Datasets:

JesusCrist

/

pubmed

like 0

Infectious complications, especially bloodstream infections (bsis), are major causes of morbidity and mortality among patients who suffered from malignant hematological diseases and treated with intensive chemotherapeutic regimens [1, 2]. In these clinical settings, bacterial cultures from blood are of great diagnostic value and the gold standard to detect bloodstream infections; in addition to this, the results of blood cultures provide epidemiological data which are useful to determine empiric antibiotic therapy . However, the diagnosis of bsis is still challenging in this patient group, because about half of all bsi cases are culture negative mainly because of the frequently used prophylactic antibiotics . To overcome the inhibitory effect of antibiotics, special blood culture bottles containing resin have been developed; thus, modest increase in the sensitivity of culture has been achieved . In the early 1970s, introducing empiric treatment protocols and antibiotic prophylaxis, increasing use of certain chemotherapeutic drugs associated with frequent oral mucositis, and frequent use of central venous catheters have changed the spectrum of pathogens in febrile neutropenic patients shifting it from gram - negative to gram - positive bacteria, especially viridans group streptococci and coagulase - negative staphylococci [36]. The aim of this study was to evaluate occurrence of bacterial species causing bloodstream infections due to febrile neutropenic episodes in the hematology ward of the university hospital in szeged, hungary, between 2005 and 2008 . Between 2005 and 2008, 469 patients with febrile neutropenia (230 females and 239 males, median age 60 years) were observed in our department with various hematological diseases . Collected data from patients documentations included demographics of patients, diagnosis, febrile episodes, source of fever and source of infection, neutrophil count, and clinical significance of the isolated organism . Infectious complications were categorized into three groups: 1 fever of unknown origin (fuo), 2 microbiologically documented infection (mdi), and 3 clinically documented infection (cdi). Febrile neutropenia was defined if a single oral temperature was measured higher than 38.3 c, or temperature was 38.0 c or higher for 1 h. neutropenia was defined as absolute neutrophil count (anc) less than 0.5 10/l or less than 1.0 10/l and rapidly declined below 0.5 10/l . A single positive blood culture (bc) common skin contaminants (cns, propionibacteria) were considered significant only if they could be found in two consecutive bc samples or if there were concurrent skin, soft tissue, or catheter - related infections . Bsi was defined as polymicrobial if more than 1 bacteria grew from bc on the same day . Medical database of patients was used to collect information on the hematologic diseases, presence of febrile neutropenic episode, duration of neutropenia, and source of infection . Bc samples were taken at the onset of fever . In patients having central venous catheters, bcs for collection of blood culture, the blood culture system (bd bactec, beckton dickinson, usa) including aerobic, anaerobic bottles, and bottles for fungi was used . After taking blood, bottles were immediately placed in an incubator, where these were incubated for 514 days depending on the type of the putative pathogens . In the case of positive signal produced by the instrument on the basis of bacterial or fungal growth, microscopic examinations (phase contrast microscopy and examination of gram - stained preparations) and columbia blood agar supplemented with 5% sheep blood (biomrieux, marcy letoile, france), chocolate agar supplemented with poly - vitex (biomrieux, marcy letoile, france), eosin methylene blue (lab m, uk) and sabouraud chloramphenicol (bio - rad, france) agars, and, for anaerobic culture, schaedler agar supplemented with 5% sheep blood (bio - mrieux, marcy letoile, france) were inoculated with one drop of blood . Plates were incubated at 37 c for 24 h in a 5% co2 incubator or 37 c for 24 h under normal atmosphere or at 37 c for 48 h in an anaerobic cabinet (concept 400; ruskinn technology ltd ., bridgend, uk) under a gas composition of 85% n2, 10% h2, and 5% co2 . From pure culture, antibiotic susceptibility tests were performed on the basis of clinical laboratory standard institute recommendations [811]. At the onset of fever, after taking bc, broad spectrum antibiotics were started empirically (piperacillin tazobactam, cefepime, and imipenem or meropenem). Changes in empiric antibiotic therapy depended on bc results and clinical response . In afebrile and culture - negative patients with stable clinical state, empiric antibiotic treatment was continued until anc reached 500/l . Vancomycin was used in patients with central venous devices, persistent fever, and hypotension . On day 45, in patients with persistent fever suggesting fungal infection on the basis of clinical signs and computed tomography (ct) scans, amphotericin b was applied . Between 2005 and 2008, 469 patients with febrile neutropenia (230 females and 239 males, median age 60 years) were observed in our department with various hematological diseases . Collected data from patients documentations included demographics of patients, diagnosis, febrile episodes, source of fever and source of infection, neutrophil count, and clinical significance of the isolated organism . Infectious complications were categorized into three groups: 1 fever of unknown origin (fuo), 2 microbiologically documented infection (mdi), and 3 clinically documented infection (cdi). Febrile neutropenia was defined if a single oral temperature was measured higher than 38.3 c, or temperature was 38.0 c or higher for 1 h. neutropenia was defined as absolute neutrophil count (anc) less than 0.5 10/l or less than 1.0 10/l and rapidly declined below 0.5 10/l . A single positive blood culture (bc) common skin contaminants (cns, propionibacteria) were considered significant only if they could be found in two consecutive bc samples or if there were concurrent skin, soft tissue, or catheter - related infections . Bsi was defined as polymicrobial if more than 1 bacteria grew from bc on the same day . Medical database of patients was used to collect information on the hematologic diseases, presence of febrile neutropenic episode, duration of neutropenia, and source of infection . Bc samples were taken at the onset of fever . In patients having central venous catheters, bcs were taken from both central and peripheral veins . For collection of blood culture, the blood culture system (bd bactec, beckton dickinson, usa) including aerobic, anaerobic bottles, and bottles for fungi was used . After taking blood, bottles were immediately placed in an incubator, where these were incubated for 514 days depending on the type of the putative pathogens . In the case of positive signal produced by the instrument on the basis of bacterial or fungal growth, microscopic examinations (phase contrast microscopy and examination of gram - stained preparations) and columbia blood agar supplemented with 5% sheep blood (biomrieux, marcy letoile, france), chocolate agar supplemented with poly - vitex (biomrieux, marcy letoile, france), eosin methylene blue (lab m, uk) and sabouraud chloramphenicol (bio - rad, france) agars, and, for anaerobic culture, schaedler agar supplemented with 5% sheep blood (bio - mrieux, marcy letoile, france) were inoculated with one drop of blood . Plates were incubated at 37 c for 24 h in a 5% co2 incubator or 37 c for 24 h under normal atmosphere or at 37 c for 48 h in an anaerobic cabinet (concept 400; ruskinn technology ltd ., bridgend, uk) under a gas composition of 85% n2, 10% h2, and 5% co2 . From pure culture, antibiotic susceptibility tests were performed on the basis of clinical laboratory standard institute recommendations [811]. At the onset of fever, after taking bc, broad spectrum antibiotics were started empirically (piperacillin tazobactam, cefepime, and imipenem or meropenem). Changes in empiric antibiotic therapy depended on bc results and clinical response . In afebrile and culture - negative patients with stable clinical state vancomycin was used in patients with central venous devices, persistent fever, and hypotension . On day 45, in patients with persistent fever suggesting fungal infection on the basis of clinical signs and computed tomography (ct) scans, amphotericin b was applied . During the four - year study period, 1,361 patients were treated in the hematology ward because of various hematological diseases . A total of 812 febrile episodes were recorded in 469 (34.5%) patients, and blood was collected for microbiological culture . Of the 469 patients, 128 (27.3%) had acute myeloid leukemia, 85 (18.1%) non - hodgkin s lymphoma, 66 (14.1%) multiple myeloma, 64 (13.6%) chronic lymphocytic leukemia, 41 (8.7%) acute lymphoblastic leukemia, and 85 (18.1%) others (hodgkin s lymphoma, myelodysplastic syndrome, chronic myeloprolipherative disorders etc .) (table 1). Altogether, 3,714 blood culture bottles, 6.5 bottles / patient (ranging 212), were sent to the laboratory . In 126 (27%) of 469 patients, only one pair of blood culture bottles was taken by febrile episodes . Clinically documented infections could be observed in 430 of 812 febrile episodes (52.95%). Colitis and skin and soft tissue infections were the second and third most common infections . During the microbiological culture, 759 (20.4%) of 3,714 blood culture bottles gave positive signals . From the majority of positive blood culture bottles (509 bottles (67.1%)), gram - positive bacteria were cultured . Among gram - positive bacteria, the most frequent isolates were coagulase - negative staphylococci (65%), staphylococcus aureus (10%), enterococcus spp . (6.7%), popionibacterium acnes (5.7%), -hemolytic streptococci (3.1%), streptococcus pneumoniae (2.8%), -hemolytic streptococci (2.4%), clostridium spp . (1.4%), and others (3%) (including listeria monocytogenes, nocardia farcinica, gemella spp ., micrococcus spp ., brevibacterium spp ., and gram - positive nonidentified bacteria) high prevalence of escherichia coli (52%) could be detected in these specimens, while 14% of samples contained pseudomonas aeruginosa, 9.6% klebsiella spp ., 8% enterobacter spp ., 3.6% citrobacter spp ., 2% stenotrophomonas maltophilia, 1.6% acinetobacter spp ., and 1.6% fusobacterium spp . Only six bottles proved to be positive for fungi during the examined period; in two cases, candida albicans and also, in two bottles, candida tropicalis could be detected, while two other bottles were positive for cryptococcus spp . Among gram - positive isolates, coagulase - negative staphylococci (cns) were identified in 331 cases . These blood culture samples were collected from 161 febrile episodes of 149 patients . In 50 febrile neutropenic episodes, cns were relevant as a causative agent of fever because of the coexistence of skin, soft tissue, and central venous catheter - related infections . In the case of the remaining 111 cases, contamination could be the source of cns . Among rarely isolated pathogens, listeria sp . Was identified from one patient with acute myeloid leukemia (aml) due to second relapse in 2006 . The patient had clinically documented pneumonia and was treated with ampicillin . In 2006 and 2008, blood culture sample was taken from peripheral vein . In this case, the patient was treated empirically with levofloxacin . The other patient suffered from relapsed hodgkin lymphoma and was treated according to eshap chemotherapeutic regimen (combination of high - dose cytosine - arabinosid, methylprednisolone, cisplatin, and etoposide) through the central venous line . Two pairs of blood culture samples were taken due to febrile episode from catheter, and b. cepacea was grown from each samples . N. farcinica was isolated from a patient with large granular lymphocytic (lgl) leukemia . He underwent six cycles of combined chemotherapeutic treatment (cyclophosphamide, vincristine, and prednisolone) and later had long term steroid therapy due to coombs positive hemolytic anemia and active hemolytic events . On hospital admission, ct scan showed multiple lesions with perifocal oedema, but stereotactic core biopsy from lesions could not be performed because of the patient s severe clinical status . From one pair of blood culture, n. farcinica was isolated, but the patient died before adequate therapy could start . During the examined period, four cases of bacteremia caused by fusobacterium nucleatum two patients had acute myeloid leukemia, one patient had acute myelomonocytic leukemia, and one patient suffered from pre - b - cell lymphoblastic leukemia . Two patients received chemotherapy before positive blood culture; one of them had oral mucositis associated with the applied chemotherapy . This may have influence on the applied chemotherapy; dose reduction or treatment delays can be observed frequently when febrile neutropenia is present, and this also has unfavorable long - term outcome in otherwise curable malignancy . Bloodstream infections are among the most important bacterial infections, despite the development in the field of microbiological diagnosis and antimicrobial therapy; these infections are responsible for the large proportion of nosocomial infections worldwide . In the early 1960s, the importance of bloodstream infection in neutropenic patients had been recognized; thus, empirical treatment protocols were established for mainly gram - negative bacteria . Later, the spectrum of pathogens associated with bsi shifted from gram - negative bacteria to gram - positive bacteria due to the increased use of antibiotic prophylaxis and indwelling catheters allowing colonizations and infections with the skin flora . Nowadays, the most common pathogens isolated from blood are coagulase - negative staphylococci and various antibiotic - resistant bacteria . In the majority of cases, the source of these infections is unknown in spite of various efforts to find them . Recognition of changes in the epidemiology of bsis is very important to modify the antibiotic policy because, on the basis of these findings, we can reduce the infection - related morbidity and mortality [15, 16]. During the four - year study period, the incidence of bacteremia was 20.4% . Showed that the incidence of bacteremia was 23% when they examined over two thousand patients with febrile neutropenia in cancer patients, while viscoli et al . Found that bacteremia occurred in 29% of patients with febrile neutropenia [17, 18]. Our findings correlated with the abovementioned literature data because, from the majority of blood culture bottles (13.7%), gram - positive bacteria were isolated . Sixty - five percent of gram - positive bacteria belonged to coagulase - negative staphylococci . However, in a study by winston et al . In north america, gram - negative bacteria (55.6%) were responsible for the majority of bacteremia in febrile neutropenic patients . At the same time, other authors from italy or france showed that the most important isolates in neutropenic patients are gram - positive bacteria, including coagulase - negative staphylococci or streptococci, while gram - negative organisms including e. coli or klebsiella spp . And p. aeruginosa constitute smaller portion of the isolates [20, 21]. In our case, the most frequently used empirical treatment in this patient group is piperacillin tazobactam or, if the patient has colitis or the possibility of abdominal infection is arisen, imipenem or meropenem is the frequently used antibiotic . Thus, the increased incidence of gram - positive bacteria can be explained by the applied empirical antibiotic treatment, while the presence of coagulase - negative staphylococci could be attributed to the frequently used central venous catheters . The incidence of bacterial species in blood cultures can be influenced by the applied chemotherapy . In our case, 30% of patients with acute leukemia received high - dose ara - c chemotherapy, and 15% and 12% of patients were treated with fludarabin and ara - c plus idarubicin, respectively . On the basis of literature data, increasing prevalence of gram - positive cocci in febrile neutropenic patients could be observed after highdose cytarabine chemotherapy; this was confirmed by our results . Showed that the prevalence of staphylococci is higher than the prevalence of streptococci and enterococci in febrile neutropenic patients . Similarly, our results confirmed this because, among gram - positive bacteria, the majority of the isolated strains were coagulase - negative staphylococci; 6.7% and only 2.4% of gram - positive bacteria belonged to enterococcus spp . And -hemolytic streptococci, respectively . A total of 331 blood culture samples proved to be positive for coagulase - negative staphylococci and were collected from 161 febrile episodes of 149 patients . In 50 febrile neutropenic episodes, coagulase - negative staphylococci were relevant pathogen of fever because of the coexistence of skin, soft tissue, and central venous catheter - related infection . The remaining 111 cases were supposed to be contamination . From 32.9% of positive blood cultures bottles, gram - negative bacteria were cultured; the majority of these proved to be positive for e. coli (52%). The second most common isolate was p. aeruginosa (14%), while the third one was klebsiella spp . In this review, the results of four articles were analyzed, and, among gram - negative organisms, the most important pathogens were also e. coli, klebsiella spp ., and p. aeruginosa . Among rarely isolated bacteria, achromobacter xylosoxidans and burkholderia cepacia are usually associated with catheter - related sepsis, while s. maltophilia can cause mainly nosocomial bacteremia and the possible source of haemophilus influenzae, neisseria spp ., and gemella spp . Because of the possible presence of unusual pathogens, such as anaerobic bacteria or fastidious microorganisms, the use of various blood culture bottles including anaerobic bottles should be considered . Because of its rapid progression of infection in febrile neutropenic patients and difficulties in distinguishing infection from noninfected patients on the basis of clinical presentation in this patient group, the use of empirical antibiotic treatment is essential and may provide the possibility to reach better outcome.

Research indicates that many sami became reindeer herders in the early 17th century, as a response to a population crisis (9). This transition coincided with the swedish state's increased interest in spmi, the distant regions of the north which were the sami's traditional lands . Courts were held annually, market places were built, and the first printed books in the sami language appeared (10). Further interest in the area was stirred in the late 17th century by the discovery of silver, but the mining epoch lasted for only 50 years . The sami remained very isolated, not only because of their economy and culture but also because of the great distances between households and the intense cold of the region for most of the year . At the end of the 17 century, the state also tried to encourage settlers to move to the area, offering free land, and 15 years free from taxes . This had, however, a limited impact on in - migration, a trend that did not change until the mid-18th century . During the following 100 years, the ethnic balance in spmi changed, turning the sami into a position as minority in their own lands . Omran's essay on the epidemiological transition, modeling societies change from high mortality due to infectious diseases to low mortality caused by chronic diseases, has had a great impact on the public health community and stirred research in a variety of disciplines (12, 13). Indigenous peoples were not mentioned in his work, but few researchers would dispute that the indigenous populations of the world experienced demographic transitions much later than non - indigenous populations . However, although an indigenous demographic or health transition is generally acknowledged, due to lack of longitudinal data, it is rarely examined (14, 15). The main source material used for the present study is a set of data files from the demographic database (ddb) at ume university, one of the world's most information - dense historical population databases . A recent addition to the ddb are 18th and 19th century parish records from spmi . The longitudinal database includes every individual in the parishes during the period when the area was colonized, largely by swedish settlers, and the sami population changed from a majority to a minority . The source material separates the sami and the settler populations and contains information on, for instance, sex, age, cause of death, migration, and fertility . Each individual can be followed from the cradle to the grave allowing the reconstruction of life biographies and family composition based on ethnic categorization (table 1). Working sample and missing cases individuals born in 17501895 . Because data quality is poor in the earlier years, the time period has been restricted to 17501895 . Only infants born within the study area and with a known birth day have been included . Infant mortality is calculated by the number of deaths within the first year of life during a time period divided by the number of live births during the same period . When calculating infant mortality and making comparisons with swedish national data, 10 year intervals were used (16). The risk of infant mortality is modeled as a cox proportional hazard model with ethnicity, sex, parity, birth season, and birth period as the explanatory covariates . 1). Map of sweden, including the parishes of jukkasjrvi, jokkmokk, and fllinge . Sami live in four countries, speak nine different languages, and are diversified by reindeer - herding techniques, social organization, and economic resources . Until the early 19th century, sami land rights were legally protected, but then a more repressive state policy replaced the sami traditional division and use of land with a national administrative system (17). The present study includes three parishes where sami were in a great majority around 1750 . The church registers of jukkasjrvi and jokkmokk in the north sami area contained both sami and swedish settlers, whereas fllinge sami parish in the south sami area was an administrative construction exclusively for the indigenous population in the area . The magnitude and timing of colonization differed between the parishes . In the northernmost parish of jukkasjrvi, sami were in majority throughout the period 17501900 . Until 1850, there are around 400 non - sami and 1000 sami, and both groups experienced a population increase from 1880, settlers more than the indigenous . We believe that the parish of jokkmokk is more representative of the sami parishes in general, where an ethnic majority shift occurred around 1830, moving in a frontier wave from the south to the north . In the parish of fllinge, the ethnic majority shift came earlier: from the late 18th century, there were more non - sami than sami in the area, and the change accelerated so that at the end of the period there were almost 10 times as many swedes as sami . Previous research has to a large extent exclusively counted the reindeer herding nomads in the sami group . There was, however, an ethnic complexity in the north already during the early stages of colonization, and not all sami were nomadic reindeer herders; large groups were hunters or farmers, and during the period, many sami took up residence in settlements, becoming settlers but still sami, sometimes recorded as sami - settlers [lappnybyggare] in the parish registers . All these groups are included as sami in our study, resulting in a sami population larger than normally stated . This has been done to create a more in situ-oriented demography (18). We have combined the ethnic markers in the sources using a system designed by the historian gabriella nordin in her dissertation on marriage patterns in spmi 17501900 and also presented in skld and axelsson (5, 11). A complementary source of information about infant mortality is the annual reports of the district physicians in the area . However, the doctors were not well acquainted with the conditions among the sami, and the reports often give laconic and judgemental descriptions of sami health . Previous studies of sami mortality have revealed considerably higher rates from 1750 to1900 compared with non - sami, both in spmi and in sweden generally (4, 5, 19). By contrast, the second half of the 20th century shows no ethnic mortality differences (3). This is consistent with the occurrence of a delayed indigenous demographic and epidemiologic transition (20), and because infant mortality is one of the early indicators of intensified change, our study aims to find evidence for declining imr among the sami before 1900 that could be interpreted as a forerunner of a general transition . Long - term infant mortality trends are analyzed to compare sami and non - sami groups in the three parishes.using both northern and southern sami areas, the cultural complexity of the sami society is recognized . Sex differences and seasonality are included parameters that are interpreted in terms of the varying work intensity of the reindeer nomads . Parity, causes of death, and change over time are additional variables that complete the study together with an estimation of the impact of health care programs . The results are discussed from the perspective of data quality, methodological issues, and the general demographic transition in sweden . The sami have lived in spmi for thousands of years and have learned to adapt to the extreme conditions there . Nevertheless, the nomadic sami lifestyle, the hazardous character of reindeer herding, and a shifting food resource resulted in a high mortality, including infant mortality . The sami were devoted parents with strong emotions and traditions attached to their children, and had developed customs for reducing risk during pregnancy, delivery, and child care . The child was believed to be endangered by evil spirits and other threats, and a newborn child was put in a skin from a newborn reindeer calf, with a piece of steel close to the infant to protect it (22). It is universally reported by the clergy, physicians, travelers, politicians and later also expressed by the sami themselves that sami children were breast - fed for at least 2 years, and sometimes for as long as four years . During the first days after birth, before the mother produced milk, the infant was given a piece of sugar or reindeer fat in a small napkin . Some sami women consumed alcohol during pregnancy but not during the last days before birth giving . However, when the infant was born, the woman was encouraged to drink quite a lot of alcohol (22). The non - sami settlers were mostly from other parts of sweden, but sometimes from finland or norway . Colonization was promoted by the state from the late 17th century, but the great explosion of in - migration occurred in the second half of the 19th century, when mining, railroads, and improved agricultural techniques offered new opportunities . From the mid-18th century, the swedish health care system tried to reduce the very high infant mortality in the country . In stockholm and other urban areas, sometimes more than half of the newborn children died within their first year of life . Medical instructions were published concerning the care of infants, and district doctors were employed, even though in the 1870s it was still a rare event for someone in northern sweden to have a visit by the doctor (23). In earlier times, the clergy were given responsibility for health care, but during the 19th century they became less and less involved . They were officially released from health duties in 1830, and after this, their participation in medical issues in the parish was greatly reduced, although many clergy continued to assist with medical advice . From this time, midwifery services increased, although economic difficulties caused many parishes to resist official requests to employ a midwife (24). In the early 19th century, the northern parishes had among the highest infant mortality in sweden . The imr declined over the 19th century, as a result of improved hygiene, and increased breast - feeding . In many places in sweden, instead, there was a widespread culture of artificial feeding, where undiluted and unboiled cow milk, often sour and of bad quality, replaced breast - feeding . Different sorts of diarrhea were common in those areas, especially during the warm summer months . The combination of hard agricultural work that often prevented mothers from breast - feeding their infants, and the difficulties in preserving fresh milk, resulted in repeated mortality peaks from june to august . Previous research has shown that high levels of artificial feeding of infants lead to higher mortality during the summer months . Nevertheless, many areas in northern sweden experienced a great reduction in infant mortality during the 19th century . In some parishes, it dropped from over 50% to below 18% 50 years later (23). Swedish observers in the 18th century believed that lapland, as spmi was then known, was one of the healthiest places someone could live . It was thought that the fresh air guaranteed a long and strong life . Although some clergy were afraid that the nomadic life that began soon after the birth was harmful, as were the drinking habits of the women, the sami were generally described as healthy: children were given frequent baths and infants were breast - fed for several years (25). It was not until hellstenius in 1884 published an article on infant mortality in the counties of jmtland and hrjedalen, including the south sami area, that the extremely high infant mortality among the sami was revealed . However, hellstenius offered no explanation other than vague ideas about racial differences . Later, wahlund showed a similar infant mortality among sami parishes in the northern area, twice as high as the settlers . Children and adults showed no corresponding increased mortality (26, 27) (fig . Sami infant mortality in jukkasjrvi, jokkmokk, fllinge, and sweden in 17511895 . Registration before 1780 is often incomplete and the imr is unreliable . At the end of the 18th century, sami infant mortality was at the same high level as the rest of sweden, and occasionally even higher, but when the imr declined generally in sweden from 1810, the sami in jukkasjrvi and jokkmokk stayed at high rates . The sami parish of fllinge shows considerably lower rates than the sami in the other two parishes, and until 1850 sami infants in fllinge had much lower mortality than in the rest of sweden . The trend appears to continue with only six infant deaths of 93 births during the period 18501895 . Due to the low overall number of births and deaths, we have excluded 10 year averages for fllinge parish (table 2). Infant mortality (per 1000) in jukkasjrvi, jokkmokk, and fllinge in 17501899 source: demographic database, ume university . There is a general trend of decreasing sami infant mortality in 17501899 . In the northern parish of jukkasjrvi, sami have consistently higher imr than the rest of sweden, but the difference decreases over time . Until 1850, they also have higher rates than the non - sami in the parish, but during the second half of the century, the situation is the opposite . The non - sami in jukkasjrvi experience increased infant mortality over time . Before 1850, the non - sami in jokkmokk also have lower imr than sweden until the mid-19th century . They have an increasing imr trend over time, nevertheless their rates are lower than the sami throughout the period . In fllinge, there are insignificant imr differences between sami and non - sami, and both groups are well below the swedish average . There is an excess infant mortality for males in all three parishes, and for both sami and non - sami (except for non - sami in fllinge). Male and female infant mortality (per 1000) in jukkasjrvi, jokkmokk, and fllinge 17501899 source: demographic database, ume university . The higher male imr is significant for both sami and non - sami in jukkasjrvi and in jokkmokk, but in fllinge only for sami . There is, however, no reason to believe that these differences have any explanatory value for the demographic transition in spmi . It was often claimed that sami families were smaller than non - sami families in the area (28). This was often based on an assumption that a large family was an obstacle to the nomadic life of the reindeer herders (table 4). Infant mortality (per 1000) after parity in jukkasjrvi, jokkmokk, and fllinge 17501899 source: demographic database, ume university . In all three parishes, sami infants born as child number five or more suffered from the highest risk of dying . Although we cannot control for the number of older siblings that were actually alive, it seems clear that large families were less able to avoid infant mortality . The mothers who gave birth for the fifth time or more were also older than those giving birth for the first time . The health status of the mother is an important determinant of infant survival, especially during the first week . Among the sami, first - born infants had the second largest risk of dying, whereas among the non - sami they experienced the greatest risk . The settlers may have lacked the well - developed traditional knowledge needed for dealing with the cold climate and other risks specific to the northern inland area . Both ethnic groups in all parishes had the lowest risks for mortality for infants born as number two, three, or four in the birth order of the mother . The period of study includes great social, political, economic, demographic, and environmental changes . Due to the unreliability of the data during the 18th century, the cox regression analysis is based on results from the period 18001899 (table 5). Cox regression of infant mortality in jokkmokk, jukkasjrvi, and fllinge, 18001899 note: e is the relative risk, p is the p - value for each parameter in the model . The results show geographical differences between the three sami groups . In jokkmokk with an ethnic majority shift around the 1830s, this is also the only parish with the highest mortality risk among the first born infants in 18501899 . The northern parish jukkasjrvi experiences a dramatic shift from twice as high sami infant mortality in18001849 to slightly lower imr compared to the non - sami during the second half of the century . The more balanced the ethnic proportions became, the less differences occurred in infant mortality . In the southern parish of fllinge, sami were a minority from the 18th century, but nevertheless they showed higher imr over the entire period . Generally, a modest male excess mortality is found and less risk for parity 24 . There are no noteworthy seasonal differences, except in fllinge where higher imr appeared among infants born during the winter months january to march . The sample from this parish is too small to include separate analyses for different periods of the 19th century . It was often claimed that sami families were smaller than non - sami families in the area (28). This was often based on an assumption that a large family was an obstacle to the nomadic life of the reindeer herders (table 4). Infant mortality (per 1000) after parity in jukkasjrvi, jokkmokk, and fllinge 17501899 source: demographic database, ume university . In all three parishes, sami infants although we cannot control for the number of older siblings that were actually alive, it seems clear that large families were less able to avoid infant mortality . The mothers who gave birth for the fifth time or more were also older than those giving birth for the first time . The health status of the mother is an important determinant of infant survival, especially during the first week . Among the sami, first - born infants had the second largest risk of dying, whereas among the non - sami they experienced the greatest risk . The settlers may have lacked the well - developed traditional knowledge needed for dealing with the cold climate and other risks specific to the northern inland area . Both ethnic groups in all parishes had the lowest risks for mortality for infants born as number two, three, or four in the birth order of the mother . The period of study includes great social, political, economic, demographic, and environmental changes . Due to the unreliability of the data during the 18th century, the cox regression analysis is based on results from the period 18001899 (table 5). Cox regression of infant mortality in jokkmokk, jukkasjrvi, and fllinge, 18001899 note: e is the relative risk, p is the p - value for each parameter in the model . The results show geographical differences between the three sami groups . In jokkmokk with an ethnic majority shift around the 1830s, this is also the only parish with the highest mortality risk among the first born infants in 18501899 . The northern parish jukkasjrvi experiences a dramatic shift from twice as high sami infant mortality in18001849 to slightly lower imr compared to the non - sami during the second half of the century . The more balanced the ethnic proportions became, the less differences occurred in infant mortality . In the southern parish of fllinge, sami were a minority from the 18th century, but nevertheless they showed higher imr over the entire period . Generally, a modest male excess mortality is found and less risk for parity 24 . There are no noteworthy seasonal differences, except in fllinge where higher imr appeared among infants born during the winter months january to march . The sample from this parish is too small to include separate analyses for different periods of the 19th century . The sami in the northern parishes of jokkmokk and jukkasjrvi had a high imr between 1750 and 1900, whereas the southern sami in fllinge experienced considerably lower levels . If infant mortality is used as an indicator of a positive shift in the demographic, epidemiologic, and health transitions, it can be concluded that by 1900 these transitions had not begun in the northern parts of the area . The non - sami in the area show increased imr over time, and did not follow the decreasing imr in sweden from the 1820s . The indigenous people of northern sweden experienced a delayed process, and at the end of the 19th century, their imr were still above the national average . On the other hand, the trend shows decreasing imr, and we know that the gap between the sami and the rest of sweden was closed around 1950 . Other indigenous peoples of the arctic still have much higher mortality rates, and an imr below 100 was achieved only after 1950 in most countries (29, 30). Between 1910 and 1939, the native people in canada had an imr between 120 and 205 (31). Serning reported remaining ethnic imr differences in jukkasjrvi and jokkmokk for the period 19301948, but they were rapidly decreasing (22). And, from the 1960s, there are no significant mortality differences between sami and non - sami in the area (3). Therefore, the first half of the 20th century is crucial for our understanding of the imr transition in spmi, and hence for our understanding of the sami demographic, epidemiologic, and health transitions . Brndstrm (23) asked if there were reasons to believe that the sami practiced birth control . Contemporary observers claimed that sami women gave birth to few children, rarely more than five or six (31), even if they married at early ages (11). By limiting family size, they may have avoided the increased risk associated with higher order births, and by concentrating births in the seasons with lower risk, they may have improved survival . Cultural responses to infectious diseases and the use of a so - called komse, a small wooden boat box where infants were kept almost constantly for 1 or even 2 years (32, 33) helped in the care of the newborn children . The traditional nomadic life style is important for our understanding of sami infant mortality (25), but there is no reason to believe that hard working conditions caused the sami women to stop breast - feeding their infants, as was often the case in other contexts (34). Reindeer herding was an extreme form of living, and the social organization did not offer any assistance . Sami women either rejoined the continuous travel with the reindeer only a couple of days after giving birth (31) or were left alone with the child in a hut (22). Until the mid-19th century, the sami imr was considerably higher than the non - sami in the area, even though extensive breast - feeding prevented infectious diseases and nutritional deficiencies . We can note cultural differences within spmi, where the south sami joined the low imr of the district of jmtland, whereas the northern parishes remained at higher levels . However, there is no evidence that medical interventions played any significant role in the reduction in infant mortality . The sami rarely had any contact with the district physicians, and midwives were not appointed in the northern parishes until the late 19th century . Kertzer and fricke (35) take a cultural approach to demographic behavior, arguing that from an anthropological perspective, the concept of agency must be given more prominence . They emphasize a cultural sphere that is interwoven with, both shaping and being shaped by, political and economic institutions as well as by kinship and other social organizational structures . The sami population has slowly increased since the 18th century and onwards, and the previous general opinion that the sami were a dying race has been proven to be mistaken . It is the sami culture, and not the sami race, that is under threat today (36). But the path to this point has been long and winding, including great improvements in life expectancy . Infant mortality was a difficult obstacle to overcome, and the final breakthrough did not occur until the 20th century . The authors have not received any funding or benefits from industry to conduct this study.

So far, anthropometric variables and their relation to conventional coronary risk factors in railway employees have been inadequately studied in india . To assess anthropometric variables and their relation to coronary risk factors, this cross - sectional survey was carried out in solapur division of the central railway in the year 2004 . The purpose of this study was to examine the association of obesity with cad risk factors by different anthropometric variables . This particular section of the population was selected, as it comprises all classes of employees, including both sexes, sedentary and nonsedentary job workers of various socioeconomic groups, religions, and from different parts of india . This study was designed to investigate conventional cad risk factors and their relation to anthropometric variables among the solapur division railway employees . This study was conducted among the railway employees of solapur division of the central railway . A proforma was prepared that incorporated information regarding demography (age and sex), anthropometric (height in meter, weight in kilograms, waist and hip circumferences in centimeters) variables, occupation (sedentary or nonsedentary), physical examination (pulse, blood pressure), clinical data (history of diabetes hypertension, smoking, tobacco chewing, exercise), and biochemical investigations [fasting blood sugar level (bsl) and complete lipid profile]. Anthropometric variables were calculated by using the above measurements for body mass index (bmi), waist circumference (wc), waist - to - hip ratio (whr), waist - to - height ratio (whtr), and abdominal volume index (avi). All the eligible employees of both sexes underwent physical, anthropometric examination, and biochemical investigations according to the standard guidelines used earlier . A total of 995 railway employees participated in this cross - sectional survey with age 30 and 60 years . Railway employees were chosen from railway stations, divisional railway mandal office, railway police force (rpf) and railway hospitals . According to the nature of their job, there were 872 men of whom 484 (55.5%) were of age <45 years and 388 (44.5%) were of age 45 years . A total of 123 were females, 58 (48%) were of age <45 years and 65 (52%) were of age 45 years . Blood pressure was measured using a standard mercury sphygmomanometer under standard conditions as mentioned in cardiovascular survey methods . Biochemical investigations were performed on an automated analyzer by using the kit provided by accurex biomedical pvt . Ltd . (iso 13485: 2003, iso 9001: 2008 & ce certified mumbai, india). Was measured by cholesterol oxidase (chod) phenol + aminophenazone (pap) enzymatic colorimetric technique . Triglyceride (trg) was measured by glycerol-3-phosphate oxidase (gpo) peroxidase (pod) enzymatic technique . Bsl fasting was done by glucose oxidase (god) peroxidase (pod) enzymatase by autoenzyme technique . Each person was examined for height, weight, wc, and hip circumference without shoes and chappals with minimal clothing as per cardiovascular survey methods . Bmi was calculated by formula of weight in kg / height m. whr was calculated by wc / hc in centimeters . Avi was calculated using volume formulas for cylinder (v = rh) and vertical cone v = (1/3)rh . The formula developed was avi = [2 cm (waist) + 0.7 cm (wc hc)]/1000, which estimates overall abdominal volume between symphysis of pubis and xiphoid appendix and theoretically includes intra - abdominal fat and adipose tissue volumes . A smoker in india consumes tobacco in the form of bidi / cigarettes and chewing tobacco . A person smoking one or more cigarettes or bidis per day at the time of study was considered as a smoker and one chewing tobacco currently, a tobacco chewer . In the present study, tobacco consumption in the form of smoking and in the form of tobacco chewing were grouped separately.physical activity according to the type of job were classified as, nonsedentary job (moderate to heavy physical activity)sedentary job (low physical activity) physical activity was classified into 2 levels, moderate to high physical activity was referred as nonsedentary (rpf, drivers, gangmen, and others)low physical activity referred (sedentary) to people involved in office work, research work, and so on . A smoker in india consumes tobacco in the form of bidi / cigarettes and chewing tobacco . A person smoking one or more cigarettes or bidis per day at the time of study was considered as a smoker and one chewing tobacco currently, a tobacco chewer . In the present study, tobacco consumption in the form of smoking and in the form of tobacco chewing were grouped separately . Physical activity according to the type of job were classified as, nonsedentary job (moderate to heavy physical activity) sedentary job (low physical activity) physical activity was classified into 2 levels, moderate to high physical activity was referred as nonsedentary (rpf, drivers, gangmen, and others) low physical activity referred (sedentary) to people involved in office work, research work, and so on . Cutoffs for high wc were> 85 cm for females and> 90 cm for males . Cutoffs for high avi was calculated by receiver - operator characteristic (roc) curve 16.48 liter . Diabetes mellitus (dm): if a subject is a known diabetic on treatment with any bsl or if fasting bsl (f - bsl) 126 mg / dl . Dyslipidemia was defined as if, t - cho 200 mg / dl, ldl, cholesterol 130 mg / dl, hdl, cholesterol 40 mg / dl, trg 150 mg / dl . Hypertension was labeled if blood pressure 140 mmhg sbp and 90 mmhg dbp or known to be hypertensive on treatment with any blood pressure . The data were pooled, computerized, and analyzed by evaluation version of epi info . 6 [(epi info is public domain statistical software for epidemiology developed by centers for disease control and prevention (cdc) in atlanta, georgia (usa)]. Correlation of anthropometric variables and coronary risk factors in different age groups were determined using r and multiple linear regression analysis . Roc curve is used to find out the cutoff point for particular value of a test as a diagnostic test . Cutoff values of whtr and avi were calculated by using this curve as a tool for diagnosing central obesity . Correlation (r): r = 0.8 (high correlation coefficient), r= 0.40.7 (moderate correlation), and r= 0.3 and above (low correlation coefficient). Each person was examined for height, weight, wc, and hip circumference without shoes and chappals with minimal clothing as per cardiovascular survey methods . Bmi was calculated by formula of weight in kg / height m. whr was calculated by wc / hc in centimeters . Avi was calculated using volume formulas for cylinder (v = rh) and vertical cone v = (1/3)rh . The formula developed was avi = [2 cm (waist) + 0.7 cm (wc hc)]/1000, which estimates overall abdominal volume between symphysis of pubis and xiphoid appendix and theoretically includes intra - abdominal fat and adipose tissue volumes . A smoker in india consumes tobacco in the form of bidi / cigarettes and chewing tobacco . A person smoking one or more cigarettes or bidis per day at the time of study was considered as a smoker and one chewing tobacco currently, a tobacco chewer . In the present study, tobacco consumption in the form of smoking and in the form of tobacco chewing were grouped separately.physical activity according to the type of job were classified as, nonsedentary job (moderate to heavy physical activity)sedentary job (low physical activity) physical activity was classified into 2 levels, moderate to high physical activity was referred as nonsedentary (rpf, drivers, gangmen, and others)low physical activity referred (sedentary) to people involved in office work, research work, and so on . A smoker in india consumes tobacco in the form of bidi / cigarettes and chewing tobacco . A person smoking one or more cigarettes or bidis per day at the time of study was considered as a smoker and one chewing tobacco currently, a tobacco chewer . In the present study, tobacco consumption in the form of smoking and in the form of tobacco chewing were grouped separately . Physical activity according to the type of job were classified as, nonsedentary job (moderate to heavy physical activity) sedentary job (low physical activity) physical activity was classified into 2 levels, moderate to high physical activity was referred as nonsedentary (rpf, drivers, gangmen, and others) low physical activity referred (sedentary) to people involved in office work, research work, and so on . Cutoffs for high wc were> 85 cm for females and> 90 cm for males . Cutoffs for high avi was calculated by receiver - operator characteristic (roc) curve 16.48 liter . Diabetes mellitus (dm): if a subject is a known diabetic on treatment with any bsl or if fasting bsl (f - bsl) 126 mg / dl . Dyslipidemia was defined as if, t - cho 200 mg / dl, ldl, cholesterol 130 mg / dl, hdl, cholesterol 40 mg / dl, trg 150 mg / dl . Hypertension was labeled if blood pressure 140 mmhg sbp and 90 mmhg dbp or known to be hypertensive on treatment with any blood pressure . The data were pooled, computerized, and analyzed by evaluation version of epi info . 6 [(epi info is public domain statistical software for epidemiology developed by centers for disease control and prevention (cdc) in atlanta, georgia (usa)]. Correlation of anthropometric variables and coronary risk factors in different age groups were determined using r and multiple linear regression analysis . Roc curve is used to find out the cutoff point for particular value of a test as a diagnostic test . Cutoff values of whtr and avi were calculated by using this curve as a tool for diagnosing central obesity . Correlation (r): r = 0.8 (high correlation coefficient), r= 0.40.7 (moderate correlation), and r= 0.3 and above (low correlation coefficient). A total of 872 (87.63%) were males and 123 (12.36%) were females . All of them underwent physical examination, and anthropometric measurements for ht, wt, hc, and wc, but only 605 males and 95 females underwent biochemical investigations with a response rate of 69.15%in males and 77.23% in females . The subjects were 45 years of age; 388 (53.35%) males and 65 (52.84%) females . High sbp was present in 290 (33.25%) males and 32 (26.03%) females . High dbp was present in 304 (34.86%) males and 37 (30.08%) females . Physical inactivity was present in 767 (87.95%) males and 102 (82.92%) females . Tobacco chewing was present in 178 (20.41%) males and 12 (9.75%) females . Smoking was present in 151 (17.31%) males and 2 (1.62%) females . High bmi was present in 172 (19.72%) males and 73 (59.34%) females . High wc was present in 412 (47.24%) males and 98 (79.67%) females . High whr was present in 504 (57.79%) males and 90 (73.17%) females . High whtr was present in 699 (80.16%) males and 103 (83.73%) females . High avi was present in 359 (41.16%) males and 35 (28.45%) females . Dm was present in 51 (8.42%) males and 2 (2.10%) females . Low hdl was present in 248 (40.99%) males and 15 (15.78%) females . High ldl was present in 117 (19.33%) males and 23 (24.21%) females . High t - cho was present in 151 (24.95%) males and 34 (35.78%) females . High trg was present in 275 (45.45%) males and 19 (20%) females [table 1]. Prevalence of coronary artery disease risk factors in both males and females, all the anthropometric variables were high . Most prevalent obesity index in male population was high whtr . In female population, the most prevalent obesity index was high whtr . Prevalence of overall and central obesity was comparatively more in female population for all the variables as shown in table 2 . Mean age, bmi, and low hdl levels were comparatively higher in females, whereas mean sbp, dbp, trg, whr, wc, and whtr were comparatively higher in males . Standard deviation values of quantitative data in male and female population are shown in table 3 . Prevalence of obesity indices standard deviation values of quantitative data in male and female population total 65 females were with age 45 years and 58 with age <45 years . In female population, high whr in age 45 years was present in 58 (47.15%). In females only high bmi was statistically significant in age 45 years with p value <0.001 . Males totalling 388 were of the age 45 years and 484 females were <45 years of age . In male population, 45 years of age, a high whr was present in 262 (30.04%). A high bmi in age 45 years was present in 90 (10.32%). A high wc in age 45 years was present in 207 (23.73%). High avi in age 45 years was present in 279 (31.99%). In males, all anthropometric variables, such as whr, whtr, bmi, wc, and avi, were significantly raised, in the age group 45 years with p value <0.001 . Bmi had partial positive correlation (moderate to low) with coronary risk factors, such as age weight, sbp, dbp, f - bsl, t - cho, ldl cholesterol, trg, and other anthropometric variables . Whr had partial positive correlation (moderate to low) with coronary risk factors, such as age, height, weight, sbp, dbp, f - bsl, total, trg, and other anthropometric variables . Whtr had partial positive correlation (moderate to low) with coronary risk factors, such as age, weight, sbp, dbp, f - bsl, ldl cholesterol, trg, and other anthropometric variables . Wc had partial positive correlation (moderate to low) with coronary risk factors, such as age, weight, height, sbp, dbp, f - bsl, trg, and other anthropometric variables . Avi had partial positive correlation (moderate to low) with coronary risk factors, such as age, weight, height, sbp, dbp, f - bsl, trg, and other anthropometric variables [table 4]. In male population, age 45 years had odds ratio of 2.15 with whtr and 1.95 with avi . Sbp had an odds ratio of 2.0 with bmi, 1.47 with wc, and 1.48 with avi . Correlation of anthropometric indices with coronary artery disease risk factors in female population, age 45 years had an odds ratio of 1.673 with bmi . Sedentary job had an odds ratio of 2.0 with whr, 1.86 with wc, and 1.79 with whtr . Sbp had an odds ratio of 1.48 with avi and dbp had an odds ratio of 1.34 with wc . We have found that age 45 years was better correlated with high values of bmi, wc, whr, whtr, and avi . High sbp, high dbp, and sedentary job were significantly and positively correlated with high values of bmi, wc, whr, whtr and avi . High values of bmi, wc, whr, whtr, and avi were negatively associated with physical inactivity . Tobacco and smoking were negatively correlated with high values of bmi, wc, whr, and whtr . Dm was statistically significant and positively associated with high values of bmi, wc, whr, whtr, and avi . In dyslipidemia low hdl was correlated with high values of whr, whtr, and avi, whereas ldl cholesterol, t - cho, and trg were correlated only with high bmi and high whtr in this population [table 4]. In multiple regression analysis a model was utilized that included age, bmi, whr, whtr, wc, avi, sbp, dbp, plasma t - cho, trg, and smoking . This revealed age, whtr, and whr as an independent determinant of most of the cad risk factors in both genders . Multiple regression analysis for whtr and whr showed that both of them were significantly associated with most of the cad risk factors, such as age 45 years, high sbp, high dbp, dm, low hdl, high ldl, high t - cho, and high trg [table 5]. Relation of anthropometric variables and coronary artery disease risk factors in males and females furthermore, the whr was the single independent variable to all or most of the cad risk factors by multiple regression analysis . Multiple logistic regression analysis revealed whtr and whr were significantly associated with age (p <0.001), bmi (p <0.001) dm (p = 0.005), sbp (p <0.001), dbp (p <0.001), low hdl in females, and high trg in males (p <0.001) [figure 1]. Bmi had partial positive correlation (moderate to low) with coronary risk factors, such as age weight, sbp, dbp, f - bsl, t - cho, ldl cholesterol, trg, and other anthropometric variables . Whr had partial positive correlation (moderate to low) with coronary risk factors, such as age, height, weight, sbp, dbp, f - bsl, total, trg, and other anthropometric variables . Whtr had partial positive correlation (moderate to low) with coronary risk factors, such as age, weight, sbp, dbp, f - bsl, ldl cholesterol, trg, and other anthropometric variables . Wc had partial positive correlation (moderate to low) with coronary risk factors, such as age, weight, height, sbp, dbp, f - bsl, trg, and other anthropometric variables . Avi had partial positive correlation (moderate to low) with coronary risk factors, such as age, weight, height, sbp, dbp, f - bsl, trg, and other anthropometric variables [table 4]. In male population, age 45 years had odds ratio of 2.15 with whtr and 1.95 with avi . Sedentary job had an odds ratio of 1.402 with bmi . Sbp had an odds ratio of 2.0 with bmi, 1.47 with wc, and 1.48 with avi . Correlation of anthropometric indices with coronary artery disease risk factors in female population, age 45 years had an odds ratio of 1.673 with bmi . Sedentary job had an odds ratio of 2.0 with whr, 1.86 with wc, and 1.79 with whtr . Sbp had an odds ratio of 1.48 with avi and dbp had an odds ratio of 1.34 with wc . We have found that age 45 years was better correlated with high values of bmi, wc, whr, whtr, and avi . High sbp, high dbp, and sedentary job were significantly and positively correlated with high values of bmi, wc, whr, whtr and avi . High values of bmi, wc, whr, whtr, and avi were negatively associated with physical inactivity . Tobacco and smoking were negatively correlated with high values of bmi, wc, whr, and whtr . Dm was statistically significant and positively associated with high values of bmi, wc, whr, whtr, and avi . In dyslipidemia low hdl was correlated with high values of whr, whtr, and avi, whereas ldl cholesterol, t - cho, and trg were correlated only with high bmi and high whtr in this population [table 4]. In multiple regression analysis a model was utilized that included age, bmi, whr, whtr, wc, avi, sbp, dbp, plasma t - cho, trg, and smoking . This revealed age, whtr, and whr as an independent determinant of most of the cad risk factors in both genders . Multiple regression analysis for whtr and whr showed that both of them were significantly associated with most of the cad risk factors, such as age 45 years, high sbp, high dbp, dm, low hdl, high ldl, high t - cho, and high trg [table 5]. Relation of anthropometric variables and coronary artery disease risk factors in males and females furthermore, the whr was the single independent variable to all or most of the cad risk factors by multiple regression analysis . Multiple logistic regression analysis revealed whtr and whr were significantly associated with age (p <0.001), bmi (p <0.001) dm (p = 0.005), sbp (p <0.001), dbp (p <0.001), low hdl in females, and high trg in males (p <0.001) [figure 1]. Conventional cad risk factors, such as physical inactivity, central obesity, hypertension, low hdl, age 45 years, and hypertriglyceridemia were highly prevalent in males, whereas physical inactivity, central obesity, hypertension, age 45 years, and hypercholesterolemia were highly prevalent in female population . Compared to overall obesity, central obesity was better correlated with most of the cad risk factors . Whtr was better predictive of cad risk factors than wc and whr in present study . Cutoff value for whtr has not been calculated for the indian population, hence further studies are required for calculation in the indian context . In the present study, whtr was a powerful predictor of most of the cad risk factors, whereas whr, wc, and avi were next to it in a decreasing order . We have compared our results with various studies in which lin et al in a general population study reported that, whtr is a better indicator for predicting cvd risk factors than the other 3 indices (bmi, wc, and whr) in taiwan, which is comparable with our study . Lin et al and hsieh et al also stated that whtr is a better predictor of most of the cad risk factors than whr, wc, and bmi . Huang et al in a general population study in taiwan found that the 4 anthropometric indices (bmi, wc, whr, and whtr) are closely related to cardiovascular risk factors, which is comparable with our study . The results of misra et al indicated a high prevalence of diabetes, obesity, and dyslipidemia in urban slum population in northern india in middle age, particularly in females, which is comparable with our study . Guerrero - romero et al in their study of 746 men and nonpregnant women randomly recruited from durango city in northern mexico, stated that avi is reliable and shown to be strongly related to igt and dm, which is comparable with our study, but they have not correlated the association with other cad risk factors, such as hypertension, dyslipidemia, and physical inactivity . In southern andhra pradesh, india, a study of randomly selected urban and rural population by venkatramana et al suggested that bmi and wc are better indicators of cad risk factors, which is partially comparable with our study as other anthropometric variables have not been used in their study . Reeder et al in 5 canadian provinces (alberta, manitoba, ontario, quebec, and saskatchewan) general population study, found that wc was the measure of abdominal obesity most highly correlated with cardiovascular disease risk factors, which is partially comparable with our study . In omani population al - riyami and afifi, in their study among male adults aged 20 years and above in a community - based survey as a part of the national health survey, reported that current smokers were of low bmi compared with nonsmokers and exsmokers and currently light smokers were also of low bmi compared with exsmokers, which is comparable with our study . Ledoux et al, in a canadian general population study stated that the wc and bmi correlate most closely with blood pressure and plasma lipids, which is comparable with the present study . Onat et al, in a random sample of turkish general adult population, observed that the wc and whr were strongly associated with bmi and dbp and plasma trg in turkish women, which is similar to and comparable with our results . Hsieh et al, in a study found that, the whtr and whr increased with age in both the genders, which is comparable with our results . Rosmond et al, in a selected population study, reported that obesity (bmi) and centralization of body fat stores (whr) are differently associated with occupational factors as well as leisure time activities . Hu et al reported that television watching and other sedentary behaviors are related to risk of obesity and type 2 dm in women . Both these studies are comparable with the current study . Slattery et al in a study of the us railroad population quoted that occupationally and leisure time physically inactive employees are at a higher risk of developing cad risk factors and cardiovascular death, which is consistent with the current study . Several studies showed that smokers have, on an average, lower bmi than nonsmokers and that smoking cessation is often associated with weight gain . In the present study, whtr has been found to be significantly and positively associated with most of the cad risk factors, hence whtr can be used routinely as an anthropometric tool for prediction of cad risk factors in epidemiologic studies. [2529] the other parameters of coronary artery risk [c - reactive protein (crp), homocysteine, and others] have not been done in the present study because of limitations of study to conventional cad risk factors and resource limitations . Other cad risk factors, such as hyperhomocysteinemia, have not shown a robust utility in chd risk stratification, and there are no clinical trial data showing that intervention to lower homocysteine levels reduces chd events . Measurement of homocysteine levels should be reserved for individuals with atherosclerosis at a young age or out of proportion to established risk factors . Elevations in acute - phase reactants, such as fibrinogen or crp, may reflect overall atherosclerotic burden or extravascular inflammation that could potentiate atherosclerosis or its complications . Crp measured by high - sensitivity assay, adds predictive information to that derived from established coronary artery risk factors, such as cholesterol . Elevated levels of the acute - phase reactant crp and fibrinogen may merely reflect ongoing inflammation rather than a direct etiologic role for crp in cad . In the present study, the prevalence of metabolic syndrome (using atp iii criteria modified for indians) was 25.17% in males and 27.35% in females . Among all the components of metabolic syndrome, high wc was most prevalent in females and systolic hypertension in males . In the current study, the most common cad risk factor was truncal obesity in the solapur division railway employees . Generalized obesity, overweight, and central obesity problem was more prevalent in subjects with age 45 years, sedentary job, physical inactivity, and female gender . There was a significant lack of physical activity and exercise among sedentary job workers, leading to overweight and obesity . Generalized obesity, overweight, and central obesity were significantly correlated with cad risk factors, such as age 45 years, dyslipidemia, hypertension, dm, and physical inactivity . Central obesity measured by whtr was strongly correlated with majority of cad risk factors than whr, wc, and avi . These observations serve to underline the central role of overweight / obesity and the additive deleterious effects of abdominal obesity in the pathogenesis of lipid and carbohydrate metabolism, leading to chd and type 2 dm, and hypertension . The present study shows a disturbing burden of coronary risk factors mainly truncal obesity, physical inactivity, hypertension in a sample population of railway employees . There is an urgent need to undertake population - based measures to reverse the trend . Out of all the anthropometric variables, whtr was significantly and positively associated with most of the cad risk factors, hence whtr can be used routinely as an anthropometric tool for prediction of cad risk factors in epidemiologic studies . By preventing obesity and overweight, a substantial part of chd mortality may be prevented because a majority of the cad risk factors are strongly correlated with anthropometric indices . We concluded that weight control should be an integral part of the prevention of cardiovascular disease . Turn in obesity express highway probably lies in lifestyle modifications, going back to a traditional lifestyle with a judicious use of modern technology.

Polymerase chain reaction (pcr) is a commonly used laboratory procedure nowadays for a variety of tasks, such as dna cloning, sequence determination and snp detection . Consequently, numerous primers need to be designed for dna amplification in order to produce enough dna . For dna sequencing, to design primers for the promoter and exon regions of a gene, one needs to retrieve the required sequence information for each single exon and promoter, including their corresponding flanking sequences, convert them to the correct format, switch to a primer design application like primer 3 (1), import the sequence information and adjust parameter settings if necessary before submitting the request . While this is tolerable for primer design for a gene that has a single exon, a human, mouse or rat gene can easily have more than 10 exons, and each of the above steps may thus need to be repeated 10 times or more . Furthermore, if an exon is too long to sequence properly in one run, several primers have to be designed to map overlapping sections of the exon . The whole process requires many manual steps for repeated window opening, browsing, application switching, copying and pasting, typing and so on, which can be tedious, time - consuming and error prone . In fact, for a gene with 10 exons, the process can easily exceed 300 steps . To improve the situation, we have developed primerz to replace almost all of these manual steps so that users can easily complete a primer design task using just a few clicks for a gene or batched human snps . More than 2000 primers have been designed with primerz at our institute since 2004 and the success rate is over 70% . There are a multitude of user - definable options available including product size, maximum exon length, excluded regions of the query sequence, gc - content and maximum allowable local alignment score . Simply by submitting a candidate gene name, a snp i d or up to 100 batched snp ids, in most cases all the primer sequences should be returned in a minute or two . The generated information, including gene transcript graph, primer data from primer3, and direct links to ucsc in - silico pcr (3,4) for pcr product prediction, to ncbi blast and to ensembl source data, is integrated and displayed on a single page for convenient viewing . Additionally, all the primer data can be exported in csv format for further processing . Primerz takes advantage of the well - developed public - domain database ensembl, through its api (application programming interface). When a gene query is received, primerz will access the ensembl database through ensj api (5) to retrieve promoter and exon information . By default but with an adjustable setting, primerz retrieves one region of 1440 bp upstream from the start of 5-utr which it treats as the promoter region . The promoter region is thereafter divided into four 360 bp non - overlapping segments plus their respective flanking sequences . All exons are directly flanked with 240 bp sequences, except when an exon of the gene is> 360 bp, when the sequence will be split into segments of 360 bp for a better quality sequencing result . For example, an exon of 1000 bp will produce two 360 bp segments and one 280 bp segment . The above sequence information, plus parametric settings packaged by primerz are then fed into primer3 for primer design . All returned primer results, together with a transcript graph, are integrated into a one - page report for final output . The self - explanatory workflow of the whole primerz system is shown in figure 1 . The software development environment included the following software: java, jdk: j2sdk1.4.2_06, server vmstruts framework 1.2red hat enterprise linux academic editionmysql 4.1tomcat 5.0 web serverensembl java api java, jdk: j2sdk1.4.2_06, server vm red hat enterprise linux academic edition tomcat 5.0 web server the api provided by ensembl is used for gene information retrieval . Java language is used to pipeline gene data into primer 3 and merge the returned results . Primerz is an easy - to - use tool to design primers for genes and snps, using only a few simple steps to design the wanted primers . It currently provides gene primer design for all ensembl species while snp primer design is currently only available for human snps . For gene primer design, there are some essential parameters required for optimal design of primers, such as maximum exon length, exon flanking region, product size range and excluded region . The excluded region value allows the program to bypass regions with low sequence quality or containing repetitive elements such as alus or lines for primer design . For snp primer design, a snp rsid or an affy_probid(6) as well as a batch file containing mixed i d types can be accepted as input, where the maximum number of snps per batch is limited to 100 . The result page comprises three major parts: initial input data and parameters, the gene transcript diagram (only available for gene primer design) and designed primer information . The first part lists all the input data and parameters plus ensembl database version, for ease of reference . The second part shows each promoter fragment and exon of a transcript diagram, and links to their accompanying original primer3 output . Finally, the third section presents tabulated primer information and incorporates executable links to ncbi blast and ucsc in - silico pcr to check specificity and product prediction . Ensembl link button offers the ensembl exon report of the transcript so that a user can trace all primers to their original sequence information . A csv format text file of the results can be downloaded at this results page . In a manual operation benchmarking test, it took a person very familiar with all processes about 1260 s and 380 discrete steps to design the primers of hadhsc (l-3-hydroxyacyl - coenzyme a dehydrogenase, short chain), our benchmark gene with 10 exons . With automated primerz, the same operation took only 16 s and three steps . This comparison clearly demonstrates the superior efficiency and ease - of - use of primerz for gene primer design . A benchmark test on batched snps showed a similar dramatic reduction in workload from 90 discrete steps to two steps, from 840 to 49 s, and from 40 result pages to a single page . Primerz has been designed to obtain reliable primers for pcr experiments and to allow standardized, automated primer design for batch operation . Users can access the ucsc in - silico pcr directly from the result page to verify their primers to achieve higher accuracy and lower cost . Primerz also allows users to modify the conditions of primer design, including the maximum exon size, the flanking region of the target sequence, the exclusion region and the maximum allowed polya and ca - repeats in the pcr products . In addition, primerz will offer primer design from ncbi transcripts in the near future, which should be of great interest to those users who use ncbi data to design primers . The results from ncbi and ensembl will be shown in the same page . Following the release of primer3 web interface in november 2006, we are installing and testing a local copy of primer3 web to alleviate the burden on the original primer3 website and the restriction on the number of snps allowed . Primer z is a simple - to - use program that greatly facilitates and enhances the traditionally time - consuming task of accurate primer design for pcr, and should be an excellent additional tool for the modern molecular biologist.

