are due to the catastrophic energy losses for muons (see, footnote 3). It is easily understood that one sees the fluctuation effect rather weak in the energy of $10^{12}$eV. It is seen from figures and Table 1 that there is not so big difference between the case with *the shortest range* and one with *the longest range* for $10^{12}$eV. In the case with *the shortest range* (Fig.3), we find two catastrophic energy losses (at $\sim 910$ meters and $\sim 1870$ meters) due to two bremsstrahlungs play the important role in the range. In the case with *the average-like range* (Fig.4), we can find one catastrophic energy loss due to bremsstrahlung at $\sim 1.48$ kilometer. However, in the case of *the longest range* (Fig.5), we cannot find the catastrophic energy losses due to bremsstrahlung and, instead, we can find that almost energy losses are due to many number($\sim 300$) of direct electron-positron pair production events. In Fig.7 to Fig.9, we give the typical diversities for primary energy of $10^{15}$eV similarly for primary energy of $10^{12}$eV. In these figures, the diversities for *the shortest range*, *the average-like range* and *the longest range* are compared explicitly expressed in the same scale. Fig.6 shows the same in Fig.7 in extended scale. Combined with Table 1, *the shortest range*, $\sim 940$ meter (Fig.6), is far shorter compared with *the longest range*, $\sim 35.0$ kilometers (Fig.9). It is seen from Fig.6 and the Table 1 that bremsstrahlung plays a decisive role as the cause of catastrophic energy loss in the case of *the shortest range*, ( $\sim 96.5$% of total energy up to$ \sim 450$ meters). $86.6$% of the total energy is lost by $2$ bremsstrahlungs, $13.4$% by $367$ direct electron-positron pair productions and $5.9 \times10^{-3}$% by $1$ photonuclear interaction. In Fig.9, we give the case for *the longest range*. Here, large numbers of direct electron-positron pair production with rather small energy loss play an important role, as shown similarly in Fig.5. Here, $80.2$% of the total energy is lost by $13722$ direct electron-positron pair productions, $7.53$% by $71$ bremsstrahlungs and $11.1$% by $105$ photonuclear interactions. In Fig.8, combined with Table 1, we give the case with *the average-like range*. Here, $23.5$% of the total energy is lost by $5489$ direct electron-positron pair productions, $75.0$% by $49$ bremsstrahlungs and $0.93$% by $37$ photonuclear interactions, while in the real averages ($100,000$ samples), $47.4$% of the total energy is lost by $6800$ direct electron-positron pair productions, $35.3$% by $48.1$ bremsstrahlungs and $16.7$% by $55.0$ photonuclear interactions. In Fig.10 to Fig.13, combined with Table 1, we show the similar relations for $10^{18}$eV muons as shown in $10^{15}$eV. We can say the case with *the shortest range* in Fig.10 (or Fig.11) has a strong contrast to that with *the longest range*. The manner of the energy loss in Fig.10 is drastic with two big catastrophic energy losses due to bremsstrahlungs ($\sim 0.8$km and $4.74$km), while that in Fig.13 is very moderate with no catastrophic energy loss. *The shortest range*, $\sim 7.7$ kilometers (Fig.11), is far shorter compared with *the longest range*, $\sim 57.8$ kilometers (Fig.13). It is seen from Fig.10 and Table 1 in the case of *the shortest range* that bremsstrahlung plays a decisive role as the cause of catastrophic energy loss. $87.5$% of the total energy is lost by $28$ bremsstrahlungs, $11.9$% by $5760$ direct electron-positron pair productions and $0.623$% by $40$ photonuclear interactions. In Fig.13, we give the case with *the longest range*. Here, $57.7$% of the total energy is lost by $46542$ direct electron-positron pair productions, $36.6$% by $277$ photonuclear interactions and only $5.71$% by $162$ bremsstrahlungs in the complete absence of catastrophic energy losses. In Fig.12, we give the case with *the average-like range*. Here, $55.8$% of the total energy is lost by $29321$ direct electron-positron pair productions, $16.8$% by $118$ bremsstrahlungs and $27.4$% by $196$ photonuclear interactions, while, in the real averages ($100,000$ samples), $43.9$% of the total energy is lost by $2.57 \times 10^{4}$ direct electron-positron pair productions, $33.7$% by $108$ bremsstrahlungs and $22.5$% by $172$ photonuclear interactions. Thus, it can be concluded that the diversity among muon propagation with the same primary energy should be noticed. ### Average characteristics of high energy muons with the shortest range, the average-like range, the longest range around the average range {#sec:2.4.2} In Table 2 (a), we give the ratios of energy losses due to respective stochastic processes to total energy loss in the typical ranges (*the average*, *the average-like*, *the shortest* and *the longest*) for $10^{12}$eV, $10^{15}$eV and $10^{18}$eV. It is clear from the Table that, averagely speaking, high energy muons are lost $\sim 50$% in the direct electron-positron pair production, $\sim 30$% in bremsstrahlung and $\sim 20$% in photonuclear interaction. It is clear from Table 2(a) that the muon with *the longest range* loses $\sim 70$ % in direct electron-positron pair productions, in long chain of electron pairs induced electromagnetic cascade showers with rather smaller energies, while the muon with *the shortest range* loses $\sim 70$% to $100$% of their energy in a few number of bremsstrahlungs (catastrophic energy loss). \[0.9\] ------------------- ---------------------- --------- ---------------------- ------------------------ ---------------------- ------------------------- $E_{0}=10^{12}eV$ (a) (b) (a) (b) (a) (b) $<$Average$>$ 3.37$\times 10^{-1}$ $1.00 $ 5.26$\times 10^{-1}$ $1.00 $ 1.37$\times 10^{-1}$ $1.00 $ Average-like 2.87$\times 10^{-1}$ $0.872$ 4.30$\times 10^{-1}$ $0.688 $ 2.83$\times 10^{-1}$ $2.51 $ Shortest 5.32$\times 10^{-1}$ $2.96 $ 3.76$\times 10^{-1}$ $9.14 \times 10^{-4} $ 9.20$\times 10^{-2}$ $2.96 \times 10^{-3} $ Longest 3.50$\times 10^{-2}$ $0.875$ 9.54$\times 10^{-1}$ $1.33 $ 1.10$\times 10^{-2}$ $5.87 \times 10^{-2} $ $E_{0}=10^{15}eV$ $<$Average$>$ 3.40$\times 10^{-1}$ $1.00 $ 4.98$\times 10^{-1}$ $1.00 $ 1.62$\times 10^{-1}$ $1.00 $ Average-like 7.54$\times 10^{-1}$ $1.25 $ 2.37$\times 10^{-1}$ $0.960$ 9.36$\times 10^{-3}$ $0.600 $ Shortest 8.66$\times 10^{-1}$ $2.53 $ 1.34$\times 10^{-1}$ $0.178$ 5.90$\times 10^{-5}$ $0.321$ Longest 7.62$\times 10^{-2}$ $0.541$ 8.11$\times 10^{-1}$ $1.52 $ 1.12$\times 10^{-1}$ $0.364$ $E_{0}=10^{18}eV$ $<$Average$>$ 3.24$\times 10^{-1}$ $1.00 $ 4.59$\times 10^{-1}$ $1.00 $ 2.17$\times 10^{-1}$ $1.00 $ Average-like 1.68$\times 10^{-1}$ $1.30 $ 5.58$\times 10^{-1}$ $0.858$ 2.74$\times 10^{-1}$ $0.848$ Shortest 8.75$\times 10^{-1}$ $2.17 $ 1.19$\times 10^{-1}$ $0.634$ 6.23$\times 10^{-3}$ $2.20 \times 10^{-2} $ Longest 5.71$\times 10^{-2}$ $0.209$ 5.77$\times 10^{-1}$ $1.49 $ 3.66$\times 10^{-1}$ $1.13 $ ------------------- ---------------------- --------- ---------------------- ------------------------ ---------------------- ------------------------- In Table 2(b), the ratios of fractional energy lose for specified stochastic processes are divided by the corresponding averaged ones. It is clear from the Table 2(b) that the divisions of energy loss to the specified processes in *the average-like range* are clearly different from that of the real averaged. It shows that the energy divisions for different processes are different, even if the ranges are same. This fact makes the ejection of the Cherenkov light influence, even if the paths of the high energy muons are same. In Table 2(b), it is also clear from the characteristics of the typical showers from the point of energy dissipation that energy losses ratios of showers concerned to their averages due to bremsstrahlung in *the shortest ranges* lose their energies are $2.96$, $2.53$, $2.17$ for primaries $10^{12}$eV, $10^{15}$eV and $10^{18}$eV, respectively. Namely, these showers with *the shortest range* essentially lose their energies almost due to bremsstrahlung, while the corresponding ratios due to direct electron-positron pair production in the showers with *the longest range* are $1.33$, $1.52$, $1.49$. Also, these showers with *the longest range* lose their pretty energies owing to direct electron-positron pair production. ### Range Distributions and Hypothetical Range Distributions for high energy muons {#sec:2.4.3} As shown, for example, in Fig.3 to Fig.13, we can pursue three kinds of the typical types of the behaviors of high energy muons with definite primary energies in stochastic manner exactly, recording the locations of the interaction points for specified interactions and their dissipated energies exactly. However, we pursue the behaviors of all sampled muons exactly, including three different types of the muons. We can construct the range distributions from ensemble of $100,000$ individual muons for respective primary muon’s energy, as shown in Fig.14. In the figure, we give $P(R;E_{0})$, the probabilities for the range distribution in water with primary energies, $10^{12}$eV to $10^{15}$eV and $10^{18}$eV in water whose minimum energy is $10^{9}$eV(1GeV), respectively. It is clear from the figure that the width of the range distribution increases rapidly, as their primary energy increases. Also, as the primary energy decreases, the width of range distribution becomes narrower and approaches to a $\delta $ function-type, the limit of which denotes no fluctuation. It is interesting that the range distributions can be well approximated as the normal distribution above $\sim 10^{14}$eV where the total Cherenkov light yields comes almost from the muon induced electromagnetic cascade showers and they are given as, $$% Eq.13 \label{PRE} P\left(R;E_{0}\right)=\frac{1}{\sqrt{2\pi}\sigma}exp\left(-\frac{R-<R>}{2\sigma^{2}}\right),$$ , where $E_{0}$, $R$, $<R>$ and $\sigma $ are primary energy, real range, the average value of ranges and the standard deviations, respectively. Their average ranges, standard deviations and relative variances (standard deviations divided by averages) in water are given in Table 3. Also, it is interesting that their relative variances decrease slightly as their primary energies increase. It should be noticed from Table 3 that the standard deviation increases as primary energy increases, but, the relative variance of the range distribution decreases inversely. \[0.9\] [c|l|l|c]{} $E_{0}$ \[eV\] & $<R>$ \[km\] & $\sigma$ \[km\] & $\sigma/<R>$\ $10^{11}$ & 3.56$\times 10^{-1}$ & 2.52$\times 10^{-2}$ & 7.07$\times 10^{-2}$\ $10^{12}$ & 2.43 & 4.71$\times 10^{-1}$ & 1.94$\times 10^{-1}$\ $10^{13}$ & 7.28 & 2.02 & 2.78$\times 10^{-1}$\ $10^{14}$ & 1.26$\times 10^{1} $ & 3.49 & 2.77$\times 10^{-1}$\ $10^{15}$ & 1.78$\times 10^{1} $ & 4.57 & 2.57$\times 10^{-1}$\ $10^{16}$ & 2.30$\times 10^{1} $ & 5.41 & 2.36$\times 10^{-1}$\ $10^{17}$ & 2.79$\times 10^{1} $ & 6.14 & 2.20$\times 10^{-1}$\ $10^{18}$ & 3.29$\times 10^{1} $ & 6.81 & 2.07$\times 10^{-1}$\ In order to examine each characteristic of the stochastic process, such as the bremsstrahlung, direct electron-positron pair production and photonuclear interaction, we construct the hypothetical range distribution in which a specified stochastic process only is assumed to occur and the other two stochastic processes are assumed not to occur. To clarify the characteristics of the specified stochastic processes, we can compare this hypothetical range distribution with that of real range distribution in which every specified stochastic process is realized as the competition effect among these three processes. We compare the hypothetical range distribution with the real range distribution in Fig.15 to Fig.17. In Fig.15, we compare three different hypothetical range distributions with the real range distribution for primary energy of $10^{13}$eV. Here, the symbol **d** in these figures means the hypothetical range distribution in which only direct electron-positron pair production is taken into account and both the bremsstrahlung and photo nuclear interaction are neglected. The symbols **b** and **n** have similar meaning to that of **d**. The symbol **t** means the real range distribution in which all interactions are taken into account (The true distribution). From the shapes of the distributions and their maximum frequencies for different stochastic processes in the figures, it is clear that energy losses in the direct electron-positron pair production are of small fluctuation, while both the bremsstrahlung and photonuclear interaction are of bigger fluctuation, and the fluctuation in photonuclear interaction becomes bigger when compared with bremsstrahlung as primary energy increases. The smaller fluctuation in direct electron-positron pair production suggests us that energy loss from this process may be treated as something like “continuous” energy loss in the special situation ### Other physical quantities obtained from *the Time Sequential Procedure* {#sec:2.4.4} In Fig.18 to Fig.20, we give the survival probabilities for different cutoff energies with primary energies of $10^{12}$eV, $10^{15}$eV and $10^{18}$eV, respectively. The values for cutoff energies are given in respective figures. The sampling number utilized is $100,000$ for each primary energy. In Fig.21 to Fig.23, we give the differential energy spectrum of muons for primary energies, $10^{12}$eV, $10^{15}$eV and $10^{18}$eV, respectively. The energy spectra of the survival muons obtained by *the* $V_{cut}$ *Procedure* are surmised to become different from those by *the Time Sequential Procedure*. As the primary energies of the mouns increase and/or the depths increase, the magnitude of the energy spectra of the muons obtained by *the* $V_{cut}$ *Procedure* is surmised to decrease particularly at lower energies due to the constant $v_{cut}$, compared with those obtained by *the Time Sequential Procedure*. See, further discussion in the next section. *The* $V_{cut}$ *Procedure*: The fundamental structure and its application limit {#sec:3} ================================================================================ Here, we examine the fundamental structure of *the* $V_{cut}$ *Procedure* from a different point of view. Lipari and Stanev [@Lipari] and subsequent authors, P.Antonioli, S.Iyer et al., Klimushin et al., D.Chirkin et al., S.Bottai et al. [@Antoni]- [@Chirkin] formulate *the* $V_{cut}$ *Procedure* as follows: $$\begin{aligned} \label{dEdx_rad} %% Eq.14 \frac{dE}{dx} &=&\left[\frac{dE}{dx}\right]_{soft}+\left[\frac{dE}{dx}\right]_{hard} \nonumber \\ &=&\frac{N}{A}E\int_{0}^{v_{cut}}dv\cdot v\frac{\sigma\left(v,E\right)}{dv} \nonumber \\ &+&\frac{N}{A}E\int_{v_{cut}}^{1}dv\cdot v\frac{d\sigma\left(v,E\right)}{dv},\end{aligned}$$ , where $v$ denotes the fractional emitted energy. They introduce $v_{cut}$ , a certain constant value, into the diffusion equation, in such a way that the effective energy loss, for example, the emitted energies above $v_{cut} \times E$, is treated stochastically in the “hard” part, while that below $v_{cut} \times E$ they are put into “continuous” energy losses (the “soft” part), which are simply subtracted from the muons concerned. Here, let us summarize the values of $v_{cut}$ utilized in *the* $V_{cut}$ *Procedure* in the following. \[a\] Lipari and Stanev adopt $v_{cut}$= $0.01$ [@Lipari], \[b\] Antonioli et al. adopt $v_{cut}$ = $10^{-3}$ [@Antoni], \[c\] Dutta et al. adopt $v_{cut}$ =$10^{-3}$ [@Dutta], \[d\] Sokalski et al. adopt $v_{cut}$= $10^{-3}$ to $0.2$ [@Sokal], \[e\] Chirikin and Rohde adopt $v_{cut}$ = $10^{-4}$ to $10^{-3}$ [@Chirkin]. Relating to its application limit in *the* $V_{cut}$ *Procedure*, the problems to be examined are as follows: The inconsistent treatment in the separation of the “hard” part from the “soft” part ------------------------------------------------------------------------------------ It should be pointed that the separation of the “soft” part from the “hard” part is treated in inconsistent manner in *the* $V_{cut}$ *Procedure* as for fixed energy muon. Namely, the muon with the some energy is treated in the “soft” part in some case, while the muon with the same energy is treated in the “hard” part in another case. Such the treatment lacks in consistency for description on muon behavior, because the effectiveness of fluctuation depends on the absolute values of muon energies. *The* $V_{cut}$ *Procedure* pursues the change of energy state by step by step method with regard to the depth $dx$. Consequently, by the constancy of $v_{cut}$ ($10^{-4}$ under examination), their stochastic energy loss part (the “hard” part) shifts toward lower energy region, as $dx$ advances. In other words, as already mention, the muons with some energy belongs to the “hard” part (stochastic energy loss part) at certain depth, but belongs to the “soft” part (“continuous” energy loss part) at another depth, owing to the shift of the boundary line between the “hard” part and the “soft” part. Such a description on the behavior of the muon in *the* $V_{cut}$ *Procedure* clearly lacks in consistency as for the range fluctuation of high energy muon. For example, comparing Fig.24(a) with Fig.24(b), it is clear that the region from $10^{14}$eV to $10^{11}$eV for $E_{0}=10^{18}$eV belongs to the “soft” part, while the same region belong to the “hard” part for $E_{0}=10^{15}$eV. This is also an example that the stochastic process is not treated in the unified manner. The inconsistent description of *the* $V_{cut}$ *Procedure* is clarified by the examination on the interrelation among the $v_{cut}$, the “continuous” energy loss, $E_{b,min}$, the minimum energy of the emitted photon due to bremsstrahlung and $E$, the energy of the muon concerned. In the relation of $v_{cut} = E_{b,min} /E$, there is two choices for given E, namely, which quantities should be chosen as constant (or variable), $v_{cut}$ ? or $E_{b,min}$ ? In *the* $V_{cut}$ *Procedure*, they adopt $v_{cut}$ to be constant, then, $E_{b,min}$ is the function of $E$. In other word, the values of $E_{b,min}$ change as $E$ change so as to keep $v_{cut}$ to be constant. This denote the borderlines which separate the “soft” part from “hard” part (Eq.(14)) change as $E$ change as shown in Figure 24. Namely, the value of “continuous” energy loss change as the muons concerned change. It should be noted that the “continuous” energy losses are treated as dissipated energies which “flow out” merely from the system for muons towards the outside and neither contribute to the muon propagation any more, nor produce “seeds” for the electromagnetic cascade showers, just as the same in the usual ionization losses. Considering such the character of the “continuous” energy loss, the results that the borderline shift owing to the choice of both $v_{cut}$ and $E$ denote the inconsistent treatment in *the* $V_{cut}$ *Procedure* (see, Figure 24, too). Originally, the borderline should be decided owing to the physical reasons, but it is reluctantly decided in artificial manner. In Figure 25, the “continuous” energy losses per muon radiation length shown as the function of $v_{cut}$ for given the energies of the muons concerned. Here \[**a1**\], \[**a2**\], \[**a3**\], \[**a4**\] and \[**a5**\] denote the “continuous” energy loss per muon radiation length ($\sim 1500$ meter in water) for the muons with $10^{18}$ eV, $10^{17}$ eV, $10^{16}$ eV, $10^{15}$ eV and $10^{14}$ eV as the function of $v_{cut}$, respectively. For example, we consider the case of a muon with $10^{16}$ eV (\[**a3**\]). In the case of $v_{cut} = 10^{-2}$ \[25\] and, $10^{-4}$ \[31\], the “continuous” energy loss per muon radiation length $\sim 10^{14}$ eV and $\sim 10^{12}$ eV, respectively. Also, we show the energies of the muons concerned where the “continuous” energy losses attain at the usual ionization loss as the function of $v_{cut}$ marked with \[c\]. It is clear from the figure that the “continuous” energy losses exceed over the usual ionization loss at the energies of the muons concerned for $\sim 3\times 10^{13}$ eV, $\sim 3 \times 10^{14}$ eV, and $\sim 3 \times 10^{15}$ eV for $v_{cut}=10^{-2}$, $10^{-3}$ and $10^{-4}$, respectively, because $E_{b,min}$ increases linearly with $E$. These “continuous” energy losses obtained by *the* $V_{cut}$ *Procedure* are far higher than $\sim 10^{6}$ eV, that obtained by *the Time Sequential Procedure* (see, the section 2.3 and the discussion in the end of this section, too). It should be noted that the large spread of the numerical values of the “continuous” energy losses obtained by *the* $V_{cut}$ *Procedure* shown in Figure 25 is not owing to the real physical causes, and the introduction of $v_{cut}$ treatment into the muon struggling is made artificially for the sake of convenience to remove the infrared catastrophe in the bremsstrahlung. Namely, the “continuous” energy loss is a kind of artificial product and, therefore, its numerical value is desirable taken to be as small as possible for avoidance of the divergence in bremsstrahlung. Otherwise, the “continuous” energy loss may distort the nature of the original bremsstrahlung. It is easily understood from the figure that *the* $V_{cut}$ *Procedure* is not described in consistent manner owing to the great change in the “continuous” energy loss. On the other hand, we adopt $E_{b,min}$ to be constant ($1.02$ MeV) in the relation of $v_{cut} = E_{b,min} / E$ in *the Time Sequential Procedure*, instead of $v_{cut}$ to be constant in *the* $V_{cut}$ *Procedure*. Then, $v_{cut}$ is the function of $E$ in our procedure, while $E_{b,min}$ is the function of $E$ in *the* $V_{cut}$ *Procedure*. Owing to the adoption of $E_{b,min}$ to be constant, the “continuous” energy loss per muon radiation unit is $E_{b,min}$ ($1.02$ MeV) by the definition, irrespective of the energies of the muons concerned in *the Time Sequential Procedure* and furthermore, the numerical value $\sim 10^{6}$ eV is far smaller even compared with the usual ionization loss, $\sim 3 \times 10^{11}$ eV. (see, the section 2.3, too). Consequently, the introduction of $v_{cut}$ in *the Time Sequential Procedure* allow us to treat the every energy loss as those really coming from the “radiative” part except for the muons with below $\sim 10^{13}$ eV where we cannot the neglect the effect of the usual ionization loss. Thus, it is conclude that *the Time Sequential Procedure* is described in consistent manner. From where the differences in the survival probabilities come between *the* $V_{cut}$ *Procedure* and *the Time Sequential Procedure* ? --------------------------------------------------------------------------------------------------------------------------------------- For higher energy muons and/or larger $v_{cut}$, for example, in the case of bremsstrahlung, the emitted higher photons may be contained in the “soft” part in which they are subtracted from the muon concerned, being treated “continuous” energy loss and don’t contribute to the muon’s future behavior any more. However, some part of such the higher photons may not be consumed as dissipated energies, if $v_{cut}$ is taken up smaller. Then the muons concerned should maintain them in the “hard” part and their energy loss may be treated in stochastic manner. As the result of it, the emitted photons may be correctly taken into account in the “hard” part so that the muon concerned can maintain higher energy than that in the case of larger $v_{cut}$ and, consequently, more muons may survive than in the case of larger $v_{cut}$. It may be possible to re-state the matter mentioned above in the following. When one adopts larger $v_{cut}$, one may expect the some deficit in the lower energies above $E_{min}$ in the energy spectrum of the survived muon. This deficits of the lower energies in the energy spectrum of the muons concerned above $E_{min}$ due to larger $v_{cut}$ lead to smaller survival probabilities. The deficits are the another representation which the larger energy loss is put into the “continuous” energy loss. Conclusively speaking, the numerical values in the survival probabilities obtained by *the* $V_{cut}$ *Procedure* are expected to approach to those obtained by *the Time Sequential Procedure* as the ratios of the “soft” part to the “hard” part in *the* $V_{cut}$ *Procedure* decrease, as far as the survival probability is concerned. Thus, in the case of higher energy muons and/or larger $v_{cut}$, we expect the deformed high energy photons (or electrons) spectrum due to the high energy muons which, in turn, may result in the deformed Cherenkov light spectra, compared with the corresponding ones which can be obtained by *the Time Sequential Procedure*. The difference between *the* $V_{cut}$ *Procedure* and *the Time Sequential Procedure* in the light of the Monte Carlo method {#sec:3.2} ----------------------------------------------------------------------------------------------------------------------------- Apart from the largeness of $v_{cut}$ values in *the* $V_{cut}$ *Procedure*, we discuss the difference in the Monte Carlo method between *the* $V_{cut}$ *Procedure* and *the Time Sequential Procedure*. On the sampling of energy loss in the radiation part (the “hard” part) in *the* $V_{cut}$ *Procedure*, they utilize the corresponding total cross sections, namely, the sum of the bremsstrahlung, direct electron-positron pair production and photo nuclear interaction, but not utilize the cross section for the respective interaction. As far as one is interested exclusively in the energy loss of the muons concerned, this treatment seems to be reasonable. However, in the case when one is interested in the energy determination of the muons through the Cherenkov light yields due to the muons concerned, one need the detailed information around the respective interaction. In the treatment of the Cherenkov light yields, they considered only in the fluctuation around the total cross section, while we consider the fluctuation around the respective interaction (see, the discussion in the 4. Conclusion and Outlook) Comparison of the survival probabilities obtained by *the Time Sequential Procedure* with those obtained by *the* $V_{cut}$ *Procedure* --------------------------------------------------------------------------------------------------------------------------------------- In the previous section, we examine the inconsistency problems involved in *the* $V_{cut}$ *Procedure*. However, *the* $V_{cut}$ *Procedure* may be useful within their application limit. In Fig.26 and Fig.27, we give the comparison of our results by *the Time Sequential Procedure* for survival probabilities with those of Lipari and Stanev and those of Klimushin et al. by *the* $V_{cut}$ *Procedure*, respectively. We discuss the agreement or disagreement between the results obtained by *the Time Sequential Procedure* and *the* $V_{cut}$ *Procedure*. The agreement between Lipari and Stanev’s (Fig.26) and ours is quite well in the energies from 1 TeV to $10^{4}$TeV, while the disagreement between them become clear beyond $10^{5}$TeV. As indicated in the subsection 3.2 the photons contained the “soft” part, should be involved in the muon spectrum, if the stochastic processes concerned down to $E_{min}$ are taken into account. Therefore, this fact leads increase of survival probability and muon spectrum. If $v_{cut}$ of Lipari and Stanev in higher primary muon energies is taken smaller value, then, their results are expected to approach to us. The rather nice agreement in lower primary energies between them and us indicates that *the* $V_{cut}$ *Procedure* functions well within its application limit, while the disagreement between them and us in higher primary energies that *the* $V_{cut}$ *Procedure* functions beyond its application limit. The agreement and disagreement between Klimushin et al’s (Fig.27) and ours can be explained similarly. The figure shows that the discrepancies between them and us become larger as the depths become lager. This indicates that the deficit of the lower energies part in survived muon energy spectrum become larger, as the depths increase. Namely, if they adopt smaller $v_{cut}$, their numerical values are expected to approach to us. Also, it should be noticed that fluctuation effect in the muons’ behavior depends entirely on the absolute values of muon’s energy. In *the* $V_{cut}$ *Procedure*, as the Monte Carlo procedure, the calculations are performed by step by step method in $dx$, which inevitably introduce uncertainties due to the accumulation effect in calculation error. One may call their procedure *the differential method*. On the contrast to it, *the Time Sequential Procedure* can determine interaction point directly (*the integral method*). Consequently, its accuracy is independent of the errors due to the accumulation effect coming from $dx$. One may call our procedure as *the integral method* on the contrast to *the differential method*, the relation of which is complementary. Conclusion and Outlook {#sec:4} ====================== From the methodological point of view, *the Time Sequential Procedure* is classified as *the integral method*, while *the* $V_{cut}$ *Procedures* are done as *the differential method*. They are complementary each other and the results obtained by the present $V_{cut}$ *Procedure* approach to those obtained by *the Time Sequential Procedure*, when both $dx$ and $v_{cut}$ are sufficiently small in the latter. We surmise that it takes less time for *the Time Sequential Procedure* to perform the computation than for *the* $V_{cut}$ *Procedure* to do, when both procedures utilize the same boundary conditions for computation and the results obtained by the both procedures maintain the same accuracy of the computation. Main purpose of the development of *the Time Sequential Procedure* is the application to KM3 physics. However, another ones are the application to both the energy spectrum of muons underground or underwater and to the range energy fluctuation problem under different photonuclear interactions ( [@Dutta], [@Groom], [@Butk], [@Buga2], [@Petru], [@Kuzm]) because the muon-nucleus inelastic scattering (photonuclear interaction) is of prime interest in another aspect. In Fig.28, we give the ratios of the Cherenkov light yields due to muon induced electromagnetic cascades showers to the total Cherenkov light ones as the function of the depth traversed for $10^{11}$eV to $10^{16}$ eV. It is clear from the figure that $\sim 10^{11}$eV, the most of the Cherenkov light yield comes from the muon itself, while above $\sim 10^{14}$eV the most Cherenkov light yield comes from the muon induced electromagnetic cascade shower and, consequently, the Cherenkov light yield from the original muon is essentially negligible. Namely, above $\sim 10^{14}$eV, the Cherenkov light yields are produced essentially from the electromagnetic cascade showers due to the bremsstrahlung, direct electron-positron pair production or photo nuclear interaction. Now, we discuss this problem in more detail. The electromagnetic cascade showers due to bremsstrahlung, direct electron-positron pair production and photo nuclear interaction are photon induced one, electron pair induced one and aggregate of $\pi_{0}-2\gamma$ induced one, respectively. These different kinds of electromagnetic cascade showers have the different characteristics in their respective behaviors, which show different characteristics in the respective Cherenkov light yields. In *the Time Sequential Procedure*, we simulate exactly these electromagnetic cascade showers in stochastic manner and calculate the Cherenkov light yields produced from the respective electron segments in the electromagnetic cascade showers concerned (see, Eqs.(5) and (6)). In the case that they sample $v$ which is larger than $v_{cut}$ from Eq.(14) in the Monte Carlo simulation of *the* $V_{cut}$ *Procedure*, $v \times E$ denotes the sum of energy losses from bremsstrahlung, direct elctron pair production and photo nuclear interaction with some relative weights, because they are essentially interested in the total energy loss for bremsstrahlung, direct electron-positron pair production and photo nuclear interaction. Considering the differences in the treatment of the Cherenkov light production through the respective electromagnetic showers among bremsstrahlung, direct electron-positron pair production and photo nuclear interaction in addition to adoption of larger $v_{cut}$ value, the difference in the Cherenkov light production spectrum between *the* $V_{cut}$ *Procedure* and *the Time Sequential Procedure* will become apparent, which is just the main subject in our subsequent papers. A part of the correlations between the energy losses of the high energy muons and their Cherenkov light yields was reported elsewhere [@Okumura]. However, as far as one is interested in the muons behavior exclusively, the situation mentioned above may be not influential. This is the reason why there are no significant difference in the survival probabilities between *the* $V_{cut}$ *Procedure* and *the Time Sequential Procedure* (see, Figures 26 and 27). Up to now, our discussion still remains to single high energy muon problem. However, really, muon does not exist singly, but they exist in the form of energy spectrum which is directly reflection of parent neutrino spectrum through the interactions. In *the Time Sequential Procedure*, for given primary muon, we exactly simulate the muon behaviors in stochastic manner, without introducing the “soft” part and, consequently, we obtain accurate muon energy spectrum at arbitrary depths as well as the energy spectrum of ’primary’ (in the sense of origin of electromagnetic cascade showers) electrons and photons energy spectrum due to the muons concerned at arbitrary depths. The existence of the energy spectrum of primary muons brings more difficulty into the elucidation of fluctuation effect even in *the Time Sequential Procedure*. These effects intermingle with each other and we could not discuss them separately. Up to now, we restrict our discussion around electromagnetic cascade showers which the primary muons produce in the case of Bethe-Heitler shower. However, we could not neglect LPM effects, related to the interpretation of extremely high energy muon events in future. One is related to electrons [@Koni1]-[@Misaki4] and other is related to muon [@Poly1; @Poly2]. We cannot neglect the LPM effect on the behaviors of electromagnetic cascade themselves above $\sim 10^{15}$eV in water [@Misaki5]. However, the LPM effect is supposed to be effective above $\sim 10^{18}$eV in the case of muon induced electromagnetic cascade showers In such extremely high energies, range fluctuation of muon may alter their feature essentially compared with that of present situation. Furthermore, above $10^{21}$eV, we cannot neglect the LPM effect related to the muons [@Poly1; @Poly2]. Namely, above $10^{21}$eV, the Cherenkov light spectrum is supposed to become essentially different from those in the absence of two kinds of LPM effects at present. In the present paper, we restrict our discussion to muons themselves in high energies. In subsequent papers, we will extend our examination to the Cherenkov light yield via electromagnetic cascade showers from different interactions, such as, bremsstrahlung, direct electron-positron pair production and photonuclear interaction, taking into account of muon energy spectrum for imaging KM3 detector. There, the main subject will be the examination of the Cherenkov light yeilds from the muon induced electromagnetic cascade showers. In discussion of the problems around high energy neutrino spectrum from the universe, it should be noticed that the reliable results are obtained essentially through the utilization of the stochastically correct tools, taking into account of very few number of experimental events and the steepness of high energy neutrino spectrum. Acknowledgments {#acknowledgments .unnumbered} =============== One of authors (A.M.) would like to express his thanks to The Institute for China-Japan Culture Study for providing the research fund and for stimulating him. [00]{} M.G.K.Menon, P.V.Ramana Murthy, Progress in Elementary Particles and Cosmic Ray Physics, Vol.9 (1967) 161-243, North- Holland Publ. Y.Miyazaki, Phys. Rev. **76** (1949) 1733 S.Miyake, V.S.Narashimham, P.V.Ramana Murthy, Nouvo Cimento **32** (1964) 1505 E.V.Bugaev, A.Misaki, V.A.Naumov, T.S. Sinegovskaya, S.I.Sinegovsky, N.Takahashi, Phys. Rev. D **58** (1998) 054001 M.Mand, L.Ronchi, Nuovo Cimento **9** (1952) 105 M.Mand, L.Ronchi, Nuovo Cimento **9** (1952) 517 M.Mando, P.G.Sona, Nuovo Cimento 10 (1953) 1275 I.L.Rozental, V.N.Streltsov, Zh.Eksp. Teor. Fiz **35** (1958) 1440 G.T.Zatsepin, E.D.Mikhalchi, Proc. 0th Int. Cosmic Ray Conf., Kyoto, Japan **3** (1961) 356 J.Nishimura, Proc. 8th Int. Cosmic Ray Conf., Jaipur, India **6** (1963) 224 V.I.Gurentsov, G.T.Zatsepin, E.D.Mikhalchi, Sov.Jour.Nuc.Phys. **23** (1976) 527 K.Kobayakawa, Nuovo Cimento B **47** (1967) 156 A.Misaki, J.Nishimura, Uchusen Kenkyuu **21** (1976) 250; ICR-Report-45774-4, University of Tokyo (1977) V.I.Gurentsov, G.T.Zatsepin and E.D. Mikhalchi, Sov.J.Nucl.Phys. **23** (1976) 527 Y.Minorikawa,T.Kitamura, K.Kobayakawa, Nuovo Cimento C **4** (1981) 471 V.A.Naumov, S.I.Sinegovsky, E.V.Bugaev, Phys.Atom.Nucl. 57 (1994) 412 H.Oda, T.Murayama, Jur.Phys.Sos.Japan **20** (1965) 1549 H.J.Bolinger, Ph.D thesis, Cornel University (1958) P.J.Hayman, A.W.Wolfendale, Proc. Phys. Soc. **80** (1962) 710 P.J.Hayman, N.S.Palmer, A.W.Wolfendale, Proc. Roy. Soc. A **275** (1963) 391 P.V.Ramana Murthy, Ph.D thesis, Bombay University (1962) S.Miyake, V.S.Narasimham, P.V.Ramana Murthy, Nuovo Cimento **32** (1964) 1524 N.Takahashi, A.Misaki, A.Adachi, N.Ogita, Y.Okamoto, K.Mitsui, H.Kujirai, S.Miono, O.Saavedra, Proc.18th Int. Cosmic Ray Conf., Bangalore, India **11** (1983) 443 N.Takahashi, H.Kujirai, A.Adachi, N.Ogita, A.Misaki, Uchusen Kenkyuu **28** (1984) 120 P.Lipari, T.Stanev, Phys. Rev. D **44** (1991) 3543 P.Antonioli, C.Ghetti, E.V.Korolkova, V.A. Kudryavtsev, G.Sartorelli, Asroparticle Physics **7** (1997) 357 S.Bottai, L.Perrone, Nucl.Instrment and Method in Research A **459** (2001) 319 S.Iyer Dutta, M.H.Reno, I.Sarcevic, D. Seckel, Phys.Rev. D **63** (2001) 094020 S.I.Klimushin, E.V.Bugaev, I.A.Sokalski, Phys. Rev. D **64** (2001) 014016 L.A.Sokalski, E.V.Bugaev, S.I.Klimushin, Phys. Rev. D **64** (2001) 074015 D.Chirkin, W.Rhode, hep-ph 0407075 v2 (2008) For example, S.R.Kelner, R.P.Kokoulin, A.A. Petrukhin, Preprint MEPHI 024-95 Moscow (1995); CERN SCAN-9510048 For example, R.P.Kokoulin, A.A.Petrukhin, Proc. 11st Int. Cosmic Ray Conf., Budapest, Hungary MU-**41** (1969) 277 For example, V.V.Borog, A.A.Petrukhin, Proc. 14th Int. Cosmic Ray Conf., Munchen, Germany **6** (1975) 1949 D.E.Groom, N.V.Mokhov, S.I.Striganov, Atomic Data and Nuclear Data Table, **78** (2001) 183 M.Tamura, Prog.Theor.Phys. **34** (1965) 912 A.Adachi, Y.Fujimoto, N.Ogita, S.Takagi, A.Ueda, Suppl.Prog.Theor.Phys. **32** (1964) 154 A.V.Butkevich, S.P.Mikheyev, JETP **95** (2002) 11 E.V.Bugaev, Yu.V.Shelpin, Phys.Rev.**D** **67** (2003) 034027 A.A.Petrukhin, D.A.Timashkov, Phys.At.Nucl. **67** (2004) 2216 K.S.Kuzmin, K.S.Lokhtin, S.I.Sinegovskii, Phys. Part. Nucl. Lett. **4** (2007) 477\ K.S.Kuzmin, K.S.Lokhtin, S.I.Sinegovskii, Int. J. Mod. Phys. A **20** (2005) 6956 B.Rossi, K.Greisen, Rev.Mod.Phys. **13** (1941) 240 J.Nishimura, Handbuch der Physik, **XLVI/2**, ’COSMIC RAY II’, Springer-Verlag, (1966) 1 A.Misaki, Suppl.Prog.Theor.Phys., Suppl. Theor.Phys. **89** (1965) 82 Konishi, A.Misaki, N.Fujimaki, Nuovo Cimento, **44** A (1978) 509 T.Stanev, Ch.Vankov, R.E.Streitmatter, R.W. Ellsworth, T.Bowen, Phys. Rev. D **25** (1982) 1291 E.Konishi, A.Adachi, N.Takahashi, A.Misaki, J.Phys.G:Nuc.and Part.Phys., 17 (1991)719 A.Misaki, Fort.Schr. d. Phys. **38** (1990) 413 A.Misaki, Nuov.Cim. **13** C (1990) 733 A.Misaki, Phys. Rev. D **40** (1990) 3086 S.Polytiko, M.Kato, E.Konishi, N.Takahashi, A.Misaki, J.Phys.G:Nucl.and Part.Phys. **28** (2002) 427 S.Polytiko, N.Takahashi, M.Kato, Y.Yamada, A.Misaki, Nucl. Instr. Meth. in Physical Research B **173** (2001) 30 Y.Okumura, N.Takahashi, A.Misaki, arXiv: 1010.5054v1 \[astro-ph.HE\] (2010) [^1]: For examples, http://baikalweb.jinr.ru/,\ http://icecube.wisc.edu/, http://antares.in2p3.fr/ [^2]: We adopt, $1$ GeV, the minimum energy of the muon for simulation throughout the present paper. The numerical value of $1$ GeV is adopted for the same purpose in [@Lipari]. [^3]: In order to understand the situation visually the characteristic behaviors of high energy muons which are shown Fig.3 to Fig.13, we suggest the readers to look at the pictures with colors in the WEB page.