The prevalence rates of t2 dm increase with age, and older people are a growing population that account for a high proportion of cases among adults . Older patients are more likely to present cardiovascular complications and comorbid conditions, which entail specific goals to control the disease . However, elderly patients are systematically excluded from clinical trials, and there is also a lack of reliable data on the response to pharmacological treatments in this age group . In a primary care reallife setting, t2 dm patients in the older age subgroup (> 65 years) had a better control of glycaemic targets and cardiovascular risk factors than younger patients in spite of having a higher prevalence of chronic complications . Moreover, this age subgroup was less intensively treated with glucoselowering and lipidlowering drugs than younger patients . T2 dm in elderly people should be clinically managed taking into account the observed differential agerelated pattern of the disease . Type 2 diabetes mellitus (t2 dm) has become one of the most serious and challenging public health issues of our time, and the human, social and economic burden associated with the disease has dramatically increased over the past few decades . According to the international diabetes federation 382 million people worldwide have diabetes, and 316 million are at high risk of developing t2 dm 1 . In spain, a recent epidemiological survey estimated that the prevalence rate of t2 dm is around 13.8%, and that about 6% of the spanish population is unaware of their disease 2 . Moreover, the study showed that diabetes is more frequent in men and prevalence rates increase with age 2 . The global prevalence of diabetes in people 6079 years of age has been estimated to be 18.6% 1; the prevalence of diagnosed diabetes in the united states in subjects 75 years was 20% in 2012, which is more than eightfold the rate reported among adults aged 1844 years (2.4%) 3 . Similar prevalence rates have been found in spain, with 40% of the population aged 75 years and over having known diabetes (41.3% of women and 37.4% of men) 2 . The strong link between age and diabetes is of concern if we take into account the progressive increase in life expectancy, which is likely to result in a substantial increase in the number of older people with diabetes, and a concomitant increase in the costs for the health system in the near future . There is compelling evidence that older onsetdiabetes has differential characteristics compared with onset in middleaged or earlier populations 4 . On the one hand, the disease starts insidiously in people 65 years and over, and remains frequently undiagnosed until a routine analysis is performed or after the subject is admitted to a hospital for any other reason . On the other hand, older people are more likely to present cardiovascular complications, have higher rates of comorbid conditions, mortality, and prevalence of geriatric syndromes (e.g. Cognitive dysfunction, functional impairment, frailty, falls and fractures, polypharmacy, depression, vision and hear impairment, persistent pain, urinary incontinence) than older people without diabetes 5 . Finally, some studies report that older adults have a worse glycaemic control than other age groups with diabetes 6, and have the highest rates of hyperglycaemic crises and also of hypoglycaemia episodes requiring emergency department visits 5 . Although recommendations in clinical guidelines may vary per country, decisionmaking should not be in general based on the age of the patient but on a combination of factors including general health status and functional and cognitive ability, among others 4, 5, 7, 8 . Thus, in elderly individuals with preserved cognitive and functional abilities and a good life expectancy, the recommendation is a glycated haemoglobin goal similar to that recommended for younger adults . Conversely, the goal for glycaemic control in frail elderly subjects not meeting the above criteria or with greater hypoglycaemia vulnerability should be more relaxed, as the short life expectancy precludes the medium and longterm benefits resulting from very tight control goals 4, 9 . Indeed, the benefits associated with glycaemic control require 510 years to reduce the incidence of microvascular complications 4, 10, and it is not yet certain whether it has an actual impact in the incidence of cardiovascular disease (cvd) in these patients . The objective of the present populationbased crosssectional study was to retrospectively assess and compare the clinical characteristics, degree of glycaemic and cardiovascular risk factors control, treatments, and diabetesrelated complications between older t2 dm patients and younger adults in a primary care population database in catalonia, spain . Secondarily, we aimed to compare these same variables stratifying by gender and different age subgroups . Descriptive, populationbased, crosssectional study at the primary care setting in catalonia, spain . Data were extracted from sidiap (information system for the development of research in primary care) 11, which is a computerised database containing anonymised patient's records for the 5.8 million people attended by general practitioners in the catalan health institute . Sidiap includes data on demographic variables, diagnoses, clinical variables, prescriptions, specialist referrals, laboratory test results, and medications withdrawn from pharmacist offices, obtained from the catsalut general database . Data were obtained for patients 30 years diagnosed with t2 dm by 31 december 2011 and attended a primary care centre during 2011 . Patients with type 1 diabetes mellitus or gestational diabetes were excluded . For the objective of the study, we extracted demographic data, including age (further categorised into age subgroups: 65, 6675, 7685, and> 85 years) and sex; clinical variables included diabetes duration; smoking status; body mass index (bmi); blood pressure (bp) (systolic and diastolic); standardised glycated haemoglobin (hba1c) values; lipid levels including total cholesterol (tc), lowdensity lipoproteins or ldl cholesterol (ldlc), highdensity lipoproteins or hdl cholesterol (hdlc), nonhdl cholesterol, and triglycerides (tg), estimated glomerular filtration rate (egfr) using the modified diet in renal disease (mdrd4) formula and urine albumintocreatinine ratio (acr). Values of clinical variables corresponded to the most recent registered value in the last 15 months except for bmi, which was the most recent value in the last 24 months, and smoking status, which corresponded to the most recent information recorded in the medical history . As for comorbidities, the diagnose of hypertension and/or dyslipidaemia was considered if mentioned in an active record up to the cutoff date, and we also extracted information on the presence of diabetesrelated chronic complications, namely ischaemic heart disease, heart failure, stroke, peripheral artery disease, diabetic retinopathy and chronic kidney disease (defined according to egfrmdrd4 and acr values). Control of cv risk factors were defined as follows: no current smoking; bmi <30 kg / m; bp <140/90 mmhg; hba1c 7% (53.0 mmol / mol); tc 250 mg / dl; ldlc <130 mg / dl for patients without cvd and <100 mg / dl for those with cvd; hdlc> 50 mg / dl for women and> 40 mg / dl for men; and tg 150 mg / dl . A descriptive analysis was performed stratified by gender and age subgroup . For qualitative variables, proportions and means were compared by pearson's chisquared test and analysis of variance (anova), respectively . All hypothesis contrasts were bidirectional and the statistical significance level was set at 0.05 . Moreover, the prevalence of diabetesrelated complications and the degree of glycaemic control was studied stratifying by t2 dm duration (5, 510, 1020 and> 20 years). All analyses were performed with stata / se version 13 for windows (stata corp ., college station, tx, usa) and r software version 3.0.1 (the r foundation for statistical computing, vienna, austria). Descriptive, populationbased, crosssectional study at the primary care setting in catalonia, spain . Data were extracted from sidiap (information system for the development of research in primary care) 11, which is a computerised database containing anonymised patient's records for the 5.8 million people attended by general practitioners in the catalan health institute . Sidiap includes data on demographic variables, diagnoses, clinical variables, prescriptions, specialist referrals, laboratory test results, and medications withdrawn from pharmacist offices, obtained from the catsalut general database . Data were obtained for patients 30 years diagnosed with t2 dm by 31 december 2011 and attended a primary care centre during 2011 . Patients with type 1 diabetes mellitus or gestational diabetes were excluded . For the objective of the study, we extracted demographic data, including age (further categorised into age subgroups: 65, 6675, 7685, and> 85 years) and sex; clinical variables included diabetes duration; smoking status; body mass index (bmi); blood pressure (bp) (systolic and diastolic); standardised glycated haemoglobin (hba1c) values; lipid levels including total cholesterol (tc), lowdensity lipoproteins or ldl cholesterol (ldlc), highdensity lipoproteins or hdl cholesterol (hdlc), nonhdl cholesterol, and triglycerides (tg), estimated glomerular filtration rate (egfr) using the modified diet in renal disease (mdrd4) formula and urine albumintocreatinine ratio (acr). Values of clinical variables corresponded to the most recent registered value in the last 15 months except for bmi, which was the most recent value in the last 24 months, and smoking status, which corresponded to the most recent information recorded in the medical history . As for comorbidities, the diagnose of hypertension and/or dyslipidaemia was considered if mentioned in an active record up to the cutoff date, and we also extracted information on the presence of diabetesrelated chronic complications, namely ischaemic heart disease, heart failure, stroke, peripheral artery disease, diabetic retinopathy and chronic kidney disease (defined according to egfrmdrd4 and acr values). Control of cv risk factors were defined as follows: no current smoking; bmi <30 kg / m; bp <140/90 mmhg; hba1c 7% (53.0 mmol / mol); tc 250 mg / dl; ldlc <130 mg / dl for patients without cvd and <100 mg / dl for those with cvd; hdlc> 50 mg / dl for women and> 40 mg / dl for men; and tg 150 mg / dl . A descriptive analysis was performed stratified by gender and age subgroup . For qualitative variables, proportions and means were compared by pearson's chisquared test and analysis of variance (anova), respectively . All hypothesis contrasts were bidirectional and the statistical significance level was set at 0.05 . Moreover, the prevalence of diabetesrelated complications and the degree of glycaemic control was studied stratifying by t2 dm duration (5, 510, 1020 and> 20 years). All analyses were performed with stata / se version 13 for windows (stata corp ., college station, tx, usa) and r software version 3.0.1 (the r foundation for statistical computing, vienna, austria). A total of 318,020 subjects with a diagnosis of t2 dm were included in the study; 53.8% of them were males (n = 171,219; table 1). Mean age of the overall population was 68.8 years (sd = 11.9); the mean age at diagnosis was 61.6 years (sd = 11.7), and the median disease duration was 6.7 years [interquartile range (iqr) = 6.2 years). According to prespecified age categories, 38.0% of subjects were 65 (62.9% males); 29.4% were 6675 (54.3% males); 25.8% were 7685 (45% males); and 6.8% were> 85 years (33.4% males). Demographic and clinical characteristics of the study population by gender and age group the number of patients with available data varied depending on each studied variable . Acr, albumintocreatinine ratio; bmi, body mass index; bp, blood pressure; egfrmdrd, estimated glomerular filtration rate (egfr) using the modified diet in renal disease (mdrd4) formula; hba1c, standardised glycated haemoglobin; hdlc, highdensity lipoproteins hdl cholesterol; ldlc, lowdensity lipoproteins ldl cholesterol; tc, total cholesterol . There was a progressive improvement in glycaemic control values (hba1c) with age in both genders (p <0.001) despite longer diabetes duration in older age groups . In the total sample, kg / m vs. 31.0 kg / m, respectively), and declined with age for both genders (p <0.001). Of note, in both genders the mean values of diastolic bp, tc, ldlc and tg were significantly lower in the older age groups (p <0.001). The average values of egfrmdrd also decreased gradually with age in both genders; thus, the percentage of patients with renal failure (egfr <60 ml / min) and urine acr increased gradually with age in both genders (p <0.001). The degree of control of main cardiovascular risk factors for t2 dm and pharmacological treatments is shown in table 2 . The percentage of subjects with fair glycaemic control (hba1c 7%) was significantly higher among older age groups (p <0.001); moreover, a lower proportion of patients in the older age groups were not well controlled (hba1c> 10%) in spite of having more comorbid conditions . Overall, a 22% of patients in both genders were not taking any glucoselowering drugs . Its use was progressively reduced with increasing age, with a total of 71.5% of men and 68.4% of women older than 85 years taking any glucoselowering agent . However, there was also a parallel increase in the use of insulin with age, particularly in monotherapy . There were no substantial differences in the control of blood pressure (bp 140/90 mmhg) with age, although the control was slightly better among patients 65 years, particularly in women (67.3% vs. 71% of men), while 65.5% of men and 62.9% of women older than 65 years had their bp under control . As for the pharmacological treatment of hypertension, there was a greater proportion of older subjects being pharmacologically treated compared with younger adults, and more frequently treated with a combination of different drugs . Degree of control of main cardiovascular risk factors for t2 dm and pharmacological treatment by gender and age group hba1c 7% = 53 mmol / mol; hba1c 7.5% = 58.5 mmol / mol; hba1c 8.5% = 69.4 mmol / mol; hba1c 10% = 85.8 mmol / mol . Bmi, body mass index; bp, blood pressure; hba1c, standardised glycated haemoglobin; ldlc, lowdensity lipoproteins ldl cholesterol . In both genders, the control of dyslipidaemia, both in patients without cvd and with cvd (ldlc levels <130 mg / dl and <100 mg / dl, respectively) was better among patients 6685 years than in patients 65 years, while in the age group> 85 years the highest values across all age groups was observed . Additionally, lipidlowering drugs were used less frequently by both women and men in the older age groups (p <0.001). As for the use of antiplatelet agents, their use was progressively higher with increasing age (p <0.001), being used by 53.9% of men and 46.2% of women older than 85 years . Finally, the percentage of patients currently smokers decreased with age (p <0.001), and in all age groups there was a much lower proportion of women smokers . As for the combined control of different cardiovascular risk factors (namely hba1c 7%, bp 140/90 mmhg, ldlc <130 mg / dl or 100 mg / dl, and no smoking), it was achieved in 22.6% of men and 24.9% of women 65 years, while these percentages were significantly higher among patients> 65 years, ranging between 29.7% and 35.2% in men, and 29% and 32% in women across older age groups (p <0.001). The prevalence of chronic micro and macrovascular complications associated with t2 dm by gender and age subgroup is shown in table 3 . There was a sharp increase in the frequency of heart failure and all macrovascular complications (ischaemic heart disease, stroke and peripheral artery disease) with increasing age (p <0.001 in all complications). The global prevalence of ischaemic heart disease was 8.6% in women vs. 15.9% in men; the prevalence of stroke was 6.4% in men vs. 5.3% in women; the prevalence of peripheral artery disease was 5.7% in men vs. 2.0% in women; and the prevalence of heart failure was 4.7% in men vs. 6.6% in women . Prevalence of diabetesrelated complications by gender and age subgroup acr, albumintocreatinine ratio; cvd, cardiovascular disease; egfrmdrd, estimated glomerular filtration rate (egfr) using the modified diet in renal disease (mdrd4) formula . As for microvascular complications, diabetic retinopathy was more frequent among patients> 65 years (p <0.001), although taking into account the diabetes duration, there was a progressive decrease in frequency with increasing age, particularly in men (figure 1). The assessment of kidney disease by egfrmdrd showed a progressive increase in renal failure cases (egfrmdrd <60 ml / minute) with age, which was also the case for acr values, and both complications together were observed up to a 20% of men and 19.3% of women older than 85 years compared with a 2.2% of men and 1.9% of women furthermore, albuminuria (acr> 30 mg / mmol) increased with age and was more frequent in men than in women in all age groups (p <0.001). Impact of t2 dm duration, age and gender on the prevalence of diabetic retinopathy (dr) we further studied whether diabetes duration (5 years, 510 years, 1020 years and> 20 years) was related to the degree of glycaemic control and presence of diabetesrelated complications . The older the patients were the higher the percentage achieving a glycaemic goal of hba1c values 7%, and this was true in all age subgroups regardless the duration of t2 dm . Moreover, patients in older age subgroups were more likely to achieve target glycaemic values irrespective of having a cvd or heart failure . For instance, the proportion of patients with a disease duration 15 years and no cvd who achieved target hba1c values 7% was 49% among those aged 65 years, and 54% among those aged 6575 years; in patients with a disease duration> 15 years and cvd, 56% aged 65 years and 83% aged 6575 years achieved target hba1c values 7% and 8.5%, respectively . As for individual diabetesrelated complications, there was a higher prevalence among subjects with a longer duration of t2 dm and increasing age, particularly in those with a disease lasting for more than 20 years . This was true for heart failure (5.4% if t2 dm lasting between 0 and 20 years vs. 10.1% after 20 years of diabetes across age groups, p <0.001), coronary artery disease (12.3% vs. 21.3% after 20 years of diabetes, p <0.001), stroke (5.8%, but 10.8% after 20 years of diabetes, p <0.001) and peripheral artery disease (3.9% vs. 8.6% after 20 years of diabetes, p <0.001). In the case of diabetic retinopathy, patients with a longer duration had also a higher prevalence of diabetic retinopathy (6.7% vs. 26% after 20 years of diabetes, p <0.001) a total of 318,020 subjects with a diagnosis of t2 dm were included in the study; 53.8% of them were males (n = 171,219; table 1). Mean age of the overall population was 68.8 years (sd = 11.9); the mean age at diagnosis was 61.6 years (sd = 11.7), and the median disease duration was 6.7 years [interquartile range (iqr) = 6.2 years). According to prespecified age categories, 38.0% of subjects were 65 (62.9% males); 29.4% were 6675 (54.3% males); 25.8% were 7685 (45% males); and 6.8% were> 85 years (33.4% males). Demographic and clinical characteristics of the study population by gender and age group the number of patients with available data varied depending on each studied variable . Acr, albumintocreatinine ratio; bmi, body mass index; bp, blood pressure; egfrmdrd, estimated glomerular filtration rate (egfr) using the modified diet in renal disease (mdrd4) formula; hba1c, standardised glycated haemoglobin; hdlc, highdensity lipoproteins hdl cholesterol; ldlc, lowdensity lipoproteins ldl cholesterol; tc, total cholesterol . There was a progressive improvement in glycaemic control values (hba1c) with age in both genders (p <0.001) despite longer diabetes duration in older age groups . In the total sample, kg / m vs. 31.0 kg / m, respectively), and declined with age for both genders (p <0.001). Of note, in both genders the mean values of diastolic bp, tc, ldlc and tg were significantly lower in the older age groups (p <0.001). The average values of egfrmdrd also decreased gradually with age in both genders; thus, the percentage of patients with renal failure (egfr <60 ml / min) and urine acr increased gradually with age in both genders (p <0.001). The degree of control of main cardiovascular risk factors for t2 dm and pharmacological treatments is shown in table 2 . The percentage of subjects with fair glycaemic control (hba1c 7%) was significantly higher among older age groups (p <0.001); moreover, a lower proportion of patients in the older age groups were not well controlled (hba1c> 10%) in spite of having more comorbid conditions . Overall, a 22% of patients in both genders were not taking any glucoselowering drugs . Its use was progressively reduced with increasing age, with a total of 71.5% of men and 68.4% of women older than 85 years taking any glucoselowering agent . However, there was also a parallel increase in the use of insulin with age, particularly in monotherapy . There were no substantial differences in the control of blood pressure (bp 140/90 mmhg) with age, although the control was slightly better among patients 65 years, particularly in women (67.3% vs. 71% of men), while 65.5% of men and 62.9% of women older than 65 years had their bp under control . As for the pharmacological treatment of hypertension, there was a greater proportion of older subjects being pharmacologically treated compared with younger adults, and more frequently treated with a combination of different drugs . Degree of control of main cardiovascular risk factors for t2 dm and pharmacological treatment by gender and age group hba1c 7% = 53 mmol / mol; hba1c 7.5% = 58.5 mmol / mol; hba1c 8.5% = 69.4 mmol / mol; hba1c bmi, body mass index; bp, blood pressure; hba1c, standardised glycated haemoglobin; ldlc, lowdensity lipoproteins ldl cholesterol . In both genders, the control of dyslipidaemia, both in patients without cvd and with cvd (ldlc levels <130 mg / dl and <100 mg / dl, respectively) was better among patients 6685 years than in patients 65 years, while in the age group> 85 years the highest values across all age groups was observed . Additionally, lipidlowering drugs were used less frequently by both women and men in the older age groups (p <0.001). As for the use of antiplatelet agents, their use was progressively higher with increasing age (p <0.001), being used by 53.9% of men and 46.2% of women older than 85 years . Finally, the percentage of patients currently smokers decreased with age (p <0.001), and in all age groups there was a much lower proportion of women smokers . As for the combined control of different cardiovascular risk factors (namely hba1c 7%, bp 140/90 mmhg, ldlc <130 mg / dl or 100 mg / dl, and no smoking), it was achieved in 22.6% of men and 24.9% of women 65 years, while these percentages were significantly higher among patients> 65 years, ranging between 29.7% and 35.2% in men, and 29% and 32% in women across older age groups (p <0.001). The prevalence of chronic micro and macrovascular complications associated with t2 dm by gender and age subgroup is shown in table 3 . There was a sharp increase in the frequency of heart failure and all macrovascular complications (ischaemic heart disease, stroke and peripheral artery disease) with increasing age (p <0.001 in all complications). The global prevalence of ischaemic heart disease was 8.6% in women vs. 15.9% in men; the prevalence of stroke was 6.4% in men vs. 5.3% in women; the prevalence of peripheral artery disease was 5.7% in men vs. 2.0% in women; and the prevalence of heart failure was 4.7% in men vs. 6.6% in women . Prevalence of diabetesrelated complications by gender and age subgroup acr, albumintocreatinine ratio; cvd, cardiovascular disease; egfrmdrd, estimated glomerular filtration rate (egfr) using the modified diet in renal disease (mdrd4) formula . As for microvascular complications, diabetic retinopathy was more frequent among patients> 65 years (p <0.001), although taking into account the diabetes duration, there was a progressive decrease in frequency with increasing age, particularly in men (figure 1). The assessment of kidney disease by egfrmdrd showed a progressive increase in renal failure cases (egfrmdrd <60 ml / minute) with age, which was also the case for acr values, and both complications together were observed up to a 20% of men and 19.3% of women older than 85 years compared with a 2.2% of men and 1.9% of women furthermore, albuminuria (acr> 30 mg / mmol) increased with age and was more frequent in men than in women in all age groups (p <0.001). Impact of t2 dm duration, age and gender on the prevalence of diabetic retinopathy (dr) we further studied whether diabetes duration (5 years, 510 years, 1020 years and> 20 years) was related to the degree of glycaemic control and presence of diabetesrelated complications . The older the patients were the higher the percentage achieving a glycaemic goal of hba1c values 7%, and this was true in all age subgroups regardless the duration of t2 dm . Moreover, patients in older age subgroups were more likely to achieve target glycaemic values irrespective of having a cvd or heart failure . For instance, the proportion of patients with a disease duration 15 years and no cvd who achieved target hba1c values 7% was 49% among those aged 65 years, and 54% among those aged 6575 years; in patients with a disease duration> 15 years and cvd, 56% aged 65 years and 83% aged 6575 years achieved target hba1c values 7% and 8.5%, respectively . As for individual diabetesrelated complications, there was a higher prevalence among subjects with a longer duration of t2 dm and increasing age, particularly in those with a disease lasting for more than 20 years . Dm lasting between 0 and 20 years vs. 10.1% after 20 years of diabetes across age groups, p <0.001), coronary artery disease (12.3% vs. 21.3% after 20 years of diabetes, p <0.001), stroke (5.8%, but 10.8% after 20 years of diabetes, p <0.001) and peripheral artery disease (3.9% vs. 8.6% after 20 years of diabetes, p <0.001). In the case of diabetic retinopathy, patients with a longer duration had also a higher prevalence of diabetic retinopathy (6.7% vs. 26% after 20 years of diabetes, p <0.001) older people are a growing population with t2 dm that account for approximately 50% of all cases of diabetes in adults and have differential characteristics, requiring tailored management approaches 1, 5, 8 . The present descriptive study assessed the clinical and characteristics, the degree of glycaemic control, the presence of chronic diabetesrelated complications and the use of pharmacological treatments in a population of 318,020 adults with t2 dm treated in a reallife clinical setting . The results evidenced the existence of different profiles between age groups: except for the control of bp, diabetic patients older than 65 years had a better glycaemic control and a better control of dyslipidaemia, obesity and tobacco smoking than patients 65 years; they were less frequently treated with glucoselowering and lipidlowering drugs, but more frequently with antiplatelet agents . They also had a better control of glycaemic targets and cardiovascular risk factors in spite of a progressive increase in the prevalence of chronic complications with increasing age . We observed a better glycaemic control among elderly patients that was independent of t2 dm duration and the degree of obesity, as it has been previously reported in another crosssectional study 12 . Moreover, glycaemic goals were more often achieved by patients in the older subgroups regardless the presence of a cvd, in accordance with the results from clinical trials and observational studies suggesting that a global control of cardiovascular risk factors in older patients provides a greater benefit regarding morbidity and mortality than an intensive glycaemic control 13, 14, 15, 16, 17 . Antihypertensive treatment, for instance, has benefits even in very old patients 18, 19, 20, 21, and there are also compelling evidences of the benefit of statins and antiplatelet agents in older adults in secondary prevention of cvd, while its use in primary prevention is controversial, and individual characteristics and the risk of related adverse events should be taken into account 5, 7, 22, 23, 24, 25 . There is a lack of data regarding the benefits of the pharmacological treatment of t2 dm among elderly people, mainly because they are systematically excluded from clinical trials, and evidences have been inferred from studies in middleaged adults 5 . From our results, both men and women 65 years used less glucoselowering drugs, albeit with a progressive increase in insulin use with increasing age, which is consistent with the evidence that elderly patients eventually require insulin as a result of the natural progression of the disease but also because of the high prevalence of renal failure that contraindicates other antidiabetic drugs 26, 27 . Moreover, as bp increases with age, older patients used more hypertensive agents than younger patients reaching a similar control of bp . In relation to lipidlowering drugs, they used less, which would be in agreement with the observed better control of dyslipidaemia, although the particular subgroup 85 years had the worse level of control across all age groups . This is probably because of the fact that they were using less lipidlowering drugs because general practitioners do not prescribe them based on the scarce evidences on the benefits of statins in very old people . As expected, increasing age was associated with a parallel increase in the prevalence of micro and macrovascular complications except for retinopathy, which decreased after 85 years, and they were more frequent in men . This pattern was dependent on the diabetes duration and also on the degree of obesity in the case of heart failure, which suggests that control and prevention of cvds must be an important goal based not only on the age of the patient but also on disease's duration . The main strength is that this is the largest crosssectional study conducted in spain to study t2 dm in older population through the use of a large primary care database with high quality records previously validated in other studies 28, 29, and that is closer to the reallife clinical practice than randomised clinical trials, which usually exclude elderly patients . However, no causal associations between risk factors and presence of diabetesrelated complications can be drawn because of the crosssectional design, and we estimated the strength of these associations stratifying by other variables . Moreover, the retrospective records for diabetic neuropathy were also scarce, probably because it is difficult to diagnose and there is a lack of uniform diagnostic criteria . In addition, and inherent to all crosssectional studies conducted in elderly populations, there is a survival bias because patients with diabetesrelated complications, poor control and/or severe forms of t2 dm usually die at a younger age than patients with a late onset and/or well controlled disease . It is possible that those who survive have different metabolic characteristics and also a slower decline of beta cell function in the natural history of t2 dm than those who do not survive . Avoidance of this bias could only be addressed through the design of prospective controlled longterm followup studies . Finally, mortality could have also impacted the prevalence of particular factors and complications, as populations at high risk have greater mortality rates and therefore survivors in older age groups have a lesser prevalence than actually expected . Patients with t2 dm older than 65 years have a better glycaemic control and a better global control of cardiovascular risk factors than younger adults . However, older age groups were also more likely to achieve glycaemic targets irrespective of having cvd and longer diabetes duration . Finally, the use of agents to control hyperglycaemia and dyslipidaemia was lower in older ages . This differential age and genderrelated pattern stresses the need to individually adapt the therapeutic and care approaches of t2 dm in elderly people to allow the best benefit and the lowest risk at all stages of the disease . Further research is warranted to investigate through prospective and interventional studies the observed differences in the clinical behaviour and treatment of t2 dm in elderly people . Jbdlp, mmc and jfn wrote the manuscript and contributed to the discussion; xmt, ac and jmfrl contributed to the discussion; jfn, mmc and dm designed and conducted the study, reviewed / edited the manuscript and contributed to the discussion . Mmc had full access to all data in the study and takes responsibility for the integrity of data and the accuracy of the data analysis.

The perception of the sensory consequences of one s own actions is inherently different to the perception of other sensory events . For example, people tend to perceive the sensory consequences of their actions as attenuated (blakemore et al . 1998; shergill et al . 2003), which is proposed to facilitate the distinction between self- and externally generated actions (blakemore et al . Another well - described perceptual distortion with voluntary actions is the temporal attraction between a self - generated action and its sensory outcome: a willed action is perceived to occur later in time, whereas its sensory consequence (e.g., a tone) is perceived to occur earlier in time . This attraction is absent for involuntary actions, suggesting it is the intentionality that leads to the temporal binding of the action and its effect . The term 2002), it has been suggested to be a quantitative index of awareness of action or agency, that is, the sense that one controls one s own actions . As an objective and replicable behavioral measure, it has considerable advantages over verbal self - reports in the study of volition . The intentional binding paradigm has therefore been applied to study agency in healthy individuals (e.g., moore et al . 2011) and in clinical populations, such as individuals with parkinson s disease (moore et al . 2010b) or schizophrenia (haggard et al . 2003). In many of these studies, the magnitudes of action binding (the temporal attraction of action toward its outcome tone) and tone binding (the attraction of consequent tone toward action) are summed up to obtain an for example, the drug ketamine, which can induce a reversible psychosis in healthy individuals, enhances overall binding, similarly to that observed in schizophrenia, and has been suggested to increase agency (moore et al . 2011). Despite the growing use of binding as a measure of agency, the underlying mechanisms of action and tone binding remain largely unclear . Moore and haggard (2008) have shown that action binding depends on both a predictive process (modulated by the probability of the tone following the action) and an inferential process (as action binding is apparent even in low effect probability as long as the tone occurs). Both of these processes are significantly supported by the contingency or causality relation between the action and tone (moore et al . 2009), suggesting a critical role for learning an action tone binding on the other hand is related to a more general association process, as it does not depend on establishing a specific action a predictive process has also been suggested to account for tone binding, in which predicted sensory outcomes reach perceptual threshold more rapidly (waszak et al . For example, repetitive transcranial magnetic stimulation over the pre - supplementary motor area can specifically alter tone binding with no effect on action binding (moore et al . These studies suggest that action and tone binding may be driven by distinct mechanisms . Despite this body of evidence, there are few studies which examine the mechanisms of both action and tone binding . The present study aims to satisfy this experimental challenge by considering the role of cue integration in both action and tone binding . In many sensorimotor tasks, these experimentally tractable models have also been suggested to contribute to the sense of agency, and the intentional binding in particular (moore and fletcher 2012; moore and haggard 2008). According to this framework, the sensorimotor system optimally combines information from different sources, such as multiple sensory modalities (ernst and banks 2002; hillis et al . 2002) and prior expectations (krding and wolpert 2004), in order to reduce variability in performance (e.g., ernst and banks 2002). In binding, the action event and the sensory outcome event (tone) provide two separate cues for estimating their time . The time estimates are then a weighted average of the action and tone events, where the weight of each cue corresponds to its reliability (or in other words the precision of estimates, expressed as the inverse of the variance) relative to the reliability of the other cue . If both action and tone binding are supported by action effect cue integration, this framework could explain the temporal attraction between action and tone events in binding . In this study, we investigated the contribution of cue integration to action and tone binding . To this end, we manipulated the reliability of the tone event by modulating its intensity relative to a background white noise . Based on each subject s individual auditory detection threshold, we generated three tones with increasing intensities, which in the presence of noise provided high, intermediate and low levels of uncertainty in the perception of tone onset . We tested three main predictions of the cue integration hypothesis under different conditions of tone reliability . First, if cue integration underlies both action and tone binding measures, action binding will be weakest under high tone uncertainty, whereas tone binding will be strongest . These changes should be mainly driven by differential weighting of the action and tone cues according to uncertainty, in the conditions where both cues are provided . Second, if such cue integration mechanism is in fact common to both action and tone binding, the extent of changes in these measures as a result of modifying uncertainty will be related . Finally, in conditions where both action and tone cues are provided, the variability of time estimates should be lower (i.e., time estimates should be more precise) than in conditions where only one cue is provided, reflecting the key behavioral advantage of cue integration for perceptual precision . Twenty right - handed volunteers (ten females) aged 1836 (mean: 26, sd: 6) took part in the study and were compensated 14.5 for their participation . All subjects reported no history of neuropsychiatric disorders and had normal or corrected - to - normal vision . Subjects were tested with a modified version of the intentional binding task (haggard et al . White noise (1,000 hz frequency) was played continuously, while pure tones (1,000 hz; 100-ms duration) were played at intervals of 16 s. tones were generated by multiplying the amplitude of a sinusoidal waveform by factors between 0.01 and 0.1 (fixed 0.01 interval between them). Overall level of noise was 80-db spl, and tones were between 63 and 83-db spl (intervals of 13-db spl between each tone). Subjects task was to press a key to indicate when they were able to hear a tone . For each tone intensity (10 in total), six trials were played pseudorandomly, making up a total of 60 trials . Clock on a computer screen marked with numbers from five to sixty in intervals of five (fig . 1). A single hand rotated clockwise (period of 2,560 ms), providing a time stamp for reporting the perceived time of events . On each trial, subjects used a keyboard to report the time of self - paced button presses or tones (1,000 hz; 100 ms). In the baseline tone condition, a tone was played at random without a prior action between 2.5 and 6 s after trial onset . In the baseline action condition in the two operant conditions, a tone followed the button press by 250 ms, and subjects were asked to report either the time of their button press or the tone . Subjects were discouraged from pre - planning the time at which they press the button.fig . They were asked to press a button at their own pace, which triggered a tone (250-ms delay). The tone had low, intermediate or high intensity (interleaved in a pseudorandomized order). Subjects reported either the time of the button press or the time of the tone (conditions blocked) using the position of the rotating clock hand . Binding is measured as the difference between the means of estimation errors for action or tone events, and those in the corresponding baseline conditions, when the action and tone occur separately illustration of the modified intentional binding task . Subjects attended to a they were asked to press a button at their own pace, which triggered a tone (250-ms delay). The tone had low, intermediate or high intensity (interleaved in a pseudorandomized order). Subjects reported either the time of the button press or the time of the tone (conditions blocked) using the position of the rotating clock hand . Binding is measured as the difference between the means of estimation errors for action or tone events, and those in the corresponding baseline conditions, when the action and tone occur separately in contrast to previous intentional binding studies, a background white noise was played throughout the trials in order to increase the uncertainty about the time of tone onset . The tones had one of three amplitudes, generated as a function of each subject s detection threshold (see analyses). These three amplitudes were used to produce three levels of uncertainty with regard to estimating the time of tone onset . The three levels of uncertainty were pseudorandomly interleaved in the three task conditions in which tones were played . In the experimental blocks, each of the four block types consisted of 30 trials and was repeated four times . In total, 120 trials were performed for each condition, 40 trials per level of uncertainty . The preliminary tone detection performance was fitted with a psychometric (weibull) function, using a maximum - likelihood procedure (wichmann and hill 2001). Each subject s amplitude of detection threshold was calculated at 50% threshold in the psychometric function . In addition to the threshold amplitude, two more amplitudes were calculated, by multiplying that of the detection threshold by 2 and 5 . This generated low (detection threshold), intermediate and high intensities for the tones used in the binding task . Across subjects, low tones had a mean intensity of 78-db spl; intermediate tones, 84-db spl; and high, 92-db spl; the noise was fixed at overall level of 80-db spl . Low, intermediate and high tone intensities were used to provide high, intermediate and low levels of uncertainty about the tone onset, respectively . Mean estimation errors (i.e., the difference between actual and estimated time of event) were calculated separately for each level of uncertainty for action and tone in the baseline and operant conditions . Trials with outlier estimation errors (2.5 sd from mean) were removed from each subject s dataset (on average approximately three trials per subject). One subject was excluded from the study, as the standard deviation (sd) of his baseline action values was greater than two times the group mean sd . For each level of uncertainty, the mean estimation errors in baseline action and tone conditions were subtracted from their corresponding operant conditions to obtain action and tone binding measures, respectively . To explore the effect of uncertainty on binding, we performed repeated - measures anovas with uncertainty (high, intermediate and low) as a within - subject factor on the following datasets: (1) sds of estimation errors in baseline tone condition; (2) action and tone binding values; and (3) mean estimation errors in baseline and operant tone conditions . Anovas were followed by two - tailed paired t tests, except for the comparisons of binding across uncertainties, in which the direction was hypothesized according to the cue integration prediction . Two additional analyses were performed: (1) correlating the ratios between action binding in low and high uncertainty and the corresponding ratios in tone binding, using spearman s ranked correlation, and (2) pairwise comparisons of sds in baseline versus operant action and tone conditions for each level of uncertainty . Twenty right - handed volunteers (ten females) aged 1836 (mean: 26, sd: 6) took part in the study and were compensated 14.5 for their participation . All subjects reported no history of neuropsychiatric disorders and had normal or corrected - to - normal vision . Subjects were tested with a modified version of the intentional binding task (haggard et al . Auditory stimuli were presented by sennheiser hd250 linear ii headphones throughout the testing session . An auditory detection task was first performed to identify each subject s detection threshold . White noise (1,000 hz frequency) was played continuously, while pure tones (1,000 hz; 100-ms duration) were played at intervals of 16 s. tones were generated by multiplying the amplitude of a sinusoidal waveform by factors between 0.01 and 0.1 (fixed 0.01 interval between them). Overall level of noise was 80-db spl, and tones were between 63 and 83-db spl (intervals of 13-db spl between each tone). Subjects task was to press a key to indicate when they were able to hear a tone . For each tone intensity (10 in total), six trials were played pseudorandomly, making up a total of 60 trials . Clock on a computer screen marked with numbers from five to sixty in intervals of five (fig . 1). A single hand rotated clockwise (period of 2,560 ms), providing a time stamp for reporting the perceived time of events . On each trial, subjects used a keyboard to report the time of self - paced button presses or tones (1,000 hz; 100 ms). In the baseline tone condition, a tone was played at random without a prior action between 2.5 and 6 s after trial onset . In the baseline action condition in the two operant conditions, a tone followed the button press by 250 ms, and subjects were asked to report either the time of their button press or the tone . Subjects were discouraged from pre - planning the time at which they press the button.fig . They were asked to press a button at their own pace, which triggered a tone (250-ms delay). The tone had low, intermediate or high intensity (interleaved in a pseudorandomized order). Subjects reported either the time of the button press or the time of the tone (conditions blocked) using the position of the rotating clock hand . Binding is measured as the difference between the means of estimation errors for action or tone events, and those in the corresponding baseline conditions, when the action and tone occur separately illustration of the modified intentional binding task . They were asked to press a button at their own pace, which triggered a tone (250-ms delay). The tone had low, intermediate or high intensity (interleaved in a pseudorandomized order). Subjects reported either the time of the button press or the time of the tone (conditions blocked) using the position of the rotating clock hand . Binding is measured as the difference between the means of estimation errors for action or tone events, and those in the corresponding baseline conditions, when the action and tone occur separately in contrast to previous intentional binding studies, a background white noise was played throughout the trials in order to increase the uncertainty about the time of tone onset . The tones had one of three amplitudes, generated as a function of each subject s detection threshold (see analyses). These three amplitudes were used to produce three levels of uncertainty with regard to estimating the time of tone onset . The three levels of uncertainty were pseudorandomly interleaved in the three task conditions in which tones were played . Each of the four block types consisted of 30 trials and was repeated four times . In total, 120 trials were performed for each condition, 40 trials per level of uncertainty . The preliminary tone detection performance was fitted with a psychometric (weibull) function, using a maximum - likelihood procedure (wichmann and hill 2001). Each subject s amplitude of detection threshold was calculated at 50% threshold in the psychometric function . In addition to the threshold amplitude, two more amplitudes were calculated, by multiplying that of the detection threshold by 2 and 5 . This generated low (detection threshold), intermediate and high intensities for the tones used in the binding task . Across subjects, low tones had a mean intensity of 78-db spl; intermediate tones, 84-db spl; and high, 92-db spl; the noise was fixed at overall level of 80-db spl . Low, intermediate and high tone intensities were used to provide high, intermediate and low levels of uncertainty about the tone onset, respectively . Mean estimation errors (i.e., the difference between actual and estimated time of event) were calculated separately for each level of uncertainty for action and tone in the baseline and operant conditions . Trials with outlier estimation errors (2.5 sd from mean) were removed from each subject s dataset (on average approximately three trials per subject). One subject was excluded from the study, as the standard deviation (sd) of his baseline action values was greater than two times the group mean sd . For each level of uncertainty, the mean estimation errors in baseline action and tone conditions were subtracted from their corresponding operant conditions to obtain action and tone binding measures, respectively . To explore the effect of uncertainty on binding, we performed repeated - measures anovas with uncertainty (high, intermediate and low) as a within - subject factor on the following datasets: (1) sds of estimation errors in baseline tone condition; (2) action and tone binding values; and (3) mean estimation errors in baseline and operant tone conditions . Anovas were followed by two - tailed paired t tests, except for the comparisons of binding across uncertainties, in which the direction was hypothesized according to the cue integration prediction . Two additional analyses were performed: (1) correlating the ratios between action binding in low and high uncertainty and the corresponding ratios in tone binding, using spearman s ranked correlation, and (2) pairwise comparisons of sds in baseline versus operant action and tone conditions for each level of uncertainty . Table 1 summarizes the estimation errors and their sds for all experimental conditions across subjects . We first sought to verify the assumption that reducing tone intensities against the background noise would increase uncertainty with regard to estimates of tone event onset . Baseline tone condition, that is, where tones were played at random, and not associated with a button press or action (fig . 2). Repeated - measures anova showed a main effect of intensity (f(1.29, 24.43) = 23.8, p <0.001) on estimation error sd . Post hoc two - tailed (bonferroni corrected) comparisons confirmed an increase in the sd of estimation errors for low - intensity tones, relative to both intermediate (t19 = 4.38, p <0.001) and high (t19 = 5.94, p <0.001) intensities, and a weak trend toward increased sd in intermediate- compared to high - intensity tones (t19 = 1.69, p = 0.11). High-, intermediate- and low - intensity tones were thus able to provide low, intermediate and high levels of temporal uncertainty, respectively.table 1mean estimation errors and mean standard deviation (sd) of estimation errors across subjects (mean standard error in parentheses). Values are shown for the estimated time of action and tone in the baseline and operant conditions for the three levels of uncertaintylevel of uncertaintyconditioneventmean (se) estimation error (ms)mean (se) sd of estimation error (ms)lowbaselineaction8 (11)75 (6)tone35 (11)61 (3)operantaction31 (11)79 (5)tone16 (22)76 (4)intermediatebaselineaction8 (11)75 (6)tone46 (11)66 (3)operantaction23 (10)70 (5)tone19 (21)80 (5)highbaselineaction8 (11)75 (6)tone95 (11)90 (5)operantaction24 (10)71 (6)tone10 (23)77 (4)fig . 2the standard deviation (sd) of estimation errors for the different tone intensities in baseline tone condition, wherein a tone was played at random without a prior action . Sds were increased in trials with low tone intensity relative to both intermediate and high intensities (* * * p <0.001). High, intermediate and low tone intensities thus provided low, intermediate and high levels of sensory uncertainty in estimating the time of tone onset . Error bars indicate mean standard errors for the study group mean estimation errors and mean standard deviation (sd) of estimation errors across subjects (mean standard error in parentheses). Values are shown for the estimated time of action and tone in the baseline and operant conditions for the three levels of uncertainty the standard deviation (sd) of estimation errors for the different tone intensities in baseline tone condition, wherein a tone was played at random without a prior action . Sds were increased in trials with low tone intensity relative to both intermediate and high intensities (* * * p <0.001). High, intermediate and low tone intensities thus provided low, intermediate and high levels of sensory uncertainty in estimating the time of tone onset . Error bars indicate mean standard errors for the study group the cue integration hypothesis predicts that as uncertainty about the timing of the tone increases (i.e., reliability is reduced), action binding will be reduced, whereas tone binding will be enhanced . To test this, we first calculated action and tone binding separately for each level of uncertainty, by subtracting estimation errors in the baseline conditions from their corresponding operant conditions, in which the action was associated with a tone (fig . 3). To examine the effect of cue integration on action and tone binding independently, we entered these measures to two separate repeated - measures anovas, with uncertainty (low, intermediate and high) as a within - subject factor.fig . Shapes represent the event (rectangle action, oval tone), and their shade denotes the condition (white baseline, gray operant). Numbers indicate the mean action and tone binding across subjects (mean standard error in parentheses). Significance level in pairwise comparisons is indicated by * * * p <0.001 and * p 0.05 action and tone binding for the three levels of tone uncertainty . Shapes represent the event (rectangle action, oval tone), and their shade denotes the condition (white baseline, gray operant). Numbers indicate the mean action and tone binding across subjects (mean standard error in parentheses). Significance level in pairwise comparisons is indicated by * * * p <0.001 and * p 0.05 a main effect of uncertainty on action binding was found (f(1.34, 25.37) = 4.22, p = 0.04). One - tailed (bonferroni corrected) post hoc t tests indicated a reduction in action binding in the high relative to low uncertainty (t19 = 4.465, p <0.001), and a just significantly reduced action binding in the intermediate relative to low uncertainty (t19 = 2.261, p = 0.05). A main effect of uncertainty was also found for tone binding measures (f(1.64, 31.2) = 28.69, p <0.001). Post hoc pairwise comparisons confirmed an increase in tone binding (i.e., an earlier estimate of the tone event) in the high uncertainty condition, relative to both intermediate (t19 = 5.546, p <0.001) and low (t19 = 6.109, p <0.001) levels of uncertainty . In addition, higher tone binding was observed in the intermediate compared to low uncertainty (t19 = 2.4, p = 0.04). Differences in action binding could only result from changes in estimation errors in the operant condition, as there were no different levels of uncertainty in baseline action condition . By contrast, the differences in tone binding could arise from changes in either baseline or operant conditions, as estimation errors were calculated separately for each level of tone uncertainty in both of these conditions . To explore where differences in tone binding originated from, we examined the estimation errors in the baseline and operant tone conditions in two separate anovas . A main effect of uncertainty on baseline tone estimation errors was found (f(1.56, 29.7) = 69.81, p <0.001), with significant post hoc (bonferroni corrected) pairwise comparisons between the three levels of uncertainty (high intermediate: t19 = 8.97, p <0.001; high low: t19 = 9.23, p <0.001; intermediate low: t19 = 2.88, p = 0.03). By contrast, there was no effect of uncertainty on operant tone estimation errors (f(1.7, 32.31) = 1.88, p = 0.174). Taken together, these results indicate that the differences observed in tone binding across the three levels of uncertainty were driven by changes in estimation errors in the baseline condition, in which only the tone cue was provided . On the other hand, in action binding these differences could only arise from changes in the operant condition, indicating a contribution of cue integration . We next examined the relation between changes in tone binding and changes in action binding across uncertainties . If the extent of change in action binding, arising from cue integration, is correlated with the extent of change in tone binding, this would support a common effect of cue integration on tone binding as well . Specifically, we looked at action and tone binding measures in the low and high uncertainty conditions (the conditions which showed a highly significant difference, above). We correlated the ratio between action binding in the low and high uncertainty conditions and the corresponding ratio in tone binding . There was no significant correlation between the change in action and tone binding as a result of uncertainty across subjects (spearman s rho = 0.038, p = 0.876), indicating there was no consistent relation between these changes in action and tone binding . A critical assumption of the cue integration account is that the integration of multiple cues reduces variability in performance . Therefore, if cue integration contributes to tone binding, sd in the operant condition should be lower than the sd in the corresponding baseline condition . However, two - tailed (bonferroni corrected) comparisons revealed a significant increase in sd in operant relative to baseline tone conditions in both intermediate (t19 = 3.92, p = 0.003) and low (t19 = 3.77, p = 0.004) levels of uncertainty . For action binding, the mean sd in operant action condition was lower than sd in baseline action condition for low and intermediate uncertainties, although not statistically significant (t19 = 1.66, p = 0.3; and t19 = 1.67, p = 0.3). Taken together, the results suggest that in contrast to action binding, tone binding is unlikely to be driven by action we studied the contribution of action effect cue integration to the perception of action and its sensory outcome in intentional binding . According to the cue integration hypothesis, the compression in the perceived temporal interval between a voluntary action and its sensory consequence results from using both events as temporally informative cues . The time estimates are based on a weighted average of the two events, in which the weight of each cue is determined by its relative reliability . As predicted by cue integration, our data show that reducing the reliability of the sensory outcome results in a smaller shift in the perceived time of action toward its outcome (reduced action binding). The cue integration hypothesis also predicted an increase in the shift of the perception of the sensory outcome toward the action with increasing uncertainty (i.e., increased tone binding). However, the results of additional analyses point to a separate mechanism involved in tone binding . Action binding has been described in terms of a postdictive or inferential process, as it occurs even when the action is not strongly predictive of a tone, as long as the tone event occurs (moore and haggard 2008). Our results suggest that this postdictive process could be mediated by a cue integration mechanism . On the other hand, a predictive process has also been proposed to support action binding, as when the action is highly predictive of a tone, action binding occurs even in trials in which tones are absent (moore and haggard 2008). Consistent with this notion, even in our high uncertainty condition, in which tones were at each individual subject s perceptual threshold, action binding measures were significantly above zero (data not shown). The association between the action and its outcome has been suggested to explain the predictive component of action binding (moore et al . Our finding that action binding is supported by cue integration is consistent with a previous study, suggesting that the estimation of time of movement depends on cue integration (lau et al . This integration combines information about the time of action with other sources, as in the sensory outcome of an action . Information about the time of one s own voluntary action could draw upon proprioceptive as well as internal volitional signals, such as an efference copy of motor commands (von holst 1954) or components of the readiness potential (lau et al . 2007). When sensory uncertainty is high or in the absence of sensory feedback, the perception of action relies more on these internal representations, thereby reducing action binding . The cue integration framework has been successfully used to explain many perceptual phenomena in the sensorimotor system (e.g., ernst and banks 2002) and has been suggested to support the sense of agency (moore and fletcher 2012). Particularly, the integration of internal, volitional signals with external sensory cues can help dealing with uncertainty in the attribution of agency . Therefore, alongside the well - described action effect association mechanism (see above), this integration could be another mechanism that links agency and intentional binding and reflects the volitional components that are captured in binding . For example, abnormal agency in disease states or under experimental interventions could arise from impairments in the internal volitional signals that normally contribute to the experience of agency . In turn, these impaired signals can lead to distinct changes in intentional binding, resulting from abnormal weighting of the action and outcome events . Future studies can thus apply the cue integration approach to explain abnormalities in action binding in terms of volitional deficits . If cue integration can account for action binding effects, can it also explain tone binding? Tone binding was enhanced with increasing tone uncertainty, which at first glance is consistent with cue integration . However, this effect is attributable to increasing perceptual shifts in the baseline condition (tone only) as a function of tone intensity, rather than changes in the operant conditions, in which both action and tone events occurred together . Moreover, the changes in action and tone binding that resulted from sensory uncertainty were not correlated, suggesting different underlying mechanisms . Crucially, the prediction that integrating cues reduces performance variability was not satisfied for tone binding: variability in estimation errors was significantly increased when two cues were provided in the operant tone condition, compared to baseline tone condition . These results show that the perceptual changes we observed in tone binding are likely to be driven by an alternative mechanism . According to this account, the neural representation of a predicted sensory event, such as a sensory outcome following a voluntary action, is activated prior to its occurrence . Because of this ramped predictive activity, when the predicted sensory outcome occurs, it reaches perceptual threshold faster than when it is not predicted . Consequently, estimation errors are smaller in the operant tone condition than they are in the baseline tone condition, leading to tone binding . Our results suggest that this pre - activation mechanism can better account for the changes in tone binding under different levels of uncertainty . We found increased tone binding under high uncertainty, resulting from increased estimation errors in baseline tone condition . As tone intensity was reduced against a background noise for increasing sensory uncertainty, more time would be required for the tones to reach the perceptual threshold for detection . This additional time would be reflected in the increased estimation errors in the baseline condition . By contrast, in the operant condition, the learned action effect association could diminish these differences in perceptual latencies . In other words, for pre - activated tone representations, the differences in intensities could be negligible, resulting in the lack of differences in estimation errors that was observed in the operant condition across uncertainties . Our results thus support the hypothesis that tone binding results from changes in perceptual latencies, driven by a predictive pre - activation mechanism (waszak et al . These results add to the growing evidence that different mechanisms underlie action and tone binding (waszak et al . Effect association is required for action binding (e.g., moore and haggard 2008), a more general association is sufficient for tone binding to occur (desantis et al . Such interventions include transcranial magnetic stimulation of the pre - supplementary motor area (moore et al . Effect cue integration is the most plausible explanation for the effect of uncertainty on action binding, differences in tone binding could be better accounted for by changes in perceptual latencies . Effect association can contribute to action binding through a prediction mechanism (moore and haggard 2008). Similarly, a prediction mechanism could be implemented for the tone to reach the perceptual threshold more rapidly and thereby lead to tone binding (waszak et al . 2010a) have motivated the study of volitional disorders in patients with neurological and psychiatric illnesses, as well as healthy adults (e.g., moore et al . 2010b, 2011). Often, action and tone binding measures have been added together (i.e., action binding plus the negative of tone binding) to generate an this measure has been used as a single metric of agency for comparing groups or measuring the effects of experimental interventions . However, if, as our data suggest, action and tone binding have different underlying contributory mechanisms, then disease states or interventions may have differential effects on these two forms of binding . Not only that our data indicate these two measures can be partially independent, but we also show that under some circumstances action and tone binding can be inversely related: recall that high sensory uncertainty led to a reduction in action binding, while tone binding was increased . We therefore suggest that future studies should consider action and tone binding separately, rather than summing up these measures for studying volition . First, our study draws upon the principles of cue integration, but does not apply computational techniques to model the data . Formal modeling of individual subject data would require many more trials for each condition per subject, which were not obtained here . Moreover, statistically optimal cue integration has been classically described for integrating multiple sources of information about one sensory event or object . Although action and tone events are synthesized in binding, it is possible that some of the principles of cue integration may not apply for the binding task, such as the statistical optimality . Second, we did not use a continuous variation of uncertainty, which would allow us to examine the psychometric properties of sensory uncertainty as a continuous effect . Such continuous variation was opted instead for the greater power conferred by the ordinal uncertainties . Third, our study only varies uncertainty in perception of action outcome tone and does not alter uncertainty in perception of time of action for fully covering the contribution of action effect cue integration to binding . One solution could be to study clinical populations, such as patients with movement disorders, in which there is uncertainty over actions . In conclusion, our results suggest that cue integration between action and effect contributes to the intentional binding effect for actions . By contrast, cue integration did not account for the observed changes in tone binding . This supports the notion that action and tone binding are driven by distinct underlying mechanisms . Our data support the use of intentional binding in the investigation of the mechanisms of volition, but suggest that action and tone binding should be considered separately in future studies.

Synovial chondromatosis is a disease with unknown etiology, originating from synovia and characterized by the presence of metaplastic cartilaginous nodules in the synovial cavities, bursa or tendon sheaths . The disease is commonly seen in men and between the 3rd and 5th decades of life . Although the exact etiology is not known the knee, hip and elbow joints are frequently reported to be involved by the condition . However, shoulder and ankle joints are involved extremely rarely . The disease is classified in 3 stages and evaluated according to following criteria: the early stage with intrasynovial differentiation without loose bodies, the transitional stage by intrasynovial cartilaginous nodules with loose bodies and late stage with multiple loose bodies . The treatment decision is made according to the patient's age, symptoms and the disease stage . The main advantages of the arthroscopic approaches are decreased morbidity, synchronous visualization and treatment feature for intra and extra articular pathologies . The hypertrophic synovia and multiple loose bodies are typical arthroscopic findings . In this case report, we presented an arthroscopically managed adult patient with anteriorly localized right ankle chondromatosis and discussed the potential benefits of arthroscopic surgery . A twenty - eight year old male patient was admitted to our hospital with decreased range of motion, swelling and increased pain during movement in the right ankle joint . He had no history of trauma, systemic inflammatory disease or family history of bone or joint diseases . The physical examination revealed that he had mild tenderness around the anterior ankle joint on palpation with palpable loose bodies . Multiple nodules 39 mm in diameter with calcifications were located at the anterior aspect of the right ankle on the plain anteroposterior and lateral x - ray images (fig . 1). Magnetic resonance imaging (mri) revealed multiple calcified well - circumscribed loose bodies at the same location and synovitis in the ankle joint (fig . The laboratory tests were within the normal limits and the patient was scheduled for arthroscopic surgery with the diagnosis of anterior impingement syndrome due to right ankle synovial chondromatosis . The ankle joint was entered via anteromedial and anterolateral arthroscopic portals during spinal anesthesia and tourniquet application . Multiple loose bodies and hypertrophic synovia around the anterior ankle joint were seen (fig . 3). Arthroscopic partial synovectomy and excision of loose bodies were performed (fig . The drain was removed in the 1st postoperative day and the active and passive range of motion exercises was started . The patient was allowed partial weight bearing with crutches and at the 2nd week he was mobilized with full weight . There were multiple cartilaginous loose bodies, with the biggest and smallest dimensions of 0.9 cm 0.7 cm 0.5 cm and 0.4 cm 0.3 cm 0.2 cm in the permanent pathology report respectively (fig . The patient's dorsiflexion and plantar flexion degrees were 25 and 30, respectively, at the end of the 11th postoperative month . No complications were diagnosed in the follow - up period with no recurrence on the plain x - ray images and mri . Trauma, degenerating joint diseases, osteochondritis dissecans, rhomatoid arthritis and tuberculosis arthritis are examples of the secondary form . Our case was evaluated in the primary synovial osteochondromatosis group due to the absence of previous trauma or inflammatory pathologies . Complaints of pain, swelling of the joint (especially after physical activity) with or without accompanying pain, decreased range of motion, palpable mass, locking paresthesias and joint clicking are main symptoms and signs in patients with synovial chondromatosis . The suspected diagnosis was confirmed by the appropriate radiologic investigations and pathologic examination after history taking and physical evaluation . The calcified form synovial osteochondromatosis could be seen in the anteroposterior and lateral plain x - ray images . Mri investigation enabled the diagnosis of the disease in the early stage, the exact localization of the disease and intrinsic property of chondroid tissue . The tenosynovial giant cell tumor, calcifying aponeurotic fibroma, periosteal chondroma, osteocartilaginous loose bodies and soft tissue chondrosarcoma must be kept in mind in the differential diagnosis . The disease is slowly progressive and is considered to be a self - limiting condition . In the early stages of the disease and in asymptomatic patients, treatment can be planned conservatively with frequent follow - up visits . Degenerative changes could occur in the later stages of the disease in patients without appropriate therapy . Although the classical treatment approach for ankle joint chondromatosis is open surgery, arthroscopic surgery is rarely encountered in the literature . Some important advantages of arthroscopic surgery are wide visualization areas, easy access to difficult to reach areas, lower morbidity, no need for casting and immobilization, early rehabilitation and quick recovery period . However, there is the possibility of limited synovectomy and residual loose bodies . Arthroscopic surgery enables wide regional visualization, lowers morbidity, promotes early rehabilitation, shortens the recovery period and decreases the immobilization period . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal upon request . Nevres hurriyet aydogan, ahmet ozmeric, onur kocadal, murad pepe, talip kara took part in surgical procedure, literature search, preparation of the paper and review . Serap gozel took part in pathological investigation.key learning pointssynovial chondromatosis is a disease originating from synovia and characterized by the presence of metaplastic cartilaginous nodules.pain, swelling of the joint especially after physical activity and decreased range of motion are main symptoms.treatment is arranged according to the patient's complaints, age and disease stage.there are many advantages of arthroscopic surgery in selected patients . Synovial chondromatosis is a disease originating from synovia and characterized by the presence of metaplastic cartilaginous nodules.pain, swelling of the joint especially after physical activity and decreased range of motion are main symptoms.treatment is arranged according to the patient's complaints, age and disease stage.there are many advantages of arthroscopic surgery in selected patients . Synovial chondromatosis is a disease originating from synovia and characterized by the presence of metaplastic cartilaginous nodules . Pain, swelling of the joint especially after physical activity and decreased range of motion are main symptoms.

The norfolk component of the european prospective investigation into cancer and nutrition (epic - norfolk) study recruited 25,639 men and women aged 4079 years at baseline in 19931997 . The epic - norfolk study was initiated to investigate the relationship between diet and cancer but has since broadened its scope to include a range of chronic diseases, including t2d . The recruitment procedures, collection of questionnaire data, and anthropometric and dietary measures have been described in detail elsewhere (10,11). In brief, participants residing in norfolk, england, were recruited from age - sex registers of general practices and attended a baseline health check . Follow - up of participants constituted a postal questionnaire at 18 months, a second health check in 19982000, and a further postal questionnaire in 20022004 . From the 25,639 participants in epic - norfolk at baseline, we ascertained incident cases of t2d (n = 892) and selected a random subcohort of 4,000 participants . This subcohort was representative of the entire epic - norfolk cohort in terms of age, bmi, education level, physical activity level, smoking status, and total energy intake (data not shown). Among the subcohort of the 4,749 participants, we excluded those with unknown diabetes status (n = 1) or prevalent diabetes at baseline (n = 121), those with fewer than 7 days of diary data (n = 435) or who did not return a diary (n = 15), or those with missing information on potential confounding variables (n = 73). Participants with prevalent myocardial infarction, stroke, or cancer were also excluded (n = 400). The final sample for analysis consisted of 653 incident t2d cases and a subcohort of 3,166 individuals (including 115 incident t2d cases). All volunteers gave written informed consent, and the study was approved by the norwich district ethics committee . We ascertained incident t2d cases by self - report of doctor - diagnosed diabetes from three follow - up health and lifestyle questionnaires, i.e., answering to has a doctor ever told you that you have diabetes? Or diabetes medication that was self - reported or brought to the second health check . In addition, external sources of information through record linkage included listing of any epic - norfolk participant in the general practice diabetes register, local hospital diabetes register, hospital admissions data with screening for any diabetes - related admissions among study participants, and office of national statistics mortality data with coding for diabetes . Participants who gave a self - report of history of diabetes that could not be confirmed against any other sources of ascertainment were not considered as a confirmed case of t2d . Follow - up was censored at the date of diagnosis of t2d, 31 july 2006, or the date of death, whichever came first . At the baseline medical examination, participants were instructed by trained interviewers on how to complete the 7-day food diary (11,12). The food diary consisted of 45 color pages containing food portion photographs and detailed instructions on how to record and describe preparation methods and quantities of foods eaten at main meals, snacks, and between meals . Completed diaries were returned by post to the coordinating center at the university of cambridge . The food diary has been validated with weighed food records, 24-h urine collections, and blood biomarkers (13). Intake of f&v (including tinned and dried) was calculated from food diary data to give average daily quantity of intake for each participant . In order to precisely quantify the actual intake of five - a - day public health guidelines) (14), all recorded foods and dishes were disaggregated into their component parts . Composite dishes containing fruits and/or vegetables included homemade and shop - bought desserts, vegetable bakes, stews, pies, and soups, for example . The f&v quantity and type was derived for the composite dishes by using recipes from mccance and widdowson as previously described (12) and by using ingredients listed on the packages of products and ready - made meals . Potatoes were not included as a vegetable because they differ from vegetables regarding energy and carbohydrate content and are frequently used as a substitute for cereals (15). F&v juices were also not included because they differ from their source of origin in terms of food matrix and fiber content, and as such may be dissimilarly associated with diabetes (16). Variety of fruit, vegetables, and combined f&v intake was derived by calculating the total number of different items consumed at least once in a 1-week period, irrespective of quantity of intake . The groupings of items included 58 different fruit items (range 058), 59 different vegetable items (range 059), and hence a total of 117 different f&v items consumed over a 1-week period, as recorded in the 7-day food diary . At recruitment, participants completed a detailed health and lifestyle questionnaire . Participants self - reported their education level (low, o level, a level, or degree), occupational social class (manual or nonmanual), smoking status (current, former, or never), and baseline history of myocardial infarction, stroke, and cancer (yes or no). Area deprivation was assessed from residential postal codes using the townsend deprivation index, which provides a material measure of deprivation and disadvantage based on unemployment, car ownership, home ownership and household overcrowding . A validated, four - point physical activity index was derived, incorporating occupational and leisure - time components of physical activity (18). Trained nurses measured height, weight, and waist circumference according to standardized protocols (10). (hba1c) was measured halfway through the baseline health check (19951997) and was available in approximately half of the epic - norfolk cohort . Hba1c was measured using high - performance liquid chromatography on a bio - rad diamat (bio - rad, richmond, ca), on a sample of edta - anticoagulated blood . Baseline characteristics were summarized by tertiles of combined f&v quantity and variety among the subcohort participants, using means with sds, medians with interquartile ranges (iqrs), or frequencies (where appropriate). Multivariable, prentice - weighted cox regression (19) was used to estimate the associations between quantity and variety of fruit, vegetables, and combined f&v intake and hazard of diabetes, with intake defined as tertiles (with the lowest tertile as the reference category). To check the proportional hazards assumption of the models, interactions between quantity and variety of fruit, vegetables, and combined f&v intake and current age (i.e., the underlying timescale) were tested . The proportional hazards assumption was not violated for quantity and variety of fruit, vegetables, or combined f&v intake (all p values 0.32). Hazard ratios (hrs) and 95% cis were estimated using the following modeling strategy . We additionally adjusted for bmi (continuous), waist circumference (continuous), education level (low, o level, a level, or degree), townsend deprivation index (continuous), occupational social class (manual or nonmanual), physical activity level (inactive, moderately inactive, moderately active, or active), smoking status (current, former, or never), family history of diabetes (yes or no), total energy intake (continuous), and season of diary completion (december, january, february = winter; march, april, may = spring; june, july, august = summer; and september, october, november = autumn). In model 3, in order to estimate the association between quantity of f&v consumption and hazard of diabetes independent of the effect of variety, we additionally adjusted for variety of f&v intake and vice versa for the analysis of variety in intake . We examined multicolinearity in model 3 using the variance inflation factor . In sensitivity analyses, the association between f&v quantity and variety and the hazard of diabetes was also investigated by including other potentially confounding variables in model 3, including hypertension (yes or no), dairy intake (continuous), total fiber intake (continuous), red and processed meat intake (continuous), and percentage energy from carbohydrate (continuous), protein (continuous), fat (continuous), and alcohol intake (continuous). Analyses were also repeated after additionally excluding participants who 1) developed diabetes within the first 2 years of follow - up (n = 26), 2) had a baseline hba1c level 6.5% (n = 15) in the subsample with hba1c data available (n = 1,333), and 3) were in the top and bottom 1% of the ratio of energy intake to energy expenditure . Multiplicative interaction terms were added to model 3 for quantity and variety of combined f&v intake to examine effect modification by sex, age (<60 or 60 years), bmi (normal weight <25 kg / m, overweight / obese 25 kg / m), and smoking status (never smoker or ever smoker) by using the wald test . Additionally, spline regression was used to demonstrate the continuous association between quantity and variety of combined f&v intake and the hr (95% ci) of diabetes with knots placed at quartiles of the distribution (20). All statistical analyses were performed using stata / se 11.1 (stata - corp, college station, tx). The norfolk component of the european prospective investigation into cancer and nutrition (epic - norfolk) study recruited 25,639 men and women aged 4079 years at baseline in 19931997 . The epic - norfolk study was initiated to investigate the relationship between diet and cancer but has since broadened its scope to include a range of chronic diseases, including t2d . The recruitment procedures, collection of questionnaire data, and anthropometric and dietary measures have been described in detail elsewhere (10,11). In brief, participants residing in norfolk, england, were recruited from age - sex registers of general practices and attended a baseline health check . Follow - up of participants constituted a postal questionnaire at 18 months, a second health check in 19982000, and a further postal questionnaire in 20022004 . From the 25,639 participants in epic - norfolk at baseline, we ascertained incident cases of t2d (n = 892) and selected a random subcohort of 4,000 participants . This subcohort was representative of the entire epic - norfolk cohort in terms of age, bmi, education level, physical activity level, smoking status, and total energy intake (data not shown). Among the subcohort of the 4,749 participants, we excluded those with unknown diabetes status (n = 1) or prevalent diabetes at baseline (n = 121), those with fewer than 7 days of diary data (n = 435) or who did not return a diary (n = 15), or those with missing information on potential confounding variables (n = 73). Participants with prevalent myocardial infarction, stroke, or cancer were also excluded (n = 400). The final sample for analysis consisted of 653 incident t2d cases and a subcohort of 3,166 individuals (including 115 incident t2d cases). All volunteers gave written informed consent, and the study was approved by the norwich district ethics committee . We ascertained incident t2d cases by self - report of doctor - diagnosed diabetes from three follow - up health and lifestyle questionnaires, i.e., answering yes to has a doctor ever told you that you have diabetes? Or diabetes medication that was self - reported or brought to the second health check . In addition, external sources of information through record linkage included listing of any epic - norfolk participant in the general practice diabetes register, local hospital diabetes register, hospital admissions data with screening for any diabetes - related admissions among study participants, and office of national statistics mortality data with coding for diabetes . Participants who gave a self - report of history of diabetes that could not be confirmed against any other sources of ascertainment were not considered as a confirmed case of t2d . Follow - up was censored at the date of diagnosis of t2d, 31 july 2006, or the date of death, whichever came first . At the baseline medical examination, participants were instructed by trained interviewers on how to complete the 7-day food diary (11,12). The food diary consisted of 45 color pages containing food portion photographs and detailed instructions on how to record and describe preparation methods and quantities of foods eaten at main meals, snacks, and between meals . Completed diaries were returned by post to the coordinating center at the university of cambridge . The food diary has been validated with weighed food records, 24-h urine collections, and blood biomarkers (13). Intake of f&v (including tinned and dried) was calculated from food diary data to give average daily quantity of intake for each participant . In order to precisely quantify the actual intake of five - a - day public health guidelines) (14), all recorded foods and dishes were disaggregated into their component parts . Composite dishes containing fruits and/or vegetables included homemade and shop - bought desserts, vegetable bakes, stews, pies, and soups, for example . The f&v quantity and type was derived for the composite dishes by using recipes from mccance and widdowson as previously described (12) and by using ingredients listed on the packages of products and ready - made meals . Potatoes were not included as a vegetable because they differ from vegetables regarding energy and carbohydrate content and are frequently used as a substitute for cereals (15). F&v juices were also not included because they differ from their source of origin in terms of food matrix and fiber content, and as such may be dissimilarly associated with diabetes (16). Variety of fruit, vegetables, and combined f&v intake was derived by calculating the total number of different items consumed at least once in a 1-week period, irrespective of quantity of intake . The groupings of items included 58 different fruit items (range 058), 59 different vegetable items (range 059), and hence a total of 117 different f&v items consumed over a 1-week period, as recorded in the 7-day food diary . At recruitment participants self - reported their education level (low, o level, a level, or degree), occupational social class (manual or nonmanual), smoking status (current, former, or never), and baseline history of myocardial infarction, stroke, and cancer (yes or no). Area deprivation was assessed from residential postal codes using the townsend deprivation index, which provides a material measure of deprivation and disadvantage based on unemployment, car ownership, home ownership and household overcrowding ., four - point physical activity index was derived, incorporating occupational and leisure - time components of physical activity (18). Trained nurses measured height, weight, and waist circumference according to standardized protocols (10). Venous blood samples were taken by trained study nurses . Hemoglobin a1c (hba1c) was measured halfway through the baseline health check (19951997) and was available in approximately half of the epic - norfolk cohort . Hba1c was measured using high - performance liquid chromatography on a bio - rad diamat (bio - rad, richmond, ca), on a sample of edta - anticoagulated blood . Baseline characteristics were summarized by tertiles of combined f&v quantity and variety among the subcohort participants, using means with sds, medians with interquartile ranges (iqrs), or frequencies (where appropriate). Multivariable, prentice - weighted cox regression (19) was used to estimate the associations between quantity and variety of fruit, vegetables, and combined f&v intake and hazard of diabetes, with intake defined as tertiles (with the lowest tertile as the reference category). To check the proportional hazards assumption of the models, interactions between quantity and variety of fruit, vegetables, and combined f&v intake and current age (i.e., the underlying timescale) were tested . The proportional hazards assumption was not violated for quantity and variety of fruit, vegetables, or combined f&v intake (all p values 0.32). Hazard ratios (hrs) and 95% cis were estimated using the following modeling strategy . Model 1 was adjusted for sex . In model 2, we additionally adjusted for bmi (continuous), waist circumference (continuous), education level (low, o level, a level, or degree), townsend deprivation index (continuous), occupational social class (manual or nonmanual), physical activity level (inactive, moderately inactive, moderately active, or active), smoking status (current, former, or never), family history of diabetes (yes or no), total energy intake (continuous), and season of diary completion (december, january, february = winter; march, april, may = spring; june, july, august = summer; and september, october, november = autumn). In model 3, in order to estimate the association between quantity of f&v consumption and hazard of diabetes independent of the effect of variety, we additionally adjusted for variety of f&v intake and vice versa for the analysis of variety in intake . We examined multicolinearity in model 3 using the variance inflation factor . In sensitivity analyses, the association between f&v quantity and variety and the hazard of diabetes was also investigated by including other potentially confounding variables in model 3, including hypertension (yes or no), dairy intake (continuous), total fiber intake (continuous), red and processed meat intake (continuous), and percentage energy from carbohydrate (continuous), protein (continuous), fat (continuous), and alcohol intake (continuous). Analyses were also repeated after additionally excluding participants who 1) developed diabetes within the first 2 years of follow - up (n = 26), 2) had a baseline hba1c level 6.5% (n = 15) in the subsample with hba1c data available (n = 1,333), and 3) were in the top and bottom 1% of the ratio of energy intake to energy expenditure . Multiplicative interaction terms were added to model 3 for quantity and variety of combined f&v intake to examine effect modification by sex, age (<60 or 60 years), bmi (normal weight <25 kg / m, overweight / obese 25 kg / m), and smoking status (never smoker or ever smoker) by using the wald test . Additionally, spline regression was used to demonstrate the continuous association between quantity and variety of combined f&v intake and the hr (95% ci) of diabetes with knots placed at quartiles of the distribution (20). All statistical analyses were performed using stata / se 11.1 (stata - corp, college station, tx). Statistical significance was set at p <0.05 . The median (iqr) duration of follow - up was 10.9 (9.811.8) years . The median quantity of combined f&v intake was 3.7 (2.55.0) portions per day and the mean (sd) variety of combined f&v intake was 11.7 (3.9) items / week . Fewer than 26% of study participants reported consuming at least five portions of f&v per day . There was nearly a threefold difference in quantity and in excess of a twofold difference in variety of combined f&v consumption between the highest versus lowest tertiles of f&v intake (table 1). Participants who consumed higher quantities and a greater variety of combined f&v had more favorable lifestyle, anthropometric, and dietary profiles . Baseline characteristics by tertiles of quantity and variety of fruit and vegetable intake separately showed similar results (data not shown). The pearson correlation coefficient between quantity of fruit and quantity of vegetable intake was 0.29, and between variety of fruit and variety of vegetable intake was 0.30 . Quantity of combined f&v intake was strongly positively correlated with variety of combined f&v intake (0.60). Descriptive characteristics at baseline by combined f&v quantity and variety tertiles in 3,166 subcohort participants in the epic - norfolk study as shown in table 2, quantity of fruit, vegetables, and combined f&v intake were all inversely associated with incident t2d (model 1). Further adjustment did not appreciably alter the hrs (model 2). After additionally adjusting for the effects of variety of intake, an inverse association with quantity of vegetable intake remained, but the associations for quantity of fruit and quantity of combined f&v intake with t2d were attenuated, such that fruit was no longer associated and f&v intake was borderline inversely associated with t2d . Further adjustment for hypertension, dairy intake, total fiber intake, percentage energy from carbohydrate, protein, fat, and alcohol intake, and red and processed meat intake did not change our results (data not shown). Those meeting the recommendation to consume at least five portions of f&v per day did not differ from those not meeting this recommendation in hazard of t2d, excluding and including variety of intake (hr 0.85 [95% ci 0.701.02] and 0.98 [0.801.21], respectively). As shown in table 3, greater variety in fruit, vegetables, and combined f&v intake was inversely associated with incident t2d in adjusted analyses and also when accounting for quantity of intake . The relative reduction in the hazard of t2d with every additional two - item increase in f&v variety per week was 8% (0.92 [0.870.97]). The mean estimated variance inflation factor was <1.9 (<1.6 for both f&v quantity and f&v variety), indicating that colinearity of the variables included in model 3 was low . Hrs (95% cis) of incident diabetes for quantity of fruit, vegetables, and combined f&v intake in the epic - norfolk study hrs (95% cis) of incident diabetes for variety of fruit, vegetables, and combined f&v intake in the epic - norfolk study figure 1 shows the continuous association between quantity and variety of combined f&v intake and t2d . As shown, the hr for t2d decreased between an intake of 3.57.0 portions per day (fig . 1a), and this association was largely unchanged after accounting for the effects of variety of f&v (fig . 1b). For variety, consuming 12 different f&v items per week was associated with a decreased hr of t2d (fig . 1c), and this association was largely unaffected after accounting for the effects of quantity of f&v intake (fig . The percentage of participants achieving a quantity of> 3.5 portions per day was 53.2%, and the percentage achieving a variety of> 12 different f&v items per week was 40.3% . The upper percentile of the first tertile for quantity and variety of f&v intake was used as the reference category . A: the association between quantity of f&v intake and hr (95% ci) of diabetes adjusted for sex, bmi, waist circumference, education level, townsend deprivation index, occupational social class, physical activity level, smoking status, family history of diabetes, total energy intake, and season . C: the association between variety of f&v intake and hr (95% ci) of diabetes adjusted for sex, bmi, waist circumference, education level, townsend deprivation index, occupational social class, physical activity level, smoking status, family history of diabetes, total energy intake, and season . Results were unaffected in sensitivity analyses after excluding participants who 1) developed t2d within the first 2 years of follow - up, 2) had a baseline hba1c level of 6.5% in the subsample with hba1c data, and 3) were in the top and bottom 1% of energy intake to energy expenditure (data not shown). We found no evidence of interaction between either quantity or variety in f&v intake with sex, age, bmi, or smoking status and incident diabetes (p> 0.10). In this prospective study of nearly 4,000 men and women with dietary information from prospective 7-day food diaries, we observed that a greater quantity of vegetable intake and a greater variety of fruit, vegetables, and combined f&v intake may independently be beneficial for reducing the risk of t2d . After accounting for potential confounding factors and the effects of quantity of intake, each different additional two item per week increase in variety of f&v intake was associated with an 8% reduction in the incidence of t2d . Previous epidemiological studies have reported inconsistent findings for an association between quantity of f&v intake and risk of t2d . Two separate meta - analyses have reported no overall association between fruit, vegetables, and combined f&v intake and diabetes risk, although there was significant heterogeneity of association between the included studies (21,22). (21) did however find a significant inverse association between green leafy vegetable intake and risk of t2d (hr for highest vs. lowest intake group 0.86 [95% ci 0.770.97]). Although low heterogeneity in f&v consumption may be one explanation for the null findings in some study populations, our current results suggest that it may also be due to differences in the assessment methods used for measuring f&v intake . Although ffqs can be used to rank individuals according to their relative intake (8), they are less suitable for the assessment of absolute intake (11,23), which they tend to overestimate . For example, in the epic - norfolk study, mean consumption of f&v was much higher when assessed by ffq (6.5 portions per day) than by a food diary (3.8 portions per day) (11). For this reason, ffqs are not ideal for examining adherence to, or for informing, public health guidelines . Furthermore, ffqs are based on perceptions of habitual intake, whereas food diaries are based on self - report of foods and amounts actually consumed in real time (8). Additionally, because ffqs contain only a limited list of precoded food items, which tend to be grouped together, unlike the food diary, which is open ended, they may not be as suitable as food diaries for assessing variety of food intake . Despite the fact that variety in f&v intake has been advocated by many national and international bodies (57), no studies that we are aware of have explored associations between variety in intake and risk of t2d . Our current findings suggest that quantity (at least 3.5 portions of f&v per day) and variety (at least 12 different f&v items per week) in f&v intake are both inversely and independently associated with t2d . However, only 50% and 40% of the participants reported meeting these thresholds for quantity and variety of intake, respectively . There are several unique strengths of our study, including the large sample size, prospective study design, use of a 7-day prospective food diary with disaggregated f&v data, thorough assessment of new cases of t2d with self - report information supplemented by external sources, and comprehensive information on covariates, thus minimizing sources of bias and confounding . Another strength of our study was that we had hba1c data available on a subsample of participants and were thus able to demonstrate that our findings were unlikely to have been influenced by the presence of previously undiagnosed cases of t2d at baseline . However, several potential limitations of our study merit discussion . First, because of the observational nature of the study, we cannot exclude the possibility of residual confounding or confounding by unmeasured factors . Second, we used baseline dietary consumption data to characterize individuals and did not take into account possible misclassification with respect to changes in consumption patterns over time . However, as this type of misclassification is likely to be nondifferential, the effect would be to attenuate the observed hrs toward the null, suggesting that the true associations between quantity and variety in f&v intake may be stronger than reported in the current study . We were also not able to adjust for lifestyle factors (e.g., smoking and physical activity) that may have changed during follow - up . Finally, our population is predominantly of european - caucasian origin (99.1%) and middle aged . Thus, the generalizability of our findings to other populations may be limited . Nevertheless, in comparison with the general population of england, epic - norfolk participants are comparable with respect to characteristics including anthropometry, blood pressure, and lipids (10). The biological mechanisms for the inverse associations of f&v intake and diabetes risk are not clear . Our findings suggest that f&v may be inversely associated with diabetes through two distinct but complementary pathways . A plausible biological mechanism to explain the beneficial effect of quantity of f&v intake on t2d is via the low energy and high fiber content of f&v, and as such their ability to reduce the overall energy content of the diet . It has previously been demonstrated that those who consume the highest quantity of f&v, in comparison with low consumers, have a lower risk of weight gain (24,25), a major risk factor for diabetes (26). A decreased risk of t2d with increasing quantities of vegetable intake in particular may be explained by the fact that vegetables are generally consumed with other foods as part of a meal and therefore may displace or buffer the harmful effects of deleterious foods from the diet, such as energy - dense foods or foods that increase the risk of t2d . Alternatively, higher consumption of specific vegetables, particularly green leafy vegetables, might reduce the risk of t2d due to the presence of relatively high concentrations of potentially beneficial bioactive compounds (21). The biological mechanisms for the inverse associations of variety of f&v intake with t2d are not clear but may be attributable to individual or combined effects of the many different bioactive phytochemicals contained in f&v (e.g., vitamin c and carotenoids) (27,28). Thus, consumption of a wide variety of f&v will increase the likelihood of consuming these phytochemicals . As the current study was not designed to examine mechanisms of association, future studies will be required to investigate this further . In conclusion, using the prospective 7-day food diary to assess f&v intake, we found that a greater variety of fruit, vegetables, and combined f&v intake is associated with a reduced risk of t2d, whereas for quantity, only greater vegetable, but not fruit intake, was associated with a reduced risk . These findings support current public health recommendations encouraging consumption of f&v as part of a balanced diet and place particular emphasis on the important and independent role that both quantity and variety in f&v intake may play in helping to prevent the development of t2d.

The rh1 alloimmunization responsible for the hemolytic disease of the newborn occurs when the rh1-negative mother s blood comes into contact with the foetus s rh1 positive red blood cells . After the passing of foetal red blood cells into the maternal circulation, the rh1 antigens on foetal red blood cells, which are foreign antigens to the maternal immune system, trigger the immunological processes producing anti - rh1 allo - antibodies of the immunoglobulin class igg . These antibodies cross the placenta, attack foetal red blood cells and lead to a foetal hemolytic anemia . The immunoprophylaxis by anti - rh1 immunoglobulins has been established since the 1970s, but this disease remains the leading cause of fetal anemia . The severe forms of hemolytic disease are observed in 10% of fetuses or newborn affected by this disease . It exposes to fetal complications such as hydrops, hypoxic brain damage and fetal death . We report a case of dramatic outcome of an observation of severe hemolytic anaemia in a newborn due to rh1 incompatibility, which led to death . A male newborn presenting the antecedents of consanguinity was admitted 30 minutes of life to the pediatric department of mohammed v military teaching hospital for the issue of hydrops fetalis on rhesus incompatibility; the birth weight was 1800 g and his blood group was a rh1 . After birth, the baby was intubated and placed on mechanical ventilation due to respiratory distress and hypoxia . The blood group of his mother, aged 31, was ab rh1-negative and that of his father aged 37 was a rh1 . The mother had a history of 4 term deliveries, 3 abortions, and 1 living child ., she was sent to gynecology department of mohammed v military teaching hospital after the discovery of fetal ascites . Preterm birth was induced at 30 weeks of gestation by cesarean section under spinal anaesthesia and she was transferred to the medical intensive care unit and the newborn was transferred to the paediatric department . The laboratory tests of the newborn on the first day of life showed hyperbilirubinaemia (total serum bilirubin level = 30 mg / l), hyperuremia (1.03 g / l), hyperkalaemia (7.2 mmol / l) and hyponatremia (134 the blood count showed bicytopenia with macrocytic regenerative anemia (hemoglobin = 4g / dl, mean corpuscular volume = 183 fl, reticulocyte count = 176600/l) associated with thrombocytopenia at 120 000/l . The blood smear showed erythroblastosis (1256 erythroblasts per 100 leukocytes), howell jolly bodies, anisocytosis and many macrocytes (figure 1). After drainage of the ascites fluid, the newborn was transfused with red blood cell concentrates and was also treated with conventional phototherapy . The evolution was unfavorable with a steady increase of total serum bilirubin level (71 mg / l), hemoglobin (9.4 g / dl), reticulocytes (187203/l) and circulating erythroblasts (1386 erythroblasts per 100 leukocytes) and a decrease in platelet count (72 000/l) on the second day (table i) and died three days after the death of his mother, who died from pulmonary embolism in the intensive care unit . Our case report shows that there is rh1 incompatibility between the ab rh1-negative mother and the a rh1 newborn . The feto - maternal blood incompatibility constitutes the major cause of autoimmune hemolytic anaemia among newborns and must be evoked first before a neonatal anemia with early onset jaundice . The allo - antibodies of the most common obstetrical interest are anti - rh1, anti - rh4 and anti - kel1, representing respectively 35%, 37% and 13% of identified allo - antibodies; they are responsible for 88%, 8% and 2% respectively for severe fetomaternal incompatibilities . Our patient presented anemia associated with erythroblastosis, howell jolly bodies, many macrocytes and high reticulocytosis showing a very active erythropoiesis, to compensate for the hemolysis . Biological signs of autoimmune hemolytic anemia are regenerative anemia which can be macrocytic or normochromic normocytic anemia, a decrease in haptoglobin, an increase in lactate dehydrogenase related to the importance of hemolysis; a hemoglobinemia with hemoglobinuria in the case of intravascular hemolysis and sometimes an increase in unconjugated bilirubin and a decrease in the glycated hemoglobin and the direct antiglobulin test is positive in 95% of cases . The direct antiglobulin test is based on the detection of erythrocytic autoantibodies either in serum, or when they are attached on red blood cells . In this pathology, it is necessary to exclude physiologic jaundice due to newborn s immature liver . However, the physiologic jaundice of the newborn is never present at birth and appears from the 36th hour to reach a maximum on the 3rd-4th day and disappears before the 10th day . It is also necessary to eliminate abo incompatibility which is exclusively found in newborns with a or b blood type and whose mothers are o blood type and neonatal jaundice associated with hyperhemolysis due to common congenital hemolytic anemia: red blood cell membrane disorders (hereditary spherocytosis, hereditary elliptocytosis, and hereditary pyropoikilocytosis), red blood cell enzyme defects (glucose 6 phosphate dehydrogenase deficiency, pyruvate kinase deficiency and other red blood cells enzymopathies) and neonatal hemolysis due to hemoglobinopathies(-thalassaemia major and -globin and -globin chain structural abnormalities). The cases of polycythemia vera and certain infectious syndromes can also be accompanied by jaundice . In case of prolonged jaundice the irregular agglutinin test is an important test for pregnancy monitoring as part of the prevention of anti - rh1 alloimmunization and management of feto - maternal incompatibilities . It aims at detecting and identifying red cell alloantibodies directed against erythrocyte antigens other than a or b of unexpressed abo system on the surface of its own red blood cells capable of inducing, by feto - maternal incompatibility, hemolytic disease in the fetus and/or newborn . The irregular agglutinin test is done 2 times (1st and 6th or 7th prenatal examinations) in rh1 pregnant women without transfusion history and 4 times (1, 4, 6 and 7th prenatal examinations) in rh1 women with a history of transfusion or pregnancy and in the rh1 negative women . This test is also practiced at childbirth in rh1 negative women before the anti - d immunoglobulin injection . Postnatal management of hemolytic disease of the newborn due to rh1 incompatibility aims at preventing postnatal death from anemia complications and neonatal kernicterus and may include: intensive phototherapy which is the most commonly used treatment and its effectiveness is evaluated by regular monitoring of the concentration of total serum bilirubin, exchange transfusion which is the last resort in the treatment of hyperbilirubinaemia and its adverse effects are numerous: hypocalcaemia and thrombocytopenia, convulsions, necrotizing enterocolitis, apnea, bradycardia, hyperkalemia and hypoglycemia . The treatment of hyperbilirubinaemia can also be done using intravenous immunoglobulin (ivig) (0.51 g / kg). A few small randomized controlled trials showed that the use of ivig reduced the need for exchange transfusion, the duration of intensive phototherapy and length of hospitalization, but a randomized controlled trial conducted in the netherlands did not confirm these results . Other drugs which have been proposed in the treatment of neonatal jaundice are: d - penicillamine and metalloporphyrins which inhibit hemeoxygenase and reduce the production of bilirubin, albumin which increases bilirubin transport capacity in the blood and reduces the blood concentration of unconjugated bilirubin, and phenobarbital which increases bilirubin uptake, conjugation and excretion . Blood transfusions may also be needed to correct severe anemia . Despite blood transfusion and treatment by intensive phototherapy, our patient died four days after his birth with hemolysis, kidney failure, jaundice and hypoxia . The best treatment is to prevent causal anti - d immunization with intravenous (iv) anti - rh1 immunoglobulin in rh1 negative pregnant women to neutralize the foetal red blood cells in the maternal vascular compartment . When the newborn is rh1 negative, the rhesus is confirmed on the second sample . If negativity is confirmed, anti - d immunization in mothers is unnecessary . If the newborn is rh1, the prophylaxis of alloimmunization to rh1 antigen is based on the iv injection of anti - rh1immunoglobulins . It is necessary first of all to perform the double determination of abo group and the phenotype of rh - kell of the newborn, a direct antiglobulin test on the red blood cells of the newborn, the irregular agglutinin test on maternal serum at childbirth and kleihauer test on maternal blood collected at least one hour after delivery . The iv injection of anti - rh1 immunoglobulins is carried out within 72 hours at the latest following delivery . The monitoring of these high - risk pregnancies requires specialized centres and collaboration between the gynecologist and the blood transfusion centre biologist . Hemolytic disease of the newborn related to rh1 incompatibility is rare but serious . In order to avoid this drama, it is necessary to strengthen the prevention and clinico - biological monitoring in patients with a history of feto - maternal rhesus alloimmunization by sensitizing and advising all rh1 negative unimmunized women that rh1 prophylaxis should be applied after all birthing of rh1 child and must also always be carried out after any miscarriage.

Tourette syndrome (ts) is a childhood neuropsychiatric disorder characterized by motor and phonic tics . Ts is often complicated by behavioral disorders such as attention - deficit hyperactivity disorder (adhd), obsessive - compulsive disorder (ocd), and anxiety and emotional disorders . Approximately one - third of ts patients engage in self - injurious behaviors . As a self - limited disease, while ts symptoms are often controlled effectively via behavioral and drug therapies, conventional therapy does not work for a small number of patients . Since 1995, researchers have been working toward the use of stereotactic surgery in the treatment of ts . In 1999, bilateral subthalamic deep brain stimulation (dbs) was first applied in the treatment of ts with substantial efficacy . Subsequently, researchers have attempted the use of dbs for the treatment of ts with various targets . This study was conducted at the department of functional neurosurgery at xuanwu hospital, capital medical university . We performed globus pallidus internus (gpi) dbs on 25 patients with drug - resistant ts and conducted follow - up assessments of 24 of the patients for over 1 year . Twenty - five patients with refractory ts were admitted to our hospital for treatment between september 2007 and august 2014 . Following the electrode placement surgery, specifically, he experienced severe anxiety when the dbs stimulator was turned on . Because of this side effect and the observation that dbs produced no remarkable improvement in ts symptoms, the patient requested that the stimulator to be switched off . As this patient refused to undergo a procedure to adjust the electrode position, we excluded him from our research sample . Thus, the study population included 24 patients: 22 male and two female individuals aged 1841 years (mean age: 25.3 6.4 years) with an average medical history of ts of 14.7 years (821 years). Most of the patients had comorbid disorders, including ocd (18 cases), adhd (16 cases), emotional disorder (15 cases), and self - injury behavior (three cases). All patients met the diagnostic criteria for ts as per the diagnostic and statistical manual of mental disorders, 4 edition, text revision (dsm - iv - tr) and exhibited complex motor tics complicated with phonic tics . The diagnostic confidence index (dci) scores for the participant group ranged from 58 to 96 (77.71 12.12) [table 1]. Surgical procedures were performed according to the declaration of helsinki and were approved by the institutional review board at xuanwu hospital . Baseline clinical characteristics and dbs complications of the 24 patients with tourette syndrome one patient experienced a mild sexual dysfunction, subcutaneous fluid accumulation, and infection in the ipg site . Diplopia, flashing, fatigue, dizziness, and limb convulsions were observed as transient complications and disappeared following adjustment the stimulation parameters and electrode settings . Dbs: deep brain stimulation; dci: diagnostic confidence index; ygtss: yale global tic severity scale; adhd: attention deficit hyperactivity disorders; ed: emotional disorder; ocd: obsessive - compulsive disorder; sib: selfinjury behavior; ipg: implantable pulse generator . The surgical inclusion criteria were as follows: (1) ts diagnosis according to diagnostic and statistical manual of mental disorders, 4 edition, text revision criteria and the dci, (2) chronic and severe tic disorder with severe functional impairment, (3) the patient had not responded to adequate doses of three classes of drugs administered for at least 12 weeks each or could not tolerate medications because of side effects, and (4) the patient was over 18 years of age . Our exclusion criteria barred patients whose tic disorder was attributable to another medical, psychiatric, or neurological disease, those with severe cardiovascular, pulmonary, or hematological disorders, and those with cerebral structural abnormalities from participation . We first performed magnetic resonance scanning (1.5 tesla, siemens, germany) and identified the three - dimensional coordinates of the posterior ventral globus pallidus according to the schaltenbrand after placing the patient under local anesthesia with mild sedation, we created a 2.5 cm long incision in the scalp, starting 2.5 cm from the coronal suture and running parallel to the midline . After drilling a hole in the skull, we ensured that the dura mater had been coagulated before opening it via a cruciate incision . Using a high - impedance microelectrode with a tip diameter of 12 m, we recorded extracellular discharges 10 mm above the target and confirmed the tissue characteristics . A dbs device (model 3387, medtronic, minneapolis, mn we then incised the retroauricular and subclavian regions and implanted the connecting wire and implantable pulse generator (ipg, kinetra 7428 or soletra 7426). We conducted bilateral gpi stimulation in twenty patients and unilateral gpi stimulation in four other patients who could not afford bilateral stimulation device or whose symptoms affected only one side . The dbs devices were switched on 1 week after surgery in a unipolar stimulation mode . The stimulation parameters included a pulse width of 90120 s, frequency of 65185 hz, and amplitude of 2.53.7 v. the stimulation parameters were individually adjusted according to the extent of symptomatic improvement and degree of side effects with the goal of obtaining an optimal treatment with minimal side effects . Patients continued the use of any medications they had been treated with before the surgery . The follow - up data were compiled by an assessment group that was independent from the surgical group . The severity scores for motor tics, phonic tics, overall damage, and global tics were assessed based on the yale global tic severity scale (ygtss). The assessments were performed 1 week before the surgery and 3, 6, and 12 months after the surgery . The symptoms of ocd were assessed using the yale - brown obsessive - compulsive scale (y - bocs). Surgical safety was evaluated by means of the wechsler adult intelligence scale - revised in china (wais - rc). The postoperative improvement rate of symptoms was calculated as follows: improvement rate = (preoperative ygtss score postoperative ygtss score)/preoperative ygtss score 100% . All statistical analyses were performed using the statistical software package spss version 17.0 (ibm statistics, chicago, il, usa). Statistical differences were assessed through a one - way analysis of variance (anova) using the student newman keuls test for post hoc comparisons after assessing the normality of data distribution . A criterion of p <0.05 was used for statistical significance . Twenty - five patients with refractory ts were admitted to our hospital for treatment between september 2007 and august 2014 . Following the electrode placement surgery, specifically, he experienced severe anxiety when the dbs stimulator was turned on . Because of this side effect and the observation that dbs produced no remarkable improvement in ts symptoms, the patient requested that the stimulator to be switched off . As this patient refused to undergo a procedure to adjust the electrode position, we excluded him from our research sample . Thus, the study population included 24 patients: 22 male and two female individuals aged 1841 years (mean age: 25.3 6.4 years) with an average medical history of ts of 14.7 years (821 years). Most of the patients had comorbid disorders, including ocd (18 cases), adhd (16 cases), emotional disorder (15 cases), and self - injury behavior (three cases). All patients met the diagnostic criteria for ts as per the diagnostic and statistical manual of mental disorders, 4 edition, text revision (dsm - iv - tr) and exhibited complex motor tics complicated with phonic tics . The diagnostic confidence index (dci) scores for the participant group ranged from 58 to 96 (77.71 12.12) [table 1]. Surgical procedures were performed according to the declaration of helsinki and were approved by the institutional review board at xuanwu hospital . Baseline clinical characteristics and dbs complications of the 24 patients with tourette syndrome one patient experienced a mild sexual dysfunction, subcutaneous fluid accumulation, and infection in the ipg site . Diplopia, flashing, fatigue, dizziness, and limb convulsions were observed as transient complications and disappeared following adjustment the stimulation parameters and electrode settings . Dbs: deep brain stimulation; dci: diagnostic confidence index; ygtss: yale global tic severity scale; adhd: attention deficit hyperactivity disorders; ed: emotional disorder; ocd: obsessive - compulsive disorder; sib: selfinjury behavior; ipg: implantable pulse generator . The surgical inclusion criteria were as follows: (1) ts diagnosis according to diagnostic and statistical manual of mental disorders, 4 edition, text revision criteria and the dci, (2) chronic and severe tic disorder with severe functional impairment, (3) the patient had not responded to adequate doses of three classes of drugs administered for at least 12 weeks each or could not tolerate medications because of side effects, and (4) the patient was over 18 years of age . Our exclusion criteria barred patients whose tic disorder was attributable to another medical, psychiatric, or neurological disease, those with severe cardiovascular, pulmonary, or hematological disorders, and those with cerebral structural abnormalities from participation . We used a crw human stereotactic instrument (radionics inc ., usa) for location orientating . We first performed magnetic resonance scanning (1.5 tesla, siemens, germany) and identified the three - dimensional coordinates of the posterior ventral globus pallidus according to the schaltenbrand, we created a 2.5 cm long incision in the scalp, starting 2.5 cm from the coronal suture and running parallel to the midline . After drilling a hole in the skull, we ensured that the dura mater had been coagulated before opening it via a cruciate incision . Using a high - impedance microelectrode with a tip diameter of 12 m, we recorded extracellular discharges 10 mm above the target and confirmed the tissue characteristics . A dbs device (model 3387, medtronic, minneapolis, mn, usa) was implanted intracranially and fixed in place . We then incised the retroauricular and subclavian regions and implanted the connecting wire and implantable pulse generator (ipg, kinetra 7428 or soletra 7426). We conducted bilateral gpi stimulation in twenty patients and unilateral gpi stimulation in four other patients who could not afford bilateral stimulation device or whose symptoms affected only one side . The dbs devices were switched on 1 week after surgery in a unipolar stimulation mode . The stimulation parameters included a pulse width of 90120 s, frequency of 65185 hz, and amplitude of 2.53.7 v. the stimulation parameters were individually adjusted according to the extent of symptomatic improvement and degree of side effects with the goal of obtaining an optimal treatment with minimal side effects . Patients continued the use of any medications they had been treated with before the surgery . The follow - up data were compiled by an assessment group that was independent from the surgical group . The severity scores for motor tics, phonic tics, overall damage, and global tics were assessed based on the yale global tic severity scale (ygtss). The assessments were performed 1 week before the surgery and 3, 6, and 12 months after the surgery . The symptoms of ocd were assessed using the yale - brown obsessive - compulsive scale (y - bocs). Surgical safety was evaluated by means of the wechsler adult intelligence scale - revised in china (wais - rc). The postoperative improvement rate of symptoms was calculated as follows: improvement rate = (preoperative ygtss score postoperative ygtss score)/preoperative ygtss score 100% . All statistical analyses were performed using the statistical software package spss version 17.0 (ibm statistics, chicago, il, usa). Statistical differences were assessed through a one - way analysis of variance (anova) using the student newman keuls test for post hoc comparisons after assessing the normality of data distribution . A criterion of p <0.05 was used for statistical significance . Among 24 cases, 18 patients experienced a lesion - like effect after the dbs surgery and exhibited varying symptomatic improvement ranging from 10% to 80% (self - assessment). When the lesion - like effect disappeared 37 days later, such that the symptoms had completely reappeared, we switched the dbs on . The follow - up data were obtained over a period of more than 12 months (ranging from 12 to 99 months) after the operation [table 2]. At the 3-month follow - up assessment, six of the patients reported that they had received no benefit from the stimulation while the remaining 18 cases exhibited varying degrees of symptom amelioration ., we found a significant improvement in four types of ygtss scores from 3 months onward . The final follow - up data (> 12 months) are not presented in table 2 . Ygtss: yale global tic severity scale; sd: standard deviation . At the 6-month follow - up assessment, all patients had significantly improved symptoms and 56% of patients had a significant decrease in ygtss scores compared with the baseline (p <0.01). At the 12-month follow - up, symptom improvements tended to be stable (ygtss scores had improved by 57.8% from baseline, p <0.01). The average improvement of motor tics, phonic tics, social impairment, and global scores were 53.7%, 48.1%, 64.8%, and 57.8%, respectively . Particularly, the mean score of global impairment was reduced to 14.2 points, which suggested that the social function of the patients was significantly improved . At the 12-month follow - up assessment, self - evaluations indicated that symptoms had improved by 50%80% after the dbs surgery, with an average improvement of approximately 70% . The improvement reflected by the self - assessment was higher than that of the ygtss score . This might be because the patients felt that their active control over tics had greatly increased after operations, such that the associated symptoms, such as emotional disorders and ocd, decreased as well . The y - bocs reflected a decrease in obsessive - compulsive tendencies at the 3 and 6-month follow - up assessments . We found a statistical difference between baseline score and scores at 3, 6, and 12 months . At the 12-month follow - up, y - bocs scores had stabilized such that they were similar to those at 6 months, with an average improvement of 38.59% compared with baseline [figure 1]. Y - bocs scores before and after gpi - dbs in ts patients . Compared with baseline values, y - bocs scores were statistically lower at 3, 6, and 12-month follow - up assessments . * p <0.01 versus baseline . Y - bocs: yale - brown obsessive - compulsive scale; gpi: globus pallidus internus; dbs: deep brain stimulation; ts: tourette syndrome . The mean preoperative scores from the wais - rc were as follows: the verbal intelligence quotient (viq) was 98.04 7.87, the performance - iq (piq) was 99.21 7.26, and the full - iq (fiq) was 98.30 6.74 . At the 12-month follow - up assessment, the mean viq, piq, and fiq scores were 100.08 7.71, 99.29 7.32, and 99.88 7.21, respectively . There were no significant changes before versus after the surgery in any of the patients [figure 2]. We found no significant difference between viq, piq, and fiq scores at baseline, 3, 6, and 12-month assessments . Wais - rc: wechsler adult intelligence scale - revised in china; gpi: globus pallidus internus; dbs: deep brain stimulation; ts: tourette syndrome; viq: verbal intelligence quotient; piq: performance - iq; fiq: full - iq . At the early stage of dbs - on (immediately after the stimulator had been turned on), temporary complications included diplopia, flashing, fatigue, dizziness, and limb convulsions . By adjusting the stimulation parameters and electrode settings, we found that these transient complications could be eliminated . One patient reported mild sexual dysfunction 3 months after the dbs had been switched on, and his dbs device was removed because of infection in the ipg site happening at 23 months after the operation . Another patient also experienced postoperative subcutaneous fluid accumulation in the ipg pocket, which, although improved by puncture and aspiration at 12 months, finally resulted in infection 22 months postoperation and subsequent removal of the implanted device . A similar incident occurred in a third patient 26 months after the surgery whose tics began to mildly deteriorate following the removal of his ipg and electrode . Among 24 cases, 18 patients experienced a lesion - like effect after the dbs surgery and exhibited varying symptomatic improvement ranging from 10% to 80% (self - assessment). When the lesion - like effect disappeared 37 days later, such that the symptoms had completely reappeared, we switched the dbs on . The follow - up data were obtained over a period of more than 12 months (ranging from 12 to 99 months) after the operation [table 2]. At the 3-month follow - up assessment, six of the patients reported that they had received no benefit from the stimulation while the remaining 18 cases exhibited varying degrees of symptom amelioration ., we found a significant improvement in four types of ygtss scores from 3 months onward . The final follow - up data (> 12 months) are not presented in table 2 . Ygtss: yale global tic severity scale; sd: standard deviation . At the 6-month follow - up assessment, all patients had significantly improved symptoms and 56% of patients had a significant decrease in ygtss scores compared with the baseline (p <0.01). At the 12-month follow - up, symptom improvements tended to be stable (ygtss scores had improved by 57.8% from baseline, p <0.01). The average improvement of motor tics, phonic tics, social impairment, and global scores were 53.7%, 48.1%, 64.8%, and 57.8%, respectively . Particularly, the mean score of global impairment was reduced to 14.2 points, which suggested that the social function of the patients was significantly improved . At the 12-month follow - up assessment, self - evaluations indicated that symptoms had improved by 50%80% after the dbs surgery, with an average improvement of approximately 70% . The improvement reflected by the self - assessment was higher than that of the ygtss score . This might be because the patients felt that their active control over tics had greatly increased after operations, such that the associated symptoms, such as emotional disorders and ocd, decreased as well . The y - bocs reflected a decrease in obsessive - compulsive tendencies at the 3 and 6-month follow - up assessments . We found a statistical difference between baseline score and scores at 3, 6, and 12 months . At the 12-month follow - up, y - bocs scores had stabilized such that they were similar to those at 6 months, with an average improvement of 38.59% compared with baseline [figure 1]. Y - bocs scores before and after gpi - dbs in ts patients . Compared with baseline values, y - bocs scores were statistically lower at 3, 6, and 12-month follow - up assessments . * p <0.01 versus baseline . Y - bocs: yale - brown obsessive - compulsive scale; gpi: globus pallidus internus; dbs: deep brain stimulation; ts: tourette syndrome . The mean preoperative scores from the wais - rc were as follows: the verbal intelligence quotient (viq) was 98.04 7.87, the performance - iq (piq) was 99.21 7.26, and the full - iq (fiq) was 98.30 6.74 . At the 12-month follow - up assessment, the mean viq, piq, and fiq scores were 100.08 7.71, 99.29 7.32, and 99.88 7.21, respectively . There were no significant changes before versus after the surgery in any of the patients [figure 2]. We found no significant difference between viq, piq, and fiq scores at baseline, 3, 6, and 12-month assessments . Wais - rc: wechsler adult intelligence scale - revised in china; gpi: globus pallidus internus; dbs: deep brain stimulation; ts: tourette syndrome; viq: verbal intelligence quotient; piq: performance - iq; fiq: full - iq . At the early stage of dbs - on (immediately after the stimulator had been turned on), temporary complications included diplopia, flashing, fatigue, dizziness, and limb convulsions . By adjusting the stimulation parameters and electrode settings, we found that these transient complications could be eliminated . One patient reported mild sexual dysfunction 3 months after the dbs had been switched on, and his dbs device was removed because of infection in the ipg site happening at 23 months after the operation . Another patient also experienced postoperative subcutaneous fluid accumulation in the ipg pocket, which, although improved by puncture and aspiration at 12 months, finally resulted in infection 22 months postoperation and subsequent removal of the implanted device . A similar incident occurred in a third patient 26 months after the surgery whose tics began to mildly deteriorate following the removal of his ipg and electrode . Approximately 30%40% of ts patients experience complete remission after puberty whereas another 30% experience further deterioration with aging . Some ts patients do not respond to treatment with systematic drugs or behavioral therapy and, thus, search for alternative treatments . Indeed, some symptoms might last into adulthood, making ts a life - long disease . The management of patients with malignant ts can be very challenging, to the extent that some individuals might opt for surgical treatments . Since then, a variety of surgical methods have been tested, leading to a large body of literature concerning possible ts mechanisms and treatments . In 1999, vandewalle et al . Described the first use of dbs for the treatment of ts . According to the literature, the thalamus and globus pallidus were selected as stimulation targets in the vast majority of patients . The average amount of tic improvement following dbs is generally 60%70% while a few studies have reported rates as high as 90%100% . There does not appear to be a significant therapeutic difference between stimulation of the thalamus or globus pallidus although stimulation of the anterior limb of the internal capsule and nucleus accumbens seems to be less effective (25%50%) for treating ts . However, these sites might impact emotion (stimulating different regions can cause feelings of depression or anxiety). Thus, these regions might be useful targets in the treatment of severe affective disorders . A large number of studies have suggested that the basal ganglia play an important role in the pathophysiology of ts . According to the basal ganglia - thalamus - cortex loop theory described by mink, dysfunction of this loop leads to ts symptoms . Therefore, dbs stimulation of the globus pallidus or thalamus, which are positioned in this loop, could bidirectionally regulate abnormal impulses in the striatum and thalamus . Dysfunctions in the limbic striatal loop and orbitofrontal cortex - medial thalamic nuclei loop are associated with the onset of ts and ocd . As projections from the frontal thalamus and frontal striatum pass through the anterior limb of the internal capsule, dbs of this region might have therapeutic benefit . In this study, we treated 24 ts patients with gpi - dbs and conducted follow - up assessments for over 12 months . Before the surgery, our patients responded poorly to conventional medication and psychological - behavioral treatment . At the 12-month follow - up assessment, we found that the motor and phonic tics had significantly improved in all 24 patients . Specifically, gpi - dbs was effective for rapid and transient motor tics (clonic tics), phonic tics, and slow and sustained movements (dystonic tics). The impulse to move (sensory tics or premonitory urge) was also significantly alleviated by the surgery in this patient group . Social impairment scores were reduced by 64.8%, indicating restored social function in the patient population . In addition, we found varying degrees of improvement in comorbid disorders, such as ocd, self - injury behavior, and emotional disorders (testiness and irritability), after the surgery . A study investigating quality of life in ts patients after gpi - dbs obtained similar findings and concluded that symptomatic improvement might lead to unexpected major psychosocial changes . In our study, we observed an improvement in both tic and ocd symptoms in our patient population . The improvement in ocd symptoms that we found is similar to the outcome reported for the use of ventral capsule / ventral striatum as dbs targets for treatment of ocd . Since it can be difficult to completely distinguish ocd symptoms from tics in ts patients with comorbid ocd, it might be difficult to discern the mechanisms underlying the observed improvement . Therefore, it still needs more evidence for concluding that gpi is an appropriate target for ocd treatment based on this study . Overall, our data indicate that bilateral gpi - dbs can be used to effectively regulate abnormal nerve impulses in the basal ganglia - related loop, thereby ameliorating tics and various accompanying symptoms in patients with ts, and improve patients quality of life with no significant changes in their intelligence or personality . The incidence of complications associated with dbs generally exceeds 25%, and 4%6% of these complications are permanent . In our study, a total of three patients encountered long - term postoperative surgical complications, which correspond to 12.5% of the participant group . The case of mild sexual dysfunction (reduced sexual drive) in one patient requires further investigation . Two patients demonstrated skin erosion and subsequent infection at the ipg site who both engaged in robust athletic exercise after the operation . It is possible that the long - term and high - intensity friction from physical activity led to broken skin and infection in this area . Compared with the disabling symptoms and refractory nature of ts, milder complications such as fatigue, a mild decrease in sex drive, and focal dystonia might be seen as acceptable . Therefore, the application of dbs to the treatment of ts seems appropriate and efficacious . The application of dbs in the treatment of refractory ts has gained increasing attention in the academic community . In addition to the anterior limb of the internal capsule and the nucleus accumbens, all further surgery targets have been found to have good efficacy . Recently, a double - blind, randomized, crossover trial provided additional evidence that dbs in the gpi can significantly improve tics . However, the study had a small number of patients, a short follow - up period, and inconsistent assessment criteria, making it difficult to ascertain the optimal therapeutic approach . Indeed, the use of standard treatment criteria and assessment measures, as well as complete follow - up data, is essential for identifying new targets and improving surgical efficacy . In addition, since dbs is a reversible (i.e., patients return to the preoperative state a few hours after switching off the stimulator) procedure, the combination of dbs with modern imaging techniques such as functional magnetic resonance imaging, positron emission computed tomography, and single photon emission computed tomography might greatly contribute to investigations of the pathophysiological basis of ts (such as dopamine metabolism in the cortex - striatum - thalamus - cortex loop in the basal nucleus and dopamine receptor abnormality). First, this study as an open research project lacks randomized, double - blind, safety / efficacy study design and thus cannot exclude the possibility of placebo effect . Second, the follow - up study lasted for only 1 year, and longer - term effect was not available . In addition, this study is limited by the lack of a comparison target of stimulation, and it is insufficient to conclude that gpi serves as the optimal stimulation target . Postoperative neuroimaging study would be helpful in future research to further delineate the relationship between actual stimulation area and treatment effect . This project was supported by a grant from national natural science foundation of china (no . First, this study as an open research project lacks randomized, double - blind, safety / efficacy study design and thus cannot exclude the possibility of placebo effect . Second, the follow - up study lasted for only 1 year, and longer - term effect was not available . In addition, this study is limited by the lack of a comparison target of stimulation, and it is insufficient to conclude that gpi serves as the optimal stimulation target . Postoperative neuroimaging study would be helpful in future research to further delineate the relationship between actual stimulation area and treatment effect . This project was supported by a grant from national natural science foundation of china (no.

Rheumatoid arthritis (ra) is a chronic, systemic, autoimmune disease, and the most common form of chronic joint inflammation, affecting 0.51% of the uk population . Ra is most prevalent in individuals aged 40 years or older with the risk of developing ra being up to 5 times higher in women . As a consequence of their disease ra patients typically suffer severe joint pain, reduced muscle strength, and impaired physical function . Although outcomes of the disease have improved with modern approaches to drug treatment, using agents such as methotrexate and biologics, the disease is still a progressive one with long - term joint damage and disability the expectation rather than the rule . A major feature of the disease is severe inflammation of the synovium where there is a 3100 times elevation of proinflammatory cytokines such as tumour necrosis factor alpha (tnf-), interleukin-6 (il-6), interleukin-1 (il-1), and c - reactive protein (crp). The course of ra is typically one of exacerbations and remissions but, even during inactive phases of the disease, systemic levels of cytokines remain dysregulated when compared to those without rheumatoid arthritis . Ra also results in downregulation of anabolic factors for muscle, for example, muscle levels of insulin - like growth factor i (igf-1). The circulating levels of cytokines reflect disease activity and level of inflammation present and also may play a significant role in the systemic effects of the disease, such as vascular disease and rheumatoid cachexia . In addition to the articular features of the disease, ra is associated with increased morbidity and mortality from cardiovascular disease (cvd) [7, 8]. The relative risk of myocardial infarction is estimated to be double in women with ra relative to those without, and cvd events typically occur a decade earlier and to a greater extent in patients with ra relative to healthy controls; sometimes even before the fulfilment of all criteria of ra . A recent meta - analysis of 24 studies, comprising 111,758 patients with 22,927 cardiovascular events, reported a 50% increased risk of cvd deaths in patients with ra compared with the general population . This increase in cvd in ra patients appears to be independent of traditional cardiovascular risk factors . Given that chronic low - grade inflammation is thought to play an important role in the underlying cause of cvd, atherosclerosis, it seems reasonable to hypothesize that systemic inflammation contributes to elevated cvd in persons with ra . Most ra patients also suffer from an accelerated loss of muscle mass, a condition known as rheumatoid cachexia . This loss contributes to disability and has a significant impact on an individuals' quality of life . Rheumatoid cachexia has been reported in two thirds of all ra patients, including patients with stable ra [5, 14]. Roubenoff and colleagues proposed that rheumatoid cachexia is caused by the cytokine - driven (principally tnf-) hypermetabolism and protein degradation . However, poor nutrition and low physical activity levels are also believed to contribute . It has been demonstrated that ra patients do less exercise than their healthy counterparts; more than 80% of ra patients are physically inactive in some countries, whilst in the uk it is believed that approximately 68% of ra patients are physically inactive . The extreme physical inactivity of ra patients' becomes a vicious circle in terms of health and disease progression . Thus it has become apparent that encouraging physical activity is an important and essential part of the overall treatment of ra . The purpose of this paper is to highlight the importance of exercise in patients with ra and to demonstrate the multitude of beneficial effects that a properly designed exercise intervention has in this population . In order to present this aim firstly, a brief explanation of the background of ra and the benefits of exercise in the general population is presented . Secondly, the benefits of exercise in ra are highlighted, focusing on the areas of cardiovascular disease, musculoskeletal and joint health, and overall function . Thirdly, the perceptions of ra patients regarding exercise are discussed and finally exercise prescription for ra is reviewed . This expert review has been derived from a combination of systematic reviews and other research papers focusing on randomised controlled trials, published guidelines, the recent literature, and also making use of our own specialised experience . It is not within the scope of this review to discuss the benefits of standard low - intensity physiotherapy techniques such as range of motion, stretching, and/or specific joint strengthening . The review, however, does encompass a range of physical activity and physical exercise . We broadly define physical activity as any bodily movement produced by skeletal muscles resulting in energy expenditure above resting levels and physical exercise (exercise or exercise training) to be a subset of leisure time physical activity that pertains to planned, structured, and repetitive bodily movements, aimed at improving or maintaining fitness, physical performance, or health . We have based our definition of functional ability from the disablement process in ra as described by escalante and del rincon (2002) of pathology, impairment, functional limitation, and disability . Overview of the benefits of exercise in the general population: older adultsit is widely acknowledged that regular exercise / physical activity provides multiple health benefits for the general population and patients with chronic diseases . This includes improvements in cardiovascular health and reducing the risk of coronary artery disease, stroke, and type 2 diabetes by attenuating hypertension and dyslipidemia, improving insulin sensitivity and reducing adiposity; reducing the risk of colon and breast cancers; increasing muscle strength and mechanical properties and bone mineral density [22, 23]; improving balance and reducing the incidence of falls; facilitating psychological well - being . By engaging in recommended exercises older adults can help reduce the risk of chronic disease (e.g., of developing cvd by about 30%50%), premature mortality, functional limitation, and disability .basic recommendations from the american college of sports medicine (acsm) suggest for health benefit that every adult should accumulate at least 30 minutes of moderate - intensity physical activity on most days of the week . Acsm have issued a separate set of guidelines for older adults, that is, men and women aged 65 years and above and adults aged 5064 years with clinically significant chronic conditions such as ra . These guidelines are similar with additional importance stressed on muscle strengthening exercises and exercises to improve balance and flexibility . It is widely acknowledged that regular exercise / physical activity provides multiple health benefits for the general population and patients with chronic diseases . This includes improvements in cardiovascular health and reducing the risk of coronary artery disease, stroke, and type 2 diabetes by attenuating hypertension and dyslipidemia, improving insulin sensitivity and reducing adiposity; reducing the risk of colon and breast cancers; increasing muscle strength and mechanical properties and bone mineral density [22, 23]; improving balance and reducing the incidence of falls; facilitating psychological well - being . By engaging in recommended exercises older adults can help reduce the risk of chronic disease (e.g., of developing cvd by about 30%50%), premature mortality, functional limitation, and disability . Basic recommendations from the american college of sports medicine (acsm) suggest for health benefit that every adult should accumulate at least 30 minutes of moderate - intensity physical activity on most days of the week . Acsm have issued a separate set of guidelines for older adults, that is, men and women aged 65 years and above and adults aged 5064 years with clinically significant chronic conditions such as ra . These guidelines are similar with additional importance stressed on muscle strengthening exercises and exercises to improve balance and flexibility . Apart from the general effects of exercise previously mentioned in the general population, exercise has been shown to have specific health benefits in people with ra . In fact, as evident from past research, including findings from randomised controlled trials [5, 2841], exercise is considered to be fundamentally beneficial for ra patients . The reported benefits of properly designed physical exercise programs include improved cardiorespiratory fitness and cardiovascular health, increased muscle mass, reduced adiposity (including attenuated trunk fat), improved strength, and physical functioning, all achieved without exacerbation of disease activity or joint damage . Furthermore, when comparing the effectiveness of high and low intensity exercise training in stable ra, it is found that the former was more effective in increasing aerobic capacity, muscle strength, joint mobility, and physical function with no detrimental effect on disease activity in patients with controlled [5, 36] and active ra . A goal for any ra treatment regime should be to reduce cardiovascular comorbidity, in line with the overall aim of prolonging and improving quality of life . The benefits of physical activity, exercise training, and cardiorespiratory fitness in primary and secondary cardiovascular disease prevention are well established [42, 43]. Low aerobic fitness is strongly associated with all - cause and cardiovascular disease mortality in apparently healthy men and women, those with comorbid conditions (obesity, hypertension, and type 2 diabetes mellitus) and those with known coronary artery disease . In general, patients with ra are less physically active and have aerobic capacities, the measure of cardiorespiratory fitness, 20 to 30% lower than age - matched healthy controls [45, 46]. Furthermore, in a cross - sectional study of 65 ra patients (43 females), metsios et al . Observed that physically inactive ra patients had a significantly worse cardiovascular risk factor profile (higher systolic blood pressure and elevated total cholesterol, and low - density lipoprotein levels) when compared with physically active ra patients . Meta - analyses of exercise - based cardiac rehabilitation estimate a reduction in mortality of around 20 to 30% . Given that the main cause of reduced life expectancy in persons with ra is cvd related, the probable cardioprotective benefit of exercise training and regular physical activity to ra patients cannot be ignored . To date, however, most studies of the beneficial effects of exercise training in ra have focused on improvements in functional ability and other ra - related disease outcomes . In a recent cochrane review, moderate evidence for a positive effect of short - term dynamic exercise on aerobic capacity in ra patients was found . It is worth noting, however, that none of the 8 studies reviewed reported any other cardiovascular risk factors . A wider review of 40 studies of exercise in ra observed that none investigated exercise interventions in relation to cvd in ra . Clearly, future studies are required to specifically investigate the effect of exercise training and cardiorespiratory fitness on cvd risk in ra . Summary of cv health and ra(i) ra patients have an increased cv risk factor profile; (ii) ra patients have been shown to be less active and have poor aerobic fitness; (iii) the relationships between physical activity, aerobic fitness, and cv risk in ra patients requires more research; (iv) reducing cv risk through exercise could have an enormous impact in patients with ra . (i) ra patients have an increased cv risk factor profile; (ii) ra patients have been shown to be less active and have poor aerobic fitness; (iii) the relationships between physical activity, aerobic fitness, and cv risk in ra patients requires more research; (iv) reducing cv risk through exercise could have an enormous impact in patients with ra . As mentioned previously, approximately two thirds of ra patients suffer from cachexia (i.e., significant muscle wasting) [5, 14]. Rheumatoid cachexia is defined as a loss of body cell mass which predominates in skeletal muscle . Unlike the cachexia associated with conditions such as hiv - aids, cancers, copd, and frail old age, rheumatoid cachexia is usually characterised by stable bodyweight as the decrease in muscle mass is masked by a concomitant increase in fat mass . These detrimental changes in body composition not only causes muscle weakness and increased disability, but also contribute to fatigue and augmented risk of diabetes and cvd [5, 6, 47]. It has been proposed that cachexia occurs in ra due to the excess production of proinflammatory cytokines, principally tnf-, which is catabolic and thought to alter the balance between protein degradation and protein synthesis in ra . However, it is unlikely that this is the only cause as specifically blocking tnf- has proved unsuccessful in reversing muscle loss in previously untreated ra patients . Thus the precise mechanism by which rheumatoid cachexia occurs is not known but reduced insulin action, muscle igf - i levels, testosterone, and low habitual physical activity are likely to be contributing mediators [5, 53, 54]. Furthermore, the use of high - dose steroid therapy to control disease activity can exacerbate muscle atrophy in ra . In addition, the symptoms of the disease, for example, pain and fatigue, also result in ra patients being less physically active; decreasing physical activity then becomes part of the viscous circle of further decreasing muscle mass and has detrimental effects on other aspects of skeletal muscle health . Loss of strength, of up to 70%, is a common finding in ra patients in comparison to healthy counterparts . Loss of muscle mass is the main contributor to loss of muscle strength; however, it is not the only factor responsible [23, 58]. With ra, the loss of muscle mass, decreased physical activity, and immunologic factors may combine with alterations in skeletal muscle properties that could result in decreased muscle strength . A summary of these pertinent factors and how they are interlinked with other ra disease - related factors that result in functional limitation are shown in figure 1 . Although there was a suggestion that ra patients have a lower activation capacity, recent studies have shown that in stable ra quadriceps muscle recruitment, strength, and other skeletal muscle properties are not compromised [60, 61]. However, a case study in active ra indicates that these parameters might be negatively affected during increased disease activity and especially in the presence of an effusion, which adversely affects mechanical joint and muscle function . Quadriceps wasting, as well as a dramatic loss of force production, which was not due to pain or impaired muscle quality, was observed . If muscle physiological properties are impaired during times of disease flare, it is likely that this would impact on the length of recovery time needed after flare . This would thereby further emphasise the importance of early and persistent exercise training in these patients and early treatment of joint effusions to avoid possible reflex inhibition and altered joint geometry caused by the effusion that may interfere with exercise training . The impaired physical function that is characteristic of ra is strongly correlated with the diminished muscle mass, but to date there is no standard treatment for rheumatoid cachexia . High intensity resistance exercise has been shown to safely reverse cachexia in patients with ra and, as a consequence of this restoration of muscle mass, to substantially improve physical function and reduce disability in ra patients [5, 28, 63, 64]. For example, a 24-week high - intensity progressive resistance training (prt) program produced significant increases in lean body mass, reduced fat mass (notably trunk adiposity), and substantial improvements in muscle strength and physical function in ra patients . It is notable that the low - intensity range of movement exercises performed by an age-, sex- and disease - matched group of patients as the control condition elicited no changes in body composition or physical function . This investigation also revealed increases in previously diminished muscle levels of igf - i- and igf - binding protein-3 following prt suggesting a probable contributing mechanism for rheumatoid cachexia . Other exercise training programs have also been suggested to induce an anti - inflammatory effect, specifically relating to tnf- production . However, immune function (including tnf- and il-6) was unaltered following 12 weeks of high - intensity prt . In terms of the magnitude of hypertrophic and strengthening effects of prt observed in ra patients [5, 63, 64] these are similar to those reported for healthy middle - aged or older subjects (e.g., [23, 57, 6668]). The study by hakkinen and colleagues in fact provides a direct comparison of training response . They identified almost identical body composition changes (increased thigh muscle cross - section and reduced thigh fat thickness) and comparable strength increases in female ra patients and age - matched healthy women following completion of the same resistance exercise program . Furthermore, a range of skeletal muscle parameters (force, muscle architecture, coactivation of antagonist muscles, contractile properties, etc .) Were observed to be no different between well - controlled ra and their healthy counterparts, resulting in similar muscle quality (muscle force per size) between the groups, even in cachetic ra patients [60, 61]. Consequently it is now clear that patients with ra are not resistant to the anabolic effects of exercise as previously suggested . These findings are important to health professionals and those involved in prescribing exercise for people with ra as rheumatoid muscle should respond to exercise training in a similar way to that of muscle in healthy individuals . In fact now much research is promoting the fact that there are more detrimental effects if exercise is not undertaken . As high - intensity prt performed by ra patients, with both newly diagnosed and long - standing disease, has proved to be efficacious in increasing muscle mass, strength, and improving physical function, whilst being well tolerated and safe, it is advocated that such programs are included in disease management to counteract the effects rheumatoid cachexia [5, 56, 57, 71, 72]. Prt can also benefit other health aspects, for example, improving coordination and balance which ra can detrimentally affect . It is also important to maintain normal muscle strength in order to stabilise the knee joint, preventing joint angulation, and later osteoarthritis . Summary of rheumatoid cachexia and musculoskeletal health and exercise types for treatment(i) at least 50% ra patients suffer loss of lean mass; (ii) intensive progressive resistance training can increase lean mass, reduce fat mass, increase strength and improve function; (iii) prt is the most effective exercise to improve skeletal muscle size and strength; (iv) prt, even performed at high intensity, is safe in ra . (i) at least 50% ra patients suffer loss of lean mass; (ii) intensive progressive resistance training can increase lean mass, reduce fat mass, increase strength and improve function; (iii) prt is the most effective exercise to improve skeletal muscle size and strength; (iv) prt, even performed at high intensity, is safe in ra . In people with ra, not only does the typically sedentary lifestyle put them at greater risk of lower bone mineral density (bmd), but the disease itself (systemic inflammatory activity and high - dose oral steroid medication when used as part of ra treatment) results in radiological changes including bone loss (especially peripherally) [74, 75]. Lower bmd has been shown to occur at the femoral neck, distal forearm, and hip, but not the spine, in ra when compared with controls [74, 76]. Lower bmd in ra is found in patients on glucocorticoid treatment, and those with lower strength (handgrip and quadriceps) and physical capacity [74, 77, 78]. Thus highlighting how physical activity that involves muscle strengthening may assist in mitigating the bone loss in people with ra . Loss of bmd with age is difficult to mitigate and requires long - term weight loading on bone (either by repetitive weight - bearing and/or strengthening exercises). Several studies have reported no change in bmd with exercise training programmes in people with ra . However most of these investigations have either been too short in duration to detect changes, have featured low participant numbers, or did not include sufficient weight loading stimulus [56, 79]. The rheumatoid arthritis patients in training program (rapit) study observed a reduced rate of bmd loss in the hip, but not the spine, during 2 years of high - intensity weight - bearing exercise training . This mitigation of bmd loss was associated with increases in both muscle strength and aerobic fitness . The authors concluded that there is an essential role for the combination of high - intensity, weight- and impact - bearing exercises in improving bone mineral density in ra patients . Summary of exercise types for bone health(i) load - bearing exercise, prt and/or weight bearing, is required to increase bmd; (ii) combination of prt and weight / impact - bearing exercises may be required to improve bmd . (i) load - bearing exercise, prt and/or weight bearing, is required to increase bmd; (ii) combination of prt and weight / impact - bearing exercises may be required to improve bmd . The role of exercise in promoting the joint health of a person with ra is of great importance, especially as this is the most pronounced and invariant element of the ra disease pathology . Tendons are extensible structures that transmit forces from muscle to bone and reversibly deform under mechanical loads, with stiffer tendons providing more efficient force production . Sheaths, leading to synovial hypertrophy and sometimes infiltration of synovial tissue within the tendon . The raised circulating inflammatory cytokines also affect collagen, leading to damage and disorganisation of the tendon structure . In addition, tendons gradually lose their elasticity and stiffness as they age and in persons who do not engage regularly in physical activities or following disuse [23, 81, 82]. Only recently have tendon properties been investigated in ra, with tendon stiffness in stable established ra being lower than that of matched healthy controls (manuscript in preparation). In the case study example described above, lower patella tendon stiffness that was observed only in the effused knee during the acute phase was found in both knees 1 year later, despite maintenance of regular physical activity . Local effects of the joint effusion are likely to be responsible for the acute decrease in tendon stiffness whilst the systemic inflammatory processes of ra could be responsible for the long - term effects . Tendon stiffness can be increased, however, following strength training in older people and with endurance training . Potential beneficial exercise training effects in tendons of ra patients are to date unknown and warrant further investigation . The ligament forms another essential component of the joint, with the main function being to passively stabilise and guide the joint through its normal range of motion . Similar to the research surrounding tendons and the effects of exercise, it is known that exercise strengthens ligaments and that even relatively short periods of immobilisation weakens them [85, 86]. Thus, it may be suggested that regular physical activity for the ra patient is essential in order to maintain normal ligament and, consequently, overall joint health and function . The primary function of cartilage within the synovial joint is to protect the bone from damage by helping to minimise friction between adjacent bones during movement . It is known that periods of compression and decompression, which can be achieved through the mechanical forces and regular cyclic loading of an exercise bout, are required to prevent cartilage tissue from becoming fragile and dysfunctional [8890]. Furthermore, it is known that cartilage responds in a site - specific way to this loading . For many years, intensive dynamic and weight - bearing exercises were considered inappropriate for people with ra due to concerns that such activities may exacerbate disease . Furthermore, research has revealed that patients are concerned about whether such exercise can cause damage to the structure of the joint . Research by de jong and colleagues [28, 77, 92, 93] has shed light on this area of concern . They investigated the effects of a high - intensity exercise program in the rapit study . This involved biweekly participation in a 1.25-hour exercise session including aerobic, muscle strengthening, joint mobility, and an impact - delivering sport or game it was concluded that exercise did not cause an increase in the rate of damage to either large or the small joints of the hands and feet . Although initially there was a suspicion that those large joints which were badly damaged prior to the start of the study deteriorated more rapidly in the exercise group than controls, results from a follow - up study led the authors to retract this conclusion . At 18 months following the cessation of the exercise program, there was no significant difference in the rate of damage of the large joints between those patients available at follow - up who were still exercising and those who had discontinued exercise . Another finding from the rapit study indicates that there was no significant change in cartilage oligomeric matrix protein (comp) level, a measure of cartilage damage, in patients after 3 months of exercising . Range of movement and flexibility are also improved as a result of exercise, reducing movement limitation . For example, van den ende et al . Found that joint mobility increased as a result of a short - term intensive exercise programme in ra patients with active disease . Joint proprioception has also been reported to improve after physical activity and deteriorate after immobilisation or joint disease [96, 97]. Whilst yet to be determined in the ra population, elderly people who regularly practiced tai chi showed better proprioception at the ankle and knee joints than sedentary controls . It may also be that joint lubrication is enhanced as a result of physical activity, further acting to promote the health of the ra joint . More specifically, after resting for long periods, synovial fluid is squeezed out from between the two surfaces of joint, resulting in contact between the areas of cartilage . When movement is resumed, the mechanism of fluid film lubrication is reactivated . A study by lynberg et al . Is typical of findings that prt does not exacerbate joint inflammation (synovitis, joint swelling, joint tenderness, periarticular tenderness, and range of motion were all clinically assessed). Furthermore, in patients with moderate disease activity a reduction in the number of clinically active joints after vigorous exercise has sometimes been observed [36, 101]. Ra is also characterised by an increase in blood flow (synovial hyperaemia) and vascularisation of the synovium [102, 103]. Whilst the links between this process and joint destruction are poorly understood, it is thought that proliferation of the joint synovium and the action of cytokines such il-1 and tnf- act to break down the superficial layers of joint cartilage . However, some evidence suggests that intermittent cycles of raised intra - articular pressure during dynamic exercise might increase synovial blood flow, suggesting a beneficial effect of dynamic exercises in joint inflammation . Using a quantitative method, ultrasonography, recent research has suggested no acute effect of handgrip exercise on synovial hyperaemia of the wrist joint in ra patients . In summary, adequate strength and endurance of the muscles alongside tone and elasticity of the connective tissues promotes optimal joint stability, alignment and attenuation of impact and compressive forces [89, 108]. Summary of exercise types for joint health(i) resistance training increases tendon stiffness and strengthens connective tissue; (ii) cyclic loading (e.g., walking, cycling, strength endurance exercises) enhances cartilage integrity and joint lubrication; (iii) mobility exercises increase range of motion . (i) resistance training increases tendon stiffness and strengthens connective tissue; (ii) cyclic loading (e.g., walking, cycling, strength endurance exercises) enhances cartilage integrity and joint lubrication; (iii) mobility exercises increase range of motion . Patients with rheumatoid arthritis usually suffer from disability, severe pain, joint stiffness, and fatigue which impair physical function . Even after controlling for the disease with development of powerful disease - modifying antirheumatic drugs (dmards), patients still suffer from functional limitation, often leading to work disability . However, exercise has been shown to significantly improve some or all of these symptoms, especially function as well as psychological well - being [5, 56, 63, 111, 112]. For example, a two - year strength training program resulted in improvements in subjective patient assessments of disability by the health assessment questionnaire (haq). Similarly, marcora and colleagues found a significant inverse correlation between increases in leg lean mass following 12 weeks prt and the perceived difficulty in performing activities of daily living (adls). For example, an intensive prt program failed to improve modified haq scores in a group of ra patients despite significant improvements in muscle mass and strength . It was concluded that patients involved in this program had relatively low disability and that the modified haq was not sensitive to change in a low disability group . However, an internationally accepted definition of fatigue in ra currently does not exist, and its aetiology still remains a mystery . Fatigue can be described as a subjective experience, a feeling of extreme, persistent tiredness, weakness or exhaustion which can be both mental and physical . Identifying ways to reduce fatigue and improving overall quality of life are very important . So far few methods have shown to be effective, however, recent research suggests that fatigue can be reduced by performing exercise . A systematic review which explored the effectiveness of nonpharmacological interventions for fatigue also concluded that both aerobic and resistance exercise interventions reduce ra fatigue . Summary: it is important to note the following(i) exercise can reduce pain, morning stiffness, and even reduce fatigue in ra; (ii) exercise can improve functional ability and psychological well - being; (iii) exercise has not been shown to exacerbate disease activity . (i) exercise can reduce pain, morning stiffness, and even reduce fatigue in ra; (ii) exercise can improve functional ability and psychological well - being; (iii) exercise has not been shown to exacerbate disease activity . Whilst there are numerous reasons why exercise is considered to be of fundamental benefit, it is apparent that the ra population is less physically active than the general population . Therefore, it is important for those involved in the care of ra patients to be aware of factors that may positively and negatively affect the uptake of and compliance to an exercise prescription . The perceptions of people with ra may provide reasoning for the lower physical activity levels of ra patients when compared to the general population . Thus, understanding the perceptions of ra patients regarding exercise is salient to the role of the health professional . The obstacles to action study (new zealand) investigated factors influencing exercise participation for individuals with self - reported arthritis who were defined as their qualitative analysis of focus group discussions revealed that active people with arthritis believed more strongly in the benefits of physical activity, reported significantly higher levels of encouragement from others, and had greater overall levels of self - efficacy when compared with the less active participants . Arthritis, fatigue, and discomfort were ranked by both groups as the top three barriers . However, the active participants reported significantly lower impact scores for these barriers than the inactive group, and these findings persisted after adjusting for occupational status, body mass index, and comorbidities . Other barriers suggested to affect the successful uptake of exercise recommendations in arthritis patients have also been revealed . Physical barriers have included pain, fatigue, and physical capabilities, alongside the additional complications of further comorbidities . Psychological aspects such as a lack of enjoyment, motivation, and confidence have been identified as negative influences . However, receiving assistance from instructors and the opportunity for social interaction have been highlighted as factors encouraging patients to exercise . Especially prevalent in those on a limited income, environmental barriers such as cost and a lack of adequate insurance have also been revealed as barriers among nonexercisers . It has also become clear that a lack of transportation can be a major hindrance . Time constraints brought about by lifestyle and other commitments is a factor common to both the general and patient population, often further compounded by the distance necessary to travel to an exercise facility [40, 91, 117120]. It is also important to consider patient perceptions and potential barriers when promoting the maintenance of an exercise program . For example, working towards strengthening patient beliefs that they are able to continue exercise outside of the healthcare environment may be valuable . As previously identified in oa patients, worry that exercise may have detrimental effects on joint health was also present in ra patients . Additionally, these patients had specific apprehensions regarding the effects of impact and repetitive exercises . Joint pain has also been highlighted as a definitive barrier and has also been perceived as a prominent factor in determining the patients' exercise behaviour [120, 123]. In contrast, however, qualitative research suggests that patients feel that their joints benefit from exercise, with quotes indicating that joints are however, evidence suggests that whilst patients with arthritis believe exercise to be an important factor in treatment, uncertainty about which exercises to do, and how to do them without causing harm, deters many patient from exercising at all . Within the obstacles to action study insufficient advice from a healthcare provider was a theme for the insufficiently active individuals, with queries relating to the type, frequency, and intensity of appropriate exercise . Due to their condition ra patients are in frequent contact with their health professionals and this contact influences their perceptions about the role of exercise as part of their treatment . Moreover, because patients are constantly making decisions about treatment due to the fluctuating nature of ra, it is important for patients to understand how to modify their exercise according to their symptoms [126, 127]. The perceptions and behaviour of the rheumatologist is an important consideration when working towards a successful exercise prescription . Research by iversen et al . Found that discussions about exercise were four times more likely to occur when the rheumatologist initiated exercise discussion, with discussions strongly impacting on the likelihood that a patient received an exercise prescription . Furthermore, although high - intensity exercise is now considered to provide the greatest benefit, the outcome expectations of patients, rheumatologists, and physiotherapists for high intensity exercise have been found to be significantly less positive than those for a conventional exercise program, with rheumatologists reporting their most negative attitudes towards aerobic exercise . It is also interesting to note that, when examining the predictors of exercise behaviour in ra patients 6 months following a visit with their rheumatologist, iversen et al . Found that if a patient's rheumatologist was currently performing aerobic exercise, the patient was more likely to be engaged in exercise . A further issue relating to the health professional is their own assertion and certainty when prescribing exercise to those with ra . In the study by iversen et al ., only 51% of rheumatologists reported they felt confident that they knew when exercises were appropriate for their patients with ra . Correspondingly, recent research has revealed that patients perceive uncertainties within the health profession regarding the impact of exercise on pain and joint health . In particular, this was in relation to whether the sensation of exercise discomfort or pain equated to actual joint damage and the effects of different types of exercise on the health of their joints . These concerns pose a further challenge to ra patients [38, 45, 93, 129, 130]. Despite these reservations, patients have demonstrated an awareness of the advantages of exercise in terms of improving strength, mobility, and function and reducing pain . However, due to the effects of ra and considering the aforementioned issues, if the perception of exercise as a positive feature of ra treatment is to supersede the apparent negative connotations, continual emphasis of the benefits of exercise in this population is of great importance [40, 77, 131]. This also means that clear exercise guidelines and prescription is necessary to attend to the fact that ra patients are currently faced with ambiguous and incomplete information . In addition to the pivotal role of the rheumatologist in influencing exercise prescription [126, 127], these recommendations are also relevant to the other health professionals involved in the treatment and care of ra patients (i.e., nurse specialists, physiotherapists, and occupational therapists) and significant others such as the patient's family and friends . Key recommendations for health professionals and significant others in the improvement of patient perceptions regarding exercise(i) impart better advice regarding the effects and benefits of exercise; (ii) clarify specific exercise recommendations; (iii) consider methods of overcoming individual barriers to exercise . (i) impart better advice regarding the effects and benefits of exercise; (ii) clarify specific exercise recommendations; (iii) consider methods of overcoming individual barriers to exercise . The benefits of dynamic exercise in improving outcomes for patients with ra were highlighted following a systematic review by van den ende et al . However, this early meta - analysis was limited to six studies . In the intervening decade, numerous studies of varying quality have investigated the effects of aerobic and/or muscle strengthening exercise training programs for ra patients . This growing body of evidence, which is the subject of a number of systematic reviews [49, 50, 132135], strongly suggests that exercise is effective in management of patients with ra, and does not induce adverse effects . Current guidelines now advise that exercise is beneficial for most individuals with ra (e.g., nice guidelines, 2009). However, whilst the exercise benefits for ra patients are widely recognized, further studies are required to investigate the most effective exercise prescription (intensity, frequency, duration, and mode), the optimum modes of exercise delivery, and how adherence to training can be facilitated . A summary of exercise types and recommendations for individuals with ra based on current evidence is depicted in table 1 . Typically exercise interventions have focused on effects of aerobic training, strength training and a combination of aerobic training and strength training . The aerobic activities most often included in exercise interventions are walking, running, cycling, exercise in water, and aerobic dance . Walking is a good mode of exercise as it is inexpensive, requires no special skills, is safe, and can be performed both indoors and outdoors . Regular brisk walking, even in short bouts, improves aerobic fitness and reduces aspects of cvd risk in healthy adults . Cycling is also an excellent mode of aerobic activity that works the large muscle groups of the lower extremity . Cycling, in line with the guidelines in table 1, improves aerobic capacity, muscle strength, and joint mobility (e.g., by 17%, 17%, and 16%, resp . Hydrotherapy (the use of water) has been shown to be very effective for ra sufferers . As little as two 30-minute sessions for 4 weeks have been shown to significantly reduce joint tenderness, improve knee range of movement, and improve emotional and psychological well - being . Dancing is another form of aerobic exercise which has reported improvements in aerobic power and resulted in positive changes in depression, anxiety, and fatigue, with no deterioration in disease activity in ra patients . See table 1 for aerobic exercise types and recommendations for individuals with ra . With a loss in muscle mass, and subsequent functional limitation and burgeoning disability a characteristic of the disease, ra several studies have demonstrated the beneficial effects for ra patients of performing muscle strengthening exercises, in particular prt . These improvements include increases in muscle mass, reduction in fat mass, and substantial improvements in physical function [5, 63, 64]. Exercises that involve the large muscle groups of the upper and lower extremities as well as hand strengthening exercises have been shown to be effective [5, 63, 111]. The effects of a two - year dynamic strength training program in early ra patients found significant improvements in muscle strength (1959%) along with reductions in systemic inflammation, pain, morning stiffness, and disease activity . These findings suggest that long - term dynamic strength training can significantly improve the physical well - being of ra patients without exacerbating disease activity . Muscle strength gains from prt programmes can also be maintained over several years of continued training at sufficient intensity [56, 92]. These examples have assisted in recommendations for strength training being developed, a summary of which is presented in table 1 . The optimum exercise program for ra patients would include both aerobic and resistance training . With poor cardiovascular health being the main cause of death in ra and with ra patients tending to have poor cardiorespiratory fitness, the requirement of aerobic exercise as part of treatment is crucial . Whilst the addition of strengthening exercises helps to mitigate rheumatoid cachexia and other musculoskeletal and joint health issues, and induces substantial improvements in physical function and the ability to perform adls . Exercise programs for ra patients should be initially supervised by an experienced exercise professional so that the program can be tailored to individual aspirations and adapted to the disease activity, joint defects, and symptoms of patients . Following on from moderate to high intensity prt or combined programs, ra patients have been shown to have high adherence rates to exercise in real life although, continuation of both high - intensity and high - frequency sessions may be required for maintenance of training gains in aerobic fitness, muscle strength, and functional ability, but evidence is still required regarding the minimum maintenance regimen . Home - based exercise programs have also been investigated and have been shown to improve quality of life and functional status . However, due to the difficulties in ensuring that exercise of sufficient intensity is performed these exercises often fail to elicit significant increases in muscle strength or aerobic fitness . Although the minimal exercise dose for functional improvements and health maintenance is unknown, even regular training performed once weekly has been shown to improve function assessed subjectively by haq scores and health status . As many ra patients have below average physical capacity, exercise training should be initiated at a lower intensity . Evidence of exercise prescription in ra patients with severe disability (functional classes iii and iv) is still lacking [57, 93]. Exercise programs, even over long periods and at high intensities, have been found to be safe as well as effective . However, little is known as to whether exercise, particularly strength training, should be continued through inflammatory flares and further research should be conducted on the effects of exercise on joints that are already severely damaged . For continued training adaptation (i.e., increased fitness) a progression of the exercise dose (i.e., duration and/or intensity) unfortunately, studies have also shown that most of the beneficial muscle adaptations are also lost after cessation of the exercise training . Thus, as with healthy individuals, the beneficial effects of exercise (prt, aerobic, mobility) are lost if training is discontinued . The importance for the inclusion of exercise training in the treatment of ra is now clear and proven . Exercise in general seems to improve overall function in ra without any proven detrimental effects to disease activity . Thus all ra patients should be encouraged to include some form of aerobic and resistance exercise training as part of their routine care . More research is still required on the optimal dose and types of exercises, especially when combining types, as well as how best to incorporate exercise into the lives of ra patients across the variable course of the disease.