172 F.Supp.2d 372 (2001) Robert SIMPSON, Plaintiff, v. BIO-WASH PRODUCTS, INC., Defendant. No. 3:01CV82(WWE). United States District Court, D. Connecticut. November 1, 2001. Joseph W. Christiano, III, Bridgeport, CT, for Robert Simpson. Patrick M. Mullins, Gregory C. Goodstein, Morrison, Mahoney & Miller, LLP, Hartford, CT, for Ring's End, Incorporated. Robert B. McLaughlin, Cartafalsa & Shields, Wallingford, CT, James E. Wildes, Sizemore Law Offices, North Haven, CT, for Bio-Wash Products, Inc. *373 RULING ON MOTION TO DISMISS EGINTON, Senior District Judge. The plaintiff, Robert Simpson, seeks to hold the defendant, Bio-Wash Products, liable for injuries allegedly caused by a product manufactured by defendant. Plaintiff asserts three federal claims for relief, alleging that defendant violated the reporting requirements of the federal Consumer Products Safety Act, 15 U.S.C. Section 2051 et seq.. In the second amended complaint, count one alleges that after the date of the accident, an agent of defendant acknowledged that he knew of the problem with that particular type of bottle. Nevertheless, prior to plaintiff's accident, defendant failed to inform the Consumer Product Safety Commission as required by 15 U.S.C. Section 2064(b) and in violation of 15 U.S.C. Section 2068(a)(4). Count two alleges that despite defendant's knowledge of plaintiff's accident, defendant failed to notify the Consumer Product Safety Commission as required by 15 U.S.C. Section 2064(b) and in violation of 15 U.S.C. Section 2068(b). Count three alleges that, as a result of defendant's failure to notify the Consumer Product Safety Commission of the product defect, plaintiff suffered severe injury to his face and eyes, for which injuries defendant should be liable pursuant to 15 U.S.C. Section 2072. Plaintiff asserts two state law claims, alleging that defendant is liable pursuant to the Connecticut Products Liability Act, Connecticut General Statutes Section 52-572m et seq. Specifically, count four alleges that defendant failed to warn of an unreasonably dangerous product, misrepresented that the product was safe for use by the public, and negligently failed to test the product prior to marketing it. Count five alleges that defendant failed to warn, notify or recall the product and acted with reckless disregard for the safety of the product users. In his prayer for relief, plaintiff seeks an injunction pursuant to 15 U.S.C. Section 2071 to restrain defendant's violations, damages pursuant to 15 U.S.C. Section 2072, an assessment of civil penalties pursuant to Section 2069, attorneys' fees and costs pursuant to Sections 2072 and 2073, and damages, punitive damages and attorneys' fees as provided by Connecticut General Statutes Section 52-572m et seq. Plaintiff asserts federal jurisdiction based on the existence of a federal question and diversity of citizenship. Defendant has moved for dismissal of the complaint in its entirety. For the following reasons, the motion will be granted in part and denied in part. BACKGROUND The following facts are reflected in the allegations of the complaint, which facts are taken as true for purposes of ruling on this motion. Plaintiff is an individual residing in Connecticut, who works as a customer service person in the paint department at Ring's End, a lumber yard and paint store in Darien, Connecticut. Defendant is a corporation formed under the laws of Canada, where it has its principal place of business. Defendant manufactures, markets and distributes wholesale wood care products, including chemical paint strippers. Plaintiff was reading the label of a one gallon bottle of Stripex-L in order to answer a customer's question. While he was turning the bottle on the shelf, the bottle spontaneously exploded, causing its contents to cover plaintiff's face, eyes and skin. As a result of the exposure, plaintiff sustained permanent injury to his eyes. Subsequent to this event, Al DePasquila, an agent of defendant, was visiting Ring's End in Darien, where he learned of the plaintiff's injury. He indicated that defendant *374 had experienced problems in the past with that type of bottle. Later, Peter Palkousky, President of defendant, acknowledged that the defendant knew of the problem with the particular type of bottle that caused plaintiff's injury. DISCUSSION The function of a motion to dismiss is "merely to assess the legal feasibility of the complaint, not to assay the weight of the evidence which might be offered in support thereof". Ryder Energy Distribution v. Merrill Lynch Commodities, Inc., 748 F.2d 774, 779 (2d Cir. 1984). When deciding a motion to dismiss, the Court must accept all well-pleaded allegations as true and draw all reasonable inferences in favor of the pleader. Hishon v. King & Spalding, 467 U.S. 69, 73, 104 S.Ct. 2229, 81 L.Ed.2d 59 (1984). A complaint should not be dismissed unless it appears beyond doubt that the plaintiff can prove no set of facts in support of his claim which would entitle him to relief. Conley v. Gibson, 355 U.S. 41, 45-46, 78 S.Ct. 99, 2 L.Ed.2d 80 (1957). FEDERAL CLAIMS Plaintiff alleges that Stripex-L constituted a substantial product hazard as defined by 15 U.S.C. Section 2064(a)(1) and (2), and that the defendant failed to inform the Consumer Product Safety Commission as required by 15 U.S.C. Section 2064 and 16 C.F.R. Part 1115.10. Claim for Injunctive Relief Pursuant to Section 2071 In the prayer for relief stated in the second amended complaint, plaintiff seeks, pursuant to 15 U.S.C. Section 2071, to restrain defendant's violations of the Consumer Products Safety Act's reporting requirements as alleged in counts one and two. However, as pointed out by defendant, Section 2071 provides that enforcement of the Act's reporting requirements lies with the Commission or the Attorney General. Accordingly, plaintiff's claim for injunctive relief based on violation of the Act's reporting requirements will be dismissed. Claim for Damages Pursuant to Section 2072 Defendant urges dismissal of plaintiff's claim for damages pursuant to 15 U.S.C. section 2072, arguing that no private cause of action for damages lies for violations of the reporting requirements in the Consumer Product Safety Act. The Consumer Product Safety Act requires manufacturers, distributors and retailers of consumer products to inform the Commission immediately when they obtain any information suggesting that a product they make or distribute "contains a defect which could create a substantial hazard." 15 U.S.C. Section 2064(b). Further, the Act provides for recovery of damages for any person who sustains "injury by reason of any knowing (including willful) violation of a consumer product safety rule or any other rule or order issued by the Commission...." 15 U.S.C. Section 2072. The Second Circuit has not reviewed whether the Consumer Product Safety Act creates a private cause of action for an injury allegedly resulting from noncompliance with the statute's reporting rules. However, several circuits that have considered the issue have answered in the negative. See Kloepfer v. Honda Motor Company, Ltd., 898 F.2d 1452, 1457 (10th Cir. 1990) and cases cited therein. Most courts have adopted the analysis of Drake v. Honeywell, 797 F.2d 603, 606 (8th Cir. 1986), in which the Eighth Circuit held that Section 2072 did not create a "private right of action" based upon violation of the statutory reporting requirements in light of the absence of specific *375 statutory language and legislative history to that effect. Drake instructs that the Commission's interpretive rules of the Act's reporting requirements, 16 C.F.R. Part 1115.10 et seq., cannot constitute a basis for liability under Section 2072. As the court elaborated, interpretive rules amount to no more than restatements of statutory provisions, and failure to distinguish between legislative and interpretive rules would frustrate the congressional intent evidenced by Section 2072's omission of a right to sue for statutory violations. In light of this analysis and the weight of authority adopting Drake, the court is persuaded that Section 2072 does not confer a private right of action for violation of the statutory reporting requirements. The motion to dismiss will be granted on this ground. Civil Penalties Plaintiff's prayer for an assessment of civil penalties pursuant to Section 2069 will also be dismissed. As defendant asserts, civil penalties provided for in 15 U.S.C Section 2069 can only be assessed by the government. Plaskolite, Inc. v. Baxt Industries, 486 F.Supp. 213 (N.D.Ga. 1980). Attorneys' Fees Since plaintiff's requests for reasonable attorneys' fees pursuant to sections 2072 and 2073 is dependent on the existence of plaintiff's claims for damages and injunctive relief, respectively, such requests will also be dismissed. STATE LAW CLAIMS Defendant asserts that the Court should exercise its discretion to dismiss plaintiff's state law claims in the event that plaintiff's federal claims are dismissed. However, defendant's argument is now moot since plaintiff has amended his complaint to assert diversity jurisdiction pursuant to Section 28 U.S.C. Section 1332. Accordingly, the court's jurisdiction over plaintiff's state law claims is proper. CONCLUSION For the foregoing reasons, the defendant's motion to dismiss [doc. # 5] is GRANTED in part and DENIED in part. Plaintiff's federal claims for damages pursuant to Section 2072, for injunctive relief pursuant to Section 2071, for an assessment of civil penalties pursuant to Section 2069; and for attorneys' fees pursuant to Sections 2072 and 2073 are dismissed. Plaintiff is instructed to file an amended complaint asserting only his state law claims in compliance with this ruling within 20 days of this ruling's filing date. So Ordered.

Accurate counts of helper T cells and related lymphocytes are critical in decisions about HIV status and antiretroviral therapies. Flow cytometry is the standard method of cell counting, but the majority of the 30 to 40 million infected people worldwide are in resource-limited areas and do not have access to these measurements. As a direct alternative, this project is developing a compact, low cost imaging instrument for HIV-related cell counting with a projected instrument cost of approximately $100. Through the Phase I grant and related funding, a prototype instrument and disposable cartridge for CD4 cell counting have been developed. Demonstrations with labeled cells were successful, and completion of a low cost instrument for absolute counts of helper T cells (CD4+) is on schedule for late 2009 - early 2010. This Phase II proposal describes plans to improve and expand the capabilities of the progress already achieved. Simple cartridge mechanics will significantly increase the total field of view, resulting in more cells being counted and better statistical accuracy. In addition to identifying CD4+ T cells, reagents and methods for counting cytotoxic T cells, B cells, monocytes, and lymphocytes will be tested and demonstrated with clinical samples. Reagents and surface coatings will be developed to allow simple sample preparation, without the repeated centrifugation associated with current flow cytometer methods of cell lysis, washing and staining. Clinical characterization of the instrument will be performed, providing feedback on the design and performance. At the conclusion of Phase II, a fieldable prototype instrument, cartridge, and procedure will be available for HIV-related cell counting with results that are comparable to current flow cytometry methods, and with a capital cost that is reduced by approximately 100-fold or more. PUBLIC HEALTH RELEVANCE: Accurate counts of helper T cells and related lymphocytes are critical in decisions about HIV status and antiretroviral therapies. HIV-infected people in resource poor countries have little or no access to appropriate cell counting, significantly affecting the use of antiretroviral therapies. The overall goal of this project is to develop a low cost, accurate system for HIV-related blood cell counting that can improve healthcare in developing regions.