Portal obstruction is the single most common etiology of portal hypertension in children, representing roughly 50% of all cases in the majority of series . The causes of portal vein obstruction fall into one of following categories: perinatal events (umbilical catheterization, omphalitis, and dehydration), congenital malformations outside the portal vein (abernethy malformation), thrombophilic states (deficiency of protein - c, s or antithrombin - iii, etc . ), tumors, abdominal infections, and a category where the etiology is unknown [1, 2]. Portal obstruction in children is usually detected early in the first decade, because of splenomegaly, gastrointestinal bleeding, or both . Development of esophageal varices is almost universal, and the actuarial risk of bleeding reaches 76% at 24 years of age . Probability of bleeding is directly correlated with the size of varices as seen on endoscopy, from the absence of bleeding episode in children without varices or with grade i varices, to 85% prevalence of bleeding in patients with grade ii or iiii varices, as reported by lykavieris et al . . Of note, this study showed that varices tended to increase in size over the years instead of disappearing, defying the classical concept of spontaneous improvement as children grow - up . Variceal bleeding is generally well tolerated, owing to normal function of the liver; however, the main concern in the management is to reduce the recurrence of episodes . Endoscopic therapy works by physical obliteration of esophageal varices and has shown excellent results, with a 90% rate of success in the long - term control of bleeding . It usually represents the first approach due to its relative simplicity, low frequency of immediate complications, and widespread availability . The high rate of success has led to ample use of this technique; however, an increase of long - term complications is usually observed, as bleeding from ectopic varices, low - grade encephalopathy, hepatopulmonary syndromes, further development of hypersplenism, and cholestasis secondary to portal cholangiopathy . Particularly challenging is the management of cholestasis; this syndrome has been described in 6% of patients with portal vein obstruction, especially after long - term followup [6, 7], and it is the consequence of dilated peribiliary venous plexus (cavernoma) in the wall of biliary ducts (figure 1). Affected patients exhibit high levels of ggt and bilirubin, with dilated bile ducts (mainly intrahepatic) as seen on the abdominal ultrasound . Biopsy samples show different degrees of fibrosis and even biliary type of cirrhosis, with a pattern indistinguishably from primary sclerosing cholangitis in some cases . Complete resolution can be achieved with surgical decompression of the portal system by means of a portosystemic or a meso - rex shunts . In rare cases congenital hepatic fibrosis (chf) is part of a spectrum of fibropolycystic diseases, in which the pathological hallmark is the presence of ductal plate malformation . It combines biliary dysplasia, perilobular fibrosis, and renal polycystic disease in different patterns, giving rise to a wide diversity of clinical manifestations observed throughout the years . Two different forms have been described in association with renal disease: autosomic recessive (arpkd) and dominant (adpkd) polycystic kidney diseases . In arpkd, clinical signs of renal disease can be observed during the first years, appear later, or remain subclinical . Findings of portal hypertension become evident, generally in the first years of life, usually in the form of variceal bleeding and hypersplenism . It has been estimated that 25% of affected individuals develop clinically significant portal hypertension, with a trend toward increased frequency with increasing age . Interestingly, children with portal hypertension were younger than the mean age of the whole cohort, suggesting that a particular subset of patients is at risk of developing this complication, probably related to specific still unknown genetic or environmental factors . Adpkd patients, in contrast with arpkd, tend to present later in life with progressive renal disease and less liver involvement . However, because variceal bleeding can occur as early as age 4, screening relatives of the index case (most commonly an adult with multiple renal cysts) by regular ultrasounds have been recently advocated . Chf has also been reported as part of other rare syndromes, such as nephronopthisis (with end - stage renal disease within 5 to 10 years), jeune syndrome (lung and thoracic hypoplasia), meckel - gruber syndrome (encephalocele and polydactily), ivemark syndrome (interstitial fibrosis leading to renal failure), chronic diarrhea related to enterocolitis cystic superficialis and intestinal lymphangiectasia, and others . In all cases, accompanying liver findings include ductal plate malformation, fibrosis, and biliary cysts in different combinations . Patients with congenital hepatic fibrosis characteristically have well - preserved liver function; they behave as those with portal vein obstruction, with regard to the risk and tolerance to bleeding . Moreover, cavernomatous transformation of the portal vein and abnormal intrahepatic branching have been described in chf patients, suggesting that anomalies in the development of portal veins are part of the spectrum of liver disease in this condition [13, 14]. Given the relatively benign liver disease, management recommendations for children with chf - related portal hypertension are based on endoscopic eradication of varices . However, the frequent need for kidney transplantation in children with arpkd leads to perform a surgical portosystemic shunt before the transplant surgery . Successful shunt facilitates abdominal surgery and avoids varices bleeding that could represent a risk for the transplanted organ . For the rare patients with repeated acute or chronic cholangitis, who develop cirrhosis, or for those with pulmonary complications, liver transplantation is a potential therapeutic option . Decision about when (and if) to combine it with kidney transplantation should be considered on a case - by - case evaluation . This disease affects 1 in 15000 to 1 in 20000 newborns and constitutes the main indication for liver transplantation in children . Current treatment strategy includes the kasai portoenterostomy operation, followed by liver transplantation in cases of its failure or later complications from cirrhosis . Children with biliary atresia tend to develop varices very early, with an estimated risk of bleeding of 15% before the age of two . When associated with high bilirubin levels, it portends a poor prognosis, and constitutes an indication to proceed to transplantation as soon as possible, owing to the more than tenfold rise in the risk of death when conjugated bilirubin levels are over 10 mg% . Even in anicteric patients, there is a considerable risk of bleeding, highlighting their tendency to suffer from severe portal hypertension, probably related to the intense fibrosis as is observed at the time of portoenterostomy, and the diffuse compromise of intrahepatic portal vein described in some . Cholangitis, a frequent complication after portoenterostomy, can be responsible for thrombophlebitis of the portal system, accelerating the development of portal hypertension . Bleeding can be predicted in patients with large varices, associated red signs, presence of gastric varices, and portal hypertensive gastropathy (figure 2). Recent data supports the implementation of prophylactic sclerotherapy or banding to prevent the first hemorrhage . Sclerotherapy would be preferred over rubber band ligation owing to size constraints faced in little children . Approximately 5% of cystic fibrosis patients develop liver cirrhosis before adolescence . Like other cholestatic type of cirrhosis, it is characterized by a high degree of portal hypertension, with preserved synthetic function for many years [22, 23]. As the management of lung disease continues to improve, liver disease is becoming a major determinant of the outcome, being the third most common cause of death . It has been estimated that nearly 60% of cirrhotic patients experimented an episode of variceal bleeding before the second decade of life, contributing to the 10 to 20% of deaths in the cystic fibrosis group as a whole . Data coming from recent cohort studies show that liver disease in cystic fibrosis patients poses a special threat to their wellbeing and survival . This is not only related to the complications of cirrhosis itself; affected children tend to have higher shwachman scores and worse pulmonary function suggesting a synergistic effect between liver and lung disease [22, 25]. In fact, improvement in the severity of respiratory disease is well documented after liver transplantation in many of those patients [24, 26]. Altogether, approaching a child suffering from variceal bleeding in the context of cystic fibrosis should be tailored to each specific case . Endoscopic treatment should be offered to all, being especially useful in the context of acute hemorrhage . However, concern remains over the long - term endoscopic treatment due to the need for multiple anesthetics procedures, and the possible development of pulmonary complications from portal hypertension itself . In patients with relatively well - preserved liver and lung functions, a selective portocaval shunt (or a tips, when feasible) could offer many years of benefit without compromising the outcome [23, 27]. Patients with advanced liver disease, or severe and refractory bleeding, with good pulmonary function are probably best managed with liver transplantation [24, 26, 28]. Results of combined liver - lung transplantation are currently not encouraging; hence waiting for advanced lung disease before deciding to go for liver transplantation does not seem to be advisable . This presinusoidal type of portal hypertension is produced by intimal thickening of small intrahepatic portal vein radicles . The clinical picture resembles that of prehepatic portal vein obstruction but with a patent (an even, dilated) portal vein on ultrasound . Well - tolerated variceal bleeding and hypersplenism have been reported in this syndrome mainly described in asian patients . Recent reports coming from western - country children surviving from acute leukemia treated with 6-thioguanin highlights the alleged toxin exposure as one of the possible causes of the endothelial damage . Chronic hepatitis associated to hbv or hcv infection can rarely present in the first two decades of life with a picture of portal hypertension secondary to cirrhosis . Children exhibit better responses rates to antiviral treatment; thereby there is better control of complications, including those of cirrhosis [3234]. Appropriate treatment with immunosuppressive drugs usually results in control and regression of fibrosis in most patients . A small percentage, however, progresses to decompensated cirrhosis and hemorrhagic complications; these should be managed in a staggered manner according to the medium - term prognosis of the disease, from endoscopic treatment to liver transplantation in end - stage patients . It is the most common indication for liver transplantation from metabolic diseases in the western hemisphere . Although some improvement of liver function tests has been reported with the use of ursodeoxycholic acid, at the present, there is no effective treatment for this condition, and management of affected patients is restricted to the complications of ongoing cirrhosis, using the same principles described for other etiologies . Budd - chiari syndrome encompasses a series of different causes producing obstruction to the hepatic venous outflow . These patients tend to present with hepatomegaly and ascitis rather than with variceal hemorrhage, but those developing secondary cirrhosis can experiment bleeding from esophageal varices . Management is very complex, strongly influenced by the clinical picture (acute versus chronic), etiology, and extent of the liver damage . In contrast with portal vein obstruction, most budd - chiari patients have an associated thrombophilic state that has to be accurately investigated and treated . Avoiding the morbidity and mortality associated with the first bleed from esophageal varices is the rationale behind primary prophylaxis . Clear recommendations exist for the adult population, but unfortunately this is not the case for pediatric patients . Application of such strategy should comply with two premises: correct identification of the population at risk and availability of an effective treatment . In spite of many efforts, achieving the first goal has been elusive, owing to the heterogeneity of the population with portal hypertension in pediatric ages . Stratifying patients at risk according to specific etiologies could be the best way to manage this problem . Regarding the second goal, the absence of controlled randomized trials in primary prophylaxis of esophageal varices bleeding in children makes any recommendation problematic and debatable . Low number of patients and difficulties in recruitment are major obstacles to the realization of such studies, as seen with the use of propranolol in children, which is in strong contrast to the adult population . A group of expert analyzed possibilities on primary prophylaxis of variceal hemorrhage in children, concluding that future research should focus on the natural history, diagnosis of varices, prediction of variceal bleeding, and explore therapeutic efficacy of different protocols . Currently, it remains intuitive to offer endoscopic obliteration to patients with high - risk varices who had never bled, preferably by band ligation . Endoscopic examination should be only offered to patients when decision to proceed with sclerotherapy or banding has already been taken in advance [5, 20]. Data in children with cirrhosis secondary to biliary atresia showed that esophageal varices developed very early in life in 70% of them . In addition, endoscopic signs indicating a high risk of mediate bleeding were found in 30% of those with esophageal varices . Another recent study, on a similar population, showed that grade ii - iii varices developed with similar frequency after failed and successful portoenterostomy, but, following failed portoenterostomy, esophageal varices were encountered significantly earlier . The authors recommended that after failed portoenterostomy surveillance should start early, for example, at six months of age . There are different approaches in the care of children at risk for esophageal varices bleeding among pediatric gastroenterologists, most of them based on personal preferences and local expertise rather than strong evidence . In addition, attitudes from parents could be different from those of physicians; a high percentage of them would accept an endoscopy to be carried out in their children if a prophylactic treatment can avoid bleeding or even to establish the current risk of bleeding in the absence of treatment . Acute bleeding is the most feared complication of portal hypertension, with an associated mortality up to 20%, mainly in patients with affected liver function . As a consequence, focus on treatment has been directed to the control of hemorrhagic episodes, reaching a rate of success higher than 90% in recent years . Volume resuscitation initiated without delay, should restore hemoglobin levels to around 8 g%, and insure good perfusion of vital organs with plasma expanders . Overzealous use of volume / plasma expanders should be avoided, however, because of the theoretical risk of rebound portal hypertension and rebleeding . Antibiotics directed at the intestinal flora should be part of the treatment from the beginning, as well as vasoactive drugs, preferably by the intravenous route . Among many drugs tested in adult patients, octreotide has been the most widely used in children, at a dose of 1 - 2 ug / kg by bolus over 20 minutes, followed by continuous infusion at 2 ug / kg / h, maintained for 2 to 5 days . Its use in this setting has been advocated to promote easier and safer endoscopic procedures . Once stabilized, patients should be treated by direct approach of the varices, either with band ligation or sclerosant injection . Both treatments are highly effective in controlling the acute episode, and the choice of one particular method depends on the local expertise and other technical issues . In a general sense, endoscopic variceal ligation is preferred in most cases, owing to its simplicity and lower rate of complications, but sclerotherapy is probably easier to implement during active bleeding, and is the best option in small children [45, 46]. Ideally, the operator should master both techniques and have all appropriate tools available during the procedure . Despite the high rate of success achieved with these approaches: in 5 to 10% of cases bleeding cannot be controlled, and rescue therapy is needed, usually after the failure of a second attempt by endoscopy . This rescue therapy involves a surgical option, or a radiological approach (tips), when feasible . Once again, both procedures are equally effective, but when used in an emergency scenario their results are less satisfactory . Tips has the advantage of avoiding a laparotomy, but its availability is limited to specialized services and is not suitable for small children, especially in cases of portal vein obstruction or biliary atresia, which are the main causes of variceal hemorrhage among pediatric patients . The choice of the surgical technique, on the other hand, depends on the medium - term prognosis of the disease . Shunting procedures are preferred in patients with relatively well - preserved liver function, like those with portal vein obstruction, congenital hepatic fibrosis, or compensated cirrhosis . Once the first bleeding has occurred, there is a substantial risk for rebleeding in the next years; consequently, eradication of esophageal varices becomes a logical goal . Endoscopic variceal ligation and sclerotherapy have been reported to be equally successful in achieving this . Variceal ligation is usually preferred because of its reported simplicity, lesser number of sessions needed, and a safer profile when compared to sclerotherapy [45, 46]. Both techniques are complementary and have been used even in primary prophylaxis with good results [5, 20]. An observational study in children with portal hypertension, of several different etiologies, showed a benefit of secondary prophylaxis in avoiding esophageal varices bleeding . In this study, in contrast, a large study including mainly adolescents did not find differences between propranolol and endoscopic ligation in the recurrence of bleeding . Longer followup of endoscopic treatments is available, showing recurrence of esophageal varices in 40% of the patients, with a tendency to worsening of gastric varices, portal hypertensive gastropathy, and rising incidence of ectopic varices, all of them representing a more difficult problem to solve . Progression of the spleen size and late incidence of complications like portal cholangiopathy in patients with portal obstruction, formerly considered a rare entity, affect children quality of life . Moreover, for these complications endoscopic treatments are clearly unsuitable . In those cases, or when hemorrhagic episodes are refractory to other treatments, surgery becomes the only option . Total portosystemic shunts are those more than 10 mm in diameter, constructed between the main veins of the portal system and the inferior vena cava . They provide excellent control of hemorrhages and ascitis, but at the high cost of encephalopathy, and are rarely used in children . Partial shunts comprises portocaval or mesocaval anastomoses of 8 mm in diameter or less, allowing part of the portal flow to reach the liver sinusoids, and thus reducing the risk of systemic complications without losing efficacy for the prevention of further bleeding . This type of shunts has been widely used in children employing the internal jugular vein as a graft, with excellent results [53, 54]. Selective shunts are constructed by the anastomoses of the splenic vein to the left renal vein, thereby decompressing gastroesophageal varices through the short gastric veins (distal splenorenal shunt), and maintaining portal perfusion to the liver . Surgical shunts have gained renewed interest in the management of portal hypertension in children with good liver function, in view of better results obtained with the refinement of surgical techniques driven by the development of liver transplantation programs, and the emergence of nonhemorrhagic complications after successful eradication of esophageal varices . The mesenteric - left portal vein bypass (rex shunt) is constructed between the superior mesenteric vein and the recessus of rex at the level of intrahepatic left branch of portal vein . Originally developed to treat patients who have portal vein thrombosis after liver transplantation, it was extended immediately to the treatment of children with extrahepatic portal vein obstruction, allowing them for the first time to reach a real cure for their disease . In fact, when successful, it can restore the normal flow to the liver with normalization of hematological tests . Availability of this technique is promoting a change of paradigm in the treatment of portal vein obstruction, towards an early indication of surgery, before progressive fibrosis of the main portal vein branches precludes the feasibility of such anastomoses . The percentage of children with portal obstruction who can benefit for a meso - rex shunt is still unknown . Recent data coming from pediatric series, albeit small in number of patients, have reproduced the rates of success obtained in adult patients, making tips a good option even in small children and expanding indications to postransplant portal hypertension, and children with portal vein obstruction with a favorable anatomy . Future studies will clarify the role of this therapy in the management of pediatric portal hypertension . Treatment of hemorrhagic complications from portal hypertension in children has its own specificities because of the different etiologies involved, and the natural history of these disorders compared to adults (table 1)., considerable progress has been achieved in the last years, mainly derived from better control of bleeding from esophageal varices . Longer followup, however, uncovers new complications for which endoscopic treatment is inappropriate, promoting a renewed interest on surgical approaches . As a general principle, management of portal hypertension in children rests on two main characteristics: the etiology of the portal hypertension and the age of the patient.

Catheter - based radiofrequency ablation (rfa) delivered during endoscopic retrograde cholangiopancreatography (ercp) has recently emerged as a possible therapeutic option within the bile duct 1 2 3 4 . Intrabiliary extension of neoplasm remains an important challenge in the endoscopic eradication of complex ampullary lesions 5 6, and rfa may represent a viable treatment adjunct for this problem . Recently, the use of rfa at the ampulla and within the distal bile duct has been described 7 8 . Herein we present 4 cases assessing the technical feasibility, safety, and treatment outcomes of rfa employed at the time of ercp to treat ampullary lesions with intraductal extension . The study was conducted at the medical university of south carolina (musc) from july 1, 2014 through october 1, 2015 . After institutional review board approval, we retrospectively identified eligible adult subjects through the musc endoscopy report database (endoworks, olympus america, center valley, pa) by searching for reports that contained the keywords radiofrequency ablation (rfa) and endoscopic retrograde cholangiopancreatography (ercp). We excluded patients who underwent rfa of a stricture not associated with an ampullary lesion . All procedures were performed by an experienced pancreaticobiliary endoscopist under general anesthesia using a side - viewing duodenoscope . Ampullary resection was performed either en bloc or in piecemeal fashion by delivering electrosurgical current through a snare with or without prior submucosal lift . Intraductal extension of the lesion was assessed cholangiographically (fig . 1) and/or visually (fig . 2). In some cases, a biliary sphincterotomy extension and papillary balloon dilation was performed to expose the inside of the terminal bile duct for assessment and therapy . Ablative therapy was delivered using a standard argon plasma coagulation (apc) probe (erbe usa inc ., mariette, ga) at a flow rate of 1.0 l / min to 1.2 l / min and 30 to 40 maximum watts (w) and/or the habib endohpb rfa bipolar cautery probe (emcision united kingdom, london, united kingdom) at 10 w for 60 to 90 seconds, extrapolating from manufacturer s recommendations of 7 to 10 w 120 seconds 9 . Given the proximity to the pancreatic orifice and the benign nature of the target lesions, a shorter duration of treatment was chosen . In general, apc was reserved for treating exposed target tissue in the duodenum or very distal duct, whereas rfa was reserved for treating hidden or difficult to access tissue within the duct . All patients undergoing rfa received a temporary pancreatic stent (5 fr, 2 5 cm) and rectal indomethacin to reduce the risk of post - ercp pancreatitis (pep), as well as a plastic endobiliary prostheses to prevent biliary obstruction and cholangitis . Cholangiogram showing a filling defect in the distal bile duct (arrow) representing bulky intraductal extension of an ampullary adenoma . Endoscopic view of the papilla after ampullectomy demonstrating intraductal extension of the adenoma (arrow). Technical success was defined as the ability to successfully position the rfa probe across the biliary orifice and deliver thermal energy to the region of the papilla and terminal bile duct, resulting in coagulation of the visualized target areas . Clinical success was defined as endoscopic absence of polypoid or adenomatous - appearing tissue at the treatment site and histologic absence of neoplasm based on extensive follow - up biopsies from the papilla, pancreaticobiliary septum, biliary orifice, and distal bile duct . When the distal bile duct was not fully exposed by prior sphincterotomy, a pediatric biopsy forceps was introduced into the distal duct to acquire tissue . Patient demographics, procedure indications, and treatment outcomes are listed in table 1 . Four eligible patients were identified, all of whom were men with a mean age of 63 years (range 54 84). Three patients (75%) had a history of familial adenomatous polyposis (fap). Three patients were treated for ampullary adenoma and 1 for ampullary adenoma with a focus of adenocarcinoma (he declined surgical evaluation). Fap, familial adenomatous polyposis; lgd, low - grade dysplasia; hgd, high - grade dysplasia; imc, intramucosal cancer; apc, argon plasma coagulation; rfa, radiofrequency ablation; pep, post - endoscopic retrograde cholangiopancreatography pancreatitis; eus, endoscopic ultrasound video 1 presents a synopsis of 2 representative cases . All rfa procedures were technically successful, resulting in a perceptible tissue effect (fig . 3). Rfa was performed immediately following endoscopic resection in 1 case and during a subsequent session in the remaining cases . The mean number of rfa sessions per patient was 1.5 (range 1 3). All patients were discharged uneventfully after the procedure without any immediate adverse events (aes). One patient developed obstructive jaundice due to a fibro - inflammatory bile duct stricture at the level of prior rfa that manifested 3 days after biliary stent removal (approximately 6 weeks after the rfa) and has required ongoing endobiliary stent therapy in excess of 3 months . 3 patients had visual and histologic evidence of complete eradication; the patient with a focus of adenocarcinoma who declined surgery developed overt invasive ampullary cancer . Video 1 this footage consists of 2 video clips demonstrating catheter - based rfa of intraductal ampullary adenoma although endoscopic ampullectomy is the preferred treatment for noninvasive ampullary lesions with a success rate reported as high as 92% 10, biliary extension of neoplasm represents a significant obstacle to endoscopic eradication . Exposure and eversion of the adenoma through a biliary sphincterotomy to allow resection or ablation has been described in amenable cases 5 11 12 . However, broad adenomatous involvement of the distal bile is associated with limited treatment success (<50%) and has been considered an indication for surgical resection 5 . Based on its ease of use and the ability to precisely position the probe within the distal duct, radiofrequency ablation may represent the first viable treatment adjunct for this challenging scenario . To date, only single case reports of rfa for benign ampullary lesions have been described; we aimed to expand our understanding of this technology by presenting our experience in 5 patients . Catheter - based rfa was technically successful in all cases, and based on short - term follow up in a small sample, may be safe and clinically effective . However, because rfa induces thermal injury and subsequent necrosis of the bile duct wall and beyond, several safety concerns exist . First, while rfa has been associated with a favorable safety profile when applied to malignant biliary strictures 1 2 3 4, it remains unclear whether rfa in the intra - pancreatic portion of the bile duct without the protective buffer of a surrounding tumor especially in the vicinity of the pancreatic orifice will be associated with an increased risk of pancreatitis . Until additional data on the risk of post - ercp pancreatitis in this context if the pancreatic and biliary orifices are in close proximity, especially if adenoma appears to involve the pancreaticobiliary septum, it may be best to perform the rfa adjacent to a guidewire which has already been placed in the pancreatic duct (subsequently guaranteeing pancreatic access for stent placement) rather than adjacent to a plastic pancreatic stent which may be damaged or even fractured during rfa . Another safety concern is the development of clinically important post - rfa biliary strictures that occurred in 1 of our patients, akin to what has been observed in the esophagus after rfa of barrett s epithelium 13 . This concern is particularly relevant in the context of benign ampullary disease in which patients do not typically undergo long - term stent placement, as is the case when rfa is performed for palliation of malignant strictures . Along these lines, until additional data are available, we have attempted to minimize rfa across the cystic duct takeoff to avoid thermal injury - related obstruction of the cystic duct, which has intentionally been induced by electrohydraulic lithotripsy to treat refractory bile leak 14 . In our series, rfa appears to have provided effective adjunctive therapy in all 4 cases of benign pathology but was ineffective in the setting of early adenocarcinoma, underscoring the concept that surgical resection remains first - line therapy for ampullary cancer (our patient declined surgery and chemoradiation). Despite the apparent effectiveness for benign lesions, it is important to consider that intrabiliary extension is often nodular in nature, leading to heterogeneous contact between the rfa probe and the target tissue; this may lead to incomplete therapy and/or an increased risk of buried neoplasm as is the concern when rfa is used to treat nodular barrett s esophagus . Moreover, it can be technically challenging to ensure circumferential contact of the probe and the target tissue within a dilated bile duct, even when luminal air is suctioned to induce collapse of the duct around the probe . In these cases, a balloon - based rfa device that flattens nodular tissue and maximizes treatment contact may be of value . An additional consideration is that the proximal extent of neoplasm is often difficult to assess cholangiographically and the role of cholangioscopy to guide probe placement should be further explored . Prospective studies are necessary to evaluate these issues and determine the long - term effectiveness of this modality . In summary, catheter - based rfa after endoscopic resection of ampullary lesions that extend up the bile duct is technically feasible . Concerns regarding injury to the pancreas and bile duct as well as incomplete treatment of nodular target tissue exist and will be addressed by additional clinical experience and research.

Reproductive tract infections (rtis), including both sexually transmitted infections (stis) and non - sexually transmitted infections (non - stis) of the reproductive tract are responsible for major ill - health throughout the world. (1) world health organization estimates that each year there are over 340 million new cases of sexually transmitted infections in which 7585% occur in developing countries . In india alone, 40 million new cases emerge each year. (2) a majority of women continue to suffer from rtis leading to complications like pelvic inflammatory disease (pid), infertility, cervical cancer, postabortal, and puerperal sepsis, chronic pelvic pain, and ectopic pregnancy . Rtis in many cases are asymptomatic among women, making their detection and diagnosis difficult. (3) an effort has been made in this regard to detect rti cases among the women in the field practice area of urban health training centre (uhtc), hubli, karnataka . The objective of the study was to know the prevalence of rtis among the reproductive age group women and the socio - demographic factors influencing the occurrence of the disease . This study was undertaken in the field practice area of uhtc, hubli, and reproductive age group women of 1545 years were identified for the study purpose . It is a cross - sectional time bound study, conducted from september 2003 to august 2004 . The sample size 656 was calculated by taking into consideration 19% of women under 1545 years in urban community, at 95% confidence interval and 3% permissible error covering 1.96 under normal curve . All houses in the field practice area were numbered by using a random numbering table . Houses were selected on the basis of a simple random sampling technique until 656 women of the reproductive age group were covered in 520 families . A pretested structured pro forma was used to interview the women about their socio - demographic, reproductive history, current, and past rti symptoms . The syndromes related to rti as recommended by government of india, ministry of health and family welfare, for management of rtis / stds were considered . All 656 women were given referral slips and encouraged after counseling to attend for clinical examination and laboratory tests in uhtc . In the center, per speculum examination was done, and vaginal and endocervical swabs were taken . In unmarried women, women with menstrual bleeding and women in their postpuerperal period at the time of clinical examination were asked to come for gynecological examination after cessation of menstrual bleeding or lochia . Blood sample for a serological test to diagnose syphilis was taken from every respondent after written consent and counseling . Wet mount microscopy of vaginal secretions was done to detect trichomonas vaginalis . Immediately after per speculum examination, the vaginal and endocervical swabs were sent to microbiology department, karnataka institute of medical sciences (kims), in a cold box, gram stained, and inoculated in suitable media like chocolate agar and thayer martin medium for gonorrhea and sabouraud dextrose agar (sda) media for candidiasis . For diagnosis of bacterial vaginosis (bv) any three out of four criteria were taken as positive:(4) watery vaginal discharge.vaginal ph more than 4.5 using ph indicator paper.amine odour test positive (odour described as fishy after addition of 10% koh).clue cells in gram's stained vaginal smear under microscopy amine odour test positive (odour described as fishy after addition of 10% koh). Statistical tests like proportions, z - test, and chi - square test were used . Data were tabulated on microsoft excel sheets and analyzed using software epi info version 6 . Statistical tests like proportions, z - test, and chi - square test were used . Data were tabulated on microsoft excel sheets and analyzed using software epi info version 6 . The present study revealed that 265 women were found to be suffering from rti based on their symptoms, giving a prevalence of 40.4% [table 1]. Distribution of women according to rti symptoms table 1 shows that a majority of women, 215 (32.7%), complained of abnormal vaginal discharge followed by lower backache in 206 (31.4%) and lower abdominal pain in 154 (23.5%) women (n=656). Table 2 shows on clinical examination that 245 (37.35%) women had significant clinical findings suggestive of rti in which 242 (36.9%) women had vaginitis, followed by pid in 205 (31.25%) women (n=656). Distribution of women according to the clinical findings of rti out of 656 women taken for the sample study, 265 women had symptoms of rti and 391 women had no symptoms of rti . Among symptomatics, 192 (72.4%) women (n=265) had positive clinical signs and among asymptomatics, 53 women (13.5%) (n=391) had signs of rti on clinical examination with majority of women having vaginitis, cervicitis, and tenderness in the fornix . Based on laboratory findings, 225 women were positive for rti giving a prevalence of 34.3% in which a majority of women were positive for candidiasis 105 (16.01%) followed by bacterial vaginosis 82 (12.5%), trichomoniasis 28 (4.27%), syphilis 10 (1.52%), and gonorrhea 0% [table 3]. Distribution of women according to laboratory investigations of rti a total of 4.12% women had mixed infections with candidiasis, bacterial vaginosis, and gram - negative organisms (n=656) [table 3]. Out of 265 symptomatic women, 192 women had positive clinical signs in which 178 women (92.7%) (n=192) had positive laboratory tests, with majority having candidiasis . Out of 391 asymptomatic women, 53 women had positive clinical signs and 338 women with no clinical signs of rti, in which 22 women (6.5%) (n=338) had a positive laboratory test with 18 women being positive for candidiasis by culture, and 4 women being positive for the venereal disease research laboratory (vdrl) test for syphilis . Table 4 shows the trend of clinical findings of rti in relation to age with maximum prevalence between 20 and 29 years age group . Sd (7.61 years). Socio - demographic profile of the women in the reproductive age group of 15 - 45 years with rti signs it was found that the number of women 50% among muslims had rti compared to other religion (p<0.001) [table 4]. Married women (43%) had more rti compared to unmarried and divorced / separated women (p<0.001); similarly the prevalence of rti increased with relation to married life from <1 year (30.4%) to> 5 years (51.75%) [table 4]. The prevalence of rti was common among illiterate women (46.5%) and showed a decreased trend with an increase in level of education (p<0.001) [table 4]. It was found that 38% of women who were home makers had rti against 26% of employed women and 15% of students [table 4]. The rti prevalence showed an increasing trend with the decrease in socioeconomic class where 82% of women belonging to the class v or lower socioeconomic group had rti (p<0.001) [table 4]. It was found that 38% of women who used clothes during menstruation had rti against 15% of those who used sanitary pads [table 4]. The prevalence of rti was 33% in women having children more than one and it increased with increase in parity (p<0.001) [table 4]. Only 34% of women were using family planning methods and among them, the occurrence of rti was 84% in the women using intra uterine contraceptive device (iucd) (p<0.001) [table 4]. It was found that the prevalence of rti among pregnant women was 51% (p<0.05) [table 4]. From this study, the prevalence of rti was 34.3% based on the laboratory findings against 40.4% based on only the symptoms . It was observed that a majority of women, 215 (32.77%), complained of abnormal excessive vaginal discharge followed by lower backache 206 (31.4%) and lower abdominal pain 154 (23.48%). Where a majority of women, 53.4%, complained of abnormal vaginal discharge. (5) our study showed that a majority of women, 242 (36.9%), had vaginitis on examination followed by pid in 205 women (31.25%) which is in accordance with the observation of garg et al . And singh et al . Where a majority of women on clinical examination had vaginitis of 94.6% and 52.1%, respectively. (67) this study is in accordance with the observations made by parikh et al . And ranchan et al ., where the prevalence of rti on laboratory findings was 17% and 26.3%, respectively, with majority of women having candidiasis. (89) this study is also in accordance with prasad et al . Where prevalence of syphilis was 1.5% and to garg et al ., where the prevalence of trichomonas vaginalis was 4.3%. (106) in this study maximum prevalence of rti was found in the reproductive age group women of 2029 years, which differs from the study of rathore et al ., where mean age of women with rti was 33.59 years. (11) it was found in the study that marital status and rti are related to each other, as married women who are leading active sexual life are having more chance of getting rti. (12) also with increased duration of married life, the risk of occurrence of rti is more, due to enhanced sexual activity. (10) the trend of increased rti with decreased educational status of women shows that illiterate women were more ignorant about the occurrence of rti with poor genital and menstrual hygiene and their health seeking behavior is also low. (11) in our study, the rti occurrence in unmarried women and students was mainly due to poor genital and menstrual hygiene . Similarly, poor socioeconomic class contributes to increased occurrence of rti due to ignorance and economic backwardness. (13) women who used clothes during the menstrual period had increased risk of rti due to lack of genital and menstrual hygiene which facilitated growth of endogenous infections. (78) it was found in the study that there is association between parity of women and occurrence of rti which is statistically significant . Women with more number of children are exposed to increased number of deliveries, contraceptive device, and gynecological surgeries which contributes to occurrence of rti in women. (12) this study is in accordance with rathore et al ., where 2.4% among nulliparous women had rti compared to 13% among primigravida and 28.5% among multigravida. (11) it was observed that 84% of women among iucd users had rti . Iucd users are at more risk of acquiring rti as they are exposed to iatrogenic and exogenous infections. (10) it was found that 51% among pregnant women had rti . It is due to hormonal change, they are prone for endogenous infections like candidiasis and mixed infections. (14) this is in accordance with maitra et al ., where 1 out of 4 pregnant women had rti, with abnormal vaginal discharge being common symptom followed by pain during urination. (13) hence the study highlights the need for community - based studies requiring laboratory investigations with feasible tests to know the exact prevalence of the disease, as the self - reported morbidity alone cannot measure the burden of any disease in the community to necessitate proper prevention and control measures . This study will serve as a reference for researchers interested in the field of rti / sti epidemiology, who may in future take up similar studies to compare and highlight the performance of reproductive and child health programme (rch) over the years in combating this disease.

The incidence of bladder forming a part of an inguinal hernia is 14% . With correct knowledge of anatomy and careful dissection, injuries to the bladder during hernia repair we hereby report a case where the patient first presented with a scrotal abscess and vesicocutaneous fistula after surgical repair of sliding hernia . A 65-year - old morbidly obese man underwent mesh hernioplasty for large right inguinal hernia . After removing the urethral catheter, he developed gradually increasing right scrotal swelling with fever . Thereafter, he developed continuous urine leakage from the site of incision and drainage, figure 1 . We carried out a cystogram via the urethral catheter that revealed a fistulous communication between bladder and scrotal skin, figure 1 ., cystoscopy revealed normal anterior and posterior urethra, non - obstructing prostatic lobes and a defect in the anterior bladder wall with no evidence of mesh erosion . Almost the whole of the bladder was lying in the right scrotum and densely adherent to the right testis and cord structures and mesh . There was a fistulous opening at the dome of the bladder wall well away from the mesh . Our main concerns were inguinal hernia repair and creation of extraperitoneal space to reposition the bladder in the normal position, which was not possible without performing right high inguinal orchiectomy . Hence, we performed right high inguinal orchiectomy and removal of mesh and extraperitoneal space was made to reposition the urinary bladder to its normal position . Fistula opening was repaired in two layers and the bladder was put on continuous drainage via 20 french urethral catheter, figure 2 . Post - operatively at 2 weeks, there was no urinary leak on cystogram and the urethral catheter was removed and normal voiding was restored . Scars of previous surgery with vesicocutaneous fistula and cystogram showing contrast in the left hemiscrotum the entire urinary bladder lying in the scrotum, with the bladder re - positioned into the normal position levine coined the term scrotal cystocoele in 1951 for inguinoscrotal herniation of the bladder . Urinary bladder herniations are usually diagnosed at the time of inguinal herniorraphy and are commonly repaired through the same incision . They are sometimes found incidentally during the evaluation of a patient with lower urinary tract symptoms and associated inguinal hernias . Two - stage micturition is the classical symptom, with the second stage facilitated by some form of external pressure on the bladder . The para - peritoneal type is the most common type and the extra - peritoneal type is the least common . Because imaging all patients with large hernias may not be cost - effective, imaging studies are performed only when bladder herniation is suspected . The diagnostic triad of lateral displacement of the distal one - third of the ureter, small asymmetric bladder and incomplete visualization of the bladder base on an intravenous urogram has been described by reardon and lowman . Iatrogenic injury to the bladder during hernia repair can be due to multiple factors, such as an inexperienced surgeon in the early part of the learning curve or an obese patient with large hernial sac with unrecognized bladder component . In our patient, there could have been an injury to the bladder that was not recognized at the time of hernia repair, which led to subsequent scrotal abscess formation resulting in a vesicocutaneous fistula . If unrecognized, these usually present immediately after catheter removal, but presentation can sometimes be delayed in case the fistula is very small and there is no infravesical obstruction . Management includes immediate repair in case it is recognized intraoperatively . In case of unrecognized injury and with delayed presentation, the first step is to put a wide caliber per urethral catheter followed by thorough evaluation with urine culture examination and cystogram . A small fistula can be healed with only continuous bladder drainage with per urethral catheter or preferably suprapubic cystostomy, provided lower tract infravesical obstruction has been ruled out . A larger fistula needs open surgical management . Careful dissection is needed in the extraperitoneal space while separating the sac from cord structures as the bladder forms a part of the posterior wall of the sac . After completing bladder dissection, the fistula is repaired in two to three layers and an adequate space is created in the extraperitoneal plane to reposition the bladder . Sometimes, large hernias could be treated by resection of the herniated bladder as described by thomas and gomella . In our case, the whole bladder was lying in the scrotum and extensive adhesions were present between the cord structures and the bladder . High inguinal orchiectomy was performed to create space for the bladder and for proper closure of the inguinal canal . Urinary bladder rarely forms a part of an inguinal hernia and, with the correct knowledge of anatomy and careful dissection injuries to the bladder during hernia repair, surgery can be prevented . Surgically creation of an extraperitoneal space for bladder repositioning is of paramount importance, sometimes needing inguinal orchiectomy in the elderly.

Unlike tears and ganglion cysts of the anterior cruciate ligament (acl), mucoid degeneration is a less - understood entity . The injury or loss of functional synovial lining protecting the acl is the primary lesion causing mucoid degeneration of acl though there was no significant preceding trauma that patients can relate to current symptoms.1 but the symptomatology, mri findings, and arthroscopy appearance are consistent.2 the excision of the degenerated acl has been the treatment of the choice, the authors believe that if the taut and hypertrophied acl were to be debulked and notchplasty done, full extension could be achieved without having to excise the entire acl . The purpose of this study was to describe the clinical characteristics and diagnosis of mucoid degeneration of the acl and to assess the outcomes of arthroscopic treatment in a series of 20 patients . The mean age was 42.2 years (range 28 - 52 years) in males and 39.4 years (range 30 - 54 years) in females . All the patients had clinical symptoms of central knee pain behind patella without any prior trauma (18 patients on terminal extension and 2 patients on terminal flexion). In four patients, there was mean flexion deformity of 6. the type of activity performed was: physically active like running, sports, and army training (n=6, 30%); moderately active doing routine work (n=12, 60%); and sedentary (n=2, 10%). The symptoms started insidiously, had a mean duration of 21 months (range 1247 months) without preceding significant trauma . Eighteen patients had extension deficit and two patients had limited flexion.34 there was medial joint pain in two patients . Anterior lachman and anterior drawer test showed firm endpoint in all patients, with + 1 laxity in three patients . All patients were treated with nonsteroidal anti - inflammatory drugs and physiotherapy for a minimum of 2 months before contemplating magnetic resonance imaging (mri) and treatment . Plain roentgenograph of both the knees was done with anteroposterior weight bearing, lateral and skyline views . Radiographic diagnosis was made only when all three key criteria56 were met: (1) abnormally thickened and ill - defined acl, (2) maintenance of normal orientation and continuity, and (3) increased intraligamentous signals (intermediate signal intensity on t1-weighted images and high signal intensity on t2-weighted and proton density weighted images [figure 1]. Proton density show increasing intraligamentous signal intensity of the anterior cruciate ligament over the left knee arthroscopy was performed by use of a 30 lens through standard anterolateral and anteromedial portals . All compartments were explored to evaluate the state of menisci, ligaments, and cartilage . The chondral lesion of each patient was described according to the outerbridge classification.7 the locations of the lesions on the articular surfaces of the patella, trochlea, medial femoral condyle, lateral femoral condyle, medial tibial plateau, and lateral tibial plateau were recorded . Bulk specific to anteromedial (am)posterolateral (pl) bundles of acl, its color, and its tautness hooked with probe were recorded . Impingement of acl fibers to lateral wall of intercondylar notch, and lateral compartment during flexion extension maneuver were recorded [figure 2]. Arthroscopic examination of a left knee, showing impingement (arrow) of hypertrophied posterolateral portion of acl to lateral wall and roof of intercondylar notch during extension the aim of surgery was to remove as much of the degenerative mass as possible without having to sacrifice the entire acl . Thus, the remaining acl consisted of some intact anteromedial or posterolateral portion of the acl interspersed with degenerate acl tissue . Care was taken to see that this remaining acl had intact attachment to the femoral condyle and did not impinge on the roof or lateral wall of the notch [figure 3]. By use of basket forceps, the materials were stained with h and e and then with mucoid tissue - specific alcian blue [figure 4]. In knees without notch narrowing, debridement of the hypertrophied acl was performed first beginning with the removal of small osteocartilaginous fragments from the upper portion of the lateral wall and roof by use of a 6.4-mm curved osteotome . This allowed easier inspection of the inner space between the acl and the lateral wall, and accurate removal of impinging structures . We decompressed the lateral wall and roof from anterior to posterior while performing a flexion extension maneuver with a 4.5-mm motorized bur and curette . Care was taken to remove all visible impinging structures in the posterior portion of the notch . Copious debridement of mucoid hypertrophied lesions of the acl was performed by use of basket forceps as well as a 4.2-mm motorized shaver . Some of the mass was removed by first teasing between the anterior fibers of the acl using a probe and then removing it with an arthroscopy grabber . The major posterior portion of the mass was removed using the basket punch (acufex) introduced through the anteromedial portal, with the arthroscope through the anterolateral portal . The probe was used to assess the tension and the clearance of the remaining acl and the notch . Arthroscopic examination of a left knee, showing impingement of hypertrophied posterolateral portion of acl to lateral wall and roof of intercondylar notch during extension photomicrograph showing distorted collagen fibers with scanty myxomatous degeneration (h and e stain, 40) during the followup, no immobilizer or brace was used except in one patient who had undergone acl reconstruction . All other patients were encouraged to perform daily active range of motion exercises with quadriceps strengthening and allowed to carry full weight bearing loads immediately . Preoperative central knee pain on terminal extension was moderate in 10 knees and severe in 8 knees . Postoperatively, 12 knees showed complete pain relief and 7 showed pain improvement by at least 3 visual analogue scale (vas) grades, for a total of 16 had well to excellent results regarding pain on terminal extension . Preoperative average international knee documentation committee (ikdc) score8 was 33.6 which improved postoperatively to the average 73.2 . The flexion deformity was found in four patients, with a mean angle of 6. postoperatively, it improved significantly with no deformity . Mris of all 20 patients showed an acl that appeared bulky, occupying almost the entire intercondylar notch, with a marked increased signal, particularly in the t2-weighted images, and with a mass - like configuration intertwined with its fibers with celery stalk sign.910 on mri, 6 patients had medial compartment arthritis, 4 patients had torn medial meniscus grade iii, and 1 patient had grade ii tear in posterior horn of lateral meniscus . Arthroscopy showed osteoarthritic changes in 9 knees and concomitant degenerative pathologies in 4 knees; these included meniscal tears and synovitis . Six (30%) degenerative lesions of the medial meniscus and 1 (0.5%) degenerative lesion of lateral meniscus were noted . Three femoropatellar cartilaginous lesions (15%), 4 (20%) medial femorotibial lesions (two grade 1, one grade 2, one grade 3), and 1 (0.5%) lateral femorotibial lesion grade 1 were observed . It filled the entire intercondylar notch and was unusually taut, toward 90 of flexion in 2 patients with hypertrophied am bundle of acl, and taut in extension in rest of the patients with hypertrophied pl bundle of acl . The posterolateral portion of the acl bulged into the lateral compartment in extension impinging in the notch . By flexion when each knee was brought into full extension, impingement of the hypertrophied acl to the lateral wall and roof of the intercondylar notch was observed.1112 impingement was particularly apparent in knees with a severely hypertrophied acl or narrowed notch, as well as limited knee joint extension . Arthroscopic treatment consisted of debridement of the afflicted portion of the acl in all cases . In six knees with evident notch narrowing, notchplasty was performed first . Because yellowish degenerative hypertrophied lesions were entangled around the posterolateral acl fibers, the anteromedial portion was retained in 18 patients . In 2 patients, posterolateral portion of acl was retained because of hypertrophied degenerated am bundle of acl . Although in one patient after debridement, the remaining portion of the acl was not enough to stabilize the knee, so we had to reconstruct the acl with hamstring graft which is comparable with the study by lintz et al. (7%).1 at an average followup time of 24 months (range 12 - 36 months), all except two patients had a full range of painless motion . It was 1 grade higher as compared with the opposite knee in 14 knees and the same as the opposite knee in 6 knees . All patients had a firm endpoint on lachman test without any symptoms of instability, inferring some intact portion of the acl between the tibia and the femur . Two patients had pivot shift positive + 1 with glide and 18 patients had negative pivot shift . A soft endpoint on anterior translation would imply no intact acl tissue in the intercondylar area . The histopathologic appearance and reports of the biopsy specimens were consistent with mucoid degeneration of the acl . Regression of the size and bulkiness of the treated acl was seen, with the t2-weighted images showing decreased signal with some intact acl fibers between the tibia and femur . The mucoid hypertrophy of the acl is a rare condition found in middle - aged individuals . Mucoid degeneration of anterior cruciate ligament is not an uncommon pathology, but is often unknown . According to bergin et al.6 and salvati et al.,13 reported its occurrence as 2 and 5%, respectively, of knee where mri was done . Our findings were incidental in initial 4 cases where clinical and radiological findings were not correlated as radiologist reported partial rupture of acl only . In practice and in the literature, it is often confused with a diagnosis of partial acl rupture . It becomes apparent in two subpopulations of patients . The first group is younger, active, athletic, in whom we can assume an acl mechanism affected by real trauma or repeated microtraumas causing an early lesion.14 the second group is older and presents with progressive degenerative acl lesions, with frequent concomitant degenerative meniscal lesions . The pathogenesis of mucoid degeneration is unclear, but injury, ganglion cysts, and degenerative process leading to loss of synovial lining have been implicated as the most likely etiologic factors in the production of this change . In younger group the possible cause of repetitive minor trauma is impingement of the acl to the lateral wall and roof of the narrow notch, which has been reported to be more common in female patients.15 in second group there is subtle alterations in joint kinematics due to osteoarthritis, meniscal tears, and other degenerative changes, leading to stretching of cruciate ligaments . Fealy et al.16 suggested that knee pain on flexion might be caused by tensioning of the diseased am bundle of the acl . For kumar et al.18 the pain is attributable to the effect of the acl mass in the posterior notch . Hsu et al.19 and kim et al.11 attribute it to incarceration of the pathological acl in the posterior femoro - tibial compartment . However, we found that the hypertrophied acl bulged into the lateral compartment, impinged on the lateral tibiofemoral joint, and caused an extension or flexion block, depending on the position of the impingement in the lateral tibiofemoral joint . We believe the most important source of pain is mechanical impingement, associated with unique function of the acl in providing nociceptive sensory signals . It is mentioned elsewhere only by mcintyre et al.2 who reported one case of atraumatic acl rupture at 1 postoperative year after partial resection . Our results indicate that postoperative laxity, largely asymptomatic, can increase anterior laxity over time and evoke instability . Mucoid hypertrophy of the acl should be clinically suspected in elderly person presenting with persistent knee pain on terminal extension without preceding trauma, especially when associated with extension deficit, which is more common in elderly individual with degenerated knee . Arthroscopic debridement of mucoid hypertrophy of the acl in conjunction with notchplasty can effectively provide symptomatic improvement without instability.