Hierarchically arranged memory has been a common feature in computing for some time. Fundamentally, faster memory is more expensive per byte. Despite rapid advances in storage performance, it is often economically unsound to utilize only the lowest latency storage medium. Instead, in order to deliver acceptable performance within a fixed budget, storage devices of different sizes and speeds may be arranged so that memory transactions read or write to the fastest devices whenever possible. In a typical example, a hierarchical memory structure includes a main memory and one or more caches. The main memory is a large pool of storage, and, for reasons including cost, is often made up of relatively slow storage devices. The main memory defines the address space and thereby defines the limits of the available storage. However, portions of the address space may be mapped to a cache, a smaller memory pool typically utilizing a faster storage medium, so that transactions directed to mapped addresses can be read from and/or written to the faster storage medium. In multiple-tiered configurations, portions of the cache may be mapped to another cache made up of an even-faster storage medium. In many examples, memory structures include multiple caches, each utilizing progressively faster storage media. A number of techniques exist for determining which data to load in a particular cache. By effectively predicting data that will be the target of subsequent transactions, more transactions can be performed by the cache even when the cache is significantly smaller than the main memory. These techniques are grounded in a number of principles, such as the principles of locality. The principle of temporal locality suggests that data that has been accessed recently is likely to be accessed again. Accordingly, frequently accessed data is often cached. The principle of spatial locality suggests that data accesses tend to cluster around certain addresses. Accordingly, a range of addresses is often cached based on an access to an address within the range. However, these principles are merely guidelines. Because every application and computing task has a unique data access pattern, no particular caching algorithm is optimal for all applications. Instead, a balance may be struck based on the anticipated use or uses of a given computing system. Unfortunately, this balance may break down when the working data set of an application grows beyond a certain point. The overhead involved caching and writing back a large data set may diminish the performance gains expected from the cache. For example, storage systems, computing systems that process data transactions on behalf of other computing systems, are generally very cache-sensitive and often manipulate large data sets. This can be caused by the large numbers of transactions typically received by storage systems and the widely varying workloads depending on host activity. These effects and others make it extremely difficult to tune a single cache algorithm for all supported host applications. Accordingly, an efficient system and method for caching that is responsive to an application's working set has the potential to dramatically improve cache hit rate and system performance.

Dévaványa polgármestere elismerte a szeghalmi tűzoltók munkáját Ünnepélyes keretek között mondott köszönetet Dévaványa polgármestere azoknak a szeghalmi hivatásos tűzoltóknak, akik a nyár közepén megfékezték a Kéthalom majornál pusztító lángokat és több hőhatásnak kitett palackot helyeztek biztonságba. Valánszki Róbert felelevenítette a dévaványai káreseményt és kiemelte, a tűzoltók július 7-én hősiességükről tettek tanúbizonyságot. A polgármester ezután Bartis Márton, Garzó László, Kovács Zoltán, Szabó Gyula c. tű. főtörzsőrmestereknek, Györösi S. Máté tűzoltó őrmesternek, valamint Patai Sándor c. tű. zászlósnak ajándéktárgyat és oklevelet adott át. A szeghalmi tűzoltókat július 7-én kora hajnalban riasztották a Kéthalom majorhoz. A körülbelül százötven négyzetméteres épület tetőszerkezete teljes terjedelmében égett, a lángok berendezési tárgyakra és a bent tárolt éghető anyagokra is átterjedtek. A beavatkozók két fecskendővel és egy vízszállítóval érkeztek, három vízsugárral fékezték meg a tűz terjedését. Oltás közben öt hőhatásnak kitett palackot (egy argon-, egy propánbutángáz-, két oxigén- és egy dissous-palackot) hoztak ki a helyiségből. Az épület mellett tárolt oxigén-és dissous-palack szintén felhevült. A két dissous-palackot a Békés Megyei Rendőr-főkapitányság „Körös” Közterületi Támogató Alosztályának rendőre lőtte ki, a többi palackot a tűzoltók visszahűtötték. Nem sérült meg senki – ismertette az elhangzottakat a Békés Megyei Katasztrófavédelmi Igazgatóság. Tetszett a bejegyzés? Tetszik Betöltés...

After right-wing talk-radio host insulted CNN host Don Lemon not once, but twice, Republican Rick Wilson sat aghast. When Lemon allowed “I go back to this again, I’m curious that John doesn’t have any objection to Norwegian workers coming here to take high skilled high paying jobs,” Wilson said. “With a mysterous demographic characteristic I can’t put my finger on. But, you know, it goes back to a broader question, America is not a Volk, we are not a race of people. We are a proposition, we are an idea. We are a Constitution and a set of laws and principles and objectives that when you come here, if you buy into that system and play by the rules in that system, you are part of it. It is the American system, we are not based on a single demographic mix, and no matter what your flimsy economic excuses are about it.” ADVERTISEMENT He went on to say that there have been many changes in the economy, but that the “jobs being lost to automation” vastly outnumber the jobs being lost to immigration. “By orders of magnitude.” “It really comes down to that point where, if you believe in this country and the proposition of this country, then you’re color-blind to where people are coming from, if they come to this country, follow the law, play by the rules and enter the society to work hard and raise their families and embrace the American dream,” Wilson continued. “These are things that I know cause problems for people, like John, and for Donald Trump. And I know that they’re looking for many ways as many ways as they can tonight to excuse and why he says this thing. you know, about shIthole countries. It’s inexcusable. Indefensible.” Watch the full conversation below:

Comfort Those Who Mourn for U.S. Manufacturing If you read more consumer magazines than business-to-business titles like MH&L and IndustryWeek, it’s easy to conclude that America is in trouble when it comes to manufacturing competitiveness. That’s why we in the trades like to showcase the native talent of business people like you and your colleagues—not only to convince the world that the U.S. is still tops when it comes to industrial ingenuity, but to remind YOU. We all sometimes need spirit boosters to get us through a tough week, so I thought I’d conclude this week by boosting American manufacturing. IW, MH&L’s sister publication, just announced the winners of its 23rd annual "Best Plants Awards." This program salutes outstanding North American manufacturing facilities that are leading efforts to increase competitiveness, enhance customer satisfaction and create stimulating and rewarding work environments. The 2012 Best Plants, profiled in IW’s January issue, are (in alphabetical order): Patricia Panchak, IndustryWeek's editor-in-chief, says these companies set a high standard of performance and show that operational excellence continues to prosper in manufacturing. In addition to applauding them in print, IW will honor the winners during an awards ceremony at the 2013 IndustryWeek Best Plants conference, where the winners will also share their stories. This will happen April 22-24 in Greenville, SC. Pat asked me to help develop the supply chain track of this conference, and when I started thinking of manufacturers from the world of material handling to join the program, Crown was one of the first that came to mind. This material handling company, headquartered in New Bremen, Ohio, is not only family-run, but it designs and manufactures about 85 percent of its forklift components. While making arrangements for Crown’s participation I spoke with Jim Mozer, Crown’s senior vice president, about the value of vertical integration vs. outsourcing components. Take electrical components, for example. The reason Crown started making their own was that there were times when off-the-shelf components were not available in quantity or quality to meet their needs. The same principle applies to stampings, but there’s an interesting back-story to how Crown got into that, per Dave Beddow, Crown’s vice president of manufacturing operations—who’ll be going into further details at IW’s Best Plants conference. Seems the supplier for some of the company’s stampings went out of business on a Friday, leaving Crown at a critical point in its production process—at such a critical point that this lift truck maker sent its Advanced Manufacturing Group to the facility to assess the supplier’s assets and capabilities. As a result of that assessment, Crown decided to acquire the company. It then sent in a Quality Engineering Team to work over the weekend and get the company up and running as a Crown facility. Crown maintained the workforce and implemented its own quality systems. How was this cost justifiable? “Considering the time it takes to ramp a supplier up, educate them on our specific needs and the reliability and quality centers we have vs. doing it ourselves, sometimes it’s just easier for us to do it ourselves,” Mozer told me. “That way we have the confidence and control that it will meet our engineering standards. I would find it very hard to ramp an outside supplier up in a matter of days vs. just doing it ourselves.” Crown’s being a privately held family-run company meant this kind of decision could be made quickly, without having to approach shareholders. Another benefit of vertical integration is what it brings to talent development. Mozer says it gives employees a wider choice of opportunities, making it easier for them to navigate toward a career path and making it easier for Crown to hang onto talent. And when there are staff shortages during critical times, it’s easier to find cross-trained talent to fill those gaps. So the next time you hear someone crying about how China is eating America’s lunch when it comes to manufacturing capabilities, point them to IW’s Best Plants issue. If that teary discussion happens before April, suggest they go with you to the Best Plants conference. Then put a check mark next to that “do a good deed” item on your New Year’s Resolution list. Oh, and if you have your own success story to tell, there’s still time to be considered as a presenter in the supply chain track. Just contact me ([email protected]) and we can flesh out your story. If you get on the program it might take care of half of that resolution about becoming rich and famous. Discuss this Blog Entry 1 This is the third time in the last 25 to 30 years that I have seen manufacturing swing to lower cost labor areas. There was the Thailand/Burma/India period, the Mexican border period and now the China swing. In my opinion this is a normal economic cycle (hurts sometimes to live through it, but normal). A new region is opened with cheap land and labor and no environmental controls and manufacturers flock. With this said what winds up leaving the US is usually the commodity type products which in their product development cycle are fully mature and often on the verge of declining. For example textiles are gone. Cheap land, labor and little care for the environment means it will stay off-shore. That is except for specialty or new products which are in the accelerating growth part of their development or is too expensive logistically to import due to lack of quantity in its early stages. Put it in perspective. I remember paying $35 to $50 dollars for a pair of pants growing up. Today the same manufacturer 30 years later is selling the same jeans for around $25 to $30 a pair. This isn't magic. It's a commodity and it is easy to produce jeans in a low cost manufacturing region. Quality control on a pair of jeans isn’t the same as electronics or semiconductor. What you are seeing now is the new products out of R&D are being manufactured in the US. Plus the products, due to supply chain costs really weren’t cheaper to manufacture so far from its consumer market. Every $5 dollars that a barrel of oil increases is a major uptick in supply chain costs. Every quality control issue that “bubbles up” once sold to consumers is a major hit in the pockets to the manufacturers (Mattel and Boeing come to mind quickly). The real issue will be when the new “in” region or country of choice can consume as much product as we do in the US the dynamics will truly turn. However, I suspect this will lead to dual or triple region manufacturing as we see in many industries (automotive comes to mind). Welcome to today’s economic reality and cycle. You can run around calling it a disaster or problem. I prefer to call it opportunity.

6-Methyl-1,3,8-trichlorodibenzofuran (MCDF) as an antiestrogen in human and rodent cancer cell lines: evidence for the role of the Ah receptor. 6-Methyl-1,3,8-trichlorodibenzofuran (MCDF) is a relatively nontoxic analog of 2,3,7,8-tetrachlorodibenzo-p-dioxin. Treatment of aryl hydrocarbon (Ah)-responsive MCF-7 human breast cancer cells with 100 nM MCDF resulted in the inhibition of 17 beta-estradiol-induced proliferation and the secretion of the 34-, 52-, and 160-kDa proteins. After treatment of the cells with 17 beta-[3H]estradiol, 100 nM of MCDF caused a decrease in the accumulation of the radiolabeled nuclear estrogen receptor (ER) complex in these cells. In parallel experiments, the antiestrogenic effects of MCDF were also determined in Ah-responsive wild-type Hepa 1c1c7 cells and Ah-nonresponsive class 1 and class 2 mutant cells. Treatment of the wild-type cells with 17 beta-[3H]estradiol and 100 nM MCDF caused a decrease in the accumulation of radiolabeled nuclear ER complex in these cells whereas no significant effects were observed in the mutant cells as determined by velocity sedimentation analysis. Comparable results were obtained using ER antibodies to measure the decrease in immunoreactive nuclear ER. In addition, both actinomycin D and cycloheximide inhibited the MCDF-mediated decrease of nuclear ER levels in the Hepa 1c1c7 wild-type cells. Although 100 nM MCDF did not induce cytochrome P-450-dependent monooxygenases in the MCF-7 or Hepa 1c1c7 cell lines, incubation of nuclear extracts from the MCF-7 cells treated with 100 nM MCDF with a synthetic consensus dioxin responsive element (an oligonucleotide duplex of 26 bases) gave a retarded band in a gel-retardation assay. The data suggest that the antiestrogenic effects of MCDF does not require the induction of the CYP1A1 gene expression but may involve the induction of other genes.

Revisiting the estrogen receptor pathway and its role in endocrine therapy for postmenopausal women with estrogen receptor-positive metastatic breast cancer. Endocrine therapy (ET) is the most commonly administered first-line systemic therapy for estrogen receptor-positive (ER+) metastatic breast cancer (MBC). Manipulation of hormone levels was one of the earliest ET approaches. However, treatment modalities have since evolved with the growing understanding of estrogen biosynthesis and ER biology. The current armamentarium of ET includes selective estrogen receptor modulation, aromatase inhibition, and selective estrogen receptor downregulation. However, intrinsic or acquired resistance to ET is frequently observed. Significant strides have been made in recent years in our understanding of the mechanisms of resistance to ET, and several targeted approaches including inhibitors against the phosphatidylinositol 3-kinase/mammalian target of rapamycin (PI3K/mTOR) pathway and cyclin-dependent kinase 4/6 (CDK4/6) have shown great promise. The mTOR inhibitor, everolimus, is already in clinical use for the treatment of resistant ER+MBC. However, multiple levels of evidence indicate that ER signaling remains as an important therapeutic target even in the resistance setting, providing the rationale for sequencing multiple lines and combinations of ET. In addition, recurrent mutations in estrogen receptor 1 (ESR1), the gene that encodes the ER, have been identified in the genomic studies of metastatic ER+ breast cancer. ESR1 mutations are an important mechanism for acquired resistance, and effective ER targeting in this setting is particularly important.

December 14, 2013 The intuitive mind is a sacred gift and the rational mind is a faithful servant. We have created a society that honors the servant and has forgotten the gift. Albert Einstein It’s often said that things happen for a reason. It’s often said that we adapt to the result with which we’re faced with at any given time. This is not a work thing, it’s a life thing. We create what we want – even when it doesn't feel like it. Our energy pulls in what we focus on which can be what we want or what we don't want. As children, one of the first words we learn is "no". Words such as; yes, imagine, how, create, come much later which may be why we gravitate to "can't" far too often. That may be why we first hear no in our minds soon after the idea. As leaders, we need to make sound decisions, but nothing is guaranteed so there is always be a chance of a misstep. But taking chances is where growth thrives. First Impressions Malcolm Gladwell talks about that feeling you get in your gut when you know you’re right in his book Blink. It happens to all of us. We sense there’s an opportunity, we feel it’s a good one, and then justify the reasons not to act. Our reflection then creates the "I knew it!" moment. We have to be careful not to build in failure at the design stage then work toward fulfilling that prescribed inevitability. What we need to do is learn from past challenges but focus on successes. Food for thought for the next time you get that nagging urge to act yet find some excuse stop yourself.

Greetings, Here is an update on my heavy cavalry. En avant! Noble cuirassiers, reminding us of the burgundian knights of old...... lördag 12 maj 2012 Reporting in Hello everyone! I have just returned from a visit to the great capital city of the Kingdom of Sweden. Stockholm. I've been at the Royal palace, training for my upcoming work there this summer. I will be working through june, july and half of august but I will bring some stuff to model and paint while I'm away from my beloved Västerbotten and Umeå. Hopefully I'll be able to update from Stockholm with some extra posts about the historical city. I just thought that you should know what's going on, there will be more updates next week we assure you. About our blog Welcome! We are two wargaming gentlemen from the north of Sweden named Anders Agdahl the younger, and Anders Agdahl the elder. On this weblog we will share our thoughts document our modeling and wargaming. If you wish to contact us, please send us an e-mail: ploughshares.to.swords[at]gmail.com

Rafael Benítez’s side have secured promotion to the top tier but plenty of questions remain about the future direction of the club Rafael Benítez and Newcastle United are back in the Premier League – but have they underachieved or overachieved this season? And, most importantly, what happens now? Why did it take so long to confirm promotion? Given that Benítez invested £55m in 12 players last summer (although he achieved a £30m transfer profit after raising £85m in sales from his newly relegated squad) many neutrals expected Newcastle to be up by March at the latest. In contrast, those with intimate knowledge of the Championship believe Benítez has worked wonders, fully earning his £5m-a-year salary. They point out that, during the previous five seasons, only one side, Burnley, have secured immediate automatic promotion the year after dropping out of the Premier League. Chris Hughton, who has taken Brighton up and also won the Championship with Newcastle in 2010, ranks among those who believe the second tier is infinitely tougher than seven years ago, with players considerably fitter and, thanks to advances in match analysis techniques, managers better prepared tactically. Rafael Benítez puts owner Mike Ashley on notice after Newcastle are promoted Read more The Tyneside challenge was further complicated by the reality that opponents viewed trips to St James’ Park, with its invariable 52,000 full houses, as “cup finals” and raised their game accordingly. Visitors also tended to turn up in packed defence mode, which does not suit either Newcastle’s or their manager’s preference for playing on the counterattack. Will the club be sold in the coming weeks? Watch this space. It is quite possible that nothing will happen and Newcastle simply continue under Mike Ashley’s ownership but senior club sources acknowledge that there has been discreet interest from assorted parties in recent months. If – and it is only an if – a takeover does happen, expect it to be as sudden and unexpected as Manchester City’s switch to Emirati control. Possible buyers? Well, the state of Qatar is reportedly weighing up purchasing a Premier League club and rumours of Chinese interest refuse to disappear. Ashley would demand a high price, and is sufficiently contrary to suddenly decide to keep the club, but purchasers are attracted by those 52,000 crowds, Newcastle’s international reach – the former chairman Freddy Shepherd may have exaggerated slightly when he once claimed his was the world’s eighth most popular team but the club are undeniably high profile – their rare city-centre location in a regional capital and, of course, the transformative presence of Benítez. Will Benítez stay? The million-dollar question. In January – when Ashley refused to allow his manager to buy the winger and central midfielder he craved – the former Liverpool and Real Madrid manager indicated he could well depart this summer. Benítez, long admired by, among others, West Ham United, would not lack offers but the January frosting of relationships has long since thawed. Indeed, harmony is said to now be restored, with two recent transfer summits to discuss summer spending having proceeded “positively”. Facebook Twitter Pinterest Rafa Benítez has plenty of admirers at other clubs. Photograph: Adam Davy/PA Critically, the manager appears to have regained charge of recruitment, with the influence of Graham Carr, the once powerful chief scout who has Ashley’s ear, much diminished. The big concerns are that Benítez and Ashley rarely speak directly and that the former is keener on buying the odd player older than 25 than the latter. Benítez’s affection for the club and the city runs deep and he would like nothing better than to stay at St James’ Park, win a trophy and take Newcastle back into the Champions League – but he is not a complete romantic and will walk if things are not to his liking. The problem is Ashley and the Spaniard like to be in control, and Benítez is perhaps far too practised a political operator for the owner’s comfort. Last summer Ashley’s edict to club staff was: “What Rafa wants, Rafa gets” but the mood music is no longer quite the same. How important is the manager staying to the club’s future? They say no one is indispensable but Newcastle fans would tell you that Benítez is the exception to the rule. His amalgam of tactical shrewdness, smart man management and genuine warmth – (long term “Rafaology” students say he is revealing his “human side” much more these days) – have helped re-connect previously fractured bonds, between club, supporters and city. A regular at football related community events on Tyneside, Benítez has invested the job with the sort of class and dignity not seen since Chris Hughton’s days at St James’ Park. Significantly his CV dictates he possesses the sort of “pulling power” capable of attracting some of Europe’s best players to Newcastle but will Mike Ashley facilitate a top tier “Rafalution”? The Spaniard is clearly not quite sure as, with promotion secured, the politics have begun in earnest. “You never know,” he said when asked on Monday night to confirm he would still be in charge come August. “That is football. I’m really pleased to be here. Hopefully we can put in the foundations for something that will be a guarantee for the future. I am sure if we do the right things, we can prepare everything to be strong enough for the Premier League.” The subtext will not be lost on Ashley. Does the squad need overhauling? Most definitely. Benítez bought players specifically to win promotion but if he is to keep the team in the top division, let alone achieve his ambition of taking Newcastle back into Europe, major surgery will be required. It has been agreed that a minimum of six recruits are needed, with a centre-half, a left-back, a holding midfielder, a creative midfielder, a winger and a couple of strikers looming large on the managerial shopping list. Who might Benítez buy? Time will tell but there are a few clues to be going on with. Bas Dost, the prolific Sporting Lisbon player, is a striker he tried to sign last summer and could do with now – but the Dutchman would not come cheap. Carr, incidentally, is also a Dost fan, having urged Ashley to buy him for years. Swansea City’s Gylfi Sigurdsson is another at the pricey end of the radar, while Crystal Palace’s Andros Townsend returning to Newcastle seems a real possibility. Hull City’s midfielder Sam Clucas and their centre-half Harry Maguire have been scouted by Newcastle and Benítez is said to also like the Stoke City defender Ryan Shawcross as well as Middlesbrough’s Ben Gibson. Facebook Twitter Pinterest Could a return for Andros Townsend be on the cards? Photograph: Lindsey Parnaby/EPA Further forward, a move for Liverpool’s Daniel Sturridge has been discussed and Newcastle have conducted background checks on the character of Burnley’s principal striker, Andre Gray. Benítez remains very enthusiastic about the creative midfield talents of Fulham’s Tom Cairney and Manchester City’s Fabian Delph has been mentioned but the second ruptured cruciate ligament sustained by the Bournemouth striker Callum Wilson may remove him from the equation, scuppering a long-mooted move. Newcastle United crush Preston North End to seal return to Premier League Read more Who from the existing team should prosper in the Premier League? Jonjo Shelvey, Matt Ritchie and Ciaran Clark. Isaac Hayden could also develop into a useful top-flight midfielder and Karl Darlow surely deserves a chance in goal. After scoring so many goals, Dwight Gayle, too, should play a part but it is not entirely inconceivable that he could be sold on for a profit to fund signings. Expect plenty of departures, however. Will Benítez be able to take Newcastle back into Europe? Why not? Europe represents the Spaniard’s natural habitat and an arena he feels Newcastle should be competing in. But, barring a takeover, it all depends on the scale of Ashley’s vision.