Prostate cancer (pca) is the fifth - most - common cancer among men in singapore, with an age - standardized rate of 17.4 cases per 100,000/y, and the incidence has been increasing steadily over the past 35 years . The average annual rate of increase between 1968 and 2002 was 5.6%, with the past 10 years showing a somewhat steeper increase . Pca could become a major public health issue with the aging of our country's population . During the past decade, a considerable number of modifications have been made to improve the technique of pca biopsy . Total prostate volume is also an important factor, and higher pca detection rates have been reported in men with smaller prostates . The current concept regarding prostate biopsy is that systematic sextant biopsies, even when directed laterally, do not provide adequate prostate sampling . Several extended biopsy techniques have been introduced to improve the pca detection rate compared with that of systematic sextant biopsy . These techniques vary in the number of cores taken and the location from which samples are obtained, but none have taken into consideration the age of the patient or the volume of the prostate gland . Life expectancy is based on patient age and has a pivotal role in diagnosis and treatment . Over - diagnosis of clinically insignificant pca is considered a major potential drawback of prostate - specific antigen (psa) screening, especially in older patients . Pca volumes to be detected can be larger in older patients, and thus fewer cores are needed, which reduces over - diagnosis of tumors (insignificant pca) at biopsy . On the basis of the above information and using data from the european prostate cancer detection study, the use of the vienna nomogram (vn) prostate biopsy model was developed . This model indicates the optimal number of cores based on patient age and total prostate volume . Thus, the use of the vn should result in higher pca detection rates, especially in younger patients and those with larger prostates, and, at the same time, should avoid the detection of insignificant cancers, especially in older patients ., we used the vn to determine the efficacy of this model in the detection of pca in our local population . We also assessed the incidence of complications due to the use of such a template . With approval from our institutional review board, 120 men were enrolled prospectively between january 2006 and june 2007 . The study population consisted of consecutive referrals for evaluation of elevated psa scores (> 4 ng / ml) and/or abnormal digital rectal examination (dre) findings . All patients underwent transrectal ultrasound (trus) examination of the prostate, which was followed by prostatic biopsies . Patients were excluded from the study if they had a history of pca, acute or chronic prostatitis, histologic evidence of prostatic intraepithelial neoplasia of any grade, urinary retention, indwelling urinary catheter, or confirmed urinary tract infection . Before the procedure, patients were observed for a minimum of 4 hours after the procedure for immediate complications and were given advice to return to hospital if they had delayed complications . In each of the 120 patients, 6 to 18 cores were taken from the peripheral zone for trus - guided biopsy, as indicated by the vn (table 1). Each biopsy core was labeled according to location on the prostate and was sent separately for histologic review . Biopsy tissue was considered positive if adenocarcinoma was diagnosed, and the number of positive cores, the gleason score, and the grade were reported . All other findings (high - grade prostatic intraepithelial neoplasia, atypia, and dysplasia) were considered negative . In this study, trus - guided biopsy performed according to the vn protocol was restricted to the first biopsy . Further management was dependent on individual urologists, and complication rates were subsequently updated by chart reviews . Chicago, il, usa) and stratified for age, psa, and trus findings . The patients' mean age was 62.68.3 years (range, 40 - 86 years). The mean psa score was 13.42 ng / ml, and the mean number of cores obtained was 9.683.1 . According to the vn, 27 out of a total of 120 patients had pca, for a detection rate of 22.5% . In the group of patients with psa scores <10 ng / ml, the detection rate was 14.9% (14 of 94 patients). The group of patients with psa scores> 10 ng / ml had a detection rate of 50% (13 of 26). Histopathologic features presented on prostate biopsy in 27 pca patients whose gleason scores were 3 + 3, 3 + 4, 4 + 3, 4 + 4, and 4 + 5 in 11.1% (3 patients), 37.0% (10), 29.6% (8), 18.5% (5), and 3.7% (1) respectively (fig . Two of these cases were diagnosed on repeat trus biopsy, and two were discovered on transurethral prostatectomy, for a false - negative rate of 3.3% . Four patients (3.3%) had bleeding per rectum: one of them required adrenaline injection, another required hemostasis under spinal anaesthesia, and the other two had rectal bleeding that resolved spontaneously without further intervention . Detection rates of pca have varied, and review of the literature from several asian countries found that the detection rate of pca in patients with raised psa scores is in the range of 14.6% to 26.5% . The austrian study that used the vn had a detection rate of 36.7% (table 2). Data from other countries in asia uniformly reported a low cancer detection rate in connection with psa scores ranging from 4 to 10 ng / ml . In comparison, the detection rate of pca with psa scores ranging from 4 to 10 ng / ml has always been about 25% in western countries . The low positive predictive value of elevated psa scores in asian countries may be due to the low incidence of pca in this geographic area, but it also may be partly due to inadequate sampling . Recent reports in the literature have queried the adequacy of sextant biopsy for the detection of small nonpalpable pca . In our study, we used the vn, and the positive predictive value was 22.5%, a value that is comparable to other published data from asian countries . The key to higher pca detection rates with the use of the vn is varying the number of cores according to prostate volume . Because larger prostate glands can result in more sampling errors during biopsy the studies by remzi et al . And ung et al . Stressed the importance of prostate volume in pca detection and showed that detection rates are, in fact, dependent on prostate volume . . Also found that the most important factor in a failure to diagnose pca at the primary screening was a large prostate volume . Evaluating the variation of pca detection in relation to prostate size through random systematic sextant biopsies, uzzo et al . Found that 23% of the patients had pca in a large prostate (> 50 ml), whereas 38% of patients with smaller prostates had pca (p<0.01). Although a study by lecuona and heyns found that the detection rates for the vn and an eight - core prostate biopsy were similar, the detection rate in the vn group was higher for patients with larger prostate volume (> 50 ml). Thus, the vn could be useful in patients with larger prostates in which potential undersampling could occur . The rationales for using age as one of the parameters to determine the number of biopsy cores taken are twofold: first, younger men have a longer life expectancy, which makes even smaller cancers clinically significant, and, thus, more cores are needed; and, second, older men may require fewer biopsy cores to avoid oversampling and overtreatment . If the time to critical pca volume is less than life expectancy, there might be no need for pca detection, as these pcas will be clinically insignificant . Standard sextant biopsies have reported high false - negative rates of 15% to 28% . By combining systematic and target sampling, the advantages of using a vn are, first, higher pca detection rates, especially in younger patients and larger prostates; second, at the same time, the avoidance of detection of insignificant cancers, especially in older patients; and, third, the fact that it provides urologists with a clear and fixed number of biopsy cores on the basis of patient age and prostate volume . In our study, the complication rate was low (7.5%). This rate was comparable to the rates in large - scale studies looking at morbidities of trus prostatic biopsy . Moreover, our complication rate was low despite our having performed more biopsies on each patient (than we would have with the sextant biopsy). With the use of the vn, our pca detection rate of 22.5% is comparable to published data for asian patients . The nomogram offers an easy tool with which to select the optimal number of prostate biopsy cores on the basis of patient age and total prostate volume . With this biopsy strategy

Selective laser trabeculoplasty (slt) is a new and promising treatment that uses the 532-nm frequency - doubled q - switched neodymium: yytrium aluminum garnet laser . Slt was developed to selectively target pigmented trabecular meshwork (tm) cells without causing thermal or collateral damage to the nonpigmented cells or structures of the tm.1 clinical trials of slt have been encouraging, with reasonable response rates, effective intraocular pressure (iop) reduction and minimal side effects.25 comparable studies have shown slt to be as effective as argon laser trabeculoplasty (alt),6 while histological investigations have demonstrated less damage to the ultrastructure of the tm.78 as a result of these studies, slt has been advocated as a treatment for the management of open - angle glaucoma (oag) with a role as a possible primary treatment.3 in the current study, we assess the iop lowering effect and the complications of slt in egyptian patients with primary open - angle glaucoma (poag). Sixty - five patients (106 eyes) were enrolled in this prospective study from june 2007 to january 2009 . Patients with a diagnosis of oag were considered eligible for this study if they were newly discovered on no previous medication (primary group of 41 eyes [group 1]), or had confirmed glaucoma poorly controlled on medications, or requesting a decrease number of medications (adjunctive group of 65 eyes [group 2]). Patients were excluded from the study if they had evidence of glaucoma other than oag (angle closure, inflammatory, or neovascular) in the study eye, were younger than 18 years, had any ocular condition in the study eye that hindered adequate visualization and treatment of the tm, (4) had prior glaucoma surgery in the study eye . Preoperative assessment included ophthalmic examination snellen visual acuity, iop measurement by goldmann applanation tonometry, slit - lamp examination and gonioscopy, and funduscopy with evaluation of cup: disc ratio and pallor . At least two preoperative iop readings were taken within 2 weeks before the laser treatment was performed . A drop of miotic (pilocarpine nitrate 2%) and brimonidine tartrate 0.2% (alphagan; allergan inc ., irvine, ca) were installed in the eye before laser treatment to assist in visualization of tm and to prevent iop spikes . The procedure was performed with topical benoxinate hydrochloride 0.4% for anesthesia . With the patient seated at the laser slit - lamp system, a goldmann three - mirror goniolens or latina lens was placed on the eye with methylcellulose 1% . Patients were treated with the ellex, solo slt laser (ellex medical pty . Ltd, adelaide, australia) a frequency - doubled q - switched nd: yag laser emitting at 532 nm with a pulse duration of 3 nsec and a spot size of 400 m, coupled to a slit - lamp delivery system . A low - power helium neon laser served as an aiming beam to provide easy targeting of the treatment area . If cavitation bubbles appeared the laser energy was reduced by 0.1 mj until only a few bubbles formed and treatment was continued at this energy level . If no cavitation bubble was observed, the pulse energy was increased by 0.1 mj until bubble formation and then decreased as described above . Approximately 100 adjacent, but nonoverlapping, laser spots were placed over 360 of the tm . Immediately after the laser treatment, prednisolone acetate (1%) drops were administered once in the treated eye then three times daily for 3 days . The same preoperative antiglaucoma medication regimen was continued until the second postoperative visit (1 week). Patients were evaluated at 1 day, 1 week, 2 weeks, 3 weeks, 4 weeks, and at 3, 6, 12 and 18 months . At each visit, the visual acuity and iop were measured, and slit - lamp examination of the anterior segment was performed . Gradual reduction of antiglaucoma medications was initiated 1 week following the procedure, after ensuring an adequate pressure drop . Combined therapy was considered two medications and each medication was decreased separately . Medically necessary medication changes were made at the physician's discretion . Data are described are range, mean standard deviation, frequencies (number of cases) and relative frequencies (percentages) as appropriate . Comparison of iop over the study period was performed with one - way analysis of variance (anova) with multiple comparisons post hoc for the two groups . Comparison of the number medications was performed with the kruskal - wallis analysis of variance (anova) test with multiple comparisons post hoc for the two groups . A probability value (p - value) less than 0.05 was considered statistically significant . All statistical calculations were performed with microsoft excel version 7 (microsoft corporation, redmond, wa) and spss (statistical package for the social science; spss inc ., chicago, il) version 13 for microsoft windows, arcus quickstat (biomedical) (research solutions, cambridge, uk). The procedure was performed with topical benoxinate hydrochloride 0.4% for anesthesia . With the patient seated at the laser slit - lamp system, a goldmann three - mirror goniolens or latina lens was placed on the eye with methylcellulose 1% . Patients were treated with the ellex, solo slt laser (ellex medical pty . Ltd, adelaide, australia) a frequency - doubled q - switched nd: yag laser emitting at 532 nm with a pulse duration of 3 nsec and a spot size of 400 m, coupled to a slit - lamp delivery system . A low - power helium neon laser served as an aiming beam to provide easy targeting of the treatment area . If cavitation bubbles appeared the laser energy was reduced by 0.1 mj until only a few bubbles formed and treatment was continued at this energy level . If no cavitation bubble was observed, the pulse energy was increased by 0.1 mj until bubble formation and then decreased as described above . Approximately 100 adjacent, but nonoverlapping, laser spots were placed over 360 of the tm . Immediately after the laser treatment, prednisolone acetate (1%) drops were administered once in the treated eye then three times daily for 3 days . The same preoperative antiglaucoma medication regimen was continued until the second postoperative visit (1 week). Patients were evaluated at 1 day, 1 week, 2 weeks, 3 weeks, 4 weeks, and at 3, 6, 12 and 18 months . At each visit, the visual acuity and iop were measured, and slit - lamp examination of the anterior segment was performed . All ophthalmic medications were recorded before surgery and at each subsequent visit . Gradual reduction of antiglaucoma medications was initiated 1 week following the procedure, after ensuring an adequate pressure drop . Data are described are range, mean standard deviation, frequencies (number of cases) and relative frequencies (percentages) as appropriate . Comparison of iop over the study period was performed with one - way analysis of variance (anova) with multiple comparisons post hoc for the two groups . Comparison of the number medications was performed with the kruskal - wallis analysis of variance (anova) test with multiple comparisons post hoc for the two groups . A probability value (p - value) all statistical calculations were performed with microsoft excel version 7 (microsoft corporation, redmond, wa) and spss (statistical package for the social science; spss inc ., chicago, il) version 13 for microsoft windows, arcus quickstat (biomedical) (research solutions, cambridge, uk). One hundred and six eyes with oag were enrolled in the study and received 360 laser treatment of tm . Females comprised 53% of the cohort and the mean age of the cohort was 53.2 years (range, 18 - 78 years). Mean preoperative iop was 19.55 4.8 mmhg which dropped significantly after 24 hours post - slt to 12.03 2.7 mmhg . Iop was 14.32 3.0 mmhg, 14.72 2.1 mmhg, 15.16 3.6 mmhg and 16.03 2.8 mmhg at 1, 6, 12, and 18 months of follow - up, respectively . The decrease in mean iop was statistically significant throughout follow - up (p <0.001). There was a tendency towards increased iop with follow - up, yet the mean final iop at the end of the study was statistically significantly lower than the pretreatment mean iop (p<0.05). Figure 1 shows the mean iop and standard deviation (sd) of all patients throughout the study period . Mean (sd) intraocular pressure (mmhg) of all patients throughout the study the greatest drop in iop occurred 24 hours after slt (7.52 mmhg) which was equivalent to a 38% drop from the baseline iop . There was a tendency toward and increase in iop during follow - up, with a mean iop reduction of 3.52 mmhg (18% from baseline) at 18 months (p= 0.001). The intraocular pressure reduction expressed as mean and percentage drop from baseline we further compared the mean iop for each group individually . Group i (primary treatment with no preoperative medications) had a preoperative mean iop of 21.54 mmhg that decreased significantly to 17.4 mmhg (p<0.001). Iop decreased significantly in group ii (adjunctive treatment where patients had been using antiglaucoma medications) from 18.29 mmhg preoperatively to 14.89 mmhg by the end of the study (p=0.001). Mean intraocular pressure changes (mmhg) in both primary and adjunctive groups over the study period success was defined as iop <21 mmhg with at least a twenty percent drop of iop from baseline and no secondary surgeries . At 1-month follow - up, success remained similar at 18 months postoperatively with 74 eyes attaining the desired drop (70% of cases). Hence despite a mean drop of iop of 18% at the end of follow - up, 70% of the patients met the success criteria . By the end of follow - up, six patients required laser retreatment and none needed any other surgical intervention to lower the iop . Number of patients with any intervention in each group among patients using preoperative medications (group ii), the mean number of medications used dropped statistically significantly throughout the study from 2.25 0.97 before the procedure to 1.0 (1.3) at the end of 18 months follow - up (p= 0.004). Mean number of medications used in the adjunctive group throughout the study during the first 24 hours following the procedure, mild flare and cells were noted in the anterior chamber . This resolved spontaneously without treatment except in one case, which was successfully treated with topical steroids and resolved in 1 week . We had five cases (4.7%) of increased iop 1 week following the procedure, the increase in iop ranged from 2 to 10 mmhg, only three eyes had an iop spike of 5 mmhg or more . One hundred and six eyes with oag were enrolled in the study and received 360 laser treatment of tm . Females comprised 53% of the cohort and the mean age of the cohort was 53.2 years (range, 18 - 78 years). Mean preoperative iop was 19.55 4.8 mmhg which dropped significantly after 24 hours post - slt to 12.03 2.7 mmhg . Iop was 14.32 3.0 mmhg, 14.72 2.1 mmhg, 15.16 3.6 mmhg and 16.03 2.8 mmhg at 1, 6, 12, and 18 months of follow - up, respectively . The decrease in mean iop was statistically significant throughout follow - up (p <0.001). There was a tendency towards increased iop with follow - up, yet the mean final iop at the end of the study was statistically significantly lower than the pretreatment mean iop (p<0.05). Figure 1 shows the mean iop and standard deviation (sd) of all patients throughout the study period . The greatest drop in iop occurred 24 hours after slt (7.52 mmhg) which was equivalent to a 38% drop from the baseline iop . There was a tendency toward and increase in iop during follow - up, with a mean iop reduction of 3.52 mmhg (18% from baseline) at 18 months (p= 0.001). The intraocular pressure reduction expressed as mean and percentage drop from baseline we further compared the mean iop for each group individually . Group i (primary treatment with no preoperative medications) had a preoperative mean iop of 21.54 mmhg that decreased significantly to 17.4 mmhg (p<0.001). Iop decreased significantly in group ii (adjunctive treatment where patients had been using antiglaucoma medications) from 18.29 mmhg preoperatively to 14.89 mmhg by the end of the study (p=0.001). Mean intraocular pressure changes (mmhg) in both primary and adjunctive groups over the study period success was defined as iop <21 mmhg with at least a twenty percent drop of iop from baseline and no secondary surgeries . At 1-month follow - up, success remained similar at 18 months postoperatively with 74 eyes attaining the desired drop (70% of cases). Hence despite a mean drop of iop of 18% at the end of follow - up, 70% of the patients met the success criteria . By the end of follow - up, six patients required laser retreatment and none needed any other surgical intervention to lower the iop . Among patients using preoperative medications (group ii), the mean number of medications used dropped statistically significantly throughout the study from 2.25 0.97 before the procedure to 1.0 (1.3) at the end of 18 months follow - up (p= 0.004). Mean number of medications used in the adjunctive group throughout the study during the first 24 hours following the procedure, mild flare and cells were noted in the anterior chamber . This resolved spontaneously without treatment except in one case, which was successfully treated with topical steroids and resolved in 1 week . We had five cases (4.7%) of increased iop 1 week following the procedure, the increase in iop ranged from 2 to 10 mmhg, only three eyes had an iop spike of 5 mmhg or more . Selective photothermolysis takes place when thermal damage is confined to the target, melanin, by using a specific laser wavelength with a laser exposure time (3 ns) equal to or shorter than the thermal relaxation time of melanin . Thus, pulsed lasers with low threshold radiant exposures can selectively target pigmented tm cells and avoid collateral thermal damage to adjacent non - pigmented cells.9 histologically, slt has not been reported to cause coagulative damage to the tm.78 the literature has reported variable rates of the short and long - term efficacy of slt, with mean reductions in iop ranging from 2 to 14 mmhg at 1 month postoperatively, 36 mmhg at 3 months postoperatively, and 57 mmhg at 6 months postoperatively.3461011 to our knowledge this is the first study to address the effect of this technique on egyptian patients whether it was used alone or as an adjunct to medical therapy for glaucoma . Our study shows slt to be an effective procedure with continued average iop lowering over 18 months consistent with the previous studies . Latina et al ., studied 101 patients (45 patients on maximum antiglaucoma medication and 56 patients who had a previous failed alt) treated by slt.1 they1 found a 70% success rate based on a 3-mmhg (20%) or more reduction in iop and no additional medication at 6 months after treatment . This outcome is very similar to our results of 69 - 70% of patients achieving 20% or more reduction in iop . Latina et al.,1 reported the greatest reduction in iop occurred on the first postoperative day (30.2%) and by 26 weeks, the average iop reduction (in percent) from baseline for the entire cohort was 18.7% (4.6 mmhg). Nagar et al.,2 achieved a 20% reduction of iop in 82% of their patients with 360 slt and mc ilraith et al.,12 achieved similar results . These outcomes are comparable to our results of 38% at day one, 25% by 6 months and 18% at 18 months follow - up . Slt proved effective for the primary treatment of poag and ocular hypertention, with a mean drop of iop of 30% from baseline at 18 months postoperatively in melamed et al.,3 study . Prasad et al.,13 achieved a 35% drop of iop after 2 years of follow - up of primary cases of glaucoma treated with 360 slt . These results are comparable to our findings in the primary treatment group which showed a mean drop of 19.2% at 18 months . Saito et al.,14 found a significant drop in iop in japanese patients undergoing slt as adjunctive treatment for poag which tended to decrease with 1 year follow - up . In a different study on chinese patients with maximally tolerated medical therapy for poag, adjunctive slt achieved iop drop of 15% at 18-months follow - up.15 our adjunctive group showed a comparable mean drop of 18.6% at 18 months . As with other studies, treatment failure occurred during the first month of follow - up and it remained the same throughout follow - up . The outcomes of our study do not indicate an advantage for slt in one group over the other . The number of medication used by patients dropped significantly in our study from 2.25 0.97 before laser treatment to 1.00 1.3 at the end of follow - up, these results are comparable to francis et al . 's report,16 showing a decrease in the number of medications after slt from 2.8 1.1 to 1.5 0.9 at 12 months, postoperatively . Adverse effects included ocular discomfort in 21 patients (19.8%), when the shots were closer to the ciliary body . The same observation was reported by latina et al.,1 where pain and discomfort was reported in 15% of patients and redness in 9% . Nagar et al.,2 also reported transient pain and discomfort in 39% of patients undergoing 360 slt . We did not encounter cases of iritis which could be explained by our routine use of pre- and postoperative steroids . Iop spikes more than 5 mmhg were recorded in three patients (2.8%) in the current study . Reports of iop spikes in the literature range widely from 0 to 27%,129 this can be explained by the use of different a preoperative regimen . Latina et al.,1 and nagar et al.,2 did not premedicate with antiglaucoma drops and both reported iop spike of 24% and 27%, respectively . However, johnson et al.,9 (similar to us) used pre- and postoperative -agonists to control iop spikes reporting no iop spikes in 136 eyes . Slt was also effective in reducing the number of medications used by patients which is an economic advantage in developing countries . There is a tendency of the iop lowering effect to wane over time hence, regular follow - up is required.

It is not easy to define a good health care system and good health care services . In these definitions, there is a complexity of elements or components, which contribute separately, but influence in a harmonized manner the perceptions towards a given health care system (1, 2). The health care system in albania has undergone several periods in which the health care concept has evolved significantly (3,4). Currently, the health care system in albania consists of three main pillars: primary, secondary and tertiary health care services (3). The quality of health care is the consequence of strong links between service providers and users of the health care services at all levels (5). Perceived quality is one of the principal determinants of utilization and non - utilization of health care services (6, 7), a major issue in developing and transitional countries including albania, a former communist country in the western balkans which has undergone tremendous political and socioeconomic changes in the past two decades associated with significant health consequences (8, 9). In addition, the rapid process of transition in albania over the past two decades has been associated with an intensive process of internal migration (from rural areas to urban areas of the country, especially in tirana, the albanian capital city) and external migration (mainly to the neighboring countries including greece and italy) (9). Migration is linked to an increased aging which, in turn, enhances the general and already existing aging effect on healthcare utilization (that is the relative care needs of the albanian population). To date, however, the available information regarding the quality of primary health care services in albania is scarce . In this framework, the aim of our study was to assess the quality of the primary health care services in albania with a main focus on family physicians perceptions towards the quality of health care services provided to the general population . A cross - sectional study was conducted in january - march 2013 including a representative sample of 132 physicians providing primary health care services in several polyclinics (health centers) of tirana . Initially, a simple random sample of 150 physicians operating at primary health care level in tirana was targeted for recruitment . Of these, 18 physicians could not be contacted (n=7), or refused to participate (n=11). The final study population consisted of 132 physicians (59 men aged 41.36.9 years and 73 women aged 43.74.8 years; overall response rate: 132/150=88%). A structured self - administered and anonymous questionnaire was applied to all male and female primary health care physicians who agreed to participate in this survey . The questionnaire consisted of self - assessment of the following key dimensions / components of primary health care services: physical conditions at the workplace (measurement scale: good [score: 2], average [score: 1], bad [score: 0]); availability and quality of working devices and equipment for proper diagnostic and treatment services (measurement scale: not available [score: 0], available but not good [score; 1], available and good [score: 2]); sources of scientific information available at the workplace (not available [score: 0], available but outdated [score: 1], available and updated [score; 2]); level of autonomy in decision - making (no autonomy [score: 0], partial autonomy [score: 1], sufficient autonomy [score: 2]). A summary score (ranging from 0 to 8) was calculated for each physician based on these four dimensions of the quality of health care services which was dichotomized into inadequate quality (overall score: 0 - 4) vs. adequate quality of health care services (summary score: 5 - 8). In addition, demographic data (age and sex of physicians), information on working experience, number of population served, working place (polyclinic, or health center), type of specialization received and involvement in teaching / training activities were collected for all physicians included in the study . Median values (and their respective interquartile ranges) were used to describe the distribution of age, duration of work experience and the number of population served by the physicians included in this cross - sectional study . Conversely, frequency distributions (absolute numbers and their respective percentages) were used to describe the distribution of sex, working place, specialization, involvement in teaching and training activities of the primary health care physicians . Similarly, absolute numbers and their respective percentages were used to describe the distribution of the key dimensions / components of primary health care services according to physicians perceptions (physical conditions at the workplace, devices and equipment, sources of information and level of autonomy). Binary logistic regression was used to assess the association between the self - assessed overall quality of primary health care services (adequate vs. inadequate) with baseline characteristics of primary health care physicians . Odds ratios (ors), 95% confidence intervals (95%ci) and their respective p - values were calculated . Spss (statistical package for social sciences, version 15.0), was used for all the statistical analyses . Demographic characteristics, working experience, specialization received, teaching involvement and population coverage of primary health care physicians included in this survey are presented in table 1 . Median age of study participants was 44 years (interquartile range: 38 - 51 years). Median working experience was 14 years (interquartile range: 4.5 - 23.5 years). Median number of population served was 2500 inhabitants (interquartile range: 2000 - 4000). About 37% of the physicians were specialized in family medicine, 42% were general practitioners, whereas 21% had received other types of specializations including cardiology, pediatrics, rheumatology, or allergology . Only 29.5% of primary health care physicians included in this study were involved in teaching and training activities (table 1). Baseline characteristics of a representative sample of primary health care physicians in tirana in 2013 (n=132). * median values and interquartile ranges (in parentheses). Numbers and column percentages (in parentheses). Table 2 presents the distribution of selected key dimensions / components of primary health care services according to physicians perceptions . Overall, 31% of the physicians considered good the physical conditions at their workplace, whereas 24% deemed them about 24% of the physicians perceived that there were no devices and equipment for a proper diagnosis and treatment of their patients, as opposed to 40% of the physicians who considered the equipment and devices available and appropriate . About 48% of the physicians stated that there were no sources of scientific information available at their workplace, compared with 20% of physicians who reported availability of updated sources of scientific information at their workplace . About 67% of the physicians perceived a complete lack of autonomy in decision - making, whereas 10% of physicians perceived sufficient autonomy in decision - making in their current (routine) health care practice (table 2). Distribution of selected key dimensions of primary health care services according to physicians perceptions table 3 presents the association of the self - assessed quality of services with characteristics of primary health care physicians included in this survey . Age of physicians was positively related to the self - perceived level of quality of health care services . Hence, younger physicians reported a lower quality of health care services compared with their older counterparts, a finding which was borderline statistically significant (or=0.79, 95%ci=0.61 - 1.04). The odds of perception of adequate health care services were lower in men compared to women, a finding which was statistically significant (or=0.68, 95%ci=0.42 - 0.91). Physicians with less than ten years of working experience had significantly lower odds of perceiving the services as adequate (or=0.77, 95%ci=0.51 - 0.94). The number of population served was a borderline predictor of the quality of primary health care services (p=0.09). Physicians specialized in family medicine had significantly higher odds of perception of services as adequate compared with the rest of physicians who were not trained in family medicine (or=1.56, 95%ci=1.13 - 1.97). On the other hand, involvement in teaching or training activities was not significantly related to the self - perceived quality of primary health care services (table 3). Association of quality of services with characteristics of primary health care physicians; odds ratios (adequate vs. inadequate quality) from binary logistic regression main findings of this survey relate to a positive association of an adequate quality of primary health care services with female gender, older age, working experience and training in family medicine of physicians operating at primary health care level in tirana, the albanian capital . These are generally in line with previous reports from the international literature (5 - 7). Albanian doctors working at the primary health care sector face many difficulties in their professional practice . Hence, albanian physicians are currently expected to provide not only high - quality services, but they should also apply competencies related to leadership, management, and community support at large . From this point of view, our findings suggest that older doctors and those with more years of working experience tend to report a higher quality of primary health care services reflecting a more favorable attitude which may be presumably linked to a higher level of professional skills and competencies . The population coverage was only a borderline predictor of the self - reported quality of services in the sample of primary health care physicians included in this study . This is an intuitive finding, in line with the expected direction, as the level of physicians competencies is related to the experience gained in the course of their health care practice (6). Our study was based on doctors perceptions about their working conditions and working environment and this can imply a subjective evaluation that can bear the possibility of information biases in the assessment of the current situation in terms of the quality of primary health care services in albania . Therefore, health authorities in albania should develop and implement suitable instruments to measure the quality of health care services at all levels . Furthermore, there is also a need to place in the public domain tool kits that can be used by physicians, administrators, and patient groups to assess and improve the quality of care . Similar to many countries, albania should develop a national quality report, based on standardized comprehensive and scientifically valid measures, which should describe the country s progress in improving quality of care (10,11). Measurement and ranking of the quality of health care services should also involve patients perspective, in line with experiences and practices from other countries (10,11). The current survey was an attempt to provide evidence about the perceptions of primary health care physicians regarding different aspects of their profession . Our findings indicate that albanian doctors face several difficulties in performing their everyday tasks and, therefore, health authorities must undertake measures to improve their performance through provision of better working environment, availability and improvement of the instruments and diagnostic devices for diagnostic and treatment services . Our findings provide useful evidence on the self - perceived quality of health care services from primary health care physicians perspective in transitional albania.

Coenurosis, also known as gid or sturdy, is a larval helminth infection of herbivorous animals . Adult tapeworm of t. multiceps inhabits small intestine of some domestic and wild carnivores, e.g. Dogs, jackals, foxes and coyotes . Eggs excreted in the environment by the definitive hosts are ingested by herbivorous intermediate hosts including sheep, goat, horse, cattle, camel, deer and pig . As a result the oncosphere passes through the intestinal wall and via bloodstream primarily localizes in the cns . This causes neurological symptoms and even death in young animals (1 - 3).furthermore, coenurosis is a zoonotic disease in which human may be accidentally infected and subsequently be suffered from - serious neurological problems . A few human cases has been reported from different countries including italy, egypt and the united states (4, 5). The infection rate of c. cerebralis, varied from 0.32 - 18.7% in sheep, goat, and wild sheep . Ovine cenurosis has been reported in 18.7% (6), 9.8% (7), 3.8% (8) and0.3% (9) of animals . Investigations on de - finitive hosts in different endemic regions of iran indicated rather high rates between 3 and 40% (10 - 13) in dogs, 7.5% in jackals,18.2% in foxes and 40% in wolves (10, 13). In other parts of the world similar prevalence rates of ovine cenuriasis have been recorded e.g. 3% in jordan (1), 1.336.8% in turkey (14, 15), and 2.5% in bangladesh (16). Recorded prevalence rate ranging from 2.3 to 4.5% of sheep in kenya (2). Significant economic losses due to livestock morbidity and mortality caused by t. multiceps have been documented in several investigati - onsi - n ende - mic countries (17, 18). In iran the financial damage resulting from the condemnation of meat and viscera of sheep due to coenurosis one accepted method for distinguishing taeniid tapeworms at intra- and inter - specific levels has been the use of larval rostellar hook dimensions particularly total length of large and small hooks (19 - 24). Due to their keratin - like contents, hook measurement is not a complexprocedure and this makes hook morphometry a suitable tool for identification of different species of tapeworms . Hook size is believed to be influenced by a combination of genetic and host factors . Using enzyme electrophoresis on six loci in the taeniid tapeworm, echinococcus granulosus, lymbery (1998) showed that the total larval hook lengths particularly the total length of small hooks was the most affected hook character in the isolatesfrom different intermediate hosts (25). For example, in bacteria a sound genetic basis is documented for the flagellar morphology in salmonella and shigella (26). In passerine birds microsatellite and mtdna variations have been significantly associated with phenotypic traits like bill length (27). However no study has been undertaken to investigate possible association of variability within different genes and the larval rostellar hook length in taeniid cestodes . This study was conducted to investigate the rostellar hook morphometry and the influence of mitochondrial gene variations on the hook length in sheep isolates of t. multiceps . A total of 4500 sheep heads were examined for the presence of t. multiceps metacestodes in the period of october 2010 to may 2011 in three major food processing companies in tehran, alborz and qom provinces of iran.after opening the skulls, coenuri were detached from the brain and were transferred to the helminthology lab in the school of medicine, kerman university of medical sciences . The metacestodes were then rinsed three times in normal saline and the specimens were stored at -20c until used . The fluid - filled coenuri were contained several scoleces surrounded by a thin, transparent membrane . All the scoleces within each coenure were counted and biometric characters based on the larval rostellar hook size were measured . For each metacestode five scoleces were randomly selected . Total lengths of each of three large and three small hooks per scolex were measured by a calibrated eyepiece micrometer under medium power magnification (fig . All measurements were taken by a single person (s.r).representative mitoch - ondrial co1 and 12s rrna gene sequences of all the isolates were obtained from ncbi genbank to find out possible association between mitochondrial gene variability and hook morphometry . The large and small hook length data as well as the corresponding co1 and 12s rrna haplotypes were managed in the statistical package for the social sciences (spss, v. 21). Cluster analysis was applied to classify the subjects into homogeneous subgroups using interclass correlation coefficient (icc). Random effects model was applied to estimate how much of variation in thehook length was attributable to the genetic differences between the subjects . Dendrogram and scatter plot were generated based on the large and small hook length using hierarchical cluster analysis . A total of 4500 sheep heads were examined for the presence of t. multiceps metacestodes in the period of october 2010 to may 2011 in three major food processing companies in tehran, alborz and qom provinces of iran.after opening the skulls, coenuri were detached from the brain and were transferred to the helminthology lab in the school of medicine, kerman university of medical sciences . The metacestodes were then rinsed three times in normal saline and the specimens were stored at -20c until used . The fluid - filled coenuri were contained several scoleces surrounded by a thin, transparent membrane . All the scoleces within each coenure were counted and biometric characters based on the larval rostellar hook size were measured . For each metacestode five scoleces were randomly selected . Total lengths of each of three large and three small hooks per scolex were measured by a calibrated eyepiece micrometer under medium power magnification (fig . All measurements were taken by a single person (s.r).representative mitoch - ondrial co1 and 12s rrna gene sequences of all the isolates were obtained from ncbi genbank to find out possible association between mitochondrial gene variability and hook morphometry . The large and small hook length data as well as the corresponding co1 and 12s rrna haplotypes were managed in the statistical package for the social sciences (spss, v. 21). Cluster analysis was applied to classify the subjects into homogeneous subgroups using interclass correlation coefficient (icc). Random effects model was applied to estimate how much of variation in thehook length was attributable to the genetic differences between the subjects . Dendrogram and scatter plot were generated based on the large and small hook length using hierarchical cluster analysis . Inspection of 4500 sheep brains revealed that 114 (2.5%) heads were infected by t. multiceps metacestodes . The average total length of thelarge and small hooks was 158.9 m (range: 110 - 195) and 112.1 m (range: 63 - 132), respectively . Significant icc s were obtained from random effects models showing that the large and small hook lengths are significantly different among t. multiceps isolates (p<0.001, table 1). The results indicated that respectively 57.0% and 22.6% of variation in large and small hook lengths are attributable to different individuals in t. multiceps isolates . This means that based on large and small hook length, statistically significant clusters are distinguishable within the isolates.the results of hierarchical analysis are presented as a dendrogram in fig . The dendrogram contained two main clades one of which comprised 97.1% of the isolates.subclades a, b and c contained the majority of the isolates i.e.44 isolates (43.1%) in the subclade a, 25 isolates (24.5%) in the subclade b and 18 isolates (17.6%) in the subclade c.no associations were found between hook length and co1 gene variability, however 12s rrna variability was significantly associated with theboth large and small hook length (table 1). Coenurus cerebralis is a serious disease of herbivores with a worldwide distribution caused by the larval form of the cestode t. multiceps . Different prevalence rates for coenurosis have been reported depending on various geographical, climatic and socio - economic conditions as well as environmental factors and livestock husbandry systems(28). Coenurosis is more prevalent in developing countries of africa and asia(2). Apparently, estimating precise prevalence of coenurosis is difficult because animal brains are not usually inspected during routine veterinary examinations . According to the present study the prevalence of ovine coenurosis was 2.5%.previous studies in iran indicated a range of relative frequency between 0.3 and 18.7% . The present prevalence is higher than those obtained by yuossefi (0.3%) in iran, abedl - maogood (2005) in egypt (1.5%) and scala et al . (2007) in italy (0.35%)(9, 29, 30).other studies indicated higher prevalences in urmia (18.7%), tabriz(3.8%) and shiraz(9.8%) (6 - 8).in the neighboring turkey similar prevalence rates were recorded as 1.3 - 36.8%(14, 15). In bangaladesh and ethiopia the prevalence of t. multiceps metacestode was obtained as 2.5% and 2.7% respectively (2, 16). Regarding the relatively high prevalence of ovine cenuriasis in iran and the resulting economic losses due to the disease (7), implementation of control and prevention programs in the endemic regions are recommended . The present study revealed that the average number of scoleces in the metacestode is 85 with a range of 40 - 550 scoleces per coenure . Our finding is almost similar to the findings of other studies in which the highest number of scoleces per cyst reached 550 ranging from 10 to 370 scoleces per cyst (2, 31 - 33). Presence of different numbers of scoleces may be related to the differences in the age of the coenuri . Table 2 compares the rostellar hook morphometric characters of t. multiceps derived from existing data in the literature.the results of morphometric study showed that the mean sd total length of the large and small hooks were 158.99.3 m and 112.19.4 m respectively . The range of large hook length was 110.3 - 195.3 m, and 63.0 - 132.3 m for the small hooks . As it is illustrated in the scatter plot (fig . 3) hook lengths of the majority of the isolates were found to be 150 - 165 m and 105 - 120 m for the large and small hooks respectively . The classical work of verster indicates the average large and small hook lengths as 166.7 and 125.0 respectively (23). Our results are in agreement with those of verster as well as the other published morphometric studies on t. multiceps hooks (table 2). Based on the small and large hook values for each individual isolate, two main clusters were identified in the dendrogram (fig . Most of the isolates were located in the three main sub clades a, b and c. however, morphologically defined variants have not been described in t. multiceps so far . Varcasia et al . Described genetic diversity within sardinian populations of t. multiceps, however morphometric analysis was not carried out on that population (34). Obviously more comprehensive morphological studies in other regions are required to clarify possible morphometric diversity within t. multiceps populations from different intermediate hosts . Mixed model analysis in the present study established a significant association between 12s rrna variability and larval rostellar hook lengths . According to the results of the present study 38% and 8% of the large and small hook length variations rostellar hooks are known to be made of keratin - like proteins (35, 36), however further genomic studies on keratin - related genes are required to improve our understanding on the genetic basis of larval hook development . Hook length analysis revealed statistically significant difference among individual isolates, indicating intraspecific variation within t. multiceps in iran . Morphometric analyses in the present study showed an association between the rostellar hook length and sequence variability in the mitochondrial 12s rrna.

Light upconversion is the generation of high - energy photons from low - energy photons, for example, the conversion of red light to blue light . Generating upconverted light can be achieved using different systems such as two - photon absorption dyes, rare earth - doped materials or nanoparticles, and triplet triplet annihilation (tta - uc). Among these systems, tta - uc offers many advantages: it works at low excitation power (down to 1 mw cm), it uses sensitizers having high molar absorptivity, and the obtained upconversion quantum yields are high, typically 15% in aqueous solution . Since its popularization more than a decade ago, tta - uc has been used in many applications such as photocatalysis, solar energy harvesting, drug delivery and activation, and luminescence bioimaging . Tta - uc is based on the photophysical interplay of photosensitizer and annihilator chromophores (see figure s1). The photosensitizer absorbs low energy light, after which intersystem crossing leads to a long - lived triplet state . The energy of this triplet state is transferred to the annihilator upon diffusional collision by means of triplet triplet energy transfer (ttet); a succession of ttet leads to a concentration buildup of long - lived triplet - state annihilators . Triplet annihilation upconversion, in which one of them departs with the energy of both triplet states, to reach a high - energy singlet state . Finally, this singlet excited state returns to the ground state by emission of a high - energy photon, thus realizing light upconversion . Tta - uc has been demonstrated in an extensive assortment of organic, inorganic, and/or supramolecular materials, as well as in nano- or microsized particles . Among the various applications of tta - uc, some of them require to operate above room temperature, such as bioimaging and phototherapy . Because ttet and tta occur via molecular collisions, these processes are highly dependent on molecular diffusion; the efficiency of tta - uc was reported as being greatly influenced by the fluidity of the matrix containing the dyes, and hence by the temperature . For many materials, a higher temperature leads to a higher fluidity, and therefore to higher tta - uc efficiency . For example, green - to - blue tta - uc in a rubbery polymer matrix was only visible above the glass transition temperature of the material, where the matrix becomes more fluid . However, diffusion is not the only important factor . First of all, temperature - dependent chemical phenomena such as dye aggregation may affect upconversion as well: counterintuitively, it was recently shown that at lower temperatures, mixed aggregation of sensitizer and annihilator molecules in diluted conditions resulted in higher tta - uc efficiency . It has also been shown that upconversion in gel matrices decreased at higher temperatures due to temperature - dependent disassembly of the host material . Overall, understanding the temperature dependence of all chemical and physical properties of a given matrix is necessary for optimizing upconversion . Our group recently demonstrated that green - to - blue and red - to - blue tta - uc can be realized in the phospholipid membrane of neutral pegylated liposomes composed of 1,2-dimyristoyl - sn - glycero-3-phosphocholine (dmpc). This knowledge was later used for the activation of photoactivatable chemotherapeutic agents in the photodynamic window . In our initial studies it was reported that the upconversion intensity was reversibly affected by changes in temperature . Upon heating the sample from 15 to 25 c the upconversion intensity increased significantly, which we interpreted as a consequence of the gel - to - liquid crystalline phase transition temperature (tm) of the dmpc lipid bilayer . Upon raising the temperature above tm the molecular diffusion of the dyes in the membrane is expected to increase greatly, which should lead to higher ttet and tta rates, and thus higher tta - uc efficiencies . In this work, we systematically investigated the temperature dependency of tta - uc in neutral pegylated liposomes made of different lipids with different transition temperatures tm, to optimize the lipid composition of red - to - blue tta - uc drug - delivery systems functioning at human body temperature . Palladium tetraphenyltetrabenzoporphyrin (1) was purchased from bio - connect (huissen, the netherlands). Perylene (2) was purchased from sigma - aldrich chemie bv (zwijndrecht, the netherlands). All lipids were purchased from either lipoid gmbh (ludwigshafen, germany) or avanti polar lipids (alabaster, al, usa) and stored at 18 c . Phosphate buffered saline (dpbs) was purchased from sigma - aldrich and had a formulation of 8 gl nacl, 0.2 gl kcl, 0.2 gl kh2po4, and 1.15 gl k2hpo4 with a ph of 7.17.5 . All liposome formulations were prepared by the classical hydration - extrusion method . As an example, the preparation of liposome sample o12 is described here . Aliquots of chloroform stock solutions containing the liposome constituents were added together in a flask to obtain a solution with 5.0 mol dopc, 0.20 mol dspe - mpeg-2000, 2.5 nmol compound 1, and 25 nmol compound 2 . The organic solvent was removed by rotary evaporation and subsequently under high vacuum for at least 30 min to create a lipid film . 1.0 ml dpbs buffer, with or without 0.3 m sodium sulfite, was added and the lipid film was hydrated by 4 cycles of freezing the flask in liquid nitrogen and thawing in warm water (60 c). The resulting dispersion was extruded through a whatman nuclepore 0.2 m polycarbonate filter at least 10 c above the main phase transition temperature of the lipid for at least 11 times using a mini - extruder from avanti polar lipids, inc . (alabaster, alabama, usa), fitted with two 1001rn gastight syringes from hamilton (bonaduz, switzerland). Warning: heating the gastight syringes to 5070 c will cause the teflon plunger to leak at room temperature it is advised to use one set of syringes for hot extrusion only! The number of extrusions was always odd to prevent any unextruded material ending up in the final liposome sample . The extrusion filter remained practically colorless after extrusion, suggesting near - complete inclusion of the dyes in the lipid bilayer . Liposomes were stored in the dark at 4 c and used within 7 days . The average liposome size and polydispersity index were measured with a malvern instruments zetasizer nano - s machine, operating with a wavelength of 632 nm . Differential scanning calorimetry (dsc) was performed on a ta instruments (de, usa) nano - dsc iii instrument in the range of 5 to 50 c with a scanning rate of 1 c min at 3 atm . The capillary cell (v = 300 l) was filled with the liposome solution (lipid bulk concentration of 5 mm), and the reference cell was filled with pbs buffer solution . The liposome dispersions were degassed for 1015 min prior to measurement on a nalgene degassing station . For each sample, at least two cycles of heating and cooling were performed with 10 min of thermal equilibration between the ramps . The machine was cleaned beforehand with 50% formic acid and rinsed thoroughly with milli - q water . Absorption and emission spectroscopy was conducted in a custom - built setup (figure s2). All optical parts were connected with fc - uvxxx-2 (xxx = 200, 400, 600) optical fibers from avantes (apeldoorn, the netherlands), with a diameter of 200600 m, respectively, and that were suitable for the uv vis range (200800 nm). Typically, 2.25 ml of sample was placed in a 111-os macro fluorescence cuvette from hellma in a cuv - uv / vis - tc temperature - controlled cuvette holder with stirring from avantes . Deoxygenated toluene samples were prepared in a glovebox in a sealed fluorescence cuvette . The cuvette holder temperature was controlled with a tc-125 controller and t - app computer software from quantum northwest (liberty lake, wa, usa), while the sample temperature was measured with an omega rdxl4sd thermometer with a k - type probe submerged in the sample . The sample was excited with a 10 mw collimated 630 nm laser light beam (4 mm beam diameter, 80 mw cm) from a diomed 630 nm pdt laser . The 630 nm light was filtered through a 630 nm band - pass filter (fb63010 from thorlabs, dachau / munich, germany) put between the laser and the sample . The excitation power was controlled using the laser control in combination with a ndl-25c-4 variable neutral density filter (thorlabs), and measured using a s310c thermal sensor connected to a pm100usb power meter (thorlabs). Vis absorption spectra were measured using an avalight - dhc halogen - deuterium lamp (avantes) as light source and a 2048l starline spectrometer (avantes) as detector, both connected to the cuvette holder at a 180 angle and both at a 90 angle with respect to the red laser irradiation direction . The filter holder between cuvette holder and detector was in a position without a filter (figure s2, item 8). Luminescence emission spectra were measured using the same detector but with the uv vis light source switched off . To visualize the spectrum from 450 to 950 nm, while blocking the red excitation light, a thorlabs nf-633 notch filter was used in the variable filter holder . All spectra were recorded with avasoft software from avantes and further processed with microsoft office excel 2010 and origin pro 9.1 software . Temperature dependent luminescence experiments were done with continuous irradiation and temperature ramping, except for phosphorescence measurements of compound 1 to prevent bleaching during the experiment . Instead, spectra were taken every 5 c with 10 min thermal equilibration between temperature points . The absolute quantum yield of upconversion was determined by means of an integrating sphere setup . Neutral pegylated liposome dispersions were prepared in phosphate buffered saline (pbs) by hydration and extrusion of lipid films containing six different neutral phosphatidylcholines, i.e., 1,2-dioleyl - sn - glycero-3-phosphocholine (dopc), 1,2-dilaureyl - sn - glycero-3-phosphocholine (dlpc), 1,2-dimyristoyl - sn - glycero-3-phosphocholine (dmpc), 1,2-dipentadecanoyl - sn - glycero-3-phosphocholine (dpdpc), 1,2-dipalmitoyl - sn - glycero-3-phosphocholine (dppc), and 1,2-distearoyl - sn - glycero-3-phosphocholine (dspc) and in the presence of 4 mol% of sodium n-(carbonyl - methoxypolyethylene glycol-2000)-1,2-distearoyl - sn - glycero-3-phosphoethanolamine (dspe - mpeg-2000, see figure 1). Addition of dspe - mpeg-2000 is a well - known strategy to prevent liposome aggregation and fusion, and moreover increases the hydrophobic dye loading capacity of phospholipid membranes . The lipid composition of liposome samples o, l, m, pd, p, and s is shown in table 1 . A well - investigated red - to - blue tta - uc dye couple consisting of palladium tetraphenyltetrabenzoporphyrin (1) and perylene (2, see figure 1) was selected for incorporation in the lipid bilayer of the liposomes . Samples containing these dyes, i.e., o12, l12, m12, pd12, p12, and s12 (defined in table 1), were prepared following an identical procedure . The hydrodynamic diameters (z - ave = 137 6 nm) and polydispersity indices (pdi = 0.09 0.02), as measured by dynamic light scattering (dls), were found to be very similar regardless of the lipid type or dye concentration . Chemical structures of dopc, dlpc, dmpc, dpdpc, dppc, dspc, dspe - mpeg-2000, palladium tetraphenyltetrabenzoporphyrin (1), and perylene (2). Dsc measurements were performed with a scanning rate of 1 c min at 3 atm pressure . All liposomes were prepared with 5.0 mm lipid and 0.20 mm dspe - mpeg-2000 in pbs (without sulfite). Compound 2 was incorporated at 0.5 mol% with respect to the phospholipid; higher dye contents could not be reproducibly obtained with our liposome preparation method . Tm is defined as the main transition temperature of the bilayer, and h as the molar enthalpy change of the phase transition (the enthalpy change of the pretransition is included, in case there is one). It is well - known that phase changes of phospholipid membranes greatly influence the two - dimensional translational molecular diffusion coefficient (dt in m s) of membrane solutes . Therefore, the gel - to - liquid phase transition temperature (tm) and the total enthalpy change of the phase transition (h) were measured for samples based on dmpc, dpdpc, dppc, and dspc using differential scanning calorimetry (dsc, see table 1, figure 2b, and figure s3). Tm and h for dye - free pegylated liposomes m, pd, p, and s were found to be very close to literature values for peg - free liposomes, i.e., the peg groups did not significantly influence the phase transition at these concentrations . Upon functionalization of the pegylated liposomes with compounds 1 and 2, a small decrease in the main transition peak height was observed, but the main features of the thermogram remained . These results indicate that for liposome samples m12, pd12, p12, and s12 compounds 1 and 2 were indeed buried in the lipid bilayer, and that their presence only minimally perturbed the physical properties of the membranes . No transitions were found between 5 and 50 c for samples o, o12, l, and l12, because tm for pure dopc and dlpc are reported to be below the freezing point of water . (a) typical absorption (solid, left axis) and emission spectrum (dashed, right axis, exc = 630 nm, intensity 80 mw cm) of l12 liposomes ([dlpc] = 1.0 mm, = 0.5 m, = 5 m) at 20 c in 0.3 m sodium sulfite pbs under air . (b) differential scanning calorimetry thermograms between 5 and 50 c of liposomes with tta - uc dyes (o12, l12, m12, pd12, p12, and s12, solid) or without (o, l, m, pd, p, and s, dashed). The thermograms for liposomes s and s12 were recorded between 35 and 65 c (figure s3). Measurements were performed in heating mode with a scanning rate of 1 c min at 3 atm pressure . (c, d) temperature evolution of the upconversion quantum yield (uc, c) and of the residual sensitizer phosphorescence quantum yield (p, d) of o12, l12, m12, pd12, p12, and s12 . Samples were heated from 5 to 50 c at a rate of 1 c min while continuously irradiated with 80 mw cm 630 nm light, at 1.0 mm lipid and = 0.5 m and = 5 m . Next, uv vis absorption and emission spectroscopy was performed on samples o12, l12, m12, pd12, p12, and s12 at 20 c in the presence of 0.3 m sodium sulfite (figure 2). In these samples, earlier work showed that despite the large increase in buffer ionic strength, na2so3 does not affect the formation of dopc and dmpc upconverting liposomes and allows stable tta - uc to occur in air . Moreover, preliminary studies indicated that a 1:10 dye ratio (1:2 = 0.05:0.50 mol% with respect to the lipid) resulted in optimized upconversion in m12, while higher dye - loading was severely limited by the solubility of 2 in the membrane . The absorption spectra of these samples showed the superposition of the characteristic bands of 1 at 440 and 630 nm and the vibronically structured band of 2 from 350450 nm . Upon irradiation with 630 nm laser light (10 mw, 80 mw cm), phosphorescence of 1 at 800 nm and upconversion emission of 2 at 474 nm were observed for each sample . The emission stability at 20 c was tested for each formulation by continuously irradiating for 1 h and collecting emission spectra . All samples exhibited good emission stability during this period (figure s4). The absolute quantum yield of upconversion (uc, 420610 nm) and residual sensitizer phosphorescence (p, 725950 nm), defined by the number of emitted photons divided by the number of absorbed photons (supporting information), was determined by means of an integrating sphere setup at room temperature (21.3 c). Uc had values of 3.6%, 2.8%, 2.0%, 0.7%, 0.6%, and 0.3% for o12, l12, m12, pd12, p12, and s12, respectively . Who show that the upconversion intensity of green - to - blue tta - uc in liposomes decreases strongly when going from dopc to dmpc, while no upconversion was observed at all in dspc . Thus, the fact that we observe tta - uc in the long - chained saturated phospholipids (i.e., dpdpc, dppc, dspc) at room temperature is interesting in itself . This may be explained by the longer triplet lifetimes (t) of sensitizer 1 (t = 250 s in dmf) compared to the green - absorbing sensitizer platinum octaethylporphyrin (ptoep, t = 50 s in toluene), which increases the possibility for tta - uc . To investigate the temperature dependency of tta - uc in o12, l12, m12, pd12, p12, and s12, these samples were heated from 5 to 50 c at a rate of 1 c.min while stirring, and upconversion spectra were continuously recorded . The same samples were used as for the quantum yield determination these measurements were conducted within 24 h of each other . Figure 2 shows the evolution of uc and p vs temperature for each liposome formulation . These curves were obtained by recording the intensity of phosphorescence (ip) and upconversion (iuc) vs temperature and scaling these to the measured absolute quantum yields at 21.3 c (vide supra). For o12 and l12, both uc and p gradually decreased with increasing temperature . For m12, pd12, and p12, uc increased up to 25, 33, and 42 c, respectively, and then decreased gradually, whereas p decreased steeply up to 25, 34, and 42 c, respectively, and then continued to decrease, but less steeply . For s12, uc increased and p decreased with increasing temperature . When the samples were brought back from 50 to 5 c, the initial emission spectra at 5 c were obtained again in all cases (figure s5) and the uv vis absorption spectra were identical to those obtained at the beginning of these experiments (figure s6); both findings showing that bleaching did not occur and that the thermophotophysical evolution is reversible . The shape of the observed temperature behavior was nearly identical at 5 lower concentration for m12, showing that the influence of liposome scatter is negligible (figure s7). Also, in a control experiment in which dspe - mpeg-2000 was omitted from sample m12, the shape of the observed temperature behavior was very similar, which indicates that pegylation did not have significant influence on the observed thermophotophysical behavior (figure s8). Interestingly, for m12, pd12, and p12, the temperature values at which uc maximizes and p kinks are very close to the phase transition temperature of the bilayer (tm) recorded with dsc . The increase of uc when approaching tm is easily explained: heating the liposomes below tm greatly increases the membrane fluidity and thus increases the lateral diffusion coefficient (dt) of membrane dyes, which in turn causes an increase in tta - uc efficiency . For instance, the dt for fluorescent probes in dmpc lipid bilayers has been reported to increase from 0.01 m s at 15 c to 6 m it is worth mentioning that for such dmpc bilayers, the foremost change in dt (a three - order increase in magnitude) was found between 20 and 25 c, and so the most considerable transition in tta - uc efficiency was expected to occur in this temperature domain . This is indeed in accordance with our data for m12 . In the absence of accurate literature data of dt in dpdpc and dppc across the full temperature range, we assume that the same explanation holds for the results obtained with pd12 and p12 . However, this rationale is clearly no longer valid above tm: although dt continues to increase (vide supra), uc decreased . Furthermore, for o12 and l12, in absence of a phase transition between 5 and 50 c, uc and p both decrease across the entire temperature range . It is thus clear that other photophysical phenomena must play a role in the temperature dependence of tta - uc in lipid bilayers . Therefore, the thermophotophysical behavior of the isolated dyes was considered in dopc, dmpc, and toluene (figure 3). First, the fluorescence intensity of compound 2 (exc = 420 nm, em = 474 nm) was found to decrease by 10% in both dopc liposomes and toluene when heated from 5 to 50 c . This is most likely explained by a slightly increased thermal deactivation . In dmpc, the fluorescence intensity increased by 25% when heated from 5 to 30 c, with the most sharp increase around 25 c, and then decreased slightly again up to 50 c . In all three systems, no significant spectral fluorescence differences are observed between 5 and 50 c (figure s9). This observation is in agreement with the work of khan et al ., who reported that perylene tends to form staggered nonfluorescent aggregates in the tightly packed gel membrane below tm, which break apart in the more loosely packed liquid - crystalline state above tm . Since the fluorescence intensity is lower in the presence of such aggregates, the tta - uc efficiency is lower below tm . Overall, dissociation of perylene aggregates gives an additional explanation for the increase of upconversion intensity up to tm . Temperature - dependent emission spectroscopy of compounds 2 or 1 in toluene, dmpc liposomes, or dopc liposomes . (a) normalized fluorescence intensity at 474 nm of compound 2 in toluene (dashed, 20 m), m2 liposomes (purple, [dmpc] = 1 mm), or o2 liposomes (black, [dopc] = 1 mm) as a function of temperature . (b) temperature variation of the normalized phosphorescence intensity at 800 nm in 5 c intervals for compound 1 in toluene under argon (open circles) and for liposomes o1 (black triangles, [dopc] = 1 mm) or m1 (purple squares, [dmpc] = 1 mm) prepared in pbs with 0.3 m sodium sulfite . Second, the phosphorescence intensity of 1 (exc = 630 nm, em = 800 nm) was investigated under deoxygenated conditions . In toluene solution, roughly 50% of the phosphorescence intensity is lost upon going from 5 to 50 c due to increased thermal deactivation . When the dye was inserted into dopc or dmpc liposomes (o1 and m1, respectively) about 70% phosphorescence intensity was lost upon going from 5 to 50 c; the additional 20% loss of phosphorescence intensity with respect to the toluene sample may be due to increased dynamic self - quenching, because the molecules are much more confined in the lipid bilayer . The explanation of self - quenching is supported by the fact that, for m1, the highest loss of phosphorescence is observed around the transition temperature, at which the fluidity of the membrane increases most rapidly and diffusion - based processes such as self - quenching are expected to have an increased effect . Overall, these results explain that the decrease of tta - uc with rising temperature is most likely due to increased thermal deactivation and self - quenching of 1 . Based on these data, we explain the typical maximization of uc around tm in lipid bilayers that have a transition temperature between 5 and 50 c as follows . On one hand, the increase in photosensitizer quenching as a function of temperature is rather linear (figure 3). On the other hand, the temperature dependence of dt has been described in the literature as sigmoidal, with three orders of magnitude increase when approaching tm, and flattening directly after tm . In other words, upon approaching tm the membrane becomes fluid rather quickly, but once it reaches the liquid crystalline state the fluidity changes negligibly . Therefore, above tm the effect of the only minor increase in lateral diffusion coefficient on the upconversion efficiency is completely outcompeted by the increased quenching of the photosensitizer . Furthermore, the dissociation of annihilator aggregates results in a rather abrupt and significant increase in fluorescence around tm as well (figure 3a). It is thus concluded that the combination of these three temperature - dependent phenomena results in the maxima that were observed in the uc versus temperature curve at 25, 33, and 42 c for samples m12, pd12, and p12, respectively (figure 2c). Finally, for the biological application of these upconverting liposomes in bioimaging or phototherapy, it would be beneficial to achieve the highest upconversion intensity at human body temperature (37 c). From our results, it is evident that the systems o12, l12, and m12 achieve similar upconversion quantum yields at 37 c, while pd12, p12, and s12 exhibit lower quantum yields . Altogether, the results suggest that even though uc maximizes around tm (for m12, pd12, and p12), choosing a lipid with a tm near 37 c does not result in an optimized upconverting liposome formulation . Finally, considering that little has been reported about the biocompatibility of dlpc, we conclude that o12 and m12 upconverting liposomes are the most promising for biological applications . The temperature dependence of red - to - blue tta - uc was studied in pegylated liposomes with pc lipids with different lipophilic chain lengths and transition temperatures, and it was found that the upconversion efficiency maximizes around the order disorder transition temperature of the membrane, tm . Three major effects contribute to this temperature dependency: (1) an increase in lipid bilayer fluidity above tm results in higher diffusion rates and thus in higher rates of ttet and tta and higher upconverted intensity; (2) perylene aggregates dissociate when t approaches tm, which results in higher annihilator emission intensity; and (3) higher thermal deactivation and self - quenching rates of the photosensitizer at higher temperatures lead to a lower ttet rate and lower upconversion intensity beyond tm . Measuring the point at which iuc maximizes may be exploited for probing the transition temperature of phospholipid membranes . Furthermore, for tta - uc applications that require high performance at elevated temperatures, the results underline the importance of selecting photosensitizers that are minimally affected by temperature . Finally, the upconverted intensity in dopc, dlpc, and dmpc liposomes were very similar at 37 c, which highlights that not being at the optimum temperature for a given lipid composition does not necessarily mean that the upconverted intensity is lower than when being at the optimum temperature for another lipid composition . Overall, tta - uc in liposomes can be realized with many different lipids of different tm, and for both saturated and unsaturated lipids . For applications in bioimaging and phototherapy, the phospholipid can be rather freely chosen among dlpc, dmpc, and dopc, while dppc, dpdpc, and dspc lead to slightly lower upconverted intensities . Such versatility allows for further optimizing the liposomal formulation in terms of other properties such as stability to medium, biocompatibility, toxicity, clearance from the bloodstream, and/or surface functionalization.