41 F.3d 480 UNITED STATES of America, Plaintiff-Appellee,v.Joshua William SANDERS, Defendant-Appellant. No. 93-10780. United States Court of Appeals,Ninth Circuit. Argued and Submitted May 13, 1994.Decided Nov. 23, 1994. Ann C. McClintock, Asst. Federal Public Defender, Sacramento, CA, for defendant-appellant. Miguel Rodriguez, Asst. U.S. Atty., Sacramento, CA, for plaintiff-appellee. Appeal from the United States District Court for the Eastern District of California. Before: GOODWIN, POOLE, and REINHARDT, Circuit Judges. Opinion by Judge GOODWIN; Partial Dissent by Judge REINHARDT. GOODWIN, Circuit Judge: 1 Joshua William Sanders appeals his conviction and sentence on two counts of mailing a threatening communication. 18 U.S.C. Sec. 876. He argues that the district court erred: (1) in concluding that his offense did not constitute a "single instance evidencing little or no deliberation," U.S.S.G. Sec. 2A6.1(b)(2); (2) in failing to notify him that it intended to reject the presentence report's recommendation on Sec. 2A6.1(b)(2); (3) in adding two points to his criminal history score for juvenile offenses; and (4) in inadequately informing him of the consequences of changing his plea. We affirm. I. 2 In April, 1990, Sanders wrote two "letters" consisting almost entirely of racial epithets and derogatory language. He addressed the first of these letters to "N.I.G.G.E.R.S." and mailed it to the Fairfield chapter of the National Association for the Advancement of Colored People ("the NAACP"). On the envelope, Sanders wrote "Watch out this might be a letter b____," "die," "go back to Africa," and other derogatory remarks. In the letter itself, Sanders drew a caricature of an African-American person and wrote a variety of racial slurs. 3 Sanders addressed the second letter to "Jewish Pussy's" [sic] and mailed it to the B'Nai Avraham Jewish Congregation in Fairfield ("the Jewish Congregation"). He decorated the envelope and letter with various anti-Semitic drawings, threats, and offensive phrases. 4 Both letters bore the return address, "Fairfield W.A.R." (i.e. White Aryan Resistance), and a Fairfield post office box registered to Sanders. The handwriting matched Sanders'. After FBI agents confronted Sanders with the match, Sanders admitted sending both letters, explaining that he had written and mailed both letters early one morning while drunk. 5 Sanders was charged with two counts of mailing a threatening communication, a felony, 18 U.S.C. Sec. 876, and one count of interfering with housing rights, a misdemeanor, 42 U.S.C. Sec. 3631(a). The misdemeanor charge alleged that the NAACP office which received Sanders' first communication was also the chapter president's home. 6 Sanders initially pled guilty to Count I, mailing a threatening communication to the Jewish congregation, and Count III, interfering with housing rights.1 Based on this plea, the presentence report calculated a sentence range of ten to sixteen months and recommended a sentence of five months in custody, five months in community confinement, and three years of supervised release. However, the report also expressed an opinion that, had Sanders pled guilty to Counts I and II (the two felony mailing a threatening communication charges), rather than to Counts I and III, the applicable guidelines range would have been six to twelve months and Sanders would have been eligible for straight probation. 7 Sanders therefore moved to withdraw his guilty plea and substitute a new guilty plea to Counts I and II, the two felony counts of mailing a threatening communication. The government opposed this motion. However, the district court allowed Sanders to withdraw his plea, expressing concern about the misdemeanor's factual basis and noting that the government had not presented any evidence that Sanders knew that the NAACP office was a private residence. Sanders then pled guilty to the two felonies. 8 A revised presentence report calculated a guidelines range of six to twelve months and recommended that Sanders serve two months imprisonment, six months community confinement, and three years supervised release. The revised report also recommended that Sanders receive a four-level reduction in offense level because his offense "involv[ed] a single instance evidencing little or no deliberation." U.S.S.G. Sec. 2A6.1(b)(2). After full briefing and a hearing on the issue, however, the district court denied Sanders the four-level reduction, resulting in a guidelines range of fifteen to twenty-one months. The court sentenced Sanders to two concurrent fifteen-month prison terms followed by three years of supervised release. 9 II. Sec. 2A6.1(b)(2) REDUCTION FOR A SINGLE INSTANCE EVIDENCING LITTLE OR NO DELIBERATION 10 Sanders first challenges the district court's refusal to award him a four-level reduction under U.S.S.G. Sec. 2A6.1(b)(2). We review the district court's interpretation of the relevant guidelines de novo, accepting its underlying factual findings unless clearly erroneous. United States v. McAninch, 994 F.2d 1380, 1383 (9th Cir.), cert. denied, --- U.S. ----, 114 S.Ct. 394, 126 L.Ed.2d 342 (1993). United States v. Fine, 975 F.2d 596, 599 (9th Cir.1992) (en banc). A. Single Instance 11 The district court found that Sanders' conduct did not constitute a "single instance" within the meaning of Sec. 2A6.1(b)(2) because "enough distinguishes [the letters'] preparation and mailing that they cannot be described as comprising one 'instance.' " Sentencing Memorandum at 5 (Dec. 2, 1993). In particular, the court noted that the letters were 12 addressed to two different groups of victims, they were sent to different locations, they were deposited in different mail boxes, the contents of each letter differed significantly, both were specifically tailored to the different racial or religious characteristics of the groups of intended victims, and each letter contained a different threat of violence. 13 Id. at 5-6. 14 Sanders argues that the district court misinterpreted the Guidelines, construing "single instance" as "single threat" rather than "single episode." He relies primarily on United States v. Pacione, 950 F.2d 1348, 1356 (7th Cir.1991), cert. denied, --- U.S. ----, 112 S.Ct. 3054, 120 L.Ed.2d 920 (1992), in which the defendant twice threatened an IRS agent over the phone and then went to the IRS office an hour later and (according to a bystander) told his friend that he was going to blow up the IRS office. Id. at 1351. Sanders emphasizes that Pacione received the Sec. 2A6.1(b)(2) reduction, despite making multiple threats, and cites the case as an indication that "offense conduct that involves multiple illegal acts may still involve a 'single instance evidencing little or no deliberation' within the meaning of Sec. 2A6.1(b)(2)." Pet.R'hg at 9. According to Sanders, his conduct, like Pacione's, took place over a few short hours and thus constitutes a "single instance" of misconduct, even if it involved several threats. 15 While Pacione is the only published circuit opinion addressing a Sec. 2A6.1(b)(2) reduction,2 the case is hardly controlling. The Seventh Circuit did not address the validity of the Sec. 2A6.1(b)(2) reduction, merely mentioning the reduction in passing in discussing an unrelated issue. See Pacione, 950 F.2d at 1356. Thus, contrary to Sanders' arguments, the Seventh Circuit did not affirm Pacione's Sec. 2A6.1(b)(2) reduction or hold that Pacione's conduct constituted a "single instance evidencing little or no deliberation." 16 Nonetheless, we agree that "single instance" does not necessarily mean "single threat" and that conduct involving several threats may constitute a single instance or episode within the meaning of Sec. 2A6.1(b)(2). As Sanders argues, several related threats, depending on the circumstances, may comprise a single episode of threatening conduct. 17 However, the mere fact that Sanders' conduct took place within a short time span does not automatically mean that his offense comprises a "single instance." "Single instance" connotes not only a temporal relationship, but also a "single purpose" or "single scheme." Especially when considered together with the "little or no deliberation" requirement, the term suggests that the reduction should apply to defendants whose threats are the product of a single impulse, or are a single thoughtless response to a particular event. 18 Thus, the "single instance" reduction might not be required where a defendant made several unrelated threats, involving several different victims, even if these threats occurred within a relatively short period of time. The reduction might not apply, for example, where a defendant, within a few hours, but for unrelated reasons, threatened both his ex-wife and a business associate. Likewise, it might not apply where the defendant made a number of similar threats over an extended period of time, as in Bellrichard, 801 F.Supp. at 265. 19 In contrast, the reduction might apply in cases such as Pacione, where the defendant threatened a single victim several times within a very short period of time, reacting throughout the misconduct to a single stressful event--in Pacione's case, the IRS's decision to levy his wife's paycheck during her hospitalization for lung cancer. Pacione's threats were all a response to one particular traumatic situation and they were all made over a short period of time.3 20 In contrast, Sanders' conduct, while it took place over a period of a few hours, has no such "single motive." He targeted two separate groups, based on two separate sets of prejudices, and two separate sets of motives. Although both letters express racial hatred, writing two letters to two different groups and tailoring each letter to the particular religious or racial characteristics of the group suggests less a "single instance" of aberrant conduct and more a chronic tendency to threaten persons because of their group membership. The district court did not clearly err in finding that Sanders' conduct did not involve a single instance of misconduct or that his two letters constituted two instances, separated not by time, but by victim. B. Little or No Deliberation 21 Nor did the court err in finding that Sanders' conduct evidenced deliberation. According to the court, 22 [t]he contents of the writings themselves demonstrate that some deliberation went into their preparation. Moreover, [Sanders] selected two distinct groups of victims, he selected them for their race and religion, and he tailored the contents of his letters to their race and religion. [He] then obtained the victims' addresses, attached proper postage, and deposited the two letters in two different mail drop boxes. These actions show a deliberate thought process rather than an impulsive action. 23 Sentencing Memorandum at 7 (citing Bellrichard, 801 F.Supp. at 265). 24 Sanders alleges that the district court inferred deliberation from the ordinary and essential steps involved in mailing a letter. According to Sanders, under the district court's interpretation of deliberation, a defendant convicted of a 18 U.S.C. Sec. 876 violation could never receive a Sec. 2A6.1(b)(2) reduction, as mailing a threatening communication necessarily involves addressing an envelope, affixing postage, and mailing a letter. 25 We agree that the mere act of mailing a letter does not, in and of itself, necessarily require deliberation. We also agree that the contents of Sanders' letters do not evidence "deliberation" in the sense of intelligent thought--on the contrary, Sanders' offensive racial epithets and caricatures demonstrate an obvious lack of thoughtful consideration. 26 However, we cannot say as a matter of law that Sanders' letters show "little or no deliberation." Sanders did not just mail a note to a familiar address stating "I am going to kill you." He looked up addresses of particular organizations and selected particular victims. His letters, while relatively short, contain a variety of racist and anti-Semitic statements and drawings, tailored to each of his particular victims. These statements are calculated to frighten and upset two particular groups of victims and to imply that they should take his threats seriously. Sanders' use of group insults and references to white supremacy groups suggests an intent to frighten numerous persons. Although writing such letters certainly does not require intelligent thought, it requires some time and attention. 27 The district court did not clearly err in finding that Sanders' conduct showed deliberation. While "thought" may not be the most accurate characterization of Sanders' mental effort, the circumstances of the letters showed some planning and a clear intent to harass the target groups. 28 III. NOTICE OF INTENTION TO REJECT THE PRESENTENCE REPORT 29 Sanders also contends that the court failed to notify him that it intended to depart from the presentence report's recommendation concerning Sec. 2A6.1(b)(2). As he notes, U.S.S.G. Sec. 6A1.3(a), p.s. requires sentencing courts to give parties "an adequate opportunity to present information" regarding "any factor important to the sentencing determination [which] is reasonably in dispute." Moreover, Sec. 6A1.3(b), p.s. requires courts to "resolve disputed sentencing factors in accordance with Rule 32(a)(1), Fed.R.Crim.Pro ..., notify the parties of its tentative findings and provide a reasonable opportunity for submission of oral and written objections before imposition of sentence." See also United States v. Brady, 928 F.2d 844, 847 (9th Cir.1991) (defendant must have notice that the court intends to depart from the presentence report's recommendation); United States v. Nuno-Para, 877 F.2d 1409, 1415 (9th Cir.1989). 30 Sanders contends that he did not learn of the district court's intention to reject the presentence report recommendation until "the close of sentencing." Appellant's Br. at 13. However, the district court first questioned the applicability of Sec. 2A6.1(b)(2) at Sanders' change of plea hearing, more than a month before sentencing. Tr. Nov. 10, 1993 at 8. At this hearing, the government specifically indicated that it would oppose a reduction based on Sec. 2A6.1(b)(2) and argued both that Sanders' conduct constituted "two separate instances" and that "there was a great deal of thought taken to make these threats." Id. at 12. Before sentencing, both parties filed briefs on the relevance of Sec. 2A6.1(b)(2) and argued the issue to the court. 31 Thus, even if the district court failed to issue "tentative findings" before sentencing, Sanders had ample notice and an opportunity to litigate the Sec. 2A1.6(b)(2) issue. Cf. United States v. Palmer, 946 F.2d 97, 100 (9th Cir.1991). Any error was harmless. 32 IV. CRIMINAL HISTORY POINTS FOR JUVENILE OFFENSES 33 Sanders next challenges his criminal history score, contending that the district court erred in adding two points for juvenile offenses. The district court accepted the presentence report's recommendation that Sanders receive one point for a 1987 California juvenile court decision declaring him a ward of the court, and one point for a 1988 decision "continuing" his wardship.4 We review de novo a district court's determination that a prior adjudication falls within the scope of the Sentencing Guidelines. United States v. Robinson, 967 F.2d 287, 292 (9th Cir.1992). 34 Sanders does not dispute the fact of his juvenile adjudications, but contends that they are not convictions within the meaning of the Guidelines. As he notes, under U.S.S.G. Sec. 4A1.2(a)(1), a prior sentence "counts" for criminal history purposes only if it was "imposed upon adjudication of guilt, whether by guilty plea, trial, or plea of nolo contendere." See also United States v. Booten, 914 F.2d 1352, 1354 (9th Cir.1990) (defendant must have been adjudged guilty). The government bears the burden of proving the fact of a prior conviction. United States v. Newman, 912 F.2d 1119, 1122 (9th Cir.1990). 35 As Sanders argues, a California juvenile adjudication is not a "conviction." See In re Asean D., 14 Cal.App.4th 467, 17 Cal.Rptr.2d 572, 577 n. 11 (1993). However, a child may be declared a ward of the court as a "law violator" only after the government shows "beyond a reasonable doubt" that the child has violated a criminal law. Cal.Welf. & Inst.Code Sec. 701. Thus, Sanders' first juvenile adjudication, in which the court declared him a ward of the court, involved an adjudication of guilt and may be used in calculating his criminal history. Booten, 914 F.2d at 1355. 36 However, a California juvenile court may modify a wardship order without a subsequent adjudication of guilt. In re Glen J., 97 Cal.App.3d 981, 159 Cal.Rptr. 148, 151 (1979). Thus, Sanders' second juvenile adjudication, in which the California court "continued" Sanders' wardship, did not necessarily involve an adjudication of guilt. Absent proof that the California juvenile court found Sanders guilty beyond a reasonable doubt, the adjudication may not be used to increase Sanders' criminal history score. 37 We must remand for resentencing unless "the record as a whole, [reveals] that the error was harmless, i.e. that the error did not affect the district court's selection of the sentence imposed." Williams v. United States, 503 U.S. 193, ----, 112 S.Ct. 1112, 1121, 117 L.Ed.2d 341 (1992) (interpreting 18 U.S.C. Sec. 3742(f)(1)); see also United States v. Rodriguez-Razo, 962 F.2d 1418, 1423-25 (9th Cir.1992) (noting that this standard imposes an "exacting burden" on the party defending the sentence). 38 Subtracting one point from Sanders' criminal history score will not change Sanders' criminal history category or the applicable guidelines range: Sanders' previous score was five5 and Category III includes scores four though six. U.S.S.G. Ch. 5, Pt. A. Thus, with or without the contested point, Sanders' sentencing range is fifteen to twenty-one months. The district court sentenced Sanders to fifteen months, the minimum under the Guidelines. Nothing in the record suggests that the court would have (or could have) imposed a lighter sentence absent the error. Thus, the error was harmless and a remand is unnecessary. Cf. United States v. Rutledge, 28 F.3d 998, 1003 (9th Cir.1994). V. GUILTY PLEA 39 Finally, Sanders contends that the district court failed to warn him of the consequences of pleading guilty to the two felonies. Fed.R.Crim.P. 11(c)(1). He does not challenge the factual basis of his convictions, and specifically concedes that both letters contained a "threat" within the meaning of 18 U.S.C. Sec. 876. Rather, he emphasizes that the presentence report led him to believe that changing his plea would reduce his sentence.6 40 However, before accepting Sanders' change of plea, the district court specifically advised Sanders that "there are no assurances as to what the Guidelines will be on the two felonies." Tr. Nov. 10, 1993 at 17-18. The court also warned that it "might even find for some reason that because there are two felonies, the Guidelines are higher than they would have been for the misdemeanor and the felony." Id. 41 Sanders did not challenge the validity of his plea in the district court and has thus waived any objections except those which fall within one of the narrow exceptions to the waiver rule or constitute plain error. United States v. Flores-Payon, 942 F.2d 556, 558-60 (9th Cir.1991). Sanders has shown neither. Because the presentence report is not prepared until after the defendant pleads guilty, a court cannot "inform [a] defendant of the minimum sentence available under the guidelines" before accepting his plea. United States v. Maree, 934 F.2d 196, 200 (9th Cir.1991). While Sanders' disappointment is understandable, he has not shown plain error. 42 AFFIRMED. REINHARDT, Circuit Judge, dissenting in part: 43 Unlike the defendant in Pacione, Joshua Sanders fails to present a particularly sympathetic figure. His threats were not the product of traumatic family illness, and his victim was not an insensitive IRS agent. Rather, Sanders was drunk and motivated by racial animosity. Although Sanders' conduct may evoke considerably less compassion and pity than that of the Pacione defendant, he is equally deserving of a lawful sentence for his crime and a fair application of the sentencing guidelines to his criminal conduct. 44 I disagree with the majority's and the district court's conclusion that Sanders was not entitled to a four-level reduction in offense level at sentencing. In my opinion, the determination that Sanders' illegal acts did not constitute a "single instance evidencing little or no deliberation" is based on a misinterpretation of Sec. 2A6.1(b)(2) of the Sentencing Guidelines. 45 I would point out preliminarily that our disagreement over the proper interpretation of the Sentencing Guidelines in this case exemplifies the complexity inherent in applying the Guidelines, and the predicament that this complexity poses for defendants. The government's presentence report originally suggested that if Sanders pled guilty to two felonies, rather than a felony and a misdemeanor, he would have a lower offense level and thus a lower sentence. In light of the report, and on the advice of counsel, Sanders withdrew his guilty plea to the misdemeanor and pled guilty to the second felony, believing that by doing so he could reduce his time of imprisonment from five months to probation only.1 He ended up being sentenced to 15 months instead. This occurred only because at the original sentencing hearing, no one--not the judge, nor either counsel--could predict with any accuracy what would be the ultimate consequence of Sanders' change in plea. The Guidelines are too complicated for that. As the district court explained to Sanders, both with candor and with some degree of prescience, "I wouldn't expect you to understand [the Guidelines] because judges and lawyers argue about them all the time."2 46 Although the Guidelines were enacted in reaction to the supposedly arbitrary and unpredictable results of the prior unregulated sentencing regime, the treatment of the defendant here shows that application of the Guidelines can easily produce results that are at least as arbitrary and unpredictable. Certainly, few would suggest that the manner in which the proceedings were handled here was fair or equitable. Nor in all candor, I must add, is such a state of affairs unusual in the Guidelines era. 47 The majority finds that the phrase "a single instance evidencing little or no deliberation," as used in Sec. 2A6.1(b)(2), is not broad enough to cover a drunken individual's writing of two short and remarkably similar hate letters during a brief time period. I disagree. A Single Instance 48 In declining to extend Sanders the "single instance" reduction, the district court apparently interpreted the word "instance," as meaning "threat," rather than "episode." Although the majority concedes that "single instance" may be broad enough to include a single episode of conduct encompassing more than one discrete threat, it concludes that the term must be evaluated with reference to the motivation of the threats as well as the time span in which they occurred. It then engages in a bit of artful appellate fact-finding and determines that two separate motivations underlay Sanders' actions. By doing so, the majority slices the cheese far too thin as far as I am concerned. Sanders' two letters are clearly linked by motivation as well as time, and, in my view, constitute a single incident. 49 After returning home at night drunk, Sanders wrote the two hate letters at the same time, mailed them on the same trip to town, and was asleep by 3 or 4 a.m. All of the relevant conduct occurred within a very brief period. Moreover, the letters were the product of a single impulse to vent feelings of bigotry. Both letters contained swastikas and slurs, and the envelopes contained equally simplistic derogatory phrases. The puerile and stick-like drawings inside could each have been drawn by the same third grader. 50 Sanders' choice of a Fairfield synagogue and the Fairfield NAACP was closely related: they were both representatives of a threat to "Aryan supremacy." Although Jews and African-Americans are two distinct social groups, it is highly artificial, as well as suppositious, to suggest that Sanders' derogation of these two groups was "based on two separate sets of prejudices, and two separate sets of motives." Maj. op. at 14353. Sanders was hardly sophisticated enough to have two separate sets of thoughts. However, if we wish to ignore the content of his pitiful writings and pretend that he was indeed a sophisticated being, then we must recognize that both of the involved groups share the common link of being non-Aryan, and that Sanders' letters were motivated by a singular desire to express his animosity towards "inferior" or non-Aryan peoples. 51 The majority attempts to minimize the commonality of Sanders' letters by emphasizing that the letters show a "tailoring ... to the particular religious or racial characteristics of the group." The term "tailoring" connotes a kind of careful crafting, an attention to detail and fit. Again, the majority writes as if we were dealing with a thinking person and a rational pair of letters. That is far from the case.3 The abstract and careful analysis that the majority purports to apply to the two idiotic messages, and the rationality and intellectual conduct that it imputes to the defendant, have nothing to do with what actually occurred. The facts are plain and simple. A drunken boor sat down and unthinkingly wrote two hate letters that delivered the same ugly message. He engaged in no subtle analysis and performed no "tailoring." To him, African-Americans and Jews were the same. To say that these unfortunate messages were tailored to the racial or religious characteristics of the recipients not only ignores the nature of the defendant's ramblings, but requires us to engage in an abstract parsing of the ambiguous and cumbersome sentences of the Guidelines. All that is accomplished by these futile and contrived intellectual exercises is to sustain a result, and a sentence, that is just plain wrong. Significant Deliberation 52 The district court examined the defendant's conduct in sending the letters, and dissected that conduct into all of its constituent steps. Having done so, and having found several steps with respect to each letter, the court found "significant deliberation" as to each. However, under this scrutiny, the mailing of any letter would be the product of significant deliberation. Any letter requires writing something, selecting the addressee, finding the addressee's address, attaching a stamp, and putting it in a mailbox. Because 18 U.S.C. Sec. 876 prohibits the mailing of a threatening communication, the steps enumerated by the district court are merely the essential and ordinary ones for a violation of the statute. 53 Recognizing that the district court's argument proves too much, the majority attempts to bolster the deliberation finding by dissecting the constituent steps of delivering any threat, and declares that these steps demonstrate "time and attention." For every threatening communication, the defendant must "select" a victim and make some statement designed to upset and elicit fear from the recipients. It seems clear, therefore, that at a minimum deliberation for purposes of Sec. 2A6.1(b)(2) requires some showing beyond the deliberation inherent in any intentional threat, and that the majority's rationalizations do not cure the district court's error. 54 Moreover, there is no reasonable basis for concluding that any element of Sanders' behavior satisfied even the erroneous definition of "deliberation" established by the majority. Sanders was drunk and angry, and hardly in a deliberative state. The letters were handwritten, extremely short, full of misspellings,4 and contained epithets typical of outbursts of bigotry. They were clearly the product of no deliberation at all.5 55 To stretch the law as the district court did in this case, and as the majority now does also, makes no practical sense. We send a young person to prison for 15 months for getting drunk and, in his drunken stupor, mailing two irrational hate letters. The defendant's state of mind at the time he committed the offense may best be demonstrated by the fact that he affixed his return address to both missives. Surely, there are more sensible ways for society to deal with this young defendant's conduct; surely, there are better ways to try to rehabilitate him and try to make of him a useful citizen; surely, we should at least first try to teach him that, if not soon cured, his bigotry will be the cause of his own destruction rather than the destruction of the groups he stupidly despises; and surely there must be better uses for our prisons, which are already more than filled to capacity and are on the verge of exacerbating our local, state, and federal governments' economic distress to the breaking point. 56 In part the error in this case lies in the district judge's construction of the Guidelines--in part it lies in the refusal of my colleagues to treat his error in the manner required by law. The most fundamental problem of all, however, lies with the Sentencing Guidelines, and their attempt to set rigid standards that in the end produce far more confusion and unfairness than existed prior to their adoption. Only Congress can correct that fundamental problem, and regrettably there is little reason to believe it will. 57 I therefore dissent in part and concur in part.APPENDIX 58 NOTE: OPINION CONTAINS TABLE OR OTHER DATA THAT IS NOT VIEWABLENOTE: OPINION CONTAINS TABLE OR OTHER DATA THAT IS NOT VIEWABLE 1 In return, the government agreed not to oppose a reduction for acceptance of responsibility or a four-level decrease for a "single instance evidencing little or no deliberation." U.S.S.G. Sec. 2A6.1(b)(2) 2 The only other published cases even mentioning Sec. 2A6.1(b)(2) are United States v. Lowenstein, 1 F.3d 452, 453-54 (6th Cir.1993) (affirming an upward departure where the defendant wrote a huge volume of threatening letters); United States v. Jimenez-Otero, 898 F.2d 813, 814 (1st Cir.1990) (affirming an upward adjustment under Sec. 2A6.1(b)(1) for an "offense involv[ing] any conduct evidencing an intent to carry out such threat" where the defendant brandished a screwdriver while making the threats); United States v. Bellrichard, 801 F.Supp. 263, 266 (D.Minn.1992) (denying a Sec. 2A6.1(b)(2) reduction where the defendant wrote a number of letters to several different victims) 3 Sanders assumes that Pacione's misconduct covered at least an hour, because a bystander testified that one hour after the threatening phone call, Pacione was at the IRS office telling his friend that he was going to blow up the IRS office. However, nothing in the opinion indicates that the district court found that this statement was threat, that it was made in the presence of the IRS agent, or that it was anything but a private expression of anger. Thus, Pacione may have been sentenced solely for the two threats made during the phone call 4 According to the presentence report, the first incident involved "petty theft [and] possession of a knife," and the latter involved a "DUI, Violation of Probation." PSI I at p 28, p 29 5 Sanders received three points for adult offenses, including a 1989 conviction for driving with a suspended license (one point) and a 1990 conviction of assault with a deadly weapon not a firearm (two points) 6 Under Sanders' original plea agreement, the government promised not to contest the applicability of Sec. 2A6.1(b)(2). Sanders lost the benefit of this agreement when he changed his plea 1 As the Assistant United States Attorney emphasized at oral argument, Sanders' trial counsel knew that, given the parties' disagreement over the application of Sec. 2A6.1(b)(2), there was no guarantee that Sanders' change of plea would result in a lower sentence. Counsel's advice to Sanders to hazard the change of plea may have been mistaken (as it clearly was in retrospect). A review of some of Sanders' other trial papers indicates that, aside from this issue, Sanders may not have benefited from the most effective legal assistance. Nonetheless, in this situation, with these variable factors, even the best of lawyers could not have given Sanders more than an educated guess regarding his sentence under the Guidelines 2 The twists in Sanders' sentencing saga were further complicated by our original unpublished disposition in this case remanding for resentencing. In a footnote, the majority erroneously stated that under a revised criminal history calculation, the applicable guidelines range was 10 to 16 months. On remand, the magistrate said the guidelines were very complicated and presumed that surely the appellate court had it right. Thus, he released Sanders because Sanders was originally sentenced to the minimum end of the then-applicable range, and under the new appellate formulation, Sanders had already served the minimum ten months Subsequently, the government filed a motion to correct this "typographical" error in the disposition. Because we granted the government's separate motion to publish the disposition, the former motion was not addressed. In the present published disposition, this "erroneous" footnote has been eliminated. Presumably the majority now feels confident that 15 months is the applicable minimum for the sentencing range under a correct reading of the sentencing guidelines. Correct or not, the way that the courts have dealt with the sentencing issue in this case does not promote confidence in either the sentencing regime or the justice system. 3 A reproduction of the letters can be found in the attached appendix 4 The misspellings might seem irrelevant, but even the act of looking words up in the dictionary would evidence a higher degree of deliberation than shown here 5 In contrast, the defendant's conduct in Pacione, in which the four-level reduction was granted, evidences significantly more deliberation. There, during working hours, the defendant called the IRS agent, threatened her, gathered together a friend to help him out, drove to the IRS office, and conveyed a new threat. Pacione, 950 F.2d at 1351