Ccug 11284 is a wild - type strain that was originally isolated from bovine feces . Before each experiment, bacteria were grown on conventional blood agar plates (columbia agar ii containing 8% vol / vol whole horse blood) at 42c for 20 h in a microaerobic environment, using a campygen gas generating system (cn0025a; oxoid ltd ., basingstoke, uk) and a bbl gaspak system (bd, franklin lakes, nj). Bacterial cells were harvested and diluted in a peptone - yeast extract - glucose (pyg) medium and used as stock solution for all treatments . The stock solution was striven to obtain a concentration of approximately 10 cfu / ml, as were detected by plate counting . A. polyphaga stock cultures were maintained in pyg medium at 27c in 75 cm culture flasks (sarstedt, nrnbrecht, germany), as described by axelsson - olsson et al ., a. polyphaga were seeded into 12-well culture plates (fischer scientific gtf ab, switzerland) in pyg medium (1 ml / well) and incubated at 27c for 24 h, until the trophozoites formed confluent layers at the bottom of the wells . Commercially available milk with a ph of 6.4 (protein 3.4 g, sugar 5 g, fat 1.5 g, ca 120 mg, vitamin a 25 g, vitamin d 0.38 g) and orange juice with a ph of 3.9 (protein 0.7 g, sugar 18 g, fat <0.5 g, na 0.003 g, vitamin c 30 mg) were used for all experiments . Basingstoke, uk) was added to the products to inhibit growth of other bacteria than c. jejuni . To mimic the conditions of storage in the fridge or at the bench, experiments were incubated at room temperature and 4c . To test whether the presence of amoeba in two different beverage products, milk and orange juice, influenced the survival of c. jejuni, the following three treatments were used: c. jejuni preincubated with a. polyphaga before the addition of product (treatment a), c. jejuni mixed with a. polyphaga after the addition of product (treatment b), and c. jejuni in product without a. polyphaga (treatment c). For treatment a, 12-well plates with confluent a. polyphaga layers in pyg medium were inoculated with 100 l of the c. jejuni stock solution, generating a concentration of 10 cfu / ml and a multiplicity of infection (moi) of one bacteria per amoeba, in each well . Before inoculation with c. jejuni, the medium in all wells were gently removed and replaced with 1 ml fresh pyg medium . The plates were incubated for 3 h at 32c to allow the bacterial cells to attach to and invade amoebae, and thereafter the pyg medium was gently removed and replaced by 2 ml of product . Plates with confluent a. polyphaga were prepared by gently removing the pyg medium and replacing it with 2 ml of product . For the control treatment (treatment c), plates without amoebae after the addition of product, the plates for treatment b and c were inoculated with 100 l of the c. jejuni stock solution generating a concentration of 510 cfu / ml and an moi of one bacteria per amoeba in treatment b, in each well . Three plates (treatments a c) were incubated at room temperature and at 4c, respectively . All plates were incubated in an aerobic environment and each treatment was done in triplicate wells, resulting in three similar wells for each temperature, treatment and product . From each well, a 100-l sample was taken at time zero (the addition of product) and at 3, 6, 18, 24, and 48 h. all samples were 10-fold serially diluted in pyg medium and spread on blood agar plates for colony counting . Three independent experiments were performed on separate occasions . To make sure that the ph level was not affected, the ph level of the fluid in each well was measured after 48 h, when experiments were completed . Compared to initial ph (milk: 6.41 and juice: 3.89) only a small increase in ph was observed (milk: 0.4 and juice: 0.1). For pasteurization experiments, the same settings were used, as described above for treatments a, b, and c. directly after the addition of product, samples of 100 l were taken from the different treatments, a, b, and c and added to tubes containing 500 l of milk or juice . The tubes were gently shaken at 1,400 rpm (ms2 minishaker ika, germany) and then incubated in a water bath (heto dt hetotherm, denmark). Incubation conditions for milk tubes were 7274c for 15 sec (equivalent to swedish low pasteurization guidelines). Incubation conditions for juice tubes were 85c for 15 sec (equivalent to swedish pasteurization guidelines). After heating, the sample tubes were put on ice and 100-l samples were spread on blood agar for colony counting . All experiments were done in triplicates, resulting in three similar wells for each treatment and product . For each well and each time point, a measure of c. jejuni cell survival was calculated by dividing the bacterial concentration of the sample (estimated from colony counts) by the bacterial concentration of that well at time 0 h (the addition of product). The c. jejuni strain ccug 11284 and the a. polyphaga strain (linc ap-1) were used in all experiments . Ccug 11284 is a wild - type strain that was originally isolated from bovine feces . Before each experiment, bacteria were grown on conventional blood agar plates (columbia agar ii containing 8% vol / vol whole horse blood) at 42c for 20 h in a microaerobic environment, using a campygen gas generating system (cn0025a; oxoid ltd ., basingstoke, uk) and a bbl gaspak system (bd, franklin lakes, nj). Bacterial cells were harvested and diluted in a peptone - yeast extract - glucose (pyg) medium and used as stock solution for all treatments . The stock solution was striven to obtain a concentration of approximately 10 cfu / ml, as were detected by plate counting . A. polyphaga stock cultures were maintained in pyg medium at 27c in 75 cm culture flasks (sarstedt, nrnbrecht, germany), as described by axelsson - olsson et al ., a. polyphaga were seeded into 12-well culture plates (fischer scientific gtf ab, switzerland) in pyg medium (1 ml / well) and incubated at 27c for 24 h, until the trophozoites formed confluent layers at the bottom of the wells . Commercially available milk with a ph of 6.4 (protein 3.4 g, sugar 5 g, fat 1.5 g, ca 120 mg, vitamin a 25 g, vitamin d 0.38 g) and orange juice with a ph of 3.9 (protein 0.7 g, sugar 18 g, fat <0.5 g, na 0.003 g, vitamin c 30 mg) were used for all experiments . Basingstoke, uk) was added to the products to inhibit growth of other bacteria than c. jejuni . To mimic the conditions of storage in the fridge or at the bench, experiments were incubated at room temperature and 4c . To test whether the presence of amoeba in two different beverage products, milk and orange juice, influenced the survival of c. jejuni, the following three treatments were used: c. jejuni preincubated with a. polyphaga before the addition of product (treatment a), c. jejuni mixed with a. polyphaga after the addition of product (treatment b), and c. jejuni in product without a. polyphaga (treatment c). For treatment a, 12-well plates with confluent a. polyphaga layers in pyg medium were inoculated with 100 l of the c. jejuni stock solution, generating a concentration of 10 cfu / ml and a multiplicity of infection (moi) of one bacteria per amoeba, in each well . Before inoculation with c. jejuni, the medium in all wells were gently removed and replaced with 1 ml fresh pyg medium . The plates were incubated for 3 h at 32c to allow the bacterial cells to attach to and invade amoebae, and thereafter the pyg medium was gently removed and replaced by 2 ml of product . Plates with confluent a. polyphaga were prepared by gently removing the pyg medium and replacing it with 2 ml of product . For the control treatment (treatment c), plates without amoebae after the addition of product, the plates for treatment b and c were inoculated with 100 l of the c. jejuni stock solution generating a concentration of 510 cfu / ml and an moi of one bacteria per amoeba in treatment b, in each well . Three plates (treatments a c) were incubated at room temperature and at 4c, respectively . All plates were incubated in an aerobic environment and each treatment was done in triplicate wells, resulting in three similar wells for each temperature, treatment and product . From each well, a 100-l sample was taken at time zero (the addition of product) and at 3, 6, 18, 24, and 48 h. all samples were 10-fold serially diluted in pyg medium and spread on blood agar plates for colony counting . Three independent experiments were performed on separate occasions . To make sure that the ph level was not affected, the ph level of the fluid in each well was measured after 48 h, when experiments were completed . Compared to initial ph (milk: 6.41 and juice: 3.89) only a small increase in ph was observed (milk: 0.4 and juice: 0.1). For pasteurization experiments, the same settings were used, as described above for treatments a, b, and c. directly after the addition of product, samples of 100 l were taken from the different treatments, a, b, and c and added to tubes containing 500 l of milk or juice . The tubes were gently shaken at 1,400 rpm (ms2 minishaker ika, germany) and then incubated in a water bath (heto dt hetotherm, denmark). Incubation conditions for milk tubes were 7274c for 15 sec (equivalent to swedish low pasteurization guidelines). Incubation conditions for juice tubes were 85c for 15 sec (equivalent to swedish pasteurization guidelines). After heating, the sample tubes were put on ice and 100-l samples were spread on blood agar for colony counting . All experiments were done in triplicates, resulting in three similar wells for each treatment and product . For each well and each time point, a measure of c. jejuni cell survival was calculated by dividing the bacterial concentration of the sample (estimated from colony counts) by the bacterial concentration of that well at time 0 h (the addition of product). The experimental setup included three different treatments (a, b, and c); see materials and methods section . In milk, the highest c. jejuni survival was seen in treatment a, where bacteria were pre - incubated with amoebae before addition of milk (2.8%, 18 h; 3.8%, 24 h; 0.8%, 48 h; table 1; fig . Treatment b showed 0.05% survival at 18 h and reached a fraction of 6.710of the inoculum at 48 h (equivalent to 14 cfu / ml; table 1). After 3 h, the survival of c. jejuni without amoebae (treatment c) decreased more rapidly compared to co - cultures (treatments a and b), and the fraction of the inoculum surviving after 18 h was only 3.510 (equivalent to 6 cfu / ml; table 1). No bacteria could be detected after 24 h. at 1848 h, treatment a had significantly higher bacterial survival than treatment c (kruskal wallis test with dunn's multiple comparison test and bonferroni correction for multiple tests; 18 h, p=0.0003; 24 h, p<0.0001; 48 h, p=0.0007; fig . . Survival of c. jejuni co - incubated with a. polyphaga in milk (a) or orange juice (b) at room temperature after 0 h, 3 h, 6 h, 24 h, and 48 h. data are based on three independent experiments with c. jejuni treated in three different ways treatment a (dots), c. jejuni preincubated with a. polyphaga before the addition of product; treatment b (squares), c. jejuni inoculated to a. polyphaga after the addition of product; and treatment c (triangles), c. jejuni in product without a. polyphaga . To use the log10 scale, a constant meanssem (missing data points: one out of nine replicates for: milk treatment b at 0 h, milk treatment a at 3 h and juice treatment b at 3 h). Mean fraction of the c. jejuni inoculum surviving after 18 h, 24 h, and 48 h for treatments a, b, and c when incubated in milk and juice at room temperature (rt) and at 4c c. jejuni incubated in juice showed similar trends as in milk albeit with more pronounced differences between co - cultures and bacteria incubated alone . The highest c. jejuni survival was seen in treatment a (88.4%, 18 h; 36.9%, 24 h; 0%, 48 h; table 1; fig . 1b) and the lowest survival was found in treatment c, c. jejuni without amoebae . After 3 h, the survival of c. jejuni incubated without amoebae decreased rapidly compared to co - cultures (treatments a and b) and no viable bacteria could be detected after 18 h (table 1, fig . 1b). The relative survival of c. jejuni in treatment b (4.1%, 18 h; 2.0%, 24 h; 0.02%, 48 h; table 1) was lower than in treatment a but higher than in c. however, due to the higher start concentration in treatment b, compared to treatment a, the bacterial concentration in the juice was still 45 cfu / ml at 48 h. statistically significant differences in survival were seen between: a and b (kruskal wallis test with dunn's multiple comparison test and bonferroni correction for multiple tests: 18 h, p=0.0428; 24 h, p=0.0428; 48 h, p=0.0029; a and c: 18 h, p<0.0001; 24 h, p<0.0001; b and c: 18 h, p=0.0428; 24 h, p=0.0428; 48 h, p=0.0029; fig . 1b; table 1). At 4c, c. jejuni generally survived better in both milk and juice and the differences were less pronounced between co - cultures and bacteria incubated alone . In milk, the highest c. jejuni survival was seen in treatment a for time point up to 24 h (90.3%, 18 h; 34.3%, 24 h; table 1; fig . At these time points, treatment c (24.1%, 18 h; 20.1%, 24 h; table 1) gave a higher survival than treatment b (19.2%, 18 h; 18.2%, 24 h; table 1). At 48 h, the highest c. jejuni survival was seen in treatment c (3.3% table 1), and the survival in treatments a and b were 0.4 and 0.6%, respectively (table 1). Statistically significant differences in survival were seen at 18 h between: a and b as well as a and c (kruskal wallis test with dunn's multiple comparison test and bonferroni correction for multiple tests: a and b:18 h, p=0.001; a and c: 18 h, p=0.0045; fig . Survival of c. jejuni co - incubated with a. polyphaga in milk (a) or orange juice (b) at 4c after 0 h, 3 h, 6 h, 24 h, and 48 h. data are based on three independent experiments with c. jejuni treated in three different ways treatment a (dots), c. jejuni preincubated with a. polyphaga before the addition of product; treatment b (squares), c. jejuni inoculated to a. polyphaga after the addition of product; and treatment c (triangles), c. jejuni in product without a. polyphaga . To use the log10 scale, a constant 1 had to be added to all cfu values to manage zeros . Meanssem (missing data points: one out of nine replicates for juice treatment c at 18 h). When c. jejuni were incubated in juice at 4c, the differences seen between co - cultures (treatments a and b) and c. jejuni incubated without amoebae (treatment c), were similar to those seen in juice at room temperature, although the bacteria in treatment c survived longer compared to incubation at room temperature . The highest c. jejuni survival was seen in treatment a: 90.6%, 18 h; 56.7%, 24 h; 0.35%, 48 h; table 1) and the lowest survival was found in treatment c: 3.3%, 18 h; 2.0%, 24 h; 0.00074%; 1 cfu / ml; 48 h; table 1). The survival of c. jejuni in treatment b: 7.4%, 18 h; 3.4%, 24 h; 0.01%, equivalent to 18 cfu / ml; 48 h, table 1) was lower than a but higher than c. statistically significant differences in survival were seen at 1824 h between a and b, and 1848 h between a and c (kruskal wallis test with dunn's multiple comparison test and bonferroni correction for multiple tests; a and b: 18 h, p=0.0125; 24 h, p=0.005; a and c: 18 h, p=0.0001; 24 h, p=0.0002; 48 h, p=0.0489; fig . A. polyphaga did not show any protective effect on c. jejuni when heated to recommended pasteurization temperatures, neither in milk nor in orange juice (data not shown). Growth was totally inhibited in all samples from treatments a, b, and c. results were based on three independent experiments . The experimental setup included three different treatments (a, b, and c); see materials and methods section . In milk, the highest c. jejuni survival was seen in treatment a, where bacteria were pre - incubated with amoebae before addition of milk (2.8%, 18 h; 3.8%, 24 h; 0.8%, 48 h; table 1; fig . Treatment b showed 0.05% survival at 18 h and reached a fraction of 6.710of the inoculum at 48 h (equivalent to 14 cfu / ml; table 1). After 3 h, the survival of c. jejuni without amoebae (treatment c) decreased more rapidly compared to co - cultures (treatments a and b), and the fraction of the inoculum surviving after 18 h was only 3.510 (equivalent to 6 cfu / ml; table 1). No bacteria could be detected after 24 h. at 1848 h, treatment a had significantly higher bacterial survival than treatment c (kruskal wallis test with dunn's multiple comparison test and bonferroni correction for multiple tests; 18 h, p=0.0003; 24 h, p<0.0001; 48 h, p=0.0007; fig . . Survival of c. jejuni co - incubated with a. polyphaga in milk (a) or orange juice (b) at room temperature after 0 h, 3 h, 6 h, 24 h, and 48 h. data are based on three independent experiments with c. jejuni treated in three different ways treatment a (dots), c. jejuni preincubated with a. polyphaga before the addition of product; treatment b (squares), c. jejuni inoculated to a. polyphaga after the addition of product; and treatment c (triangles), c. jejuni in product without a. polyphaga . To use the log10 scale, a constant meanssem (missing data points: one out of nine replicates for: milk treatment b at 0 h, milk treatment a at 3 h and juice treatment b at 3 h). Mean fraction of the c. jejuni inoculum surviving after 18 h, 24 h, and 48 h for treatments a, b, and c when incubated in milk and juice at room temperature (rt) and at 4c c. jejuni incubated in juice showed similar trends as in milk albeit with more pronounced differences between co - cultures and bacteria incubated alone . The highest c. jejuni survival was seen in treatment a (88.4%, 18 h; 36.9%, 24 h; 0%, 48 h; table 1; fig . 1b) and the lowest survival was found in treatment c, c. jejuni without amoebae . After 3 h, the survival of c. jejuni incubated without amoebae decreased rapidly compared to co - cultures (treatments a and b) and no viable bacteria could be detected after 18 h (table 1, fig . 1b). The relative survival of c. jejuni in treatment b (4.1%, 18 h; 2.0%, 24 h; 0.02%, 48 h; table 1) was lower than in treatment a but higher than in c. however, due to the higher start concentration in treatment b, compared to treatment a, the bacterial concentration in the juice was still 45 cfu / ml at 48 h. statistically significant differences in survival were seen between: a and b (kruskal wallis test with dunn's multiple comparison test and bonferroni correction for multiple tests: 18 h, p=0.0428; 24 h, p=0.0428; 48 h, p=0.0029; a and c: 18 h, p<0.0001; 24 h, p<0.0001; b and c: 18 h, p=0.0428; 24 h, p=0.0428; 48 h, p=0.0029; fig . 1b; table 1). At 4c, c. jejuni generally survived better in both milk and juice and the differences were less pronounced between co - cultures and bacteria incubated alone . In milk, the highest c. jejuni survival was seen in treatment a for time point up to 24 h (90.3%, 18 h; 34.3%, 24 h; table 1; fig . At these time points, treatment c (24.1%, 18 h; 20.1%, 24 h; table 1) gave a higher survival than treatment b (19.2%, 18 h; 18.2%, 24 h; table 1). At 48 h, the highest c. jejuni survival was seen in treatment c (3.3% table 1), and the survival in treatments a and b were 0.4 and 0.6%, respectively (table 1). Statistically significant differences in survival were seen at 18 h between: a and b as well as a and c (kruskal wallis test with dunn's multiple comparison test and bonferroni correction for multiple tests: a and b:18 h, p=0.001; a and c: 18 h, p=0.0045; fig . Survival of c. jejuni co - incubated with a. polyphaga in milk (a) or orange juice (b) at 4c after 0 h, 3 h, 6 h, 24 h, and 48 h. data are based on three independent experiments with c. jejuni treated in three different ways treatment a (dots), c. jejuni preincubated with a. polyphaga before the addition of product; treatment b (squares), c. jejuni inoculated to a. polyphaga after the addition of product; and treatment c (triangles), c. jejuni in product without a. polyphaga . To use the log10 scale, a constant 1 had to be added to all cfu values to manage zeros . Meanssem (missing data points: one out of nine replicates for juice treatment c at 18 h). When c. jejuni were incubated in juice at 4c, the differences seen between co - cultures (treatments a and b) and c. jejuni incubated without amoebae (treatment c), were similar to those seen in juice at room temperature, although the bacteria in treatment c survived longer compared to incubation at room temperature . The highest c. jejuni survival was seen in treatment a: 90.6%, 18 h; 56.7%, 24 h; 0.35%, 48 h; table 1) and the lowest survival was found in treatment c: 3.3%, 18 h; 2.0%, 24 h; 0.00074%; 1 cfu / ml; 48 h; table 1). The survival of c. jejuni in treatment b: 7.4%, 18 h; 3.4%, 24 h; 0.01%, equivalent to 18 cfu / ml; 48 h, table 1) was lower than a but higher than c. statistically significant differences in survival were seen at 1824 h between a and b, and 1848 h between a and c (kruskal wallis test with dunn's multiple comparison test and bonferroni correction for multiple tests; a and b: 18 h, p=0.0125; 24 h, p=0.005; a and c: 18 h, p=0.0001; 24 h, p=0.0002; 48 h, p=0.0489; fig . A. polyphaga did not show any protective effect on c. jejuni when heated to recommended pasteurization temperatures, neither in milk nor in orange juice (data not shown). Growth was totally inhibited in all samples from treatments a, b, and c. results were based on three independent experiments . Campylobacter causes approximately 200,000 human infections annually in the european union, with sometimes very severe chronic complications such as guillain barre syndrome (gbs) (36, 37). In this study, we investigated the protective effect of the free - living amoeba a. polyphaga on c. jejuni survival in milk and orange juice . It is well known that drinking unpasteurized milk is a risk for acquiring c. jejuni infections (38); however, the consumption of unpasteurized milk and milk products (39, 40) as well as unpasteurized juices is common in many countries (12). The acidic ph in orange juice has been considered lethal to c. jejuni (23, 41), and therefore orange juices have not been considered a risk factor for acquiring campylobacteriosis . On the other hand, c. jejuni seem well adapted to survive the acidic milieu of the human stomach as well as disinfection with acid in poultry stables (42, 43). We have previously shown an increased acid tolerance of c. jejuni ccug 11284 in co - cultures with a. polyphaga (26 . Free - living amoebae are common inhabitants of potable water plumbing systems (44, 45) and fruit squeezing machines have surfaces that are difficult to clean, with possible formation of biofilms inhabited by amoebae as a result (32, 3446). Hence, such systems could provide entry ports where the presence of amoeba could increase the c. jejuni survival and cause infections . As differences in bacterial survival were observed in a previous study depending on weather the bacteria were added to a. polyphaga before (treatment a) or after addition of acidified medium (treatment b), we evaluated the effect of these two treatments in juice and milk (26). We found significantly higher bacterial survival in co - cultures compared to when c. jejuni were incubated alone (treatment c). In both products and at both temperatures, the highest survival was found in co - cultures where c. jejuni were added to a. polyphaga before the addition of the product (treatment a). The effect of co - culture was most pronounced in juice stored at room temperature, as no c. jejuni survival was detected after 18 h in cultures with c. jejuni alone . Also milk stored at room temperature and juice stored at 4c showed significantly higher bacterial survival in co - cultures, compared to when c. jejuni were incubated alone . However, in milk stored at 4c the bacterial survival at 24 h was not significantly affected by co - culture with amoebae and at 48 h, c. jejuni incubated alone (treatment c) actually survived better than in co - culture . This is consistent with previous studies reporting good survival of campylobacter in refrigerated milk (41, 47). In our previous study assessing c. jejuni survival in an acidified medium, we found the highest bacterial survival in co - cultures where c. jejuni were added after the addition of acidic media . In that study we found that the acid milieu triggered c. jejuni motility and uptake into the amoebae . However, the products tested here are more complex than a defined bacterial growth medium and other constituent of milk and juice may likely have affected the results . In the majority of cases, this was not studied by us, and hence possible c. jejuni protection from amoebae present in low concentrations needs to be evaluated in the future . High concentrations of amoebae could be present in contaminated water or by growth of amoebae in beverages stored at room temperature for a longer period of time . In all experiments the survival curves for c. jejuni in treatment a were characterized by an increase in bacterial concentration at the beginning of the experiments (3 and 6 h). This increase might be explained by extracellular c. jejuni residing in the adherent trophozoite layer . When the medium was changed from pyg to milk or juice these bacteria together, our results suggest that a. polyphaga can prolong c. jejuni survival both in milk and juice . It has been shown that legionellae increase their thermal resistance when co - cultured with acanthamoebae, and that intracellular legionellae pneumophila can survive temperatures up to 80c (48). Acanthamoebae cysts alone have been shown to survive at temperatures up to 80c and even up to 95c for at least 10 min (4850). We studied if c. jejuni in co - culture with a. polyphaga could survive heating to recommended pasteurization temperatures for milk (7274c) and juice (85c). However, a. polyphaga did not have any effect on c. jejuni survival during pasteurization of milk or orange juice, confirming that this is a good method for eliminating c. jejuni in these products . In conclusion, amoebae associated c. jejuni in milk and juice survived better than free bacteria both at room temperature and at 4c, but a. polyphaga could not protect the bacteria from pasteurization.

Control subjects were consecutive patients seen at the hospital among individuals without diabetes and any retinal or eye pathological conditions . Individuals were excluded from participation if they were aged> 70 years, were of nonwhite ethnic background, had a history of epilepsy or glaucoma, had previous vitreal surgery, and/or had a cataract on examination . All participants and control subjects had a standardized clinical examination, measurement of blood chemistry, retinal photographs, and assessment of flicker - induced vasodilation using the dynamic vessel analyzer (dva; imedos, jena, germany). Tenets of the declaration of helsinki were followed, institutional review board approval was granted, and written informed consent was obtained from all participants . The dva measures retinal vessel dilation in response to diffuse luminance flicker (12). The participant focused on the tip of a fixation bar within the retinal camera while the fundus was examined under green light . An arteriole and venule segment between one - half and two disc diameters from the margin of the optic disc were selected . The mean diameters of the arterial and venous vessel segments were calculated and recorded automatically . Baseline vessel diameter was measured for 50 s, followed by a provocation with flicker light of the same wavelength for 20 s and then a nonflicker period for 80 s. this measurement cycle was repeated twice, with a total duration of 350 s / eye . When the eye blinked or moved, the system automatically stopped the measurement and restarted it once the vessel segments were automatically reidentified . Retinal arteriolar and venular dilation in response to flicker light was calculated automatically by the dva software . It was represented as an average increase in the vessel diameter in response to the flicker light during the three measurement cycles and was defined as the percent increase relative to the baseline diameter size . In addition to quantifying the flicker - induced vasodilation, we assessed overall static arteriolar and venular diameter using a computer - assisted program . Details of the digital image preparation are described elsewhere (15). In brief, diameters of the largest six arterioles and venules passing through the circular zone between one - half and one disc diameter away from the optic disc margin were summarized as the central retinal arteriolar equivalent and central retinal venular equivalent using the parr - hubbard formula further modified by knudtson and colleagues (15). Fasting blood samples were drawn from participants at suburban pathology centers for measurement of fasting blood glucose level within 2 weeks of their eye testing . All participants with diabetes were patients recruited from the diabetic eye clinics and were managed with oral hypoglycemic mediations and/or insulin . Control subjects (individuals without diabetes) had confirmed nondiabetic status based on a lack of history of diabetes and fasting glucose <7.0 mmol / l (126 mg / dl). In participants with diabetes, diabetic retinopathy was graded from fundus photographs at the centre for eye research australia, by graders masked to clinical details . For each eye, a retinopathy severity score was assigned based on modification of the airlie house classification system (16). For our analysis, levels 10, 11, and 12 were defined as no diabetic retinopathy, 14 to 20 as minimal nonproliferative diabetic retinopathy (npdr), 31 and 41 as early to moderate npdr, and 5180 as severe npdr (proliferative diabetic retinopathy). A detailed questionnaire was used to obtain participant information, including past medical history, current cigarette smoking, and the use of antihypertensive and lipid - lowering medications . Hypertension was defined as systolic blood pressure (sbp)> 140 mmhg, diastolic blood pressure (dbp)> 90 mmhg, or current use of antihypertensive medications . Dyslipidemia was defined as cholesterol> 5.5 mmol / l or triglyceride> 2.0 mmol / l or current use of lipid - lowering medications . Fasting blood samples were drawn from participants at suburban pathology centers for fasting blood glucose level, cholesterol and triglyceride levels, and a1c within 2 weeks of their eye testing . Induced retinal vasodilation between individuals with diabetes and control subjects and in individuals with diabetes between those with and without dr . Flicker - induced arteriolar / venular dilation was analyzed as percent increase over baseline diameter, both as a continuous measure and in categories (tertiles). Multiple logistic regression models were constructed using the generalized estimating equation models to account for correlation between the right and left eyes and to assess the odds of diabetes (vs. nondiabetic control subjects) or diabetic retinopathy (vs. no diabetic retinopathy among subjects with diabetes), comparing the lower versus upper tertiles of flicker light in addition, multiple linear regression models were used to estimate the mean difference in arteriolar and venular dilation . We initially adjusted for age, sex, and fasting blood glucose level (model 1) and further adjusted for duration of diabetes (in analysis of diabetic patients), use of antihypertensive and lipid - lowering medications, current smoking status, sbp, and cholesterol and triglyceride levels (model 2). Analyses were performed in stata (version 10.1; statacorp, college station, tx). The dva measures retinal vessel dilation in response to diffuse luminance flicker (12). The participant focused on the tip of a fixation bar within the retinal camera while the fundus was examined under green light . An arteriole and venule segment between one - half and two disc diameters from the margin of the optic disc were selected . The mean diameters of the arterial and venous vessel segments were calculated and recorded automatically . Baseline vessel diameter was measured for 50 s, followed by a provocation with flicker light of the same wavelength for 20 s and then a nonflicker period for 80 s. this measurement cycle was repeated twice, with a total duration of 350 s / eye . When the eye blinked or moved, the system automatically stopped the measurement and restarted it once the vessel segments were automatically reidentified . Retinal arteriolar and venular dilation in response to flicker light was calculated automatically by the dva software . It was represented as an average increase in the vessel diameter in response to the flicker light during the three measurement cycles and was defined as the percent increase relative to the baseline diameter size . In addition to quantifying the flicker - induced vasodilation, we assessed overall static arteriolar and venular diameter using a computer - assisted program . Details of the digital image preparation are described elsewhere (15). In brief, diameters of the largest six arterioles and venules passing through the circular zone between one - half and one disc diameter away from the optic disc margin were summarized as the central retinal arteriolar equivalent and central retinal venular equivalent using the parr - hubbard formula further modified by knudtson and colleagues (15). Fasting blood samples were drawn from participants at suburban pathology centers for measurement of fasting blood glucose level within 2 weeks of their eye testing . All participants with diabetes were patients recruited from the diabetic eye clinics and were managed with oral hypoglycemic mediations and/or insulin . Control subjects (individuals without diabetes) had confirmed nondiabetic status based on a lack of history of diabetes and fasting glucose <7.0 mmol / l (126 mg / dl). In participants with diabetes, diabetic retinopathy was graded from fundus photographs at the centre for eye research australia, by graders masked to clinical details . For each eye, a retinopathy severity score was assigned based on modification of the airlie house classification system (16). For our analysis, levels 10, 11, and 12 were defined as no diabetic retinopathy, 14 to 20 as minimal nonproliferative diabetic retinopathy (npdr), 31 and 41 as early to moderate npdr, and 5180 as severe npdr (proliferative diabetic retinopathy). A detailed questionnaire was used to obtain participant information, including past medical history, current cigarette smoking, and the use of antihypertensive and lipid - lowering medications . Hypertension was defined as systolic blood pressure (sbp)> 140 mmhg, diastolic blood pressure (dbp)> 90 mmhg, or current use of antihypertensive medications . Dyslipidemia was defined as cholesterol> 5.5 mmol / l or triglyceride> 2.0 mmol / l or current use of lipid - lowering medications . Fasting blood samples were drawn from participants at suburban pathology centers for fasting blood glucose level, cholesterol and triglyceride levels, and a1c within 2 weeks of their eye testing . We compared flicker light induced retinal vasodilation between individuals with diabetes and control subjects and in individuals with diabetes between those with and without dr . Flicker - induced arteriolar / venular dilation was analyzed as percent increase over baseline diameter, both as a continuous measure and in categories (tertiles). Multiple logistic regression models were constructed using the generalized estimating equation models to account for correlation between the right and left eyes and to assess the odds of diabetes (vs. nondiabetic control subjects) or diabetic retinopathy (vs. no diabetic retinopathy among subjects with diabetes), comparing the lower versus upper tertiles of flicker light in addition, multiple linear regression models were used to estimate the mean difference in arteriolar and venular dilation . We initially adjusted for age, sex, and fasting blood glucose level (model 1) and further adjusted for duration of diabetes (in analysis of diabetic patients), use of antihypertensive and lipid - lowering medications, current smoking status, sbp, and cholesterol and triglyceride levels (model 2). Analyses were performed in stata (version 10.1; statacorp, college station, tx). Selected characteristics of normal control subjects (n = 103), participants with diabetes (n = 224, 85 with type 1 and 139 with type 2 diabetes), and those with (n = 144) and without (n = 80) diabetic retinopathy are shown in table 1 . Mean age was 56.5 11.8 years in subjects with diabetes and 48.0 16.3 years in control subjects . The proportion of men was similar for participants with diabetes (41.6%) and control subjects (39.4%). Compared with nondiabetic control subjects, participants with diabetes were less likely to be current smokers but had higher bmi and were more likely to have hypertension, dyslipidemia, lower dbp, and lower total cholesterol levels . Compared with those with type 1 diabetes, individuals with type 2 diabetes were older, had greater bmi, but a shorter duration of diabetes, and were more likely to have hypertension and dyslipidemia (data not shown). In participants with diabetes, those with diabetic retinopathy had a longer duration of diabetes, had higher sbp, and were more likely to have hypertension . In addition, participants with diabetes had wider static arteriolar diameter than nondiabetic control subjects, whereas those with diabetic retinopathy had wider retinal venules than those without (table 1). Participant characteristics (age - adjusted means and proportions) comparing participants with diabetes and normal control subjects, and, among participants with diabetes, those with and without diabetic retinopathy data are means unless stated otherwise . Means and proportions are adjusted for age (set to mean age of 53.8 years old), except for age . * comparing those with diabetic subjects and normal control subjects, adjusted for age . Comparing those with and without diabetic retinopathy in those with diabetes, adjusted for age . Induced retinal vasodilation was reduced in participants with diabetes compared with that in control subjects (table 2). Induced arteriolar dilation was 1.43 2.10% in participants with diabetes and 3.46 2.36% in normal control subjects (p <0.001 after adjustment for age, sex, fasting glucose, cholesterol and triglyceride levels, use of antihypertensive and lipid - lowering medications, and current smoking status). Retinal arteriolar dilation was not significantly different by type of diabetes: 1.57% in those with type 1 and 1.24% in those with type 2 diabetes (p = 0.98). Induced venular dilation was 2.83 2.10% in individuals with diabetes and 3.98 1.84% in normal control subjects (p <0.001 after multivariable adjustment) and again was not significantly different by type of diabetes: 2.84% in those with type 1 and 2.83% in those with type 2 diabetes (p = 0.99). Mean differences in flicker light induced vasodilation between participants with diabetes and normal control subjects and by grades of diabetic retinopathy severity in participants with diabetes * adjustment for age, sex, fasting cholesterol and triglyceride levels, use of antihypertensive and lipid - lowering medications, current smoking status, and fasting glucose (for analysis of diabetic retinopathy severity). Table 3 shows that after multivariable adjustment, individuals with reduced flicker light induced vasodilation were more likely to have diabetes (odds ratios [ors] 19.7 and 8.1, comparing the lowest versus the highest tertile of arteriolar and venular dilation, respectively). Among participants with diabetes, those with reduced flicker induced dilation were more likely to have diabetic retinopathy (ors 2.2 and 2.5, respectively, for arteriolar and venular dilation) (table 4). These associations persisted after further adjustment for static arteriolar / venular diameters (tables 3 and 4, model 3). Associations between reduced flicker - induced arteriolar and venular dilation and diabetes data are ors (95% ci) unless indicated otherwise . Model 2: adjusted for covariates in model 1 plus diabetes duration, use of antihypertensive and lipid - lowering medications, current smoking status, sbp, and fasting cholesterol and triglyceride levels . Model 3: adjusted for covariates in model 2 plus static retinal arteriolar or venular diameter . Associations between reduced flicker - induced arteriolar and venular dilation and diabetic retinopathy data are ors (95% ci) unless indicated otherwise . Model 2: adjusted for covariates in model 1 plus diabetes duration, use of antihypertensive and lipid - lowering medications, current smoking status, sbp, and fasting cholesterol and triglyceride levels . Model 3: adjusted for covariates in model 2 plus static retinal arteriolar or venular diameter . * the distribution of diabetic retinopathy severity was not significantly different between those with type 1 and type 2 diabetes (p = 0.57, data not shown). However, the association of reduced flicker light induced vasodilation with diabetic retinopathy was stronger in participants with type 1 diabetes (arteriolar dilation or 3.1 [95% ci 1.18.5]; venular dilation or 3.8 [95% ci 1.410.0]) compared with those with type 2 diabetes (arteriolar dilation or 1.8 [95% ci 0.84.0]; venular dilation or 1.3 [95% ci 0.63.1]), although the interaction with type of diabetes was not statistically significant (p value for interaction term: p = 0.50 for arteriolar dilation and p = 0.09 for venular dilation). In this study, we demonstrated a reduction in flicker light induced retinal arteriolar and venular dilation in individuals with diabetes compared with nondiabetic control subjects and, among individuals with diabetes, in those with retinopathy signs . Importantly, we showed that these associations were independent of major risk factors for either diabetes or diabetic retinopathy and independent of static measurements of retinal arterioles and venular diameters . (17) examined 26 healthy control subjects and 26 individuals with type 1 diabetes who had none or minimal npdr and were not receiving antihypertensive treatment, whereas mandecka et al . (14) examined 240 individuals with diabetes (68 with type 1 and 172 with type 2 diabetes) and 58 control subjects . Both showed reduced flicker light vasodilation in those with diabetes (compared with those without diabetes). Furthermore, mandecka et al . Also demonstrated a reduction in flicker light vasodilation with increasing diabetic retinopathy severity, while controlling only for age, sex, and use of antihypertensive medications . We have now shown that the relationship of flicker light induced vasodilation and both diabetes and diabetic retinopathy are independent of major confounders and risk factors for diabetic retinopathy, including duration of diabetes and glycemic control . Retinal neuronal stimulation by flicker light results in retinal vessel dilation . This response probably reflects endothelial function (14), given the documented role of nitric oxide in this flickering light induced vasodilation (13,18,19). In a study by dorner et al . (13), n - monomethyl - l - arginine, an inhibitor of nitric oxide synthase, blunted this flicker - induced vasodilation in healthy individuals . In addition, impaired response to flicker light stimulation in individuals with hypertension could be restored by angiotensin ii subtype 1 receptor blockade (20). However, this finding has been documented only in individuals without diabetes . It was hypothesized previously that the decreased endothelial dysfunction in subjects with diabetes is associated with impaired nitric oxide action because of its inactivation resulting from increased oxidative stress and that abnormal nitric oxide metabolism is related to advanced diabetic microvascular complications (21). This hypothesis is supported by recent data demonstrating similar retinal arteriolar and venular dilation after a single sublingual dose of 0.8 mg nitroglycerin between 20 patients with insulin - treated diabetes with no or only mild npdr and 20 healthy age - matched control subjects (22). However, it is becoming increasingly clear that neuronal cells of the retina are also affected by diabetes, resulting in dysfunction and degeneration (23), and diabetic retinopathy is a disease of both retinal neurons and microcirculation (24). Because retinal blood flow is coupled with neuronal activity (25), reduced flicker light induced vasodilation can thus also reflect neurodegeneration (17,24). In our study, significantly reduced flicker light induced vasodilation was observed in diabetic subjects with diabetic retinopathy compared with those without diabetic retinopathy . This relationship appeared to be stronger among individuals with type 1 diabetes than among those with type 2 diabetes, given the similar distribution of diabetic retinopathy severity between the two groups . This observation could be due to longer diabetes duration in those with type 1 diabetes (mean 22.1 years for type 2 diabetes vs. 12.6 years for type 2 diabetes), resulting in possibly a greater level of impairment of retinal vascular autoregulation (26), endothelial damage (26), or neurodegeneration (17,24). Alternatively, the underlying mechanisms of diabetic retinopathy may be different in type 1 and type 2 diabetes . The strengths of this study include quantitative measures of retinal vasodilation after flicker light stimulation, assessment of diabetic retinopathy from fundus photographs using standardized grading protocols, and one researcher (t.t.n .) Performing all dva measurements . Limitations of this study should also be noted . First, the cross - sectional nature of the study provides no temporal information on the associations reported . Second, our findings are only applicable to individuals with diabetes who are aged 70 years . Thus, further longitudinal studies are needed to ascertain cause and effect and to correlate flicker - induced vasodilation with retinal neuronal functions using tests such as electroretinography . In summary induced retinal vasodilation in individuals with diabetes and, among those with diabetes, in those with retinopathy signs . These findings further support the concept that early endothelial dysfunction is a likely key pathophysiological mechanism that underlies diabetes and its microvascular complications.

De lamorce dune antirtrovirothrapie prophylactique associative (arpa) contenant du raltgravir (ral) sur la charge virale (cv) du vih chez les femmes enceintes do nt la suppression de la cv est leve ou sous - optimale en fin de grossesse . Les chercheurs ont extrait le dossier des femmes enceintes infectes par le vih qui avaient amorc une arap contenant du ral aprs 28 semaines de grossesse dans deux centres hospitaliers universitaires entre 2007 et 2013 . Onze femmes infectes ont entrepris un traitement de ral une mdiane de 35,7 semaines de grossesse (plage de 31,1 38,0 semaines). Les indications pour entreprendre le ral taient une prsentation tardive au suivi de grossesse (n=4) et une suppression sous - optimale de la cv en raison dun mauvais respect du traitement ou dune rsistance virale (n=7). La cv moyenne au dbut du traitement au ral tait de 73 959 copies / ml (plage de moins de 40 copies / ml 523 975 copies / ml). Les patientes ont pris du ral pendant une mdiane de 20 jours (plage de un 71 jours). La diminution moyenne de la cv entre le dbut du ral et laccouchement tait de 1,93 log, lexception dune patiente qui na reu quune dose de ral et dune patiente do nt la cv ntait pas dcelable au moment dentreprendre le ral . Au bout de huit jours de ral, 50% des femmes prsentaient une cv infrieure 1 000 copies / ml (le seuil pour recommander une csarienne afin de rduire le risque de transmission prinatale). La prsente tude fournit des donnes provisoires pour soutenir lutilisation darpa contenant du ral afin dacclrer la rduction de la cv du vih-1 chez les femmes qui prsentaient une cv leve ou une suppression sous - optimale de leur cv pendant la grossesse, ainsi que pour rduire le risque de transmission prinatale du vih tout en vitant une csarienne . A retrospective review of two canadian hiv perinatal databases (those of the oak tree clinic at bc woman s hospital, vancouver, british columbia, and of the grossesse avec maladie infectieuse clinic at sainte - justine hospital, montreal, quebec) was conducted to identify hiv - infected pregnant women who initiated treatment with ral (400 mg twice per day orally) after 28 weeks gestation . Data collected between 2007, the year when ral became available, and december 2013 were reviewed . Each patient s chart was then retrospectively abstracted for data including ral indication, tolerance and timing of exposure . The standard of care in both clinics included treatment of hiv - infected pregnant women with cart regardless of baseline cd4 cell - count and hiv-1 vl, as well as assessment of the women s clinical, virological and immunological status every four weeks . Infants were evaluated at least at birth, two weeks of age, one month of age and then every three to four months until 18 months of age . Hiv - negative status in infants was defined presumptively by at least two negative hiv rna polymerase chain reaction test results before four months of age, and confirmed by the absence of hiv-1 antibody at 18 months of age . Maternal and neonatal adverse reactions were systematically addressed according to who criteria (27), with specific attention devoted to hematological and hepatic complications . Hiv-1 vl was measured either using the ultrasensitive amplicor hiv-1 monitor test or cobas taqman hiv-1 test, v1.0 (roche molecular systems inc, usa) for cases in vancouver, and the abott realtime hiv-1 assay (abbott molecular inc, usa) for cases in montreal . The study was approved by the institutional review board of each centre . A descriptive analysis of population characteristics a nonparametric survival analysis was then conducted to compute the time to achieve a vl <50 copies / ml and <1000 copies / ml, respectively . The statistical analysis was performed using r version 2.11.1 (r core team, 2013). A descriptive analysis of population characteristics was performed . Because of the non - normal distribution, median and range are reported . A nonparametric survival analysis was then conducted to compute the time to achieve a vl <50 copies / ml and <1000 copies / ml, respectively . The statistical analysis was performed using r version 2.11.1 (r core team, 2013). A total of 11 women who initiated ral during the third trimester of their pregnancies were identified . Three women (cases 3, 5 and 7) had a new diagnosis of hiv during the current pregnancy . The median gestational age at their first clinic visit was 24 weeks (range seven to 35 weeks). The median duration of consistent cart received was 42 days (range seven to 202 days). Indications for ral were late presentation in pregnancy (n=4) and suboptimal vl reduction secondary to poor adherence or viral resistance (n=7). All patients received ral in combination with at least two other active antiretroviral agents, started at a median gestational age of 35.7 weeks (range 31.1 to 38.0 weeks). Exposure duration was a median of 20 days (range one to 71 days). The median gestational age at delivery was 38.7 weeks; one patient (case 9) delivered at 35 weeks in a context of spontaneous preterm labor . At the time of delivery, nine women had a hiv vl <1000 copies / ml, of which seven were <50 copies / ml . Figure 1 summarizes the typical vl evolution after ral initiation . Among the 11 women, three had a vaginal delivery, three had a caesarean section for obstetrical indications and five had a caesarean section to further decrease the risk of hiv perinatal transmission . Three of these caesarean sections could have been avoided (ie, the vl was below threshold of 1000 copies / ml) if the hiv vl had been known at the time of the delivery . There were no cases of hiv perinatal transmission observed in the in utero - exposed infants . One infant (case 11) presented a transient symptomatic cardiac arrhythmia at birth, as well as unilateral hydronephrosis and skin abnormalities (nevus, four nipples), which were not prenatally diagnosed . The following two cases were excluded from subsequent analysis: one woman (case 3) had an undetectable vl at ral initiation . She was initially started with a combination regimen with zidovudine, lamivudine and ritonavir - boosted lopinavir at 28 weeks and four days . However, she had adherence issues in a context of a newly diagnosed hiv infection in pregnancy with hepatitis c coinfection and substance use . The woman was admitted for directly observed therapy and ral was started at 33 weeks to rapidly suppress her vl . At the time of ral initiation, the last available vl result (measured two weeks previously) was 1762 copies / ml, and the woman reported poor adherence to her cart regimen during this time period . Retrospectively, it was determined that at the time of ral initiation, her vl was undetectable; however, because of concerns surrounding adherence and risk of resistance rise, ral was pursued . The woman discharged herself from hospital for three days at approximately 35 weeks gestation but returned with a positive urine cocaine screen . She had a vaginal delivery at 38 weeks and five days gestation with a confirmed undetectable vl.one woman (case 10) received only one dose of ral . Her pregnancy had been complicated by poor adherence and intolerance to cart . At 37 weeks gestation, she was admitted for supervised cart, and her vl was found to be 232,245 copies / ml . As soon as this result was known, ral was added to her regimen to attempt a rapid and maximal suppression of the hiv vl before delivery . However, 3 h after receiving the first dose of ral the woman experienced spontaneous rupture of membranes and went into active labour . She was initially started with a combination regimen with zidovudine, lamivudine and ritonavir - boosted lopinavir at 28 weeks and four days . However, she had adherence issues in a context of a newly diagnosed hiv infection in pregnancy with hepatitis c coinfection and substance use . The woman was admitted for directly observed therapy and ral was started at 33 weeks to rapidly suppress her vl . At the time of ral initiation, the last available vl result (measured two weeks previously) was 1762 copies / ml, and the woman reported poor adherence to her cart regimen during this time period . Retrospectively, it was determined that at the time of ral initiation, her vl was undetectable; however, because of concerns surrounding adherence and risk of resistance rise, ral was pursued . The woman discharged herself from hospital for three days at approximately 35 weeks gestation but returned with a positive urine cocaine screen . She had a vaginal delivery at 38 weeks and five days gestation with a confirmed undetectable vl . Her pregnancy had been complicated by poor adherence and intolerance to cart . At 37 weeks gestation, she was admitted for supervised cart, and her vl was found to be 232,245 copies / ml . As soon as this result was known, ral was added to her regimen to attempt a rapid and maximal suppression of the hiv vl before delivery . However, 3 h after receiving the first dose of ral the woman experienced spontaneous rupture of membranes and went into active labour . In the remaining nine women, median vl at ral initiation was 88,707 copies / ml (range 246 to 523,975 copies / ml; mean 73,959 copies / ml). The mean decline of vl from time of ral initiation to delivery was 1.93 log10 copies / ml (95% ci 1.32 to 2.53 log10 copies / ml) (figure 1). In the four women who received <2 weeks of ral, the mean vl decrease was 1.82 log10 copies / ml . In the four women who had an initial vl> 4 log10 copies / ml, the mean decrease was 2.65 log10 copies / ml . After eight days on ral, 50% of the women achieved a vl <1000 copies / ml (figure 2). Similarly, 50% of the women achieved a vl <50 copies / ml after 26 days on ral . An asymptomatic elevation of liver enzyme levels (11- and fivefold the upper limit of normal of alanine aminotransferase and aspartate aminotransferase, respectively) was noted in a woman for whom ral was added to a combination of zidovudine, lamivudine and ritonavir - boosted lopinavir because of late presentation . The elevation of liver enzyme levels was first observed after five days on ral, without signs of preeclampsia or cholestasis . The status regarding hepatitis a, b and c infections was confirmed to be negative . In our experience, adding ral to a cart regimen was useful in rapidly reducing hiv-1 vl to prevent perinatal transmission in women who have high vl or suboptimal suppression late in pregnancy . Our findings are consistent with previously published cases of ral use late in pregnancy, which are summarized in table 2 (8,1518,2022,2426,28). Among these, only one case of perinatal transmission has been reported (8); the clinical presentation in that case suggested in utero hiv transmission . We were able to confirm the drastic and rapid decrease of hiv vl after ral initiation, and computed a median time to achieve vl <1000 copies / ml (eight days), information that will be useful in the clinical setting . Moreover, important limitations of the present case series include the absence of data regarding resistance to integrase inhibitors among the women treated, and regarding maternal and neonatal ral plasma concentrations . Published data indicate that, despite a reduction of ral median area under the curve by approximately 50% during pregnancy (29), ral readily crosses the placenta and achieves adequate concentrations in the neonate, with mean cord blood - maternal blood drug ratios of 1.5 (range 0.32 to 9.5) (15,16,22,28). Else et al (30) found that ral achieves the highest placental / neonatal concentration among available antiretroviral medications . Explanations for effective placental transfer of ral include its relatively low protein binding and small molecular weight, as well as its favourable ph - dependent lipophilicity, which results in increased amount of ionized drug in the fetal circulation (11,22,30,31). A high cord: maternal serum ratio reflects a high placental transfer but also a neonatal accumulation . The ability of fetuses to metabolize and eliminate ral on their own is likely limited by the immaturity of ugt - glucuronidation pathways (22,32). We observed a 1.82 log10 copies / ml decrease in hiv vl within two weeks of receipt of a ral - containing cart regimen, which is faster than the mean time of approximately five weeks to suppression that is typically observed with traditional cart (33). This finding is consistent with the vl reductions (2 log10 copies / ml within 10 to 14 days of receipt of a ral - based regimen) observed in randomized controlled trials using ral - based regimens (1214) and in observational studies investigating ral administration late in pregnancy (8,15,16,18,21). The reported case of liver toxicity (23) is, to our knowledge, the second that has been described with ral use in pregnancy (29). Although hepatotoxicity is one of the well - recognized side effects of antiretroviral drugs, it has not been commonly associated with ral therapy, with increase of aspartate aminotransferase and alanine aminotransferase levels> 5 times the upper limit of normal seen in only 5% of exposed individuals (31,34). Sufficient data are not yet available to conclude whether the risk of hepatotoxicity is higher in pregnancy . Close follow - up of liver enzyme levels in pregnant women treated with ral would be prudent until more safety data are available . The infant who was diagnosed with cardiac arrhythmia, unilateral hydronephrosis and skin anomalies had been exposed to ral in utero for 35 days, starting at 36 weeks gestation . Because of this timing, the congenital anomalies are not likely related to ral exposure . However, safety data regarding ral exposure in pregnancy are weak, and it remains a category c drug (31). Considering the potential advantages of ral noted above, it remains to be determined whether its ability to rapidly reduce vl in late pregnancy will reduce the need for caesarean delivery and the rate of perinatal transmission for women who present near term with high vl . This would benefit hiv - infected women, particularly those with low cd4 cell counts, considering the increased risk of postpartum complications related to caesarean delivery (35,36). An important factor to consider, however, is the availability of rapid hiv quantitative test to follow the vl and allow for a safe vaginal delivery . Indeed, in previously published cases of pregnant women treated with ral (8,15,16,18,2022,2426) as well as in the three cases presented here, vl were retrospectively found to be <1000 copies / ml after caesarean section was performed to decrease the risk of perinatal transmission . Availability of rapid hiv quantitative polymerase chain reaction would assist the clinician to better decide whether caesarean delivery is indicated, according to their national guidelines (4,5). Our findings support the consideration of the use of ral to reduce the risk of perinatal transmission in late - presenting hiv - infected pregnant women and in women with vl rebound near term . However, long - term data are needed to assess the impact of ral use for short - term therapy in the obstetrical setting on the resistance profile . Indeed, there is a legitimate concern about the effectiveness of future ral - based regimens . Moreover, current canadian (5) and united states perinatal guidelines (4) are permissive but do not advocate for ral use in this setting due to the lack of established data . The results of two ongoing clinical trials (nct01854762 and nct01618305) will help to assess advantages of ral compared with other antiretrovirals in pregnancy . Further research needs to be performed to understand the role of ral in women with hiv acquisition in pregnancy, who are at even higher risk for perinatal transmission.

Massotherapy, defined as a manipulation of the soft tissues, is often provided to specific areas or whole body parts aiming at the following effects: enhanced blood flow, relief of muscle tension, improvement of autonomic nerve functions, prevention of bad conditions or injuries, and easing of pains1,2,3 . In recent years, massages have been admitted in international treatment guidelines4, 5 as one of the recommended therapies requiring further scientific verification . Massages are provided in the following cases: subcutaneous emphysema caused by fracturing the breastbone or ribs, external injuries, chest bruises, and crashes6; treatment at childbirth that shortens the delivery time7; healing of cobb angle of idiopathic scoliosis8; relief of patients suffering from musculoskeletal disorders including back pain9 . Massages are reported to be effective to alleviate pain and to enhance bodily functions . However, while these reports refer to the effects of massages, there are some cases which do not actively research the mechanism for how the massage is effective . Therefore, there are those who insist that massotherapy lacks scientific evidence and needs to be verified scientifically10,11,12 . In clinical practice, we obtained certain effects such as the relief of pain or improvement of the range of joint motion by providing friction to patients with popliteal edemas due to osteoarthritis of the knees or disorder of venous flow . Hammer s report referred to histamine or bradykinin as the elements involved in the effects of friction provided to chronic bursitis of the hip and shoulder joints14 . It was assumed that the effect to alleviate pain or to enhance the range of motion after providing friction would facilitate healing of edemas and relief of pain while enhancing the blood flow of the popliteal vein caused by the vascular dilatation or the vasodilator action by use of histamine or bradykinin . Physiologically, the lower legs venous sinuses play a major role in venous return, and venous sinuses in the soleus and gastrocnemius play the main role . Anatomically, these venous sinuses flow into the popliteal vein directly and indirectly through the posterior tibial and peroneal veins . Accordingly, the condition of lower legs venous return is reflected in the rate of blood flow passing through the popliteal vein . It was clarified that friction massage of the region below the popliteal fossa causes dynamic changes in muscle oxygenation15, but it was unclear what influence this effect has on venous return . Based on this assumption, an aim was set at researching the influences of friction on the popliteal region as a manipulation of the body surface, and at considering the mechanism of friction s effects from the viewpoint of venous flow . During this study, friction massage was performed on the area surrounding the popliteal vein in healthy volunteers . Friction massage was performed on the intermediate point between the medial and lateral heads of the gastrocnemius muscle . Friction massage was performed by the thumbs, moving them in small circles (23 cm) at a frequency of 3 hz . Changes in blood flow velocity of the popliteal vein was monitored before and after intervention (a comparative study: after versus before). Fifteen male students who satisfied the selection criteria were gathered from ibaraki prefectural university of health sciences as subjects (means sd: age=21.4 1.7 years). The subjects signed a letter of consent after the purpose of the study, method, benefits and risks, and rights of participants were explained . Exclusion criteria were as follows: diagnosis or evidence of any cardiovascular, metabolic, orthopedic, neurological or endocrine disease that are known to affect endothelial function; use of any medication that can interfere with cardiovascular function; and a risk of adverse response to exercise . The study protocol was approved in advance by the authors institutional review board and adhered to the declaration of helsinki . Written informed consent was obtained from all of the individual participants included in the study . The subjects underwent a single testing session in which all of the experimental procedures were conducted . Before reporting to the laboratory, subjects were asked to fast and refrain from caffeine, tobacco, alcohol, and strenuous physical activity for at least 12 h before the experiment . The measurement profiles of the blood flow velocity were obtained from pictures of the right popliteal vein by reference to the international guideline17 . Based on all the pictures, the sizes in vein diameter and blood flow were analyzed utilizing a logiq book xp (ge healthcare products, milwaukee, wi, usa) system with an 8 mhz linear transducer . The pictures of popliteal veins were identified in the b mode on the location two centimeters from the central region of the popliteal fossa . Gain settings were adjusted in order to get appropriate views of the front and the rear of the intimal interfaces of veins, thus identifying the vein in the color doppler - mode . A measurement setting was then conducted for the vascular caliber (sample volume) of the popliteal veins . Doppler velocity profiles were collected simultaneously using a pulsed signal at a corrected insonation angle of 60 to the vessel, with the velocity cursor positioned mid - artery to sample the volume . All pictures were captured by a usb video board at a frequency of 30 hz, and then saved in the external hard drive in order to be analyzed offline afterwards . Measurement of the popliteal vein was conducted using doppler ultrasonography with the subjects in a prone position . Initially, the subjects were placed in a prone position for 20 minutes at a constant temperature of 2426 c (relative humidity at 4060%) for acclimation according to the experimental protocol (fig . After that, the blood flow velocity of the popliteal vein was measured for the first time . Next, friction was provided for two minutes and then the blood flow velocity was measured for the second time . The transition was then analyzed with the first measured value set as the base line . Measurement parameters, such as average blood flow velocity (v mean), pulsatility index (pi), and resistance index (ri), were utilized18, 19 . Experimental protocol statistical analyses focused on differences between pre - friction and post - friction blood flow velocity states of the popliteal veins measured using doppler sonography . Changes in parameters were compared using within - subject paired t - tests . Participants characteristics are shown in table 1table 1.characteristics of study participantsparameters(n=15)age (years)21.4 1.7height (cm)173.6 3.8weight (kg)59.3 3.2bmi (kg / m)19.7 0.9values are expressed as means sd.bmi: body mass index . In addition, parameter values before and after friction are shown in table 2table 2.blood flow velocity changes before and after friction massageprepostblood flow velocity (cm / s)13.8 2.8 23.3 6.9*values are expressed as means sd . Significantly different between pre- and post - friction measurements, * p<0.01 . When a t - test was conducted, there were significantly large differences between pre- and post - friction measurements (t=7.162, df=14, p<0.01). Based on this result and the average values, it is possible to understand that the blood flow of the popliteal vein had a higher velocity after friction compared to before friction . In this study, regarding the venous flow of the lower legs, the effects of friction on popliteal regions was evaluated, using the blood flow velocity of the popliteal vein as an index . The blood flow velocity of the popliteal vein increased when friction was provided to the popliteal region . Based on this result, it was shown that friction is effective to improve the venous flow of the lower legs . Due to the fact that the lower legs, including the gastrocnemius and soleus muscles, have anatomical characteristics such as specific forms of vascular channels20, lower legs compartment syndrome, deep venous thrombosis, edema, and venous congestion are prone to occur . The result of this study showed that friction had an effect to heal these clinical conditions and disorders . Moreover, adding to circulatory disorders caused by the anatomical characteristics of the lower legs vascular channels, there are also disorders caused by autonomic nervous system malfunctions21 and disorders of the metabolism22 . Diabetes is one disorder of the metabolism which invokes muscle pain or muscle fatigue due to disordered blood circulation . Therefore, it is considered that enhancing the venous flow of the lower legs would alleviate pain and relieve muscle fatigue . Furthermore, it is expected that friction can be used as physical therapy to facilitate healing of injured parts during the period where muscle contraction is not available due to muscle injury, patients being in the postoperative period, and when body parts are bound in a cast . It is also pointed out that friction has other effects such as an enhancement of the circulation when being provided strongly enough to cause neurogenic inflammation . That is, when the massage is provided to the skin, the nociceptor is stimulated, inducing the discharge of neuropeptide such as substance p from the cell body . This stimulates not only the central nerves but also descends to the peripheral nerves, inducing the peptide from the sensory nerve terminal . It has been explained that as a result of the above process, the mast cells and the internal smooth muscles widen the blood vessels23 . The authors believe it to be necessary to start substantiating the study of these effects . Since dysfunction of the lower legs venous system, which plays the main role in venous return, is involved in the development of circulatory disorder in many cases, the indication of friction massage for circulatory disorders, such as lower legs compartment syndrome, edema, and diabetic muscle pain, was suggested . However, the results were obtained from young subjects and the autonomic and blood flow - related nervous systems were not investigated, and these are limitations of this study.

Holt - oram syndrome (hos) is an autosomal dominant condition with complete penetrance . Manifested in 1:1, 00, 000 live births and characterized by forelimb deformities, congenital heart disease and/or cardiac conduction abnormalities . It is linked to a single - gene tbx5 protein - producing mutation with gene map locus 12q24 and is the most commonly occurring heart - hand syndrome . Congenital cardiac and upper limb malformations frequently occur together and are classified as heart hand syndromes . The most common among the heart hand disorders is hos, which is characterized by cardiac septation defects and preaxial radial ray abnormalities . This condition with a high rate (3085%) of new non - familial cases was first described by holt and oram in 1960 in a 4-generation family with atrial septal defects (asd) and thumb abnormalities . The most common cardiac disorder is an ostium secundum asd, followed by ventricular septal defect (vsd) and ostium primum asd . Electrocardiogram (ecg) abnormalities such as various degrees of atrioventricular (av) block have also been reported . A full term female neonate born out of a nonconsanguineous marriage by cesarean section (indication - previous cesarean section with polyhydramnios) to a 25-year - old (weight 58 kg, height 155 cm) booked g3p1l1a1 with unremarkable antenatal history . Family history revealed that the father has radial ray deformity of left upper limb without any cardiac anomaly . Physical examination revealed an active baby weighing 2790 g and length of 49 cm, heart rate of 146/min, blood pressure of 70/30 mm of hg, respiratory rate of 40/min, and systemic oxygen saturation of right upper limb being 83% in room air and that of right lower limb being 74% in room air [figure 1]. On musculoskeletal examination, left upper limb shortening was noticed with absent radius bone, radial flexion deformity of the wrist and also absent thumb [figure 2]. No obvious deformities were noticed elsewhere . On cardio - vascular system examination, the pansystolic murmur of grade iii at the mitral and left parasternal area was heard picture showing the baby of holt - oram syndrome left upper limb showing radial ray deformity with absent thumb right hand showing triphalangeal thumb on further investigation, chest x - ray showed normal thoracic situs with cardiomegaly, plain radiograph of both upper limbs revealed absent radius on left side with absent carpal bones and absent first metacarpal bone and phalanges (thumb), right side showing absent carpal bones and triphalangeal thumb [figure 4]. Plain radiograph showing the bony deformities of the upper limb with cardiomegaly the baby developed cyanosis couple of hours after delivery, following which an ecg was done which was normal and a 2d echocardiography was done which revealed severe aortic atresia with hypoplastic arch, large perimembranous vsd and asd as well [figure 5]. The neonate was referred to a cardiac center for further management, however due to lack of resources the baby died on day 4 of life . Holt - oram syndrome is an autosomal dominant disorder characterized by distinctive malformation of bones of the upper limbs and abnormalities of the heart . Cardinal manifestations of hos are dysplasia of upper limb that ranges from minor findings including hypoplasia of thumb, clinodactyly, brachydactyly, triphalangeal thumbs, carpal bone dysmorphism, shortness of ulna, shortness of humerus, aplasia of radius to phocomelia and cardiac abnormalities . Although bilateral, left side is often affected more significantly . In a study of 98 subjects with hypoplastic thumbs, 16% proved to be the cases of hos . There are many well described heart - hand syndromes characterized by deformities of the radial ray and congenital heart defects such as thrombocytopenia absent radius syndrome, roberts syndrome, thalidomide embryopathy, and fanconi anemia . The unique feature that helps to differentiate these from hos is that the radial aplasia is associated with hypoplasia / absence of the thumb without any hematological abnormalities and there is often a family history of heart and limb defects . The associated congenital heart defects are the most important determining factors in morbidity and mortality in these patients . Other cardiac associations include pulmonary stenosis, mitral valve prolapse and arrhythmias in the form of atrioventricular blocks . More complex cardiac lesions such as tetralogy of fallot, endocardial cushion defects, and total anomalous pulmonary venous return are observed in 18% of subjects with hos . The association with aortic atresia is extremely rare . As per best of our knowledge, till date there were no cases reported in the literature having a description of hos with aortic atresia . The electrocardiographic abnormalities such as variable degree of av blocks have also been reported, but in our case no conduction defects were noted . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.