‘Obama’s apology not enough’ Afghan surgeons work inside a MSF hospital after an air strike. | (msf.org) A day after President Barack Obama apologized for a tragic US airstrike that killed at least 22 people at a hospital run by Medecins Sans Frontieres (MSF) in northern Afghanistan, the medical charity said that it is continuing to press its demand for an independent investigation of the incident. The October 3rd airstrike took place as Afghan forces were fighting to retake the strategic northern city of Kunduz, which was overrun and briefly held last week by the Taliban. The insurgents, who have been massing around the city for months, launched a multi-pronged attack that took authorities by surprise. Obama on Wednesday apologized to the organization and said the US would examine military procedures to look for better ways to prevent such incidents. But scarce details on the erroneous strike have only fueled growing condemnation by MSF, as the charity is known under its French acronym, and other aid groups. Along with a dozen hospital staffers, 10 patients were also killed. The airstrike will likely complicate delicate US efforts in Afghanistan. Speaking to reporters in Kabul, MSF’s general director, Christopher Stokes, reiterated the group’s demand for the probe, saying it would be important and a precedent for non-government organizations working in conflict zones worldwide. Stokes said MSF wanted the International Humanitarian Fact-Finding Commission “to get the facts of what happened, the truth.” The IHFFC is based in the Swiss capital, Bern. It is made up of diplomats, legal experts, doctors and some former military officials from nine European countries, including Britain and Russia. Created after the Gulf War in 1991, the commission has never deployed a fact-finding mission. MSF, a Nobel Peace Prize-winning organization that provides medical aid in conflict zones, is awaiting responses to letters it sent Tuesday to 76 countries that signed Article 90 of the additional protocol to the Geneva Conventions, seeking to mobilize the 15-member commission. The Conventions lay out rules on conduct in armed conflict, mostly on protecting non-combatants. For the commission to be mobilized, a single country would have to call for the fact-finding mission, and the US and Afghanistan – which are not signatories – must also give their consent. MSF says it has had no response yet from any country. “It would show a distinct lack of courage if none of the 76 signatories come forward,” Stokes said. The MSF hospital in Kunduz is no longer operational, which has put severe burden on the city, MSF and Afghan officials have said. Of the 105 patients who were in the hospital at the time of the bombing, nine have yet to be accounted for; and of a total of 461 staff, 24 are still missing, said Guilhem Molinie, MSF’s representative in Afghanistan. The organization expects there are still 24 bodies in the debris of the building that was bombed, he added. Three children who were among the 10 patients who perished were members of the same family, admitted the night before the bombing after their car came under fire, Molinie said. Government forces continued to battle Thursday to clear insurgents from Kunduz areas. Humanitarian supplies were still not reaching the city in adequate quantities, according to Sayed Sarwar Hussaini, a provincial police spokesman. Police were helping with some food distribution, he added. Some roads into Kunduz have reopened but the Taliban have been hijacking trucks delivering food and medicines, said civil society activist Zabihullah Majidi. He said medicines purchased with money raised by civil society groups have been destroyed by Taliban on the road from Balkh province, while 150 cartons had made it through. (Hindustan Times)