Idiopathic dilated cardiomyopathy (dcm) is a heart muscle disorder characterized by systolic dysfunction and dilation of the left or both ventricles in the absence of any other possible cause.1 dcm can develop in people of any age or ethnicity, although it is more common in male than female persons (occurring at a ratio of 3:1 in male to female persons) and typically manifests in the third to fourth decades of life.2, 3 dcm is the predominant cause of cardiomyopathy in both adult and pediatric populations.3, 4 in adults, dcm has an estimated prevalence of 1:2500.3 in contrast, annual incidence in pediatric populations has been reported to be much lower: 1:170 000 in the united states5 and 1:140 000 in australia.6 although pediatric dcm has a lower annual incidence than adult dcm, the outcome for pediatric dcm patients is particularly severe.7, 8, 9 dcm is the most frequent cause of heart transplantation (htx) in pediatric patients.10 data from international pediatric dcm registries indicate that the rates of death or htx over 1 and 5year periods were 31% and 46%, respectively.4 conversely, recent data showed that the htxfree survival rate in adult dcm patients receiving optimal treatment is> 85% at 8 years.2 comparative studies between pediatric and adult dcm populations are currently lacking in the literature . In fact, because of the difficulty of performing controlled clinical trials with pediatric populations, the number of such trials has been limited.10 consequently, the treatment strategies used for pediatric dcm patients have been extrapolated primarily from data based on clinical trials using adult dcm patients . By better characterizing the baseline and longterm progression and outcome of pediatric dcm patients in comparison to adult dcm patients, for which ample data have already been collected, it is thought that improved treatment strategies could be developed for pediatric patients . The aim of this study was to provide insights into the longterm characterization and outcome of dcm in a pediatric population compared with an adult one to ultimately improve the clinical management of dcm in children . We analyzed data from all dcm patients that had consecutively enrolled in the trieste heart muscle disease registry in italy between 1988 and 2014, according to the protocol approved by the institutional review board of the trieste hospital administration and the local ethics committee . The investigation was in line with the principles outlined in the declaration of helsinki.11 the diagnosis of dcm was assigned according to the current guidelines.1, 12, 13 we excluded patients with a secondary cause of myocardial damage, including coronary artery disease (investigated with coronary angiography / computed tomography), hypertensive disorder, valvular disease, biopsyproven active myocarditis, associated congenital heart disease, history of chemotherapy or pharmacologic cardiotoxicity, pulmonary parenchymal or vascular disease, immunological disease, and mitochondrial disease (studied by complete neurological examination, plasma lactate and amino acids, urine amino and organic acids, and pyruvate and acylcarnitine profiles, if indicated).2 neuromuscular disease was investigated with a laboratory test (ie, creatine kinase) and electromyography and, for final diagnosis, by skeletal muscle biopsy if clinically indicated . In the absence of family history of dcm and in the presence of severe recentonset heart failure (hf), all pediatric patients underwent endomyocardial biopsy and, from 2010, cardiac magnetic resonance to exclude active myocarditis . At enrollment, all patients underwent an initial screening that included a detailed clinical and family history interview, a complete clinical examination, an electrocardiogram, 24hour holter monitoring, and a comprehensive echocardiographic evaluation . Conventional 2dimensional echocardiographic mmode pulsed doppler and tissue doppler imaging were all performed according to international guidelines.14, 15 after enrollment, if not contraindicated, all patients received standard medical therapy with angiotensinconverting enzyme inhibitors, angiotensin receptor blockers, and beta blockers titrated to the highest tolerated dose . Clinical and instrumental data were recorded at enrollment and then after 6 months (range 38 months), 12 months (range 918 months), and 24 months (range 1936 months) in followup evaluations . At> 24 months after enrollment, patients were recorded at least once every 2 years . Patients who were aged 18 years at enrollment were considered part of the pediatric population.6, 16 to improve the accuracy of our comparisons between 2 differently sized populations, prognostic assessment statistics compared the pediatric population with a sample of adult controls randomly matched in a 1:3 ratio (47 pediatric patients to 141 adult patients). This was adjusted for the most relevant baseline differences between the 2 groups, as explained in the statistical analysis section . Three outcome measurements were primarily investigated: (1) death or htx, (2) sudden cardiac death or malignant ventricular arrhythmia (mva), and (3) death caused by pump failure or htx . Data were collected over followup periods of 1, 6, and 9 years . All patients with refractory hf requiring inotropic treatment and/or mechanical support or with lifethreatening arrhythmias unresponsive to medical therapy and/or catheter ablation and who did not have contraindications were listed for urgent htx.2 sudden death was defined as immediate death occurring within 1 hour after the onset of symptoms or during sleep in stable patients with new york heart association (nyha) class i to iii disease . Mvas were defined as ventricular fibrillation / flutter or sustained ventricular tachycardia (> 30second duration of> 200 beats per minute or hemodynamically significant), as recorded by an implantable cardioverterdefibrillator or external defibrillation . Other investigated outcomes included cardiovascular death, noncardiac death, and death from unknown causes . The trieste heart muscle disease registry is a local relational database, active since 1978, that systematically collects the data of patients affected by dcm and other cardiomyopathies consecutively evaluated in the cardiovascular department of the azienda ospedalierouniversitaria ospedali riuniti of trieste . Used as a client interface, the system has all of the characteristics of a rapid application development client / server system . Data registration is composed of a table series corresponding to the clinical (history, family study, clinical examination) and instrumental evaluation (laboratory examinations; electrocardiography; holter monitoring; echocardiography; and, when indicated, cardiac catheterization and endomyocardial biopsy) and pharmacological therapy at baseline and at scheduled followup evaluations . A section dedicated to fatal and nonfatal events and their causes is also present . Continuous variables are presented as means and standard deviations or medians and interquartile ranges, as appropriate . For descriptive comparisons, clinical and instrumental characteristics at baseline were compared between groups of patients . This was achieved by 1way anova for continuous variables or the nonparametric median test, as necessary; for categorical variables, the chisquare or fisher exact test was used, as appropriate . To assess the longitudinal changes in the investigated parameters, first, simple tests for repeated consecutive measures were calculated separately for each group (the mcnemar test for binary parameters and the paired t test for continuous parameters). Second, linear mixedeffects models with time and group as the covariates (in which time is the followup visit and group was defined as either pediatric or adult) were used to investigate whether a different behavior was present between the groups over time (by means of the interaction term timegroup evaluated in the models). For the binary parameters, generalized linear mixed models were applied.17 because of the size difference between the pediatric and adult groups, we compared the survival of the pediatric patients with that of a sample of adult patients randomly matched in a 1:3 ratio to increase the efficacy of the survival comparison . The matching procedure accounted for the variables that were significantly different at baseline between the 2 populations and that had known possible relevance for the outcome in dcm patients . Eventfree survival curves for the 3 primarily investigated outcomes (described in the clinical outcomes section) were estimated and plotted using the kaplan meier method . Last, univariate and multivariate cox regression models were estimated in the target population (pediatric patients). The limited sample size and number of events in this group were taken into account using a backwardconditional stepwise procedure to select the subset of the most powerful independent predictors . Only univariable hazard ratios were estimated for the secondary end points (sudden cardiac death or malignant ventricular arrhythmia and death from pump failure or htx). Statistical analyses were conducted using the ibm spss statistics version 19 (ibm corp) and r software version 3.0.2 (r foundation for statistical computing) with the matching and rgenoud libraries . We analyzed data from all dcm patients that had consecutively enrolled in the trieste heart muscle disease registry in italy between 1988 and 2014, according to the protocol approved by the institutional review board of the trieste hospital administration and the local ethics committee . The investigation was in line with the principles outlined in the declaration of helsinki.11 the diagnosis of dcm was assigned according to the current guidelines.1, 12, 13 we excluded patients with a secondary cause of myocardial damage, including coronary artery disease (investigated with coronary angiography / computed tomography), hypertensive disorder, valvular disease, biopsyproven active myocarditis, associated congenital heart disease, history of chemotherapy or pharmacologic cardiotoxicity, pulmonary parenchymal or vascular disease, immunological disease, and mitochondrial disease (studied by complete neurological examination, plasma lactate and amino acids, urine amino and organic acids, and pyruvate and acylcarnitine profiles, if indicated).2 neuromuscular disease was investigated with a laboratory test (ie, creatine kinase) and electromyography and, for final diagnosis, by skeletal muscle biopsy if clinically indicated . In the absence of family history of dcm and in the presence of severe recentonset heart failure (hf), all pediatric patients underwent endomyocardial biopsy and, from 2010, cardiac magnetic resonance to exclude active myocarditis . At enrollment, all patients underwent an initial screening that included a detailed clinical and family history interview, a complete clinical examination, an electrocardiogram, 24hour holter monitoring, and a comprehensive echocardiographic evaluation . Conventional 2dimensional echocardiographic mmode pulsed doppler and tissue doppler imaging were all performed according to international guidelines.14, 15 after enrollment, if not contraindicated, all patients received standard medical therapy with angiotensinconverting enzyme inhibitors, angiotensin receptor blockers, and beta blockers titrated to the highest tolerated dose . Clinical and instrumental data were recorded at enrollment and then after 6 months (range 38 months), 12 months (range 918 months), and 24 months (range 1936 months) in followup evaluations . At> 24 months after enrollment, patients were recorded at least once every 2 years . Patients who were aged 18 years at enrollment were considered part of the pediatric population.6, 16 to improve the accuracy of our comparisons between 2 differently sized populations, prognostic assessment statistics compared the pediatric population with a sample of adult controls randomly matched in a 1:3 ratio (47 pediatric patients to 141 adult patients). This was adjusted for the most relevant baseline differences between the 2 groups, as explained in the statistical analysis section . Three outcome measurements were primarily investigated: (1) death or htx, (2) sudden cardiac death or malignant ventricular arrhythmia (mva), and (3) death caused by pump failure or htx . Data were collected over followup periods of 1, 6, and 9 years . All patients with refractory hf requiring inotropic treatment and/or mechanical support or with lifethreatening arrhythmias unresponsive to medical therapy and/or catheter ablation and who did not have contraindications were listed for urgent htx.2 sudden death was defined as immediate death occurring within 1 hour after the onset of symptoms or during sleep in stable patients with new york heart association (nyha) class i to iii disease . Mvas were defined as ventricular fibrillation / flutter or sustained ventricular tachycardia (> 30second duration of> 200 beats per minute or hemodynamically significant), as recorded by an implantable cardioverterdefibrillator or external defibrillation . Other investigated outcomes included cardiovascular death, noncardiac death, and death from unknown causes . The trieste heart muscle disease registry is a local relational database, active since 1978, that systematically collects the data of patients affected by dcm and other cardiomyopathies consecutively evaluated in the cardiovascular department of the azienda ospedalierouniversitaria ospedali riuniti of trieste . Used as a client interface, the system has all of the characteristics of a rapid application development client / server system . Data registration is composed of a table series corresponding to the clinical (history, family study, clinical examination) and instrumental evaluation (laboratory examinations; electrocardiography; holter monitoring; echocardiography; and, when indicated, cardiac catheterization and endomyocardial biopsy) and pharmacological therapy at baseline and at scheduled followup evaluations . A section dedicated to fatal and nonfatal events and their causes is also present . Continuous variables are presented as means and standard deviations or medians and interquartile ranges, as appropriate . For descriptive comparisons, this was achieved by 1way anova for continuous variables or the nonparametric median test, as necessary; for categorical variables, the chisquare or fisher exact test was used, as appropriate . To assess the longitudinal changes in the investigated parameters, first, simple tests for repeated consecutive measures were calculated separately for each group (the mcnemar test for binary parameters and the paired t test for continuous parameters). Second, linear mixedeffects models with time and group as the covariates (in which time is the followup visit and group was defined as either pediatric or adult) were used to investigate whether a different behavior was present between the groups over time (by means of the interaction term timegroup evaluated in the models). For the binary parameters, generalized linear mixed models were applied.17 because of the size difference between the pediatric and adult groups, we compared the survival of the pediatric patients with that of a sample of adult patients randomly matched in a 1:3 ratio to increase the efficacy of the survival comparison . The matching procedure accounted for the variables that were significantly different at baseline between the 2 populations and that had known possible relevance for the outcome in dcm patients . Eventfree survival curves for the 3 primarily investigated outcomes (described in the clinical outcomes section) were estimated and plotted using the kaplan meier method . Last, univariate and multivariate cox regression models were estimated in the target population (pediatric patients). The limited sample size and number of events in this group were taken into account using a backwardconditional stepwise procedure to select the subset of the most powerful independent predictors . Only univariable hazard ratios were estimated for the secondary end points (sudden cardiac death or malignant ventricular arrhythmia and death from pump failure or htx). Statistical analyses were conducted using the ibm spss statistics version 19 (ibm corp) and r software version 3.0.2 (r foundation for statistical computing) with the matching and rgenoud libraries . Of the entire population of 927 dcm patients enrolled between 1988 and 2014, 47 (5.1%) were pediatric . The median followup time after the first clinical evaluation was 110 months (interquartile range 54185 months). Table 1 shows the clinical data of the pediatric population at baseline compared with the adult group.18 a family history of dcm was significantly more common among the pediatric population (34.8% versus 17.5%; p<0.03). The pediatric patients presented with significantly lower systolic arterial blood pressure (11620 versus 12517 mm hg; p<0.01), a lower presence of left bundlebranch block (4.4% versus 31.9%; p<0.001), and a higher occurrence of left ventricular ejection fraction (lvef; 3613 versus 3211; p<0.03). Pediatric patients were also characterized by a shorter duration of hf symptoms (median 0 months [interquartile range, 1st3rd quartiles: 06 months] versus 1 month [interquartile range, 1st3rd quartiles: 07 months]; p<0.04). Both groups received optimized treatments for hf without agerelated differences . Despite different features at baseline, no significant differences were observed between the pediatric and adult populations regarding the longterm longitudinal trends in nyha functional classes iii iv, left ventricular enddiastolic diameter and volume, lvef, and restrictive filling pattern . An initial improvement under treatment, midterm stabilization, and then a subsequent trend to progressive worsening of these parameters were observed in the long term in both the adult and pediatric populations (figure 1). The matched sample was built by adjusting for differences in familiar forms, duration of hf, systolic blood pressure, left bundlebranch block, and lvef; moreover, we checked for others parameters that were different in the original sample and found nonsignificant differences (diastolic blood pressure in the matched sample was 7412 mm hg in the adult population versus 7211 mm hg in the pediatric patients, p=0.09; diabetes mellitus 6% versus 0%, p=0.11; smokers 26% versus 10%, p=0.05; and diuretics 49% versus 46%, p=0.967). Clinical data at baseline for pediatric and adult dcm patients acei indicates angiotensinconverting enzyme inhibitor; bsa, body surface area; dcm, dilated cardiomyopathy; dbp, diastolic blood pressure; hf, heart failure; iqr, interquartile range; lbbb, left bundlebranch block; lvedd, left ventricular enddiastolic diameter; lvedv, left ventricular enddiastolic volume; lvef, left ventricular ejection fraction; lvesd, left ventricular endsystolic diameter; lvesv, left ventricular endsystolic volume; mr mitral regurgitation; nyha, new york heart association; sbp, systolic blood pressure; sd, sudden death . The pediatric left ventricular diameters are represented also as z scores18: lvedd, z=1.87; lvesd, z=0.66 . Longterm longitudinal trends of clinical and echocardiographic parameters (nyha classes iii iv class, lvedd_i, lvedvi, lvef, rfp) in pediatric (solid line) and adult (dotted line) populations . Lvedd_i indicates indexed left ventricular enddiastolic diameter; lvedv_i, indexed left ventricular enddiastolic volume; lvef, left ventricular ejection fraction; mr, mitral regurgitation; nyha, new york heart association; rfp, restrictive filling pattern . Table 2 shows the incidence of major events in the pediatric population and the entire adult dcm population . The incidence of death or htx was significantly higher for the pediatric patients compared with the adults (43.5% [5 events per 100 patients per year] versus 25.8% [3.4 events per 100 patients per year]; p<0.018). The worst outcomes for the pediatric patients were death caused by hf or htx (21% [2.5 events per 100 patients per year] in pediatric patients versus 7% [0.8 event per 100 patients per year] in adults, p<0.001) and sudden death or mva (21% [2.5 events per 100 patients per year] versus 14% [1.7 events per 100 patients per year], respectively; p<0.001). Incidence of major cardiovascular outcomes in pediatric and adult patients with idiopathic dilated cardiomyopathy hf indicates heart failure; htx, heart transplant; icd, implantable cardioverterdefibrillator; mva, major ventricular arrhythmias; sd, sudden death . Figure 2a shows that longterm survival free from death or htx was significantly lower among the 47 pediatric dcm patients compared with the matched sample of 141 adults (p<0.001). Notably, a significant survival difference can be seen as early as 12 months after enrollment (survival rates at 1 year: 82% versus 98% in pediatric versus adult populations, respectively; p<0.001). At followup time points of 6 and 9 years, the survival rates were 71% versus 89%, respectively, in the pediatric patients and 68% versus 89%, respectively, in the adult patients (p<0.0001). Similar results were obtained when examining survival rates free from the combined end points of sudden death or mva and death from pump failure or htx (p<0.001 for both) (figure 2b and 2c). Figure 3 shows the effect of the age at enrollment on patient outcome, with pediatric age (ie, <18 years) associated with a significantly decreased mortality rate and increased occurrence of htx . Rates of longterm survival free from d / htx (a), dhf / htx (b), and from sd / mva (c) in 47 pediatric (solid line) vs 141 adult patients (dotted line) matched in a 1:3 ratio after adjustment for baseline differences between the 2 subgroups . D / htx indicates death or heart transplantation; dhf / htx, heartfailure death or heart transplantation; sd / mva, sudden death or major ventricular arrhythmias . Pediatric age (ie, <18 years) was associated with increasing risk of all major events: d / htx (a), dhf / htx (b), sd / mva (c). D / htx indicates death or heart transplantation; dhf / htx, heartfailure death or heart transplantation; sd / mva, sudden death or major ventricular arrhythmias . Finally, we performed a univariate and subsequent multivariate cox analysis among the pediatric population to identify possible prognostic indicators . Iv at baseline were the most powerful independent predictors of the occurrence of death or htx . Conversely, the use of beta blockers was found to be a protective factor (table 3). The pediatric patients received beta blocker treatment throughout the enrollment period (ie, beta blocker therapy before versus after the year 2000: 76% versus 84%, p=0.421). The univariate analyses for sudden death or mva and for pumpfailure death or htx are reported in tables 4 and 5 . Of note, a positive family history for dcm emerged as the only significant predictor (hazard ratio 3.79, 95% ci 1.22414.7; p=0.045) for arrhythmic events in the pediatric population (table 5). Univariate and multivariate analysis in the pediatric dcm population: predictors of death or heart transplantation em dash indicates no data . Acei indicates angiotensinconverting enzyme inhibitor; bsa, body surface area; dbp, diastolic blood pressure; dcm, dilated cardiomyopathy; hr, hazard ratio; lbbb, left bundlebranch block; lvedd, left ventricular enddiastolic diameter; lvedv, left ventricular enddiastolic volume; lvef, left ventricular ejection fraction; lvesd, left ventricular endsystolic diameter; lvesv, left ventricular endsystolic volume; mr mitral regurgitation; nyha, new york heart association; rfp, restrictive filling pattern (left ventricle); sbp, systolic blood pressure; sd, sudden death . Univariate analysis in the pediatric dcm population: predictors of death from heart failure or heart transplantation acei indicates angiotensinconverting enzyme inhibitor; bsa, body surface area; dbp, diastolic blood pressure; dcm, dilated cardiomyopathy; hr, hazard ratio; lbbb, left bundle branch block; lvedd, left ventricular enddiastolic diameter; lvedv, left ventricular enddiastolic volume; lvef, left ventricular ejection fraction; lvesd, left ventricular endsystolic diameter; lvesv, left ventricular endsystolic volume; mr mitral regurgitation; nyha, new york heart association; rfp, restrictive filling pattern (left ventricle); sbp, systolic blood pressure; sd, sudden death . Univariate in the pediatric dcm population: predictors of major ventricular arrhythmias or sudden death acei indicates angiotensinconverting enzyme inhibitor; bsa, body surface area; dbp, diastolic blood pressure; dcm, dilated cardiomyopathy; hr, hazard ratio; lbbb, left bundlebranch block; lvedd, left ventricular enddiastolic diameter; lvedv, left ventricular enddiastolic volume; lvef, left ventricular ejection fraction; lvesd, left ventricular endsystolic diameter; lvesv, left ventricular endsystolic volume; mr mitral regurgitation; nyha, new york heart association; rfp, restrictive filling pattern (left ventricle); sbp, systolic blood pressure; sd, sudden death . Of the entire population of 927 dcm patients enrolled between 1988 and 2014, 47 (5.1%) were pediatric . The median followup time after the first clinical evaluation was 110 months (interquartile range 54185 months). Table 1 shows the clinical data of the pediatric population at baseline compared with the adult group.18 a family history of dcm was significantly more common among the pediatric population (34.8% versus 17.5%; p<0.03). The pediatric patients presented with significantly lower systolic arterial blood pressure (11620 versus 12517 mm hg; p<0.01), a lower presence of left bundlebranch block (4.4% versus 31.9%; p<0.001), and a higher occurrence of left ventricular ejection fraction (lvef; 3613 versus 3211; p<0.03). Pediatric patients were also characterized by a shorter duration of hf symptoms (median 0 months [interquartile range, 1st3rd quartiles: 06 months] versus 1 month [interquartile range, 1st3rd quartiles: 07 months]; p<0.04). Both groups received optimized treatments for hf without agerelated differences . Despite different features at baseline, no significant differences were observed between the pediatric and adult populations regarding the longterm longitudinal trends in nyha functional classes iii iv, left ventricular enddiastolic diameter and volume, lvef, and restrictive filling pattern . An initial improvement under treatment, midterm stabilization, and then a subsequent trend to progressive worsening of these parameters were observed in the long term in both the adult and pediatric populations (figure 1). The matched sample was built by adjusting for differences in familiar forms, duration of hf, systolic blood pressure, left bundlebranch block, and lvef; moreover, we checked for others parameters that were different in the original sample and found nonsignificant differences (diastolic blood pressure in the matched sample was 7412 mm hg in the adult population versus 7211 mm hg in the pediatric patients, p=0.09; diabetes mellitus 6% versus 0%, p=0.11; smokers 26% versus 10%, p=0.05; and diuretics 49% versus 46%, p=0.967). Clinical data at baseline for pediatric and adult dcm patients acei indicates angiotensinconverting enzyme inhibitor; bsa, body surface area; dcm, dilated cardiomyopathy; dbp, diastolic blood pressure; hf, heart failure; iqr, interquartile range; lbbb, left bundlebranch block; lvedd, left ventricular enddiastolic diameter; lvedv, left ventricular enddiastolic volume; lvef, left ventricular ejection fraction; lvesd, left ventricular endsystolic diameter; lvesv, left ventricular endsystolic volume; mr mitral regurgitation; nyha, new york heart association; sbp, systolic blood pressure; sd, sudden death . The pediatric left ventricular diameters are represented also as z scores18: lvedd, z=1.87; lvesd, z=0.66 . Longterm longitudinal trends of clinical and echocardiographic parameters (nyha classes iii iv class, lvedd_i, lvedvi, lvef, rfp) in pediatric (solid line) and adult (dotted line) populations . Lvedd_i indicates indexed left ventricular enddiastolic diameter; lvedv_i, indexed left ventricular enddiastolic volume; lvef, left ventricular ejection fraction; mr, mitral regurgitation; nyha, new york heart association; rfp, restrictive filling pattern . Table 2 shows the incidence of major events in the pediatric population and the entire adult dcm population . The incidence of death or htx was significantly higher for the pediatric patients compared with the adults (43.5% [5 events per 100 patients per year] versus 25.8% [3.4 events per 100 patients per year]; p<0.018). The worst outcomes for the pediatric patients were death caused by hf or htx (21% [2.5 events per 100 patients per year] in pediatric patients versus 7% [0.8 event per 100 patients per year] in adults, p<0.001) and sudden death or mva (21% [2.5 events per 100 patients per year] versus 14% [1.7 events per 100 patients per year], respectively; p<0.001). Incidence of major cardiovascular outcomes in pediatric and adult patients with idiopathic dilated cardiomyopathy hf indicates heart failure; htx, heart transplant; icd, implantable cardioverterdefibrillator; mva, major ventricular arrhythmias; sd, sudden death . Figure 2a shows that longterm survival free from death or htx was significantly lower among the 47 pediatric dcm patients compared with the matched sample of 141 adults (p<0.001). Notably, a significant survival difference can be seen as early as 12 months after enrollment (survival rates at 1 year: 82% versus 98% in pediatric versus adult populations, respectively; p<0.001). At followup time points of 6 and 9 years, the survival rates were 71% versus 89%, respectively, in the pediatric patients and 68% versus 89%, respectively, in the adult patients (p<0.0001). Similar results were obtained when examining survival rates free from the combined end points of sudden death or mva and death from pump failure or htx (p<0.001 for both) (figure 2b and 2c). Figure 3 shows the effect of the age at enrollment on patient outcome, with pediatric age (ie, <18 years) associated with a significantly decreased mortality rate and increased occurrence of htx . Rates of longterm survival free from d / htx (a), dhf / htx (b), and from sd / mva (c) in 47 pediatric (solid line) vs 141 adult patients (dotted line) matched in a 1:3 ratio after adjustment for baseline differences between the 2 subgroups . D / htx indicates death or heart transplantation; dhf / htx, heartfailure death or heart transplantation; sd / mva, sudden death or major ventricular arrhythmias . Effect of age on outcome measurements . Pediatric age (ie, <18 years) was associated with increasing risk of all major events: d / htx (a), dhf / htx (b), sd / mva (c). D / htx indicates death or heart transplantation; dhf / htx, heartfailure death or heart transplantation; sd / mva, sudden death or major ventricular arrhythmias . Finally, we performed a univariate and subsequent multivariate cox analysis among the pediatric population to identify possible prognostic indicators . Iv at baseline were the most powerful independent predictors of the occurrence of death or htx . Conversely, the use of beta blockers was found to be a protective factor (table 3). The pediatric patients received beta blocker treatment throughout the enrollment period (ie, beta blocker therapy before versus after the year 2000: 76% versus 84%, p=0.421). The univariate analyses for sudden death or mva and for pumpfailure death or htx are reported in tables 4 and 5 . Of note, a positive family history for dcm emerged as the only significant predictor (hazard ratio 3.79, 95% ci 1.22414.7; p=0.045) for arrhythmic events in the pediatric population (table 5). Univariate and multivariate analysis in the pediatric dcm population: predictors of death or heart transplantation em dash indicates no data . Acei indicates angiotensinconverting enzyme inhibitor; bsa, body surface area; dbp, diastolic blood pressure; dcm, dilated cardiomyopathy; hr, hazard ratio; lbbb, left bundlebranch block; lvedd, left ventricular enddiastolic diameter; lvedv, left ventricular enddiastolic volume; lvef, left ventricular ejection fraction; lvesd, left ventricular endsystolic diameter; lvesv, left ventricular endsystolic volume; mr mitral regurgitation; nyha, new york heart association; rfp, restrictive filling pattern (left ventricle); sbp, systolic blood pressure; sd, sudden death . Univariate analysis in the pediatric dcm population: predictors of death from heart failure or heart transplantation acei indicates angiotensinconverting enzyme inhibitor; bsa, body surface area; dbp, diastolic blood pressure; dcm, dilated cardiomyopathy; hr, hazard ratio; lbbb, left bundle branch block; lvedd, left ventricular enddiastolic diameter; lvedv, left ventricular enddiastolic volume; lvef, left ventricular ejection fraction; lvesd, left ventricular endsystolic diameter; lvesv, left ventricular endsystolic volume; mr mitral regurgitation; nyha, new york heart association; rfp, restrictive filling pattern (left ventricle); sbp, systolic blood pressure; sd, sudden death . Univariate in the pediatric dcm population: predictors of major ventricular arrhythmias or sudden death acei indicates angiotensinconverting enzyme inhibitor; bsa, body surface area; dbp, diastolic blood pressure; dcm, dilated cardiomyopathy; hr, hazard ratio; lbbb, left bundlebranch block; lvedd, left ventricular enddiastolic diameter; lvedv, left ventricular enddiastolic volume; lvef, left ventricular ejection fraction; lvesd, left ventricular endsystolic diameter; lvesv, left ventricular endsystolic volume; mr mitral regurgitation; nyha, new york heart association; rfp, restrictive filling pattern (left ventricle); sbp, systolic blood pressure; sd, sudden death . This study compared the characterizations, longterm progression, and outcomes of adult and pediatric dcm patients . Most studies of pediatric dcm populations have been based on registries drawn from the united states or australia, and recent data on european populations, provided in this study, have been less represented . Furthermore, in the current literature, comparative studies of adult and pediatric dcm patients are lacking . This issue is relevant because the management of pediatric dcm is based largely on longterm data derived from adult cohorts . In this study, we reported a large and wellselected idiopathic dcm cohort in which pediatric cases are rare, representing only 5% of the whole population; however, clinical cardiologists have to pay particular attention to pediatric dcm . In fact, in our pediatric population, we saw that the disease was less severe at baseline compared with adults, as suggested by the lower percentage of left bundlebranch block, the higher occurrence of lvef, and the shorter duration of hf symptoms . This could be due to having an earlier diagnosis, which may be partially explained by a systematic and detailed collection of familial history of the probands and thus the earlier screening of relatives . Despite these differences at baseline, as seen previously, our pediatric population had a significantly poorer longterm outcome compared with adults . All analyzed combined end points (ie, death / htx, death from hf / htx, and sudden death / mva) had higher incidence in the pediatric population, even after adjustment for baseline differences between groups . The longterm incidence of death / htx in the pediatric population reached 5 events per 100 patients per year, which is markedly higher than 3.4 events per 100 patients per year in the adult population . These event rates are similar to those reported in the united states and australia.5, 6 furthermore, the survival rate curves of both populations start to diverge early after the first evaluation and progressively increase the survival gap in the long term . This was particularly evident considering the combined end point of death / htx (82% versus 98% in children versus adults at 1year followup). Finally, the onset of disease at an age <18 years clearly emerged as a risk factor for all combined end points (figure 3). This underscores the relevant role of pediatric age for short and longterm management of dcm . These results apparently contrast with the known beneficial effects on the prognosis from familial screening . The latter usually allows earlier diagnosis, often at a less severe stage of the disease, and subsequent benign outcome.19 one could argue that familial screening is useful for more accurately managing the disease with tighter and more aggressive followup when dcm is discovered at a pediatric age . In adults, familial screening allows diagnosis at an earlier stage of the disease, with a consequently better longterm outcome . Notably, in our study, the poorer prognosis in pediatric cases resulted not only from the progression of hf and htx but also from arrhythmic events (figures 2c and 3c). In the current literature, much more attention has been paid to hf than to arrhythmias in pediatric dcm patients . Nevertheless, an important arrhythmic profile in the pediatric patients compared with the adults clearly emerged in this study . This topic highlights a challenging issue in the management of dcm: whether to implant an implantable cardioverterdefibrillator for primary prevention in children . The current hf pediatric guidelines10 recommend this procedure for pediatric dcm patients with unexplained syncope and at least moderate left ventricular dysfunction (class of recommendation iia, level of evidence c) or with lvef <35% and nyha class ii they also recommend this procedure for adolescent patients with a familial cardiomyopathy associated with sudden death or for younger patients, considering the risk benefit ratio and technical issues (class of recommendation iia, level of evidence c). The low level of evidence for the guidelines suggests the ethical and technical difficulty of this decision and the necessity of risk stratification models . In particular, a left ventricle thinning and dilation ratio, diagnosis before age 13 to 14 years, and use of antiarrhythmic therapy within 1 month of diagnosis emerged as predictors of sudden cardiac death20; however, no univocal statement currently exists on this topic in the literature . The identification of predictors of sudden death and mva in pediatric dcm patients was beyond the scope of our study because of the limited number of events . Interestingly, at univariate analysis, family history positive for dcm emerged as the only significant predictor of arrhythmic events in the pediatric population . This could suggest that some clusters of gene mutations have an important role in inducing specific arrhythmic phenotypes . Most cases are idiopathic, followed by familial forms3; therefore, pediatric forms may be caused by particularly aggressive genetic mutations leading to rapidly progressive disease . Accordingly, our study showed twice the prevalence of familial forms of dcm in the pediatric population compared with the adult patients (34.8% versus 17.5%), encouraging genetic screening in these patients and their relatives . In some cases, a positive result may influence clinical management, as in the presence of lamin a / c (lmna) mutations.21, 22 in other cases, the discovery of a mutation has no impact on the clinical management of the disease because, currently, wide genotype phenotype correlation data are still lacking . Furthermore, it is known that active myocarditis in children is more aggressive than in adults, probably caused by a predominant immune response.23 consequently, postinflammatory dcm in children is also likely to be more severe, and more aggressive followup and therapeutic strategies are advised . Finally, the resulting independent prognostic factors that emerged from our multivariate analysis (tolerance of beta blocker therapy, lvef, nyha class) confirm previous studies24, 25 and reflect the same features that are included in adult dcm prognostic models.2 the protective role that emerged for beta blockers could confirm their benefit in pediatric as well as adult dcm patients . Nevertheless, because of the observational nature of the present study, it is possible that beta blocker intolerance was a surrogate for advanced disease state, and a largescale randomized trial is needed to definitively assess the benefit of beta blockers in a pediatric dcm population . Only 5% of the pediatric patients enrolled in the american pediatric cardiomyopathy registry received beta blockers in the 1990s compared with 18% after 2000.26 an increasing burden of studies about the pathophysiological differences of pediatric and adult hf mechanisms characterizes the current literature.27, 28, 29 this contributes to our understanding of the different agerelated responses to therapy . Performing clinical trials in children with dcm is very difficult, but it appears to be the only way to identify the most useful treatments to improve outcome . Our population has some analogies with largescale observational studies in the pediatric dcm population5, 6, 16; however, some notable differences have to be highlighted . The mean age of our pediatric cohort was 15 years, which is older than most other studies on dcm in children . Moreover, there were higher proportions of familial and male cases . These differences should be explained by the fact that ours is a cardiomyopathy referral center that is mostly used to evaluate patients that are affected by idiopathic dcm, without known causes and with an important genetic familial or postmyocarditis background and rarely associated with congenital syndromes or neuromuscular diseases . In this sense, the comparison with the adult population was not previously reported and appears to be particularly relevant to the clinical management of such patients . Another relevant discrepancy concerns the prognostic longitudinal trends that are shown in the present study . In our population, there appears to be a continued risk of death or transplant after 1 year of followup after enrollment; that characteristic is different from other pediatric dcm international registries.5, 6, 16 it is particularly interesting and is probably related to the abovementioned characteristics of idiopathic dcm enrolled in the present registry . These characteristics revealed a particularly aggressive nature of the disease in the short and long terms in children more than in adults . Moreover, the rarity of this disease among the pediatric population in general influenced the size of the samples studied . To overcome this issue, a casecontrol like strategy was achieved by means of a random matching procedure . Another limitation concerns the availability of longterm followup data, which were not complete for all patients because of the event rates and censoring mechanism . Consequently, the longterm trends of the main clinical and echocardiographic features shown in figure 1 should be interpreted with caution and confirmed by future studies that go on for a longer time . In our opinion, however, the comparison with the adult population (affected by the same limit) is reliable . For most of the patients, the genetic data and cardiac magnetic resonance information were lacking, thus we could not include these data in our analyses . Because of the limited number of events, uni and multivariable analyses were presented mainly for exploratory purposes and should be confirmed in larger series . Future focused studies are warranted to assess the possible prognostic role of these tools in pediatric populations compared with adults . Finally, we included htx in the composite end point even though it is not a fatal event . In our opinion, it remains a major event in the natural history of dcm that has the same impact of death in the prognostic evaluation of the disease, especially considering that only urgent htx examples were included . This study compared the characterizations, longterm progression, and outcomes of adult and pediatric dcm patients . Most studies of pediatric dcm populations have been based on registries drawn from the united states or australia, and recent data on european populations, provided in this study, have been less represented . Furthermore, in the current literature, comparative studies of adult and pediatric dcm patients are lacking . This issue is relevant because the management of pediatric dcm is based largely on longterm data derived from adult cohorts . In this study, we reported a large and wellselected idiopathic dcm cohort in which pediatric cases are rare, representing only 5% of the whole population; however, clinical cardiologists have to pay particular attention to pediatric dcm . In fact, in our pediatric population, we saw that the disease was less severe at baseline compared with adults, as suggested by the lower percentage of left bundlebranch block, the higher occurrence of lvef, and the shorter duration of hf symptoms . This could be due to having an earlier diagnosis, which may be partially explained by a systematic and detailed collection of familial history of the probands and thus the earlier screening of relatives . Despite these differences at baseline, as seen previously, our pediatric population had a significantly poorer longterm outcome compared with adults . All analyzed combined end points (ie, death / htx, death from hf / htx, and sudden death / mva) had higher incidence in the pediatric population, even after adjustment for baseline differences between groups . The longterm incidence of death / htx in the pediatric population reached 5 events per 100 patients per year, which is markedly higher than 3.4 events per 100 patients per year in the adult population . These event rates are similar to those reported in the united states and australia.5, 6 furthermore, the survival rate curves of both populations start to diverge early after the first evaluation and progressively increase the survival gap in the long term . This was particularly evident considering the combined end point of death / htx (82% versus 98% in children versus adults at 1year followup). Finally, the onset of disease at an age <18 years clearly emerged as a risk factor for all combined end points (figure 3). This underscores the relevant role of pediatric age for short and longterm management of dcm . These results apparently contrast with the known beneficial effects on the prognosis from familial screening . The latter usually allows earlier diagnosis, often at a less severe stage of the disease, and subsequent benign outcome.19 one could argue that familial screening is useful for more accurately managing the disease with tighter and more aggressive followup when dcm is discovered at a pediatric age . In adults, familial screening allows diagnosis at an earlier stage of the disease, with a consequently better longterm outcome . Notably, in our study, the poorer prognosis in pediatric cases resulted not only from the progression of hf and htx but also from arrhythmic events (figures 2c and 3c). In the current literature, much more attention has been paid to hf than to arrhythmias in pediatric dcm patients . Nevertheless, an important arrhythmic profile in the pediatric patients compared with the adults clearly emerged in this study . This topic highlights a challenging issue in the management of dcm: whether to implant an implantable cardioverterdefibrillator for primary prevention in children . The current hf pediatric guidelines10 recommend this procedure for pediatric dcm patients with unexplained syncope and at least moderate left ventricular dysfunction (class of recommendation iia, level of evidence c) or with lvef <35% and nyha class ii they also recommend this procedure for adolescent patients with a familial cardiomyopathy associated with sudden death or for younger patients, considering the risk benefit ratio and technical issues (class of recommendation iia, level of evidence c). The low level of evidence for the guidelines suggests the ethical and technical difficulty of this decision and the necessity of risk stratification models . In particular, a left ventricle thinning and dilation ratio, diagnosis before age 13 to 14 years, and use of antiarrhythmic therapy within 1 month of diagnosis emerged as predictors of sudden cardiac death20; however, no univocal statement currently exists on this topic in the literature . The identification of predictors of sudden death and mva in pediatric dcm patients was beyond the scope of our study because of the limited number of events . Interestingly, at univariate analysis, family history positive for dcm emerged as the only significant predictor of arrhythmic events in the pediatric population . This could suggest that some clusters of gene mutations have an important role in inducing specific arrhythmic phenotypes . Most cases are idiopathic, followed by familial forms3; therefore, pediatric forms may be caused by particularly aggressive genetic mutations leading to rapidly progressive disease . Accordingly, our study showed twice the prevalence of familial forms of dcm in the pediatric population compared with the adult patients (34.8% versus 17.5%), encouraging genetic screening in these patients and their relatives . In some cases, a positive result may influence clinical management, as in the presence of lamin a / c (lmna) mutations.21, 22 in other cases, the discovery of a mutation has no impact on the clinical management of the disease because, currently, wide genotype phenotype correlation data are still lacking . Furthermore, it is known that active myocarditis in children is more aggressive than in adults, probably caused by a predominant immune response.23 consequently, postinflammatory dcm in children is also likely to be more severe, and more aggressive followup and therapeutic strategies are advised . Finally, the resulting independent prognostic factors that emerged from our multivariate analysis (tolerance of beta blocker therapy, lvef, nyha class) confirm previous studies24, 25 and reflect the same features that are included in adult dcm prognostic models.2 the protective role that emerged for beta blockers could confirm their benefit in pediatric as well as adult dcm patients . Nevertheless, because of the observational nature of the present study, it is possible that beta blocker intolerance was a surrogate for advanced disease state, and a largescale randomized trial is needed to definitively assess the benefit of beta blockers in a pediatric dcm population . Only 5% of the pediatric patients enrolled in the american pediatric cardiomyopathy registry received beta blockers in the 1990s compared with 18% after 2000.26 an increasing burden of studies about the pathophysiological differences of pediatric and adult hf mechanisms characterizes the current literature.27, 28, 29 this contributes to our understanding of the different agerelated responses to therapy . Performing clinical trials in children with dcm is very difficult, but it appears to be the only way to identify the most useful treatments to improve outcome . Our population has some analogies with largescale observational studies in the pediatric dcm population5, 6, 16; however, some notable differences have to be highlighted . The mean age of our pediatric cohort was 15 years, which is older than most other studies on dcm in children . Moreover, there were higher proportions of familial and male cases . These differences should be explained by the fact that ours is a cardiomyopathy referral center that is mostly used to evaluate patients that are affected by idiopathic dcm, without known causes and with an important genetic familial or postmyocarditis background and rarely associated with congenital syndromes or neuromuscular diseases . In this sense, the comparison with the adult population was not previously reported and appears to be particularly relevant to the clinical management of such patients . Another relevant discrepancy concerns the prognostic longitudinal trends that are shown in the present study . In our population, there appears to be a continued risk of death or transplant after 1 year of followup after enrollment; that characteristic is different from other pediatric dcm international registries.5, 6, 16 it is particularly interesting and is probably related to the abovementioned characteristics of idiopathic dcm enrolled in the present registry . These characteristics revealed a particularly aggressive nature of the disease in the short and long terms in children more than in adults . Moreover, the rarity of this disease among the pediatric population in general influenced the size of the samples studied . To overcome this issue, a casecontrol like strategy was achieved by means of a random matching procedure . Another limitation concerns the availability of longterm followup data, which were not complete for all patients because of the event rates and censoring mechanism . Consequently, the longterm trends of the main clinical and echocardiographic features shown in figure 1 should be interpreted with caution and confirmed by future studies that go on for a longer time . In our opinion, however, the comparison with the adult population (affected by the same limit) is reliable . For most of the patients, the genetic data and cardiac magnetic resonance information were lacking, thus we could not include these data in our analyses . Because of the limited number of events, uni and multivariable analyses were presented mainly for exploratory purposes and should be confirmed in larger series . Future focused studies are warranted to assess the possible prognostic role of these tools in pediatric populations compared with adults . Finally, we included htx in the composite end point even though it is not a fatal event . In our opinion, it remains a major event in the natural history of dcm that has the same impact of death in the prognostic evaluation of the disease, especially considering that only urgent htx examples were included . The data of this italian registry suggest that pediatric dcm patients are rare but have a worse outcome than adult patients . This is despite similar treatments, a less advanced stage of the disease at baseline in children, and similar clinical and echocardiographic longterm progression . These findings were further confirmed after adjusting for other covariates that were significantly different from adults at the time of the onset of the disease . Finally, pediatric age emerged as an important prognostic predictor of both death from hf and lifethreatening ventricular arrhythmias.

Though limited in efficacy in many cases, the control methods available today represent a major progress when compared to the lack of any means for the control of these plants one or two decades ago . Crops can be protected by resistance, by selective fungicides, by biocontrol agents, and by cultural methods that did not existed before . The current focus in applied breeding is leveraging biotechnological tools to develop more and better markers to allow marker assisted selection with the hope that this will speed up the delivery of improved cultivars to the farmer . To date, however, progress in marker development and delivery of useful markers has been slow in legumes . We are now also facing an accelerated progress in the genomic and biotechnological research, which should soon provide important understanding of some crucial developmental mechanisms in both the parasites and their host plants and will provide candidate genes for resistance to ascochyta blight . The application of ngs technologies will provide a new research framework and molecular tools to be applied in resistance to ascochyta blight in legumes . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Marginal zone b - cell malignant lymphoma is a low - grade malignant non - hodgkin's lymphoma that develops in mucosa - associated lymphoid tissue (malt). This disease frequently develops in the stomach and also occurs in the salivary gland, thyroid, and lung . Most cases are diffuse large b - cell lymphoma, and the incidence of hepatic malt lymphoma is low among cases of primary hepatic malignant lymphoma [2, 3, 4, 5]. Here, we describe a rare case in which a lesion was initially thought to be a single tumor but was ultimately diagnosed as 2 contiguous tumors (malt lymphoma and hemangioma) using contrast - enhanced ultrasonography (ceus) with sonazoid (daiichi sankyo, tokyo, japan). The patient was a 60-year - old female in whom a tumor of 15 mm in diameter was detected in the couinaud's segment (s6) of the liver on the grayscale us in a medical examination . She had no subjective symptoms, relevant medical or family history, and did not drink alcohol . Physical findings on admission were: blood pressure 136/80 mm hg, pulse rate 80/min, and body temperature 36.4c . Blood tests on admission showed hb 10.4 g / dl (normal 14.017.0 g / dl), suggesting a mild anemia . Tumor markers were normal, tests for hepatitis b virus (hbv) and hepatitis c virus (hcv) were negative, and there were no other abnormal findings . Grayscale us showed a tumor with a snowman - like appearance and a relatively clear boundary in the s6 of the liver, with hypo- and hyperechoic areas in the lateral and medial parts of the lesion, respectively (fig . The tumor had a pale, low - density area on unenhanced ct, and prolonged enhancement in the equilibrium phases (fig ., the whole lesion gave a low - intensity signal on t1-weighted imaging, but isointensity in the lateral part and high intensity in the medial part were seen on t2-weighted imaging . Similarly, the lateral part showed high intensity and the medial part had a higher intensity on heavy t2-weighted imaging (fig . The lateral part was enhanced in the arterial phase, and enhancement persisted in the portal phase . In contrast, the medial part was gradually enhanced in the arterial phase, compared to the portal phase . Ceus was performed using an aplio xg (toshiba medical systems, tokyo, japan) with a convex probe (pvt-375bt, 3.75 mhz frequency). The mechanical index for the acoustic output was set to 0.2, and a single focus point was set at the lower margin of the lesion . Sonazoid (0.5 ml) was injected into the left cubital vein followed by a flushing with 10 ml of normal saline . The lateral hypoechoic region was homogenously hyperenhanced in the vascular phase (040 s) early after injection, and the contrast medium was washed out after about 30 s. the medial hyperechoic region was gradually stained from the margin toward the central region (fig . The tumor showed a defect in both hypo- and hyperechoic regions in the post - vascular phase (after 15 min). Similar findings were observed after a second intravenous injection of 0.5 ml of sonazoid using defect reperfusion imaging in the postvascular phase . Liver hemangioma was suspected for the medial part of the lesion based on the typical contrast findings on mri and ceus . In the lateral part, the contrast medium was washed out in the vascular phase on ceus early after the intravenous injection of sonazoid . Furthermore, the lateral part showed a defect in the postvascular phase, and this defect led to the suspicion of a malignant tumor, including hepatocellular carcinoma (hcc). Thus, surgical resection was performed . In a macroscopic examination of the resected specimen, the medial part was whitish and the lateral part was yellowish - white . On hematoxylin and eosin (he) staining, the medial part comprised blood vessels formed by a single layer of flattened endothelial cells and an interstitium formed by thin connective tissue, with the vascular lumen filled with blood . Based on these findings, the medial part of the tumor was diagnosed as hemangioma . In the lateral part, lymphocyte infiltration in a dense arrangement was observed on he staining, and most lymphocytes contained a moderately sized nucleus, but some cells contained a large nucleus and noticeable nucleolus (fig . Similar findings were present in the germinal center, with atypical lymphocytes invading the germinal center . Based on these findings, the lateral part of the tumor was diagnosed as marginal zone b - cell lymphoma . Isaacson and wright first proposed the name of malt lymphoma for extranodal malignant lymphoma of marginal zone b - cell origin in 1983 . Malt lymphoma is a low - grade malignant non - hodgkin's lymphoma that develops in mucosa - associated lymphoid tissue, and accounts for 78% of all cases . Malt lymphoma frequently develops in the stomach, and also occurs in the salivary gland, thyroid, and lung . Primary hepatic malignant lymphoma is rare, with most cases being diffuse large b - cell lymphoma and less than 10% being malt lymphoma [2, 3, 4, 5]. Many cases of malt lymphoma are solitary, imaging findings are diverse, and it is difficult to make a definite diagnosis based on imaging alone . Exclusion of hcc may not be possible and a definite diagnosis can only be made histopathologically after surgical resection in many cases [8, 9, 10]. In our patient, the lesion was initially considered to be a single tumor, but imaging findings indicated that it had 2 distinct regions . A literature search indicated that 2 cases of simultaneous malt lymphoma and hemangioma in the liver have been reported, with focal nodular hyperplasia also present in 1 of these cases [11, 12]. In both previous cases, malt lymphoma and hemangioma were separate, and thus there has been no previous case in which the tumors initially appeared to be a single tumor . In our patient, malt lymphoma and hemangioma were in contact, but each tumor was independent, rather than pathologically continuous, on histopathological examination . Concomitant malt lymphoma and hemangioma were considered to have no causal relationship in the 2 previous cases [11, 12]. The characteristic imaging findings of hepatic malt lymphoma are nonspecific, but include a relatively hypoechoic mass without a clear hypoechoic margin on grayscale us, hypoenhancement of the tumor in the arterial phase on dynamic ct, and low and high intensities on t1- and t2-weighted images on mri, respectively . In ceus using sono view (bracco, milan, italy) in 2 patients with hepatic primary malt lymphoma, foschi et al . Found that the lesions were inhomogeneously hyperenhanced in the arterial phase and hypoenhanced in the portal and late phases . These 2 patients were hbv - positive: one was an hbv - inactive carrier, and the other had chronic hbv hepatitis . Dynamic ct in both patients showed a slight hyperenhancement in the arterial phase, and hypoenhancement in the portal phases, and hcc was suspected . It was difficult to make a preoperative diagnosis, and the tumor was finally diagnosed histopathologically as hepatic malt lymphoma . The development of a malt lymphoma is thought to involve persistent chronic inflammation, and helicobacter pylori infection is well - known in gastric malt lymphoma . In primary hepatic malt lymphoma, chronic liver disorders such as hbv- or hcv - associated chronic hepatitis, hepatic cirrhosis, and primary biliary cirrhosis are occasionally found in the background liver . Our patient was negative for viruses and the background liver was normal, but homogenous hyperenhancement was observed in the vascular phase early after sonazoid injection, and the contrast medium was washed out after about 30 s on ceus . A defect was also noted in the postvascular phase, based on which the possibility of a malignant tumor, including hcc, could not be ruled out . However, the presence of 2 contiguous tumors was indicated by real - time evaluation hemodynamics in the tumor using ceus, which indicates the utility of ceus for a proper diagnosis . Tumor penetration by existing blood vessels on dynamic ct and mri is a characteristic finding in hepatic malignant lymphoma [8, 10]. However, in our case, no blood vessel penetrating the tumor was evident in any imaging . This feature may not have been visualizable in our case, or the absence of blood vessels penetrating the tumor may differentiate primary hepatic malt lymphoma from other malignant lymphomas . Only a few reported cases of primary hepatic malt lymphoma have included ceus findings, and no typical enhancement pattern on ceus has been established . The presence of blood vessels penetrating the tumor is useful for the diagnosis of malignant lymphoma, and ceus evaluation of intratumoral hemodynamics in real time may be more likely to visualize penetrating blood vessels, compared to dynamic ct and mri . It is possible that the absence of this feature differentiates primary hepatic malt lymphoma from other malignant lymphomas . Confirmation of this possibility will require further evidence from ceus evaluation of more cases of primary hepatic malt lymphoma . The lesion in our patient was initially considered to be a single tumor, but contiguous hepatic malt lymphoma and hemangioma were actually present . The concomitant occurrence of these tumors is rare, and no cases with 2 tumors in contact have been previously reported . The tumors gave different enhancement patterns on ceus and their presence was confirmed histopathologically, based on which we were able to make the final diagnosis.

This study was conducted in tugela ferry, south africa, where tb incidence is 1,100 cases/100,000 population and> 80% of tb mdr tb and xdr tb incidence was 118 cases and 72 cases/100,000 population, respectively, in 2007 (4). Ethical approval for this study was obtained from albert einstein college of medicine, yale university, university of kwazulu - natal, and the kwazulu - natal department of health . We performed a prospective cross - sectional study actively identifying patients with suspected tb in medical and tb wards, the hiv clinic, and the outpatient department at the tugela ferry district hospital during february 2008april 2009 . A person with suspected tb was defined as someone having a self - reported cough of any duration or> 2 other signs or symptoms, including fever, night sweats, weight loss, or shortness of breath for any duration . Patients could be either newly manifesting tb symptoms or have been receiving tb treatment for> 2 months but currently reporting active tb symptoms (i.e., treatment failures). Sputum for this study was tested by microscopic analysis of auramine- and ziehl - nielsen stained smears and middlebrook 7h11 agar and mycobacterial growth indicator tube 960 broth culture . Dst of positive cultures was performed by using the 1% proportional method on middlebrook 7h11 agar for isoniazid (critical concentrations: isoniazid 0.2 g / ml, rifampin 1.0 g / ml, ethambutol 7.5 g / ml, streptomycin 2.0 g / ml, ofloxacin 2 g / ml, kanamycin 5.0 g / ml, capreomycin 10 g / ml, and ethionamide 5.0 g / ml). Dst was repeated on all drug - resistant isolates to confirm the observed resistance pattern . The proportion of patients with xdr tb and drug - susceptibility patterns were described by using simple frequencies . Xdr tb treatment outcomes were reported as of november 2009; standard international definitions were used (11). Of 912 enrolled patients with suspected tb, 209 (23%) had culture - positive tb (figure 2). Of these patients, 30 (14%) had mdr tb, of which 19 (63% of those with mdr tb; 9% with culture - positive results) had xdr tb . Determination of prevalence of tuberculosis (tb) and drug resistance among persons with suspected tb, tugela ferry, south afica, 20082009 . Dst, drug susceptibility testing; mdr tb, multidrug - resistant tb; xdr tb, extensively drug - resistant tb . Among xdr tb isolates, all 19 (100%) were resistant to all 6 drugs routinely tested in kwazulu - natal province (isoniazid, rifampin, ethambutol, streptomycin, ofloxacin, and kanamycin), which extended the trend seen in previous years toward increasing drug resistance (figure 1). Of these isolates, 4 (21%) were also resistant to capreomycin, and 13 (68%) were resistant to capreomycin and ethionamide (table 1). Thus, an 8-drug resistance pattern was the predominant dst type among xdr tb patients in this cohort . * xdr tb, extensively drug - resistant tuberculosis; inh, isoniazid; rif, rifampin; emb, ethambutol; sm, streptomycin; ofl, ofloxacin; km, kanamycin; cap, capreomycin; eto, ethionamide . Of 13 patients with 8-drug resistance xdr tb, 5 (38%) were women (median age 33.5 years, range 2451 years) (table 2). Although 5 (38%) had previously received (or currently showed failure to) first - line tb treatment, none had ever received treatment with second - line drugs for mdr tb . Twelve (92%) patients were hiv infected (median cd4 cell count 183.5 cells / mm, range 22670 cells / mm); only 2 (17%) were receiving antiretroviral therapy at the time of tb screening . * mdr tb, multidrug - resistant tuberculosis; xdr tb, extensively drug - resistant tb . 6-drug resistance, resistance to isoniazid, rifampin, ethambutol, ofloxacin, kanamycin, and streptomycin; 7-drug resistance, resistance to isoniazid, rifampin, ethambutol, ofloxacin, kanamycin, streptomycin, and capreomycin; 8-drug resistance, resistance to isoniazid, rifampin, ethambutol, ofloxacin, kanamycin, streptomycin, capreomycin, and ethionamide . First - line drugs used for treatment of persons with new tb cases or confirmed drug - susceptible tb include isoniazid, rifampin, ethambutol, and pyrazinamide . Second - line drugs used for treatment of persons with confirmed mdr tb include ofloxacin, kanaymycin, ethionamide, p - aminosalicylic acid, and cycloserine or terizidone . Among 13 xdr tb patients with 8-drug resistance, 7 (54%) died (median time to death 59 days, range 16205 days). Two patients were lost to follow - up, and 4 (31%) are still living and receiving xdr tb treatment (range 190502 days of follow - up). No trend in survival of patients with xdr tb was observed by drug - resistance pattern (6-drug vs 7-drug vs. 8-drug). Routine drug - resistance surveillance to first- and second - line drugs is conducted in tugela ferry, which has a high incidence of tb and hiv co - infection . In this study, we expanded second - line testing for 2 additional bactericidal drugs (capreomycin and ethionamide) for treatment of patients with xdr tb . Resistance to 8 first - line and second - line drugs is the predominant pattern for xdr tb in tugela ferry, thereby severely limiting effective therapeutic options with available medications . According to the standard xdr tb regimen used in this province, patients were receiving <3 active drugs (pyrazinamide, p - aminosalicylic acid, and cycloserine), which increases the risk for treatment failure and further amplification of drug resistance . These findings underscore the need for routine surveillance for resistance to all first - line and second - line drugs used and for tailoring regimens accordingly to improve treatment success and reduce emergence of more drug - resistant xdr tb strains . First, the reliability of second - line dst is variable, and only recently have methods and critical concentrations been standardized (12). However, all drug - resistant isolates in this study had dst repeated to confirm observed results . Second, dst for other first - line drugs, such as pyrazinamide, and other second - line drugs was not conducted, although these drugs are often used for xdr tb treatment . Thus, the degree of drug resistance was likely to be only a minimum estimate . Third, although the proportion of xdr tb cases in this survey was high, the absolute number of xdr tb cases was low . This small sample size limits our ability to make conclusions about treatment outcomes for patients with increasing drug - resistant isolates . However, previous studies from our site have shown poorer survival rates with increasing drug resistance (4). Expanded dst for second - line and third - line drugs is critical for xdr tb patient care . Given continued high and rapid number of deaths from xdr tb, better and more rapid methods for second - line dst are urgently needed to improve diagnosis and guide treatment . Although new drugs are being developed, efforts must target prevention of xdr tb and its transmission, earlier identification of cases, support of treatment completion for tb and mdr tb, and greater use of antiretroviral therapy for patients who are co - infected with hiv.

Proteus syndrome (ps) is a rare and sporadic disorder that causes postnatal overgrowth of tissues in a mosaic pattern . The complications of ps include, progressive skeletal deformities, invasive lipomas, benign and malignant tumors, and deep venous thrombosis with pulmonary embolism . We report a rare case of ps that presented with hypertrophy of index and middle finger without any other abnormalities or complications . Incidentally we noticed that he had enlarged index and middle fingers of both hands and thumb of right hand [figure 1]. On probing patient revealed that it was present since childhood with onset around the age of 5 years and gradual progression over years to the present size . No similar tissue growth in other parts of the body and there was no one in the family with similar features . On examination hypertrophy of index and middle finger of both the hand (a, b, c) and thumb of the right hand (c) laboratory investigations revealed normal renal and liver function tests . His x - ray of hands showed hyperostosis of involved fingers [figure 2]. X - ray hands showing hyperostosis of both index and middle fingure (a, b) and thumb of right hand (b) proteus who had the ability to change his shape and was proposed by wiedemann, et al . In 1983 . Happle, et al . In 1987 hypothesized that the syndrome might be due to somatic alteration of a gene leading to mosaic effects that would be lethal if the mutation were carried in nonmosaic fashion . The dysregulated tissue growth in mosaic pattern results in various phenotypic presentations and hence the clinical manifestations of ps are highly variable . The tissue overgrowth is usually absent or mild at birth and progressive in nature but usually appears to plateau after adolescence . The disproportionate overgrowth of tissue is usually asymmetrical and involves the arms, legs, hands, feet, and digits . Characteristic manifestations include hyperostoses, often near epiphyses with associated impaired mobility and cerebriform connective tissue nevus seen most commonly on plantar surface . Other findings are lipomas, epidermal nevi and capillary vascular malformations [table 1]. Criteria for the diagnosis of proteus syndrome there is no specific molecular marker, or laboratory test, for the diagnosis of ps . The diagnosis is mainly based on history, clinical examination and imaging studies . Because of its variable presentation, ps may be confused with other conditions . The two disorders most commonly confused with ps are klippel - trenaunay syndrome and hemihyperplasia / lipomatosis syndrome . The important points in ps that help in the differential diagnosis are: differential diagnosis of proteus syndrome sporadic and progressive nature of tissue overgrowththe absent or mild tissue growth at birthabsence of bone tumor, enchondromasabsence of specific gene mutations differentiates from neurofibromatosisabsence of familial inheritance (postzygotic somatic mutation of genes) sporadic and progressive nature of tissue overgrowth the absent or mild tissue growth at birth absence of bone tumor, enchondromas absence of specific gene mutations differentiates from neurofibromatosis absence of familial inheritance (postzygotic somatic mutation of genes) there are no effective treatment modalities for ps . The patients should be followed up regularly for development of complications and their management . The management is also challenging because of progressive nature of tissue growth . Both benign and malignant two relatively common tumors include cystadenomas of the ovary and monomorphic adenomas of the parotid gland . Presented with macrodactyly of index and middle finger of both the hands and thumb of right hand (one criteria of category b) and he met all the three general criteria . His skeletal survey was normal except for hyperostosis of index and middle finger and there were no associated complications except for the limitation of his affected finger movements . Although the patient did not satisfy the proposed criteria [table 1], a literature search revealed that out of the 205 cases reported 90 satisfied the criteria highlighting the variability in clinical presentation in cases of ps . Our patient was managed as a case of inferior wall mi and is presently on anti - ischemic medications with no new complications . In conclusion, ps is a very rare and highly variable, progressive tissue overgrowth disorder . Patients should be kept under regular follow - up for the development of complications and their management.

It is characterised by the production of abnormal hb referred to as sickle hb or hbs.123 the prevalence of sca is high in sub - saharan africa with nigeria having the highest burden.45 sca has been associated with hyperhaemolysis, cerebrovascular disease, acute chest syndrome, vaso - occlusive crisis, pulmonary hypertension and premature death among others.67 relatively, individuals with sca enjoy a compensated state of ill health interspersed with periods of acute exacerbation characterised by hyperhaemolytic (anaemic) or vaso - occlusive (voc; painful crisis) with infection, tissue hypoxia and micro - vascular occlusion as important predisposing events.68 abnormal lipid homeostasis has been reported in sca as well as other haematological disorders such as -thalassemia and this has been suggested to have the potential to alter membrane fluidity and function of red blood cell (rbc) in individuals with sca.91011 earlier studies reported significant increase in plasma triglyceride (tg) levels and concurrent significant decrease in plasma levels of total cholesterol (tc), high - density lipoprotein - cholesterol (hdl) and low - density lipoprotein - cholesterol (ldl) in sca subjects.91112 several inconclusive mechanisms such as heightened erythropoiesis (causing increased cholesterol utilization), defective liver function (due to iron overload) and defects in postabsorptive plasma homeostasis of fatty acids have been put forward to explain the pathogenesis of this sca - associated lipid abnormalities.913 however, it is worthy of note that this lipid phenotype is generally recognized as a risk factor for cardiovascular diseases . Zorca et al.11 reported that elevated plasma tg is a potential risk factor for pulmonary hypertension (ph) in sca subjects . The impact of disordered lipid metabolism on the course of sca and its numerous complications are not yet clearly defined . Also, there is little information on the lipid profile of sca subjects in voc . Due to the present dearth of knowledge; this study determined the lipid profile of adult nigerians with sca in vaso - occlusive crisis (voc) and in steady state (ssca). Eighty - two participants comprising 58 adults with sca (30 in steady state and 28 in voc) and 24 age - matched healthy individuals with hbaa genotype were recruited into this study . The sca (hbss) subjects were recruited from the hematology day care unit, department of hematology, university college hospital, ibadan after approval by university college hospital (ui / uch) joint ethics review committee, and informed consent by participant . Steady state (ssca) and vaso - ooclusive crisis (voc) were defined as earlier reported.14 subjects with other forms of genotype apart from hbss and hbaa, diabetes mellitus, hypertension, human immunodeficiency virus (hiv), hepatitis, cancer and with established endocrine dysfunctions were excluded from the study . Blood pressure (bp) was obtained using a mercury sphygmomanometer after at least 10 minutes of rest . After an overnight fast of about 10 hr, 5 ml of venous blood was obtained from each sca subject in steady state (ssca) and the controls . Samples were collected upon admission in the voc group as voc is an acute clinical condition hence; could not have been predicted for possible overnight fast . Most subjects in voc would probably be anorexic because of the acute pain they were going through . Blood samples were dispensed into edta - containing samples bottles and after determining the packed cell volume (pcv) and total white blood cell count (wbc), plasma was appropriately obtained and stored at 20c until analyses were done . Haemoglobin phenotype of each subject was determined using standard electrophoretic method at ph 6.8 while pcv and wbc were determined as described by cheesbrough.15 plasma lipid profile was determined using enzymatic method while ldl was calculated using friedwald equation.16 the distribution of the data was assessed using histogram with normal curve . Results are presented as mean standard deviation or as median (interquartile range) for gaussian and non - gaussian distributed data, respectively . Analysis of variance (anova) or kruskal - wallis test was used to compare all the three groups while differences between two groups were determined using independent student's t - test or man - whitney u as appropriate . Results are presented as mean standard deviation or as median (interquartile range) for gaussian and non - gaussian distributed data, respectively . Analysis of variance (anova) or kruskal - wallis test was used to compare all the three groups while differences between two groups were determined using independent student's t - test or man - whitney u as appropriate . Pcv, tc, hdl and ldl were significantly lower while wbc was significantly higher in sca compared with the control subjects . There was slight, but insignificant elevation of tg in sca compared with the control subjects . In table 2, all the components of the lipid profile between the three groups (ssca, voc and controls) were significantly different . Other components of the lipid profile had no specific pattern of differences . Characteristics of the subjects in table 3, tc and hdl were significantly lower while tg / hdl was significantly higher in sca subjects in steady state (ssca) compared with the control subjects . Similarly, tc and ldl were significantly lower in sca subjects in vaso - occlusive crisis (voc) compared with controls . However, tc, tg, ldl and tg / hdl were significantly lower while hdl was significantly higher in voc compared with ssca . Comparison of lipid profile in ssca, voc and control subjects using anova to find out if there is any interaction between wbc and lipid profile, sca subjects were classified into two groups based on the mean wbc value; 11.97 (10/l) [table 1] into 11.97 (10/l) and> 11.97 (10/l) groups . As shown in table 4, the two groups had similar lipid profile but they exhibited a similar pattern to that observed when ssca were compared with voc . There was insignificant reduction in the levels of tc, tg, ldl, tg / hdl and insignificant elevation of hdl level in sca subjects with> 11.97 (10/l) wbc compared with sca subjects with 11.97 (10/l) lipid profile in ssca, voc and control subjects pattern of lipid profile based on mean total white blood cell count (wbc) in sca subjects despite intense research for over 4 decades, mechanism of lipid homeostasis alteration in sca subjects is not yet fully understood.11 the observed lower levels of tc, hdl and ldl in the combined sca subjects (ssca and voc) are not novel findings . Hypocholesterolemia has been widely reported in sca subjects1112 and was thought to be due to increased cholesterol utilization consequent to increased erythropoiesis of sca . However, the reports of westerman17 and ngogang et al.,18 showed that hypocholesterolaemia is a common feature of both haemolytic and non - haemolytic anaemia and that serum cholesterol is in equilibrium with the cholesterol content of total red cell mass . It was, therefore, suggested that sca - associated hypocholesterolemia is a consequence of anaemia itself and not increased erythropoiesis.1117 the interaction between sca complications such as voc and disturbed metabolic homeostasis in individuals with sca has been reported.1419 in this study, tc and ldl decreased progressively from control - to - ssca - to - voc . Ssca had lower tc and hdl while voc had lower tc and ldl compared with the control subjects . This observation further confirms that sca - associated hypocholesterolemia might be anaemia dependent as intense haemolysis has been associated with various complications of sca.20 also, tg / hdl was higher in ssca than the control groups . The ratio of tg to hdl has been reported to be relevant in determining the risk of clinical vascular disease . It has been used to identify diabetic patients with an atherogenic lipid profile and has been found suitable in selecting patients needing earlier and aggressive treatment of lipid abnormalities.21 our observation is not surprising as the ssca group had slightly higher tg with concurrent lower hdl compared with the control subjects . Zorca et al.11 reported that high tg / hdl is associated with endothelial dysfunction and suggested that high tg / hdl is a potential risk factor for pulmonary hypertension . Although ldl is usually low in sca subjects, belcher et al.22 showed that ldl from sca subjects is more susceptible to oxidation and cytotoxicity to endothelium . Our observation, together with earlier reports, indicates that anaemia - associated lipid homeostasis disturbance could predispose sca subjects to various vascular diseases . Unfavorable plasma fatty acid composition has been associated with clinical severity of sca.23 similarly, nouraie et al.20 reported that intensity of haemolytic anaemia is an independent risk factor for the development of sca complications such as ph and hypoxaemia . In this study, plasma levels of tc, ldl and tg / hdl were lower in voc compared with ssca . This observation could be as a result of possible intense haemolytic anaemia in voc which would facilitate the attainment of a new equilibrium between the serum cholesterol and cholesterol content of total red cell mass.1117 the observed higher hdl in voc compared with ssca supports the report of darbari et al.3 which showed that higher hdl is independently associated with frequent voc . The observed elevated plasma hdl could be a marker of less marrow activity in sca subjects since formation of erythroid cell membrane requires cholesterol.1124 the reason for the observed lower tg in voc compared with ssca is presently unclear . However, intake of drugs and/or reduced food intake (due to possible anorexia) before presentation may be responsible for this observation . Further research work is still required to properly understand the disturbance in lipid homeostasis following voc as standard fasting period could not be ensured in our voc subjects . Also, the small sample size used in this study could limit proper data interpretation . Our study further confirms the widely reported defective lipid homeostasis in adults with sickle cell anaemia . It also showed that the alteration in the lipid metabolism becomes pronounced with vaso - occlusive crisis.

Obesity is a key public health issue for us youth, particularly among specific sociodemographic groups, including some racial / ethnic and sexual orientation groups [1, 2]. Obesity is operationalized as having a body mass index (bmi) equal to or greater than the 95th percentile among individuals younger than age 18 years or a bmi of 30 or greater for individuals age 18 years or older . Previous research in a primarily white cohort of youth and young adults, age 1223 years, found that sexual minority (nonheterosexually identified) females had higher bmi than heterosexual females throughout adolescence, similar to patterns seen in adult females . Among males in this cohort, gay males had higher bmi in early adolescence compared to heterosexual males, but by late adolescence bmi among gay males was lower than their heterosexual peers, similar to patterns seen in adult males . However, little is known about the intersection of race / ethnicity and sexual orientation and its impact on youth weight status . A small number of studies have investigated sexual orientation patterns in bmi among multiethnic samples of adults [7, 8]. One such study found that among females, white and african american sexual minorities were at increased risk of being overweight compared to same - race / ethnicity heterosexual individuals, whereas among adult males, gay males were less likely than heterosexuals to be overweight among white, african american, asian, and latino men . We are aware of only one study with a representative sample of adolescents examining sexual orientation disparities in bmi in a multiethnic sample, which found that bisexual female and male youth were at elevated risk for obesity compared to same - gender heterosexual youth across race / ethnicity groups . However, no research has explored whether an age - by - orientation interaction effect exists in racial / ethnic minority youth . Disparities in bmi among sexual minorities have been explained primarily using the minority stress model, which suggests that experiences of prejudice and discrimination based on minority status negatively affect health . Sexual minorities who are also racial / ethnic minorities may be at greater risk for negative health outcomes due to experiences of minority stress based on being a member of multiple minority groups [11, 12]. Indeed, research on sexual orientation, body image, and eating disorders in primarily white samples of adults has suggested that compared with heterosexuals, gay males indicated greater body dissatisfaction and eating disorder symptomatology [13, 14]. An alternative explanation is that sexual orientation disparities in bmi are related to sociocultural ideals regarding body appearance . For instance, sexual minority male youth reported greater desire for muscularity, but fewer attempts to gain weight, compared to heterosexual male youth . Among adult females, lesbian and bisexual individuals indicated lower internalization of sociocultural appearance ideals for a thin body type compared to heterosexual females . These findings may help to explain why sexual minority females have higher bmi and sexual minority males have lower bmi, compared to their same - gender heterosexual counterparts . However, similar to research on sexual orientation - by - gender disparities in obesity more research is needed to first identify whether sexual orientation - by - gender disparities in obesity exist in nonwhite racial / ethnic groups and then to examine whether explanations for these disparities apply across racial / ethnic groups . Previous obesity prevention and intervention efforts have been only marginally successful, in part because they tend not to be appropriately tailored and instead use a one size fits all approach . In a recent review of school - based internet obesity prevention programs for adolescents, a number of programs targeted racial / ethnic minorities who are at greater risk for obesity and the majority of programs included content on nutrition and physical activity . However, none of the programs reviewed seemed to address issues related to sexual orientation and obesity, such as body image or sociocultural ideals of thinness and muscularity . More research is needed to identify subgroups most at risk for obesity by determining whether sexual orientation - by - gender disparities exist across race / ethnicity groups, such that intervention and prevention efforts can be more effectively tailored for these groups . The transition from adolescence to young adulthood is a critical period for weight gain and the development of obesity, with long - term negative health implications for excessive weight gain during young adulthood [17, 18]. In addition, previous research has indicated that associations between sexual orientation and bmi change across adolescence and into young adulthood . Longitudinal research with nationally representative samples of adolescents is needed to address whether age - by - sexual orientation effects exist among nonwhite youth . To address this question and to inform obesity prevention and weight - loss intervention efforts, the current study used longitudinal data from waves i iv of the national longitudinal study of adolescent health (add health) to examine sexual orientation disparities in bmi over time within female and male race / ethnicity groups . Specific sexual minority subgroups were compared separately to heterosexual individuals because previous research has found bmi and obesity prevalence to differ among these subgroups, with bisexual individuals at particularly high risk for elevated bmi and obesity [9, 19]. We hypothesized that female sexual minorities, particularly bisexual individuals, would have consistently higher bmi over time than heterosexual females . We further hypothesized that heterosexual males would experience greater one - year increases in bmi compared to gay males . Finally, we hypothesized that these patterns would be similar across all three racial / ethnic groups . After exclusion criteria were applied (described below), the current sample included 7,140 females and 6,166 males, who contributed data to at least one of the four waves of add health, a us nationally representative longitudinal cohort . Participants were age 1121 years at wave i (1995) and age 2434 years at wave iv (2008 - 2009). Analyses were restricted to participants who provided a report of sexual orientation identity at wave iii and self - identified as non - latino white (59%), non - latino black / african american (23%), and latino (18%) at wave i. other race / ethnicity groups were excluded due to a small sample size within some sexual orientation groups . Descriptive statistics for age and bmi by race / ethnicity, gender, and sexual orientation are reported in table 1 . Sexual orientation identity was assessed at wave iii with one item asking participants to choose the description that best fits how they think about themselves, with the following response options: 100% heterosexual (straight); mostly heterosexual (straight), but somewhat attracted to people of your own sex; bisexual, that is, attracted to men and women equally; mostly homosexual (gay), but somewhat attracted to people of the opposite sex; 100% homosexual (gay); not sexually attracted to either males or females . Race and ethnicity were assessed separately at wave i but recoded and combined into the following groups for analysis: non - latino white, non - latino black / african american, and latina / o . Age in years and age - specific bmi (kg / m) calculated from self - reported height and weight were assessed at each wave . Self - reported height and weight were used because measured height and weight were not available at all four waves . To test the hypotheses, we conducted longitudinal unweighted linear generalized estimating equation analyses in sas (version 9.3; cary, nc). Analyses were stratified by gender and race / ethnicity, with heterosexual as the reference group . For the current study, participants who responded that they were not sexually attracted to either gender were excluded from the analyses, and mostly homosexual and 100% homosexual were combined into lesbian / gay due to small sample sizes, yielding the following sexual orientation identity groups: heterosexual, mostly heterosexual, bisexual, and lesbian / gay . To address the nonlinearity of bmi across development [2123], age was modeled both linearly and quadratically and sexual orientation - by - age was used to model repeated measures of continuous bmi across ages 1134 years, with age and bmi updated at each wave . Weights are typically used in analysis of data from add health to allow for population estimates . We conducted unweighted analyses because the complexity of the models in examining bmi trajectories across waves and accounting for clustering by schools did not allow for the incorporation of weights . In addition, a model - based analysis is reasonable if design effects are taken into account, which the current analysis did by adjusting for gender, race / ethnicity, and age . Sexual orientation and race / ethnicity group differences in mean age at each wave were found . Among females, bisexuals and mostly heterosexual individuals were significantly younger (bisexual range: 0.33 to 0.43 years; mostly heterosexual range: 0.25 to 0.30 years) than completely heterosexual individuals at all waves, p <0.02 to p <0.0001 . No significant sexual orientation group differences were found among males for mean age at each wave . Among both females and males, latinos were significantly older (female range: 0.43 to 0.49 years; male range: 0.36 to 0.44 years) than same - gender non - latinos at all waves, p <0.0001 . In addition, non - latina black / african american females were significantly older (0.15 years) than non - latina white females at wave ii only, p <0.01 . Descriptively, among both females and males across sexual orientation and race / ethnicity groups, age - specific bmi increased substantially across time from age 11 to 34 years (table 1, figure 1). Among females, the association between sexual orientation and bmi did not differ significantly by age, so sexual orientation - by - age interaction terms were not included in the final models . Non - latina white and latina bisexual individuals had higher bmi compared to their heterosexual female counterparts, while no sexual orientation differences were observed among non - latina black / african american females (see table 2, figure 1). Among males, the association between sexual orientation and bmi differed significantly by age within each of the three race / ethnicity groups . Gay males had higher bmi than heterosexual males in early adolescence . However, heterosexual males showed greater one - year bmi gains over time surpassing gay males by approximately age 17 years, with disparities widening further as participants aged into adulthood (see table 2, figure 1). Bisexual individuals showed a different pattern, with bisexual males showing greater one - year bmi gains over time compared to heterosexual males, but only among non - latino white participants . Previous research with a predominantly white cohort of youth found that age modified sexual orientation disparities in bmi in males . The current research extended these findings to non - latino black / african american and latino young men . During adolescence and young adulthood, heterosexual males demonstrated greater yearly increases in bmi compared to gay males, putting them at excess risk for obesity . It is not clear why these patterns are emerging, but reporting bias could be one factor . A prior add health analysis found that gay males underreport their bmi by an estimated 0.37 bmi units more than heterosexual males; nevertheless, bias of this magnitude would not be sufficiently large to explain the differences observed in the current study . Another potential explanation for smaller increases in bmi among gay males may be that compared to heterosexual males, gay males are at greater risk for body dissatisfaction and eating disorder symptomatology, which may result in lower bmi over time [13, 14]. Other research has suggested that sexual minority male adolescents and young adults are less likely to attempt to gain weight compared to completely heterosexual male youth, which may represent a protective factor against the development of obesity among sexual minority male youth . This study also found higher bmi among bisexual non - latina white and latina females compared to same - race / ethnicity heterosexual females, but not in other sexual minority female subgroups . It is possible that bisexual females may be responding to sexual minority stressors (e.g., increased rates of victimization) by engaging in obesogenic behaviors (e.g., stress - induced binge eating), more so than other sexual minority females or gay males . Higher bmi among bisexual females may also be attributable to comorbidity of obesogenic behaviors with other health risk behaviors and negative health outcomes . For instance, other research has indicated that bisexual females are at greater risk for psychological distress and health risk behaviors, including substance use and self - injurious behavior, compared to other sexual orientation groups . A recent study found that compared to lesbians, bisexual women are more likely to use maladaptive coping strategies, which may explain more adverse mental and physical health outcomes in bisexual females compared to lesbian females . Results from the current study highlight the need for research on health outcomes within sexual minority subgroups, in addition to comparing sexual minorities with completely heterosexual individuals . In addition, more research is needed to understand why bisexual females and males and heterosexual males have greater risk for increased bmi and whether membership in other sexual orientation groups may confer specific protective factors against weight gain and development of obesity . Findings from this study demonstrated that sexual orientation and gender differences in bmi are not limited to non - latino white youth and young adults . Among males, heterosexual males showed greater one - year bmi gains than gay males across all race / ethnicity groups . Among females, non - latina white and latina bisexual individuals had higher bmi than same - race / ethnicity heterosexual individuals regardless of age; there were no sexual orientation differences in non - latina black / african americans . It is clear from these results that sexual orientation disparities in bmi are a public health concern across race / ethnicity groups . Obesity prevention and intervention efforts should target healthy body image and weight - management methods for all youth, but additional resources may be needed for sexual minority youth . In particular, interventions should be designed in such a way as to not exacerbate risk of unhealthy weight control behaviors and eating disorders . In summary, obesity prevention initiatives and treatment interventions addressing unhealthy weight gain in adolescence and young adulthood must be relevant for all sexual orientations and race / ethnicities.

Nontuberculous mycobacteria (ntm) have emerged as an increasingly important pathogen in the last two decades . Unlike other environmental pathogens that are largely opportunistic in patients with malignancy and immunodeficiency, as well as transplant recipients, ntm can cause significant disease in otherwise healthy individuals . The ntm most commonly associated with pulmonary infection is the mycobacterium avium complex (mac), which is a microbial complex of mycobacterium avium and mycobacterium intracellulare . There have been many reports concerning its radiologic findings.123) although uncommon, several cases of solitary pulmonary nodules (spn) caused by mac pulmonary infections have been reported,456) which is different from the typical presentation of mac . However, a case of a multiple cavitating nodular infection with neither a fibrotic change nor nodular bronchiectasis associated with m. intracellulare has not been reported . We present the case of a 67-year - old asian woman who had a m. intracellulare infection presenting with multiple cavitating pulmonary nodules, which was differentiated from metastatic lung disease by percutaneous transthoracic needle aspiration (pcna). She presented to a local clinic after a single occurrence of hemoptysis 10 days prior . The color of the hemoptysis was scarlet and the amount was 1/2 cup of soju, korean distilled spirits . She had been diagnosed with type 2 diabetes mellitus (dm) 2 years prior at a local clinic, and had since been taking metformin 500 mg after breakfast and dinner . Glycosylated hemoglobin was 6.7%, and she had good control of her blood sugar levels during hospitalization . After a chest ct was obtained at the local clinic, she was transferred to our hospital to investigate the multiple cavitary pulmonary nodules that were found on the ct scan . When the patient visited our hospital, her initial vital signs showed a blood pressure of 110/70 mm hg, heart rate of 80 beats / min, respiratory rate of 16 breaths / min, and body temperature of 36.8. both pupil responses to light were normal and there was no abnormality in the conjunctivae and sclerae . On auscultation, neither crackles nor wheezing was heard in both lung fields, and the heart sound was regular without murmur . At the first visit to our hospital, the patient did not have any symptoms . There were several round nodules in both the upper lung zone and right middle lung zone, and patch consolidation in the left lower lung zone on the chest radiography, which is suggestive of mycobacterium tuberculosis (mtb) or metastatic lung disease (figure 1). Similarly, the chest ct showed centrilobular nodules with a tree - in - bud appearance and three round cavitary nodules in the left apex, the right upper lobe posterior segment, and the right lower lobe superior segment, suggestive of mtb or metastatic lung disease (figure 2). We isolated the patient because we could not exclude the possibility of mtb along with metastatic lung disease . The initial laboratory parameters were as follows: total leukocyte count 7,500/mm (neutrophil 64.6%, lymphocyte 21.1%, monocyte 0.44%); hemoglobin level 12.8 g / dl; and platelet count 217,000/mm . The level of c - reactive protein was 0.03 mg / dl and other parameters were within the normal limit on the blood chemistry tests . Additionally, the coagulation profile was checked, and the prothrombin time was 11.1 seconds (international normalized ratio 1.35). For further evaluation, we planned to perform a bronchoscopy and pcna, and the additional imaging examinations were not performed because chest imaging was obtained on the day of the initial hospital visit . The results of three smears for acid - fast bacilli, and a nucleic acid amplification test for mtb and ntm in sputum were all negative . For further evaluation, a bronchoscopy was performed on the left upper lobe apical segmental bronchus, the right upper lobe posterior segmental bronchus, and the right lower lobe superior segmental bronchus . The smear test of the bronchoscopic washing fluid was positive for acid - fast bacilli . The result of nucleic acid amplification was negative for mtb, but positive for ntm . Therefore, the patient was diagnosed with ntm, so the patient's quarantine was lifted . After 7 days, heavy colonies with confluent growth in ogawa's egg medium were detected in the bronchial washing fluid culture . After 2 weeks, several colonies with confluent growth in the mycobacterium growth indicator tube's egg medium were detected in the bronchial washing fluid culture . The precise species was identified using a polymerase chain reaction - restriction fragment length polymorphism - based method that identified differences in the rpob gene.7) the colonies were subsequently identified as m. intracellulare . To rule out metastatic lung disease, the lung tissue from the biospy showed chronic granulomatous inflammation with caseating necrosis (figure 3a, b). For further evaluation, a nucleic acid amplification for mtb and ntm with a stain for acid - fast bacilli was conducted using tissue from the pcna . The additional report showed that both the nucleic acid amplication for ntm and the stain for acid - fast bacilli were positive (figure 3c), and there were no malignant cells . This finding was consistent with ntm infection, and we could exclude metastatic lung disease . In conclusion, the lung tissue from the biospy confirmed the diagnosis obtained from the bronchial washing fluid culture . With the diagnosis of ntm infection the patient was prescribed a medication regimen that included rifampin (450 mg), ethambutol (800 mg), and clarithromycin (1,000 mg). A drug susceptibility test for clarithromycin was performed, and the result showed that the m. intracellulare was sensitive to clarithromycin . The patient started to complain of nausea and vomiting, and had poor oral intake 7 days after taking the medication for ntm . We changed the time for taking the medication from before meals to before bed, after which her symptoms improved . There were no other complications such as an abnormal liver function test or optic neuritis . We have performed blood tests and chest radiography to monitor the side effects and the disease progression . M. avium is the more important pathogen in a disseminated disease, whereas m. intracellulare is the more common respiratory pathogen . The chest radiography and ct scans showed abnormalities typical of the two forms of mac lung disease . The traditionally recognized presentation of mac lung disease is as an apical fibrocavitary lung disease with large cavities, located in the upper lobe . This form of the disease usually occurs in men with a history of cigarette smoking, excessive alcohol use, and underlying lung disease in their late 40s and early 50s . If not treated, this form of mac is rapidly progressive within a relatively short time period, 1 to 2 years mac lung disease also presents with bronchiectatic nodular infiltrates, usually involving the right middle lobe or the lingula segment, predominantly in postmenopausal and non - smoking women . This form of the disease has a tendency to progress much slower than the fibrocavitary disease, therefore long - term follow - ups lasting from months to years may be necessary to determine clinical or radiographic changes . In this indolent form of the disease spn is identified as focal, round, or oval areas of increased opacity in the lung that measure 3 cm in diameter . These nodules are frequently discovered incidently on chest radiography or chest ct.8) spn is often assumed to be attributable to mtb infection.9) however, it has been shown in case reports that spn can be attributable to mac lung infection.456) in 2009, sekine et al.10) reported a case of a mac pulmonary infection presenting with multiple nodules, which was an unusual presentation of a mac pulmonary infection . Unlike mtb therefore, the isolation of mac species from a respiratory sample is not sufficient evidence of ntm lung disease . In 1997, the american thoracic society issued a revised set of diagnostic criteria for ntm pulmonary disease . According to these criteria, a patient with ntm lung disease must have compatible symptoms and signs, and a compatible chest radiography or chest ct abnormalities . The current case did not strictly satisfy the diagnostic criteria proposed by the american thoracic society in terms of radiographic findings . The diagnostic criteria of ntm lung disease must be expanded to such cases of spn, multiple nodules, and multiple cavitary nodules, as in our case . In our case, we could not initially rule out mtb lung infection due to the chest ct findings, which showed multiple cavitating nodules with centrinodular nodules . We did not suspect mac lung infection because there was neither bronchiectasis in the right upper lobe or the left lingular segment nor a fibrotic change in the upper lobe . While the bronchoscopy findings were sufficient to diagnose the patient with mac lung infection, we also conducted a pcna to rule out metastatic lung disease ., we differentiated the atypical presentation of mac lung infection from mtb lung disease or metastatic lung disease . Ntm have emerged as an increasingly important pathogen in the last two decades . In korea, there has been an increasing prevalence of mac infections, and an increasing number of cases presenting with atypical findings . Our case report highlights the importance of differentiating among mtb, mac infection, and metastatic lung disease in cases of multiple cavitary nodules . Clinicians should consider the possibility of mac lung infection with various findings on chest radiography and chest ct . We believe that pcna can be a valuable diagnostic tool for differentiating mtb and mac, and differentiating between malignant diseases and infectious diseases when a pulmonary nodule is revealed on chest radiography or chest ct scans . In conclusion, to the best of our knowledge, this is a very rare report of a mac pulmonary infection presenting with multiple cavitary nodules . As the prevalence of mac infections increases, more cases start to show atypical radiographic findings, compared to the typical apical fibrocavitary or bronchiectatic nodular forms . Other forms of mac have been reported, such as spn and multiple nodules . In this report, we present another form of mac pulmonary infection . Therefore, clinicians should consider the possibility of mac lung disease with various findings on chest radiography or chest ct scans . In addition, pcna can be a useful diagnostic tool for evaluating multiple nodules to differentiate metastatic lung diseases from infectious diseases such as mtb or mac lung infections.

Despite better knowledge of the neurobiology of pain, progress of pharmacology and techniques of pain treatment, consensus and guidance of experts, inadequate control and underestimation of pain more often is the rule rather than the exception (1). Approximately 30 - 40% of patients with cancer have pain at the time of setting the diagnosis . In the advanced stage of the disease 75 - 90% of patients suffer pain, despite data from the institution of palliative medicine around the world that 95% of cancer pain can be effectively controlled (2). In 40 - 50% of cases the pain was rated as medium - severe to severe, whereby in 70% of cases occurring in the form of nociceptive cancer pain wherein the cancerous cells released endothelin, prostaglandins and tumor necrosis factor alpha (tnf), proteolytic enzymes and other algogene substances . Compression and nerve injury or cancer pain due to infiltration of bone nerve are the cause of the neuropathic cancer pain (3). Mild (weak) opioid analgesics are intended for the treatment of moderate pain and are used in case of treatment failure with non - opioid analgesics or if the initial pain intensity was 4 to 6 by the ias, either alone or in combination with non - opioid, with or without other analgesics . Tramadol is mild opioid analgesic with effects on the central nervous system, acting as a non - selective pure agonist of, and opioid receptors with higher affinity for the receptor . By inhibiting the reuptake of norepinephrine and is used in the treatment of moderately severe pain, and can suppress the cough, while in wide range of analgesic doses not suppress respiration . Depending on the method of application to date has been proven the involvement of paracetamol in five different analgesic mechanisms: (a) inhibition of isoenzymes of cyclooxygenase (cox) in the cns without interaction with the binding sites; (b) activation of serotonin bulbospinal time periods; (c) activation of nitric oxide (no) activation path; (d) activation or modulation of endogenous opioid periods, and (e) increase the tone of the endogenous cannabinoid (5). Metabolism of paracetamol releases n - acetyl - p - benzoquinone imine (napqi), which if it is not detoxified, binds to hepatocytes leading to cell necrosis . This binding is cause poisoning and liver weakness in case of paracetamol overdose (6). Also proven is link between hypertension and paracetamol (7, 8), which is probably caused by an significant amount of sodium which each paracetamol tablet contain . Due to the frequent occurrence of mixed nociceptive - neuropathic pain, one analgesic may not be efficient enough to cover all of the causal mechanisms of pain . Combined analgesics may be more effective because they can offer a wider range of relieving pain, activation of analgesic process and reduce the negative effects (9). The effect of analgesics combination may be higher, lower or the same as the intended total extent of the impact . This effect can be calculated mathematically, based on the concept of equal dose, which is defined as the dose of each drug that contributes to the total extent of the effect when each is used separately . The combined use of tramadol and paracetamol in one product, taking into account the pharmacokinetic and pharmacodynamic criteria can improve the benefit: risk ratio, increase efficiency by synergistic mechanisms, improve the tolerability of the drug (lower individual dose) and patient compliance (11). Combining tramadol and paracetamol is achieved a synergistic analgesia by three different mechanisms of action: binding of the -opioid receptors; activation of the descending pain control pathways; inhibition of cox-3 . The combination ensures rapid onset of action, longer efficacy, better efficiency then individual components and a good safety profile . It can be administered alone or can be added to nsaids in patients with inadequate analgesia care must be taken that tramadol may increase the risk of convulsive spasms due to a decrease of convulsive threshold and lead to serotonin syndrome in combination with other selective serotonin reuptake inhibitors (antidepressants) (12). Paracetamol as the second component of the fixed combination in therapeutic doses has just few side effects, while the maximum recommended dose for adults (4 grams per day) is associated with cases of hepatotocicity (13, 14). Palliative stage of the disease involves interruption of targeted oncology treatments and the limited lifespan of the patient with the dominant aim of improving the quality of life, regardless of the duration of life (15). Pain of medium severe intensity is dominant symptom in patients with advanced stages of cancer . Progression of the disease in these patients requires frequent evaluation of symptoms of pain and adjustment of therapeutic doses of weak opioids or switch to strong opioid analgesics . The goal of the research was to determine the efficacy of a fixed combination tramadol and acetaminophen in the treatment of pain in patients with the advanced stage of cancer . A prospective study was conducted at the center for palliative care, university clinical center tuzla, bosnia and herzegovina, from january 1 to december 31 2013 . Study entered 369 patients who were due to pain intensity 4 - 8 (medium severe to severe pain) on the numeric rating scale (nrs), treated with a fixed combination of tramadol and acetaminophen (37.5 mg and 325 mg) in the initial dose 3x1 tablets for pain intensity 4, up to 4x2 tablets for pain intensity 7 and 8 . Every day (10 days) pain intensity was recorded and if the previous day was patient had two or more episodes of pain, the dose of fixed combination tramadol and paracetamol was increased to a maximum of 8 tablets daily . During the first 10 days of study 16 patients patients excluded from the study during the first ten days of treatment . * of the total respondents, 369 patients the study ended 353 patients, with mean age of 65.3412.15 years (24 - 92 years), 211 (59.77%) males and 142 (40.23%) females . From the baseline 102 patients (28.89%) had verified metastatic changes in bones while 251 patients (71.11%) had no bone metastases (p<0.0001). In the study was 33.43% of patients with tumors of the gastrointestinal system, 25.22% with lung tumor, while the tumors of other organs account for less than 10%, with varying percentages of bone metastases (table 2). Tumor localization . * from total of 353 patients; * * from total of 102 patients; o * * * = other tumors of bones and connective tissue, unknown localization, non cancer pain; & esophagus, stomach, intestines; liver, gallbladder, pancreas from total sample 158 (44.76%) patients were in the palliative stage of cancer disease in period less than 12 months, and 195 or 55.24% of the patients in the period after 12 months (p=0.067) (table 3). Time from ph * diagnosis until psd * * from total of 353 patients; * ph = histopathological diagnosis; psd * * = palliative stage of the disease in 13 (3.68%) of patients palliative stage of the disease is verified in less than three months, with 126 (35.69%) in the period up to 36 months, while in 48 (13:59%) patients specific oncological treatment lasted up to 72 months and in 21 (5.96%) cases for more than six years . All patients were previously informed about the aims and nature of research, and they provided their approval with written informed consent to participate in the study . Statistical analysis was performed by biomedical software medcalc for windows version 9.4.2.0 . For testing the repeated measurements of dependent samples, depending on the distribution of variables the statistical hypotheses were tested at the level of significance of =0.05 or the difference between samples was considered significant if p<0.05 . A) the duration of treatment with a fixed combination tramadol and acetaminophen the average duration of treatment with a fixed combination tramadol and paracetamol for all 353 patients was 57 days (from the shortest treatment duration of 13 to the longest of 330 days). Most common duration of treatment was between 31 - 100 days (in 225 patients or 63.74%), while 2 patients (0.57%) had treatment duration was longer than 300 days (table 4). Duration of treatment with a fixed combination tramadol and acetaminophen . * total 353 patients; * * transfer to morphine; * * * fixed combination used until death in patients with bone metastases, the average duration of treatment with a fixed combination tramadol and acetaminophen was 69 days (14 - 330), and in patients without bone metastases, the median duration of treatment was 52 days (13 - 278), which is significantly lower than compared to patients with bone metastases (p=0.0047). In our study, disease progression and higher pain intensity was sign for transfer to strong opiates in 57 (16.15%) patients, while until the end of life the pain was adequately treated with a fixed combination tramadol and acetaminophen in 51 patients (14.45%) (table 4). B) analysis of the pain intensity by days of treatment for all patients the average pain score in all patients for 10 days of treatment was 2.121:34 where there was a statistically significant difference (p=0.0001) compared to the total intensity of pain in patients with metastatic changes in bones (2.261.47) compared to patients without bone metastasis (2.061.27). On the first day of treatment the average intensity of pain in all patients was 5.541.18, significantly more (p<0.0001) compared to the pain intensity on the tenth day of treatment 1.50.53 (table 5). Average pain intensity by days of treatment among all patients . Measured outside of pain breakthrough; * median, wilcoxon test; * * paired samples t - test comparing the average values of pain intensity by days of treatment of patients with and without bone metastases, on the day of admission the pain intensity was significantly higher (p<0.0001) in patients with bone metastases [median 6.00 (4.00 to 8.00)] versus patients without bone metastases [median 5.00 (4.00 to 8.00)] (table 6). Comparison of average pain intensity of patients with and without bone metastases . Presented as median; * mann - whitney test (independent samples) significantly greater pain intensity was also observed in patients with bone metastases on fifth, sixth and eighth days of treatment with a fixed combination of tramadol and paracetamol compared to patients without bone metastases (figure 1). Mean pain intensity by days of treatment of patients with and without bone metastases analysis of the optimal dose of fixed combination tramadol and paracetamol as the base of analgesics in the treatment of moderate pain the average dose of the fixed combination tramadol and paracetamol (1 tablet = 37.5 mg and 325 mg) for all 353 patients for 10 days of treatment was 4.81.8 tablets (180 mg of tramadol and 1560 mg of paracetamol). The average dose of fixed combination tramadol and paracetamol (for both groups of patients) was higher with each subsequent day of treatment of 4.171 - 53 tablets (156.4 mg tramadol and 1355.3 mg paracetamol) on first to 5.62 1.95 tablets (210.8 mg tramadol and 1826.5 mg paracetamol) on the tenth day of treatment (table 7). Mean number of tablets for fixed combination tramadol and acetaminophen * by days of treatment . * 1 tablet of fixed combination = tramadol 37.5 mg and paracetamol 325 mg in all patients with confirmed bone metastasis mean dose of fixed combination tramadol and acetaminophen was statistically significantly higher (p<0.0001) compared to patients without bone metastasis [5.421.83 (203.25 mg tramadol and paracetamol 1761.5 mg) in patients with metastases versus 4.59 1.79 (172.13 mg of tramadol and paracetamol 1491.8 mg) in patients without bone metastases] (table 8). Comparison of mean dose of fixed combination tramadol and paracetamol by days of treatment in the groups with and without bone metastases . * mann - whitney test (independent samples) on the tenth day of treatment in the group of patients without bone metastases average dose of tramadol in fixed combination tramadol and paracetamol was 200.25 mg of tramadol, while on the same day in a group of patients with bone metastases average dose of tramadol was significantly higher (p<0.0001) and amounted to 236.3 mg of tramadol (figure 2). The average dose of tramadol in a fixed combination tramadol and paracetamol by groups and days of treatment in the group of patients without bone metastases, on the tenth day of treatment, the average dose of paracetamol in a fixed combination tramadol and paracetamol was 1735.5 mg of paracetamol, while on the same day in a group of patients with bone metastases average dose of paracetamol were statistically significantly higher (p<0.0001) and amounted to 2047.5 mg of paracetamol (figure 3). The average dose of paracetamol in a fixed combination tramadol and paracetamol by groups and days of treatment from a total of 353 patients surveyed, during the first 10 days of treatment, side effects of mild to moderately high intensity (corrected with additional targeted therapy and did not jeopardize the continuation of treatment with a fixed combination tramadol and paracetamol) occurred in 103 patients (29.18%) (table 9). The frequency of side effects in the treatment of pain with a fixed combination of tramadol and paracetamol . * from 103 patients with side effects; * * from total of 353 patients nausea that was present in 39.8% and vomiting with 34.9% were the dominant side effects in the treatment of pain with a fixed combination tramadol and acetaminophen, while the dizziness was observed in 8 (7.77%) and somnolence in 2 (1.94%) patients (table 9). A study published in 2011 on the efficacy and safety of a fixed combination tramadol and acetaminophen in the treatment of medium to severe pain (16) states a significant analgesic efficacy of this combination with a reduction in average pain intensity from an initial 6.1 to 3.1, with 64.8% of patients described significant pain relief . Data from the same study indicate that 90.5% of patients have a high degree of satisfaction with treatment and 78.7% of patients assessed the general situation as much better . Of the surveyed 2663 patients with an average age of 73.66.6 years, 119 (4.5%) reported at least one side effect in form of as known and foreseeable ones . Similar results were also confirmed by our research, while in our research at the start of the study (the first day of treatment) average pain intensity in all patients was 5.541.18 which was significantly higher (p<0.0001) compared to the pain intensity on the tenth day of treatment 1.500:53 . Already after 24 hours of treatment by a fixed dose of tramadol and acetaminophen, the average pain intensity of all patients was significantly lower p<0.0001 [5.00 (4.00 to 8.00) on the first day compared to the average pain intensity 2.00 (1.00 to 7.00) on the second day of treatment] which indicates the rapid onset of the drug action . Review paper, published in 2008 (17), the efficiency of a fixed combination tramadol and acetaminophen in the treatment of mild to moderate pain included 15 studies . Nine studies (double - blind trials with a treatment duration of 1 - 10 days) includes a total of 2537 patients with chronic degenerative diseases (with the emergence of pain) after trauma or postoperatively, showed that the most common average dose of fixed combination tramadol and paracetamol (37.5 mg and 325 mg) was from 4.34.5 tablets . In six studies in which the duration of treatment was 4 - 13 weeks for the bone muscle pain, it was followed 1890 patients, and the mean daily dose of fixed combination tramadol and acetaminophen (37.5 mg and 325 mg) was 3.54.2 tablets daily . In our study an average dose of fixed combination tramadol and paracetamol for all 353 patients during 10 days of treatment was 4.8 1.8 tablets (180 mg of tramadol and paracetamol 1560 mg). The average dose of fixed combination tramadol and paracetamol was higher with each subsequent day of treatment with 4.171.53 tablets (156.4 mg of tramadol and 1355.3 mg of paracetamol) on the first to 5.6 1.95 tablets (210.8 mg of tramadol and paracetamol 1826.5) on the tenth day of treatment . In a study by ajay et al . (18) a total of 204 patients with moderate to severe pain of muscle marrow origin was treated with a combination of phentermine (50 mg) and diclofenac sodium (75 mg) (group a) and a fixed combination of tramadol and acetaminophen (37.5 and 325 mg) (group b). The intensity of pain with the use of a fixed combination tramadol and paracetamol after 5 days of treatment (measured by vas scale) is reduced from an average of 74 on the first day to 36.72 on the fifth day of treatment . However a combination of phentermine (50 mg) and diclofenac sodium (75 mg) showed better efficacy in the treatment of pain, wherein the average intensity of pain on the first day was 70.74 and 20.74 of the fifth, which is statistically better (p = 0.0001) compared to treatment than with fixed combination of tramadol and paracetamol . Similar results on the efficacy of a fixed combination tramadol and paracetamol in the treatment of pain in a group of patients with bone metastases (muscle bone pain) shows our research . In our study, the average pain intensity in patients with bone metastases (muscle bone pain) on the first day of treatment was 6.07841.1831, on the fifth day significantly lower 1.94120.6265 (p<0.001) and on the tenth day of treatment 1.58820.5691 (p<0.001) which supports the analgesic efficacy of a fixed combination tramadol and paracetamol . This claim is confirmed by a study carried out on 336 patients with chronic back pain (19) where the initial pain intensity was 67.8; immediately after the start of treatment was reduced to 47.4 and after 3 months of treatment at even 1.8 . In this study followed side effects of which the most common were nausea (12.0%), dizziness (10.8%) and constipation (10.2%). The average daily dose of tramadol and paracetamol was 4.2 tablets (158 mg of tramadol and 1369 mg of paracetamol). Our findings show that the side effects, during the treatment of pain with a fixed combination tramadol and paracetamol were registered in 103 patients or 29.18%, with the dominance of nausea and vomiting . (20) reported frequency of side effects in 35.88% of patients in the treatment of pain with a fixed combination of tramadol and acetaminophen, wherein the dominant was vomiting (27.35%) and nausea (25.88%), but much less common headache (5.88%), dizziness (3.82%) and somnolence (1.47%). (21) vomiting occurred in 28.8%, nausea in 25.8%, dizziness in 15.9% and somnolence in 9.1% of patients with pain treated with fixed combination tramadol and paracetamol . Limitations of the research there are a small number of studies in which was compared the use of fixed - dose drug treatment of the moderate to severe cancer pain, and lot more research on the treatment of some forms of non - carcinoma pain, especially skeletal and muscle . This study did not presented, nor the frequency nor the ways of cropping breakthrough of pain in our patients . Duration of life and other disorders that accompany the advanced carcinoma limit the accuracy of research . Fixed combination of tramadol and acetaminophen can be used as an effective combination in the treatment of chronic cancer pain, with frequent dose evaluation and mild side effects.

The term amyotrophic lateral sclerosis (als) was first coined by charcot, who postulated the primacy of the upper motor neuron (umn) in als pathogenesis.1 assessment of cortical function in als and identification of the characteristic clinical phenotype involving combined upper and lower motor neuron abnormalities remain the key for als diagnosis.24 however, despite charcot's initial observations, the site of disease onset and mechanisms underlying als pathophysiology remain areas of intense study and debate.5 in this setting, assessment of motor cortical and corticospinal function using non - invasive techniques, such as transcranial magnetic stimulation (tms), has enhanced our understanding of als pathophysiology and resulted in novel diagnostic approaches . Single-, paired- and multiple - pulse tms techniques have all been used (figure 1) with the following measures taken to reflect corticomotoneuronal function: motor threshold (mt), motor evoked potential (mep) amplitude, central motor conduction time (cmct), cortical silent period (csp), intracortical inhibition and facilitation . The present review will focus on the mechanisms underlying the generation of these tms measures, while at the same time assessing the contributions tms has made in the understanding of als pathophysiology . With an eye towards the future, the review will also consider the potential diagnostic utility of tms in als and incorporation of tms as a disease biomarker in the assessment of neuroprotective medications in a clinical trial setting . Transcranial magnetic stimulation excites a network of neurons in the underlying motor cortex with motor evoked potentials recorded over the contralateral abductor pollicis brevis muscle . The motor cortex is preferentially stimulated when the current flows in a posterior anterior direction within the motor cortex . Mt reflects the ease with which corticomotoneurons are excited and is proposed to be assessed by the international federation of clinical neurophysiology as the minimum stimulus intensity required to elicit a small (usually> 50 v) mep in the target muscle in 50% of trials.6 with the recent adaptation of threshold tracking techniques, mt can also be measured as the stimulus intensity required to elicit and maintain a target mep response of 0.2 mv.79 mt reflects the density of corticomotoneuronal projections onto the spinal motor neuron with the highest density of projections to intrinsic hand muscles having the lowest mts.1012 mts are lower in the dominant hand12 and correlate with the ability to perform fine (fractionated) finger tasks,13 so that mt has the potential to map corticomotoneuronal representation and function . As well as reflecting the density of corticomotoneuronal projections, mts may also be a biomarker of cortical neuronal membrane excitability.1416 mts are influenced by the glutamatergic neurotransmitter system, through -amino-3-hydroxy-5-methyl-4-isoxazoleproprionic acid (ampa) receptors, whereby excessive glutamate activity reduces mts.17 in contrast, pharmacological blockade of voltage - gated sodium channels raises mt.18 in als, abnormalities in mt have been inconsistent . While some tms studies reported an increased mt or even an inexcitable motor cortex,1926 others have documented either normal or reduced mt.2732 these discrepancies likely relate to heterogeneity of the als phenotype and the stage of disease at time of testing and rate of progression . Longitudinal studies have documented a reduction of mts early in the disease course, increasing to the point of cortical inexcitability with disease progression.29 the early reduction in mt appears most pronounced in als patients with profuse fasciculations, preserved muscle bulk and hyper - reflexia.33 fasciculations may precede other features of als by many months and taken in association with reduced mt suggest a cortical origin of fasciculations in als.34 reduced mt may be modulated by increased glutamate excitation, reduced gamma - aminobutyric acid (gaba) inhibition or a combination of both . Reduced mt early in als supports an anterograde transsynaptic process, whereby cortical hyperexcitability underlies the development of progressive neurodegeneration . Mep amplitude reflects a summation of complex corticospinal volleys consisting of d (direct)- and i (indirect)-waves.14 35 at threshold, tms elicits i - waves at intervals of 1.5 ms, which increase in amplitude with increasing stimulus intensity.35 the increase in mep amplitude with increasing stimulus intensity may be used to generate a stimulus response curve that follows a sigmoid function.36 as with mt, the mep amplitude reflects the density of corticomotoneuronal projections onto motor neurons.37 when compared with mt, the meps probably assess the function of neurons that are less excitable or further away from the centre of the tms induced electrical field.38 the mep amplitude should be expressed as a percentage of the maximum compound muscle action potential (cmap) evoked by electrical peripheral nerve stimulation.6 doing so takes into account any lower motor neuron pathology and provides insight into the percentage of the motor neurone pool activated in the mep . Normative values for the mep to cmap ratio demonstrate a large inter - subject variability thereby reducing the sensitivity and limiting the value of this measure for detecting abnormalities of the corticomotoneurons.38 39 the mep responses are modulated by a variety of neurotransmitter systems within the central nervous system.37 40 specifically, gabaergic neurotransmission via gabaa receptors suppresses while glutamatergic and noradrenergic neurotransmission enhances the mep amplitude.41 of interest, these changes in mep amplitude occur independently of changes in mt, suggesting that physiological mechanisms underlying the generation of the mep amplitude and mt are varied . Abnormalities of meps have been extensively documented in als.38 increases in mep amplitude have been reported in sporadic and familial forms of als (figure 2a), most prominently early in the disease course.30 31 42 mep amplitude correlates with surrogate biomarkers of axonal degeneration, such as the strength duration time constant, thereby providing an association between cortical hyperexcitability and motor neuron degeneration.30 43 the increase in mep amplitude in als is not seen in mimic disorders despite a comparable degree of lower motor neuron dysfunction (figure 2b). This suggests that the mep amplitude changes in als are excitotoxic in nature.4447 (a) the motor evoked potential (mep) amplitude, expressed as a percentage of compound muscle action potential (cmap) response, is significantly increased in sporadic amyotrophic lateral sclerosis (als) and familial als (fals) when compared with healthy controls . (b) the mep amplitude is significantly increased in als when compared with pathological and healthy controls, thereby distinguishing als from als mimic disorders . * cmct represents the time from stimulation of the motor cortex to the arrival of corticospinal volley at the spinal motor neuron.6 multiple factors contribute to the cmct including time to activate the corticospinal cells, conduction time of the descending volley down the corticospinal tract, synaptic transmission and activation of spinal motor neurons.48 cmct may be measured using either the f - wave or cervical (or lumbar) nerve root stimulation methods;49 50 both methods provide only an estimation of the cmct,48 51 and given that a variety of technical, physiological and pathological factors influence cmct,48 there is a range of normative data . In als, cmct is typically modestly prolonged,21 29 52 probably reflecting axonal degeneration of the fastest conducting corticomotoneuronal fibres and increased desynchronisation of corticomotoneuronal volleys secondary to axonal loss.28 53 54 the d90a - sod1 als mutation is a unique exception; in this disorder cmct is typically very prolonged.55 the sensitivity of detecting a prolonged cmct may be improved by recording from both upper and lower limb muscles, or from cranial muscles in als patients with bulbar onset disease.26 56 csp refers to the interruption of voluntary electromyography activity in a target muscle induced by stimulation of the contralateral motor cortex.57 the csp duration is measured from the onset of the mep response to resumption of voluntary electromyography activity37 57 and increases with stimulus intensity.5759 the csp is mediated by both spinal mechanisms, in its early part, and cortical inhibitory neurons acting via gabab receptors in the latter part.57 58 6063 since the duration is determined by the latter part, the csp is a measure of cortical inhibition . In addition, the density of the corticomotoneuronal projections onto motor neurons also influences the csp, with the csp duration being the longest for upper limb muscles.38 abnormalities of the csp duration are well established in als.37 absence or reduction in csp duration has been reported in both sporadic and familial als, with the reduction of csp duration being the most prominent early in the disease course.3032 44 46 52 6467 the reduction of csp duration appears to be specific for als among neuromuscular disorders, being normal in x - linked bulbospinal muscular atrophy (kennedy's disease), acquired neuromyotonia and distal hereditary motor neuronopathy with pyramidal features.4447 although the mechanisms underlying csp duration reduction in als remain to be established, decreased motor drive and reduced gabaergic inhibition, either due to degeneration of inhibitory interneurons or dysfunction of gabab receptors, may underlie the reduction of csp duration in als . An absent or delayed ipsilateral csp has also been reported as an early abnormality in als.67 68 the ipsilateral csp depends on functioning of transcallosal glutamatergic fibres projecting onto inhibitory interneurons in the non - stimulated motor cortex,69 and degeneration of these transcallosal fibres or their targeted inhibitory interneurons may account for abnormalities of the ipsilateral csp in als . The previous section has covered conventional tms parameters that can be assessed through activation of the motor cortex by single impulses . Motor cortical excitability may also be assessed using paired - pulse techniques, in which a conditioning stimulus modulates the effect of a second test stimulus . Several different paired - pulse paradigms have been developed,37 38 but short interval intracortical inhibition (sici), intracortical facilitation (icf) and long interval intracortical inhibition have been most frequently used in als clinical research as methods to determine cortical excitability . To identify sici and icf, a subthreshold conditioning stimulus is typically delivered at predetermined time intervals prior to a suprathreshold test stimulus.8 7072 in the early tms paradigms,70 72 73 the conditioning and test stimuli were kept constant, and changes in the test mep amplitude were evaluated . Typically, if the interstimulus interval (isi) was between 1 and 5 ms, the test response was inhibited (sici). Increasing the isi to between 7 and 30 ms resulted in the facilitation of the test response (icf).38 by recording the descending corticospinal volleys through epidural electrodes at the level of the cervical spinal cord, it has been deduced that both sici and icf originate at the level of the motor cortex.35 72 specifically, sici is associated with a reduction in the number and amplitude of late i - waves, namely i2 and i3, with i - wave suppression remaining up to an isi of 20 ms, which is the typical duration of the inhibitory postsynaptic potential mediated through gabaa receptors.71 74 sici and icf appear to be physiologically distinct processes as evident by lower thresholds for activation of sici and sici remains independent of the direction of current flow in the motor cortex induced by a subthreshold conditioning pulse in healthy subjects, while icf appears to be preferentially generated by current flowing in a posterior constant stimulus paired - pulse technique has been the marked variability in mep amplitudes with consecutive stimuli.71 75 to overcome this limitation, a threshold tracking technique was developed whereby a constant target mep response (0.2 mv) was tracked by a test stimulus.7 8 using threshold tracking, two phases of sici were identified,7 8 76 77 a smaller phase at isi 1 ms and a larger phase at isi 3 ms (figure 3a). Although synaptic neurotransmission through the gabaa receptor mediates the second phase of sici,74 7880 the precise mechanisms underlying the first phase of sici remain uncertain . It was initially suggested that the first phase of sici reflected local excitability properties, particularly relative refractoriness of cortical axons, with resultant resynchronisation of cortico - cortical and corticomotoneuronal volleys.7 81 subsequently, it has been argued that synaptic processes best explain the development of the initial phase of sici, possibly driven by activation of cortical inhibitory circuits that were distinct to those that mediated the later sici phase.76 77 82 (a) short interval intracortical inhibition (sici), defined as the stimulus intensity required to maintain a target motor evoked potential of 0.2 mv, as assessed by the threshold tracking transcranial magnetic stimulation technique . Intracortical inhibition is illustrated by an increase in the conditioned test stimulus intensity required to track the target response, while intracortical facilitation is indicated by a reduction in test stimulus intensity . In healthy controls, sici develops between interstimulus intervals (isi) of 1 and 7 ms, with two peaks evident at 1 and 3 ms as indicated by the arrows . Sici is significantly reduced in both sporadic amyotrophic lateral sclerosis (sals) and familial amyotrophic lateral sclerosis (fals). (b) averaged sici, between isi 1 and 7 ms, was reduced in two presymptomatic superoxide dismutase-1 (sod-1) mutation carriers 6 months prior to the development of als . (c) normalised sici, expressed as a fraction of the sici value measured at the first study, was reduced 8 months prior to development of als in a third presymptomatic sod-1 mutation carrier . A reduction or absence of sici, together with an increase in icf, indicative of cortical hyperexcitability has been documented in cohorts of sporadic and familial als patients (figure 3a).3032 44 45 8388 of relevance, cortical hyperexcitability appears to be an early feature in sporadic als, correlating with measures of subsequent peripheral neurodegeneration.30 in addition, cortical hyperexcitability appeared as an early feature in familial als due to mutations linked to the superoxide dismutase-1 (figure 3a) and fused in sarcoma (fus) genes,31 preceding the clinical development of familial als (figure 3b).31 neuropathological studies in als have identified degeneration of inhibitory cortical interneurons89 and this could account for the reduction in sici . Separately, glutamate - mediated excitotoxicity may also contribute to sici reduction, as was suggested by partial correction of sici abnormalities in als patients treated with the glutamate antagonist riluzole.87 a recent study documenting sici reduction at low (40% of resting mt (rmt)), medium (70% of rmt) and high (90% of rmt) conditioning stimulus intensities in als patients provided further support for the notion that abnormalities in sici appeared to be mediated by a combination of glutamate excitotoxicity and degeneration of inhibitory cortical circuits.90 as such, preserving the integrity of intracortical inhibitory circuits, and counteracting excitatory cortical circuits, may serve as potential therapeutic options in als . A peristimulus time histogram technique can assess the function of a select subset of corticomotoneurons by recording the perturbation of voluntarily recruited motor units induced by a threshold cortical stimulation.53 in healthy controls, there is a well synchronised primary peak with a latency of approximately 2030 ms recording from hand or forearm muscles.28 53 analysis of this primary peak in disease states such as als provides information on corticomotoneuronal conduction time, the extent of desynchronisation of corticomotoneuronal descending volleys, the degree of corticomotoneuronal synaptic input onto the anterior horn cell and the timing of excitatory and inhibitory inputs to the motor neuron.33 in als, the primary peak becomes desynchronised, prolonged in duration and delayed.28 91 92 in addition, the amplitude of the primary peak may be increased with additional subcomponents both suggestive of corticomotoneuronal hyperexcitability.53 93 these primary peak abnormalities appear early in als, accompanied by reduced mts . With progression of disease, there is prolongation and increased desynchronisation of the primary peak, findings possibly specific to als when compared with healthy controls and kennedy's disease.53 94 over recent years, collision techniques such as the triple stimulation technique (tst) have been used to reduced the degree of mep desynchronisation which normally occurs following a single cortical stimulus.95 96 this complex technique is performed by first delivering a high - intensity magnetic stimulus to motor cortex followed by supramaximal electrical stimulation of the peripheral nerve supplying the target muscle at the wrist such that the descending corticomotoneuronal volley is collision takes place along the proximal segment of the peripheral nerve at the upper arm . A third stimulus is subsequently delivered to erb's point (axilla) after an appropriate delay, eliciting a highly synchronised motor response in those fibres in which the collision had occurred . The amplitude and area of this test cmap response are compared with the response induced by the conditioned tst paradigm (erb's point - wrist erb's point stimulation) yielding an amplitude ratio of> 93% and area ratio of> 92% in healthy controls.95 96 in als, the tst is sensitive at detecting subclinical corticomotoneuronal dysfunction.54 97 corticomotoneuronal dysfunction was also reported in kennedy's disease using the tst technique,98 99 potentially limiting the diagnostic utility of tst in als . Recently, however, a combination of tst with single- and paired - pulse tms techniques has reaffirmed the functional integrity of corticomotoneuronal tracts in kennedy's disease,100 and thereby the diagnostic utility of tst . Given the well documented tms abnormalities in als patients, the tms techniques may be of utility in the diagnostic process of als . Although umn signs may be clinically evident in als, in some phenotypes such as the flail arm variant, this may not be the case, and detection of subclinical umn dysfunction may facilitate the diagnosis.42 abnormalities of cortical excitability, including an increase in mep amplitude along with reduction of sici and rmts, have been reported in the flail - arm variant of als, underscoring the utility of tms in detecting subclinical umn dysfunction.42 of further relevance, subclinical umn dysfunction has been reported in progressive muscular atrophy (pma),101103 suggesting that pma may be a phenotype of als . While corticomotoneuronal integrity was recently reported to be intact in pma using a -band intermuscular coherence technique,104 assessment of cortical function with tms techniques may be of diagnostic utility, especially in light of presence of subclinical umn pathology in pma.102 103 importantly, single- and paired - pulse tms techniques reliably distinguish als from the mimic disorders (table 1), hastening the diagnosis of als by up to 8 months.47 a reduction in averaged sici, between isi 1 and 7 ms, and peak sici at isi 3 ms were the most robust diagnostic tms parameters, with the finding of absent sici exhibiting a sensitivity of 97%.47 of further relevance, tms studies have established the presence of early and subclinical dysfunction of cortico - bulbar and cortico - respiratory tracts in als,26 105107 thereby suggesting a potential diagnostic utility of bulbar and diaphragmatic mep recordings . In addition, combining tms with radiological techniques, such as mr spectroscopy, may further add to the diagnostic yield especially given the sensitivity of mr spectroscopy in detecting subclinical umn dysfunction.108110 consequently, combining tms techniques, in particular the recording of sici as well as bulbar and diaphragmatic meps, together with radiological techniques, such as mr spectroscopy, may enable an earlier diagnosis of als and thereby commencement of neuroprotective therapies and recruitment into clinical trials . Transcranial magnetic stimulation (tms) techniques in amyotrophic lateral sclerosis (als) mimic disorders single - pulse tms studies have established a normal resting motor threshold (rmt) and cortical silent period (csp) duration in all als mimic disorders . The motor evoked potential (mep) amplitude was reported to be increased in spinal muscular atrophy (sma), a finding attributed to greater corticomotoneuronal projections onto the surviving motor neurons . In addition, the central motor conduction time (cmct) was reportedly prolonged in distal hereditary motor neuronopathy with pyramidal features (dhmnp). Short interval intracortical inhibition (sici) and intracortical facilitation (icf), assessed by the paired - pulse tms technique, have been universally normal in als mimic disorders . In contrast, triple stimulation techniques (tst) have been reportedly abnormal in kennedy's disease, suggesting subclinical upper motor neuron dysfunction, although a recent study has reaffirmed functional integrity of corticomotoneuronal tracts in kennedy's disease (see utility of peristimulus time histograms section). Single- and paired - pulse techniques have also been normal in facial onset sensory motor neuronopathy (fosmn) syndrome . * neuromuscular disorders include demyelinating neuropathy, myasthenia gravis, lead toxicity and hirayama's disease . In addition to its diagnostic utility, it has been suggested that tms may exhibit a clinical utility in assessing disease progression in als.111 specifically, longitudinal tms studies in als patients reported a significant reduction in mep amplitude, mt and cmct, and suggested that reduction in mep amplitude may be an objective biomarker of disease progression in als.111 in contrast, others have failed to document any significant longitudinal changes in tms parameters, thereby arguing against tms utility in the monitoring of disease progression in als.52 prospective longitudinal studies are indicated to further clarify the role for tms in monitoring disease progression in als . In his original writings, charcot concluded that als was a disorder of the brain and that the lower motor neuron component resulted from a downstream affect . Not all his contemporaries agreed and in particular gowers was adamant that the demise of upper and lower motor neurons were independent events . In the past 2 decades the site of als onset has been revisited, to a large extent precipitated by the advent of tms . Three schools of thought have developed pertaining to the role of the umn, and related pathophysiological processes in als: (i) the dying forward hypothesis, (ii) the dying back hypothesis and (iii) the independent degeneration hypothesis (figure 4). While the site of disease onset in als remains uncertain, tms studies have tended to favour a cortical origin, with excitotoxicity mediating motor neuron degeneration in als.5 112 the dying forward and dying back hypothesis of amyotrophic lateral sclerosis (als). The dying forward hypothesis proposed that als was primarily a disorder of the corticomotoneurons (highlighted in red), with anterior horn cell degeneration mediated via an anterograde glutamate - mediated excitotoxic process . In contrast, the dying back hypothesis proposes that als begins within the muscle or neuromuscular junction, with pathogens retrogradely transported from the neuromuscular junction to the cell body where these pathogens may exert their deleterious effects . The dying forward hypothesis proposes that als is primarily a disorder of the corticomotoneurons, which connect monosynaptically with anterior horn cells.113 corticomotoneuronal hyperexcitability was postulated to induce anterior horn cell degeneration transsynaptically via an anterograde glutamate - mediated excitotoxic process.113 most tms studies have demonstrated that cortical hyperexcitability is an early feature in sporadic and familial als, linked to motor neuron degeneration.27 30 31 43 65 112 114 115 in addition, longitudinal studies in asymptomatic sod-1 mutation carriers revealed that cortical hyperexcitability developed prior to the clinical onset of als,31 also seen in the g93a sod-1 mouse model.116 of relevance, loss of parvalbumin - positive inhibitory interneurons in the motor cortex of als patients would contribute to the development of cortical hyperexcitability.117 in keeping with a cortical origin of als is the now accepted view that als and frontotemporal dementia (ftd) represent an overlapping continuum of the same disorder,118 119 an observation underscored by recent genetic findings establishing that increased hexanucleotide repeat expansion in the first intron of c9orf72 gene on chromosome 9p21 is associated with both als and ftd.120 121 of further relevance, accumulation of tdp-43 ubiquitinated inclusions in anterior horn