Great Fire of Edinburgh The Great Fire of Edinburgh was one of the most destructive fires in the history of Edinburgh. It started on Monday, 15 November 1824, and lasted for five days, with two major phases. Sequence of events The fire broke out around 10pm on 15 November 1824, in James Kirkwood's engraving workshop on the second floor of the Old Assembly Close, a narrow alleyway just off the High Street. The city of Edinburgh had formed a permanent fire brigade only two months earlier under its new firemaster James Braidwood. Although this new force arrived quickly with their custom-built fire engines, they had difficulty locating a water supply and did not begin to tackle the blaze until 11pm, by which time six stories of the building were ablaze. Due to the narrowness of the alleyway, the fire spread quickly to adjoining buildings, first affecting those to the east of Fishmarket Close and later spreading along the roofs of the High Street through embers carried by a southwesterly breeze. By midnight, four tenements were ablaze as the fire advanced towards the Cowgate. The Old Assembly Hall at the centre of the fire (which had given its name to the close) was destroyed during the night. Around midday on Tuesday, 16 November, the spire on the Tron Kirk caught fire and molten lead began to pour from its roof. Although firemen succeeded in reaching the roof of the church, the fierceness of the blaze forced them back. At 10pm on Tuesday evening a secondary outbreak occurred in buildings on the corner of High Street and Parliament Close (renamed Parliament Square after the subsequent rebuilding of the affected area). This blaze started on the top floor of an eleven-story building overlooking the Cowgate. This led to claims of divine intervention and punishment from God, as well as deliberate fire-raising. It was more likely the result of a still smouldering ember. This second phase of the fire began to consume the buildings on the east side of Parliament Close. Efforts focused on saving the adjacent Parliament Hall and Law Courts, and stopping the fire leaping to St Giles Cathedral. A young David Octavius Hill made watercolour sketches during this second phase, viewing the fire from the west. By 5am on Wednesday 19 November, the fire was described as "grand and terrific". The building housing the Edinburgh Courant collapsed and the fire continued to spread down Conn's Close towards the Cowgate. Due mainly to a downpour of rain, the conflagration was brought under control by Wednesday evening, although small outbreaks continued and final smouldering did not cease until Friday, 21 November. Over the following days, engineers from the castle and navy were employed to pull down the highly unsafe remnants of buildings left precariously balanced along the closes. The fire attracted huge crowds of spectators including a large number of Law Lords: Charles Hope, Lord Granton (Lord President of the Courts); John Boyle of Shewalton (Lord Justice Clerk); Sir William Rae of St Catherines (Lord Advocate); John Hope (Solicitor General, later Lord Hope); the Dean of Faculty; and Henry (later Lord) Cockburn. Total damage High Street (Royal Mile): four six-storey tenements fully lost plus upper storeys of buildings closer to the Tron Kirk damaged Conn's Close: two timber-framed 'lands' (tenements) of great antiquity destroyed completely Old Assembly Close: four seven-storey tenements lost and the Assembly Hall (a ballroom) Borthwick’s Close: six tenements lost Old Fishmarket Close: four six-storey tenements lost Parliament Close: four double tenements of seven to eleven storeys destroyed, including the birthplace of James Boswell Office of the Edinburgh Courant newspaper destroyed John Kay's shop in Parliament Close destroyed Old Assembly Hall destroyed. Several printworks destroyed Notable residents who lost their home in the fire included Hector Gavin and Archibald Inglis An estimated 400 homes were destroyed, with 400-500 families left homeless. Thirteen lives were lost including those of two firemen and many people were injured. Historic homes destroyed included that of Robert Dundas of Arniston, the Elder and George Heriot. Aftermath Amidst mounting public criticism of the new fire brigade and its young firemaster, an inquiry was held after the disaster. Braidwood and his "pioneers" (as the first firemen were called) were exonerated from all blame. The inquiry found that there had been confusion as to who had been in charge of the firefighting operation. Public officials (Bailies, Law Officers and "Gentlemen of Importance"), assuming authority under older municipal regulations, were found to have issued contradictory orders to the harassed firemen. This finding prompted the passing of a new regulation whereby the City Firemaster (or, in his absence, his Deputy) was to be given complete command of all firefighting operations, a ruling subsequently adopted throughout Britain's fire services. The inquiry also criticised the inadequate number of firecocks that had been available to the firefighters and recommended improvements. Within a year the number for the whole town was increased from 45 to 97, with 88 more following later. The brigade was also fully re-equipped. The fire opened the way for a more formal completion of the Scottish Law Courts in Parliament Square. This had been proposed as early as 1807, but blocked since 1810 by owners on the east side of the square. The fire destroyed the buildings they had been trying to retain and may have been viewed as a "happy accident". The remodelling of the buildings was completed to the original plan in 1829. The south side of the Royal Mile from the Tron Kirk to Parliament Square was rebuilt as a planned run of well-proportioned but plain five-storey Georgian tenements. Some of the eastern blocks, which suffered less fire damage, incorporated some earlier fabric such as turret stairs. The rebuilt section of the High Street incorporated a new central fire station, now a police museum. St. Giles Cathedral was refaced in ashlar a few years later (1829–33), partly to repair and conceal major scorching from the fire. The steeple of the Tron Kirk was rebuilt in 1828, ignoring its earlier Dutch design. Braidwood statue In 2008, a statue of James Braidwood, master of the newly formed Edinburgh fire brigade which had fought the fire, was unveiled in Parliament Square. The spot was chosen to mark the stand made by the fire brigade to save St Giles Cathedral from more serious damage. The statue was created by the Glasgow sculptor, Kenneth Mackay, and paid for from a fund set up by the late Dr Frank Rushbrook CBE, then 93-year-old former Firemaster at Lothian & Borders Fire Brigade. References External links The Scotsman - Lost Edinburgh: The Great Fire of Edinburgh Category:1824 in Scotland Category:19th century in Edinburgh Category:Building and structure fires in the United Kingdom Category:Disasters in Edinburgh Category:Fire and rescue in Scotland Category:Fires in Scotland Category:November 1824 events

Q: Very poor performance of QGIS and PostGIS 2. User error or feature? I have a large table in PostGIS 2. It has >500 million polygon, line and point features all happily living in there and the table performs brilliantly in other GIS. I am now trying to just add that table to a project in QGIS but here is the thing, why does it take so long? When I try to 'Add PostGIS overlay' it says detecting for about four hours to tell there are three geometry types. OK, I can take that if I only have to do it once... Once it finishes that I select all three parts click OK... So far I'm two days into trying to get it to load into the canvas. What is going on? I am zoomed in so only a few polygons should be rendered on screen. Is this an error or a 'feature' of QGIS? Is there something I need to specifically do to enhance the performance for QGIS? I am using MapInfo and Cadcorp SIS both of which love the "everything in one place" model rather than the splitting it up, join it back later with queries model. And thanks @AndrewJoost, the estimated metadata saved about an hour but still it takes a few hours too long and misses one of the geometry types off the list... QGIS not supporting mixed geometries in one overlay is no problem, as long as it supports them in one table. And the way it does this with a filter is great for small tables but just fails when you have a large one it seems. I am unable to separate the table into three parts as this does not make sense for the other systems using the data, and would also break them. @NathanW How can I get 3 records for a single table into the geometry_columns view now that it is no longer a physical table? any ideas? Sorry about all the newbie questions Any other ideas to stop QGIS trying to be helpful and scanning a table before allowing me to add it? I don't mind choosing geometry types by hand for every overlay if that's what it takes? A: To my knowledge, GIS as Arcmap or QGIS can't support layers with several primitives (point, polygon or polyline). What GIS do you use? You can try to create tables for each type: Point: SELECT * INTO newtablepoints FROM initial_table WHERE ST_GeometryType(geom) = 'ST_Point' ; polygon : SELECT * INTO newtablepolygones FROM initial_table WHERE ST_GeometryType(geom) = 'ST_MultiPolygon' or ST_GeometryType(geom) = 'ST_Polygon' ; polyline : SELECT * INTO newtablelines FROM initial_table WHERE ST_GeometryType(geom) ='ST_MultiLineString' or ST_GeometryType(geom) = 'ST_LineString'; You can try to add a geometric index : CREATE INDEX idx_spatial_points ON newtablepoints USING GIST (geom); CREATE INDEX idx_spatial_polygones ON newtablepolygones USING GIST (geom); CREATE INDEX idx_spatial_lines ON newtablelines USING GIST (geom); It will accelerate geographic queries. Then these three tables will be more easily support by QGIS A: As previously mentioned, mixed Geometries in one layer are not supported by QGIS. If you have strong use case for keeping all of the data in a single table, another option to creating new tables (as suggested by @Benno) would be to create views referencing each geometry type from the initial table: CREATE VIEW vwPoints SELECT <fields> FROM initial_table WHERE ST_GeometryType(geom) = 'ST_Point' I am not sure about is the performance implications of going with views vs. individual tables, but that is something you could easily experiment with and decide which route you want to take.

Q: to find new location of files that are moved to different location - Java I have a folder of header files in older version of our application. There are many header files directly inside that folder and also inside many subfolders... Now we are going to use a newer version of the application in which the header files path are present in different subfolders than they used to be before. I want to write a java program(preferably), that gives me a one to one mapping of the old path and the new path of the headers. I have the root directory of header files in both the version... i want to find the differences in header file path with respect to the root directories. Header files Root Directory of Old Version: Root1 Header Files Root Directory of New Version: Root2 Under Root1 consider there are three sub folders: Folder1, Folder2, Folder3 Under Root2 consider there are three sub folders: Folder1, Folder2, Folder3 Under Root1/Folder1 there were three files: File1,File2,File3 Root1/Folder1/File1, Root1/Folder1/File2, Root1/Folder1/File3. Now in new version these files are like: Root2/Folder1/File1, Root2/Folder2/File3, Root2/Folder3/File2. The files are restructured. I want to write a program to find out the new version path for these files by scanning both the root folders: Required output: Root1/Folder1/File1 = Root2/Folder1/File1 Root1/Folder1/File2 = Root2/Folder3/File2 Root1/Folder1/File3 = Root2/Folder2/File3. Sorry if I am not clear. SO is a reference site if we are facing any problem in programming. I am stuck with this running out of ideas for this logic. Kindly Help. EDIT 1: sorry for the delay.. the file names are same in both the versions. let me tell the requirement. throughout the project, hundreds of header files are included referring to old version... its c and cpp based code. now we need to change in code all the include statements according to new header paths. so manually changing one by one searching through the windows explorer is tedious. it doesn't matter if the header files have changed. new function definitions might have been added in the new version. but we need to include the same header file. this program might save a lot of manual hours. Thanks :) A: This assumes that file names do not change during the migration from one directory tree into the other one. This is quick and dirty and lacks all sanity checks and error handling, but it illustrates the main point: recursive descent into a directory to collect the files to collect a mapping of file names to paths. The comp method just takes the names from the first directory tree and displays path names from both trees. public void find( File root, Map<String, String> map ){ File[] entries = root.listFiles(); for( File file: entries ){ if( file.isDirectory() ){ find( file, map ); } else { map.put( file.getName(), file.getAbsolutePath() ); } } } public void comp( File root1, File root2 ){ Map<String,String> map1 = new HashMap<>(); find( root1, map1 ); Map<String,String> map2 = new HashMap<>(); find( root2, map2 ); for( String name1: map1.keySet() ){ String path1 = map1.get( name1 ); String path2 = map2.get( name1 ); System.out.println( name1 + ": " + path1 + "->" + path2 ); } }

Richard Malone, 1st Baron Sunderlin Richard Malone, 1st Baron Sunderlin (c.1738 – 14 April 1816) was an Anglo-Irish politician and peer. Sunderlin was the eldest son and heir of Edmond Malone and Catherine Collier. His uncle was the lawyer, Anthony Malone, from whom Sunderlin inherited extensive estates in the counties of Westmeath, Roscommon, Longford, Cavan, and Dublin. He was educated at Trinity College, Dublin, from where he graduated in 1755, before studying for an MA at Christ Church, Oxford, which he achieved in 1759. He also attended Middle Temple and became a barrister, practising in Ireland. He served as the Member of Parliament for Granard between 1769 and 1776, and then as the MP for Banagher from 1783 to 1785. On 30 June 1785, he was created Baron Sunderlin of Lake Sunderlin in the Peerage of Ireland, thus entitling him to a seat in the Irish House of Lords. As Sunderlin had no children, a patent was created in 1797, when he was made Baron Sunderlin of Baronston, also in the Peerage of Ireland, with special remainder to his brother, the Shakespearean scholar and editor, Edmond Malone. However, his brother predeceased him, and both titles became extinct upon his death. References Category:Year of birth uncertain Category:1816 deaths Category:Barons in the Peerage of Ireland Category:Peers of Ireland created by George III Category:Anglo-Irish people Category:Irish MPs 1769–1776 Category:Irish MPs 1783–1790 Category:Alumni of Trinity College Dublin Category:Alumni of Christ Church, Oxford Category:Members of the Middle Temple Category:Members of the Parliament of Ireland (pre-1801) for County Longford constituencies Category:Members of the Parliament of Ireland (pre-1801) for King's County constituencies

Q: "Queueing" or "Queuing" Which spelling is better, queueing or queuing? Both words seem to mean the same, but there are two different spellings. My context is: Queueing Latency versus Queuing Latency If both spellings are applicable, when do I use which one of them? A: Just in case if anyone is wondering which one is more popular: (Queuing!) A: Both occur and there's no difference in meaning.

Pages Wednesday, September 4, 2013 Wylla's Winter Wardrobe Wylla is one of those cats that's always cold. She's a seeker of sun patches, she snuggles under the covers at night, and during the day, if you're sitting still, she'll always nap on top of you. She doesn't have a tremendous amount of body fat, and I'm guessing this is why she's on a constant quest for the warmest spot in the house. With summer winding down, and the cold, damp days to come, I've been looking for a little sweater or jacket to keep her warm on her outings. This weekend, I found this cute little vest for our girl. Please don't tell her it was made for dogs. The hood is detachable, and most likely, that's how she'll wear it. It has a little slot in the back to feed her leash through. She wears an "x-small dog" and it fits her well. You inspire me to put my knitting needles to work on a project for Miss Wylla. There are some insanely adorable little puppy sweater patterns out there. As it is, to say Wylla looks beyond precious in that wee vest -- she'll be the most stylish kitty in Tacoma this winter! I just love the way Wylla stares directly into the camera for her pictures. Does she pose or are you very good at capturing her at the right moment? I have to take about 50 shots of my Lily before she looks at the camera and Boo just runs away. Great story pictures! Watching Wylla blossom has been such a joy. Her coloring reminds me of my beloved and much missed torti-tabby, which makes seeing her thrive even sweeter. I wonder if Wylla would enjoy a self-heating blanket? It's not that I fear she lacks warm and cozy places to sleep, though. I read about them on Love & Hisses and want to try to make some for my own furballs. One suggestion was to buy a reflective car windshield shade and cut mylar panels from it. As crafty as you are, Laurie, you'd probably make something amazing. K&H makes wonderful heated pads and beds for kitties - my cats love them, particularly in the winter. They make ones that run on electricity and ones that don't. My favorite is the Thermo-Kitty mat : http://www.khmfg.com/catproducts/thermo-kitty-mat.html Linkwithin YOU ALL ARE AWESOME! WE LOVE YOU IBKC COMMUNITY! A HUGE THANKS TO OUR AWESOME DONORS! Thank you so much for caring so much and giving to support the Humane Society for Tacoma and Pierce County. Because of your huge hearts, we're making the difference in the lives of so many cat and kittens. Well done, Community. Well done! We're always on the hunt for good people in the Seattle or Tacoma area to adopt our fosters kittens. If you are thinking about adding a kitten or two to your life, drop us a line and tell us a little bit about yourself. Click here to email the IBKC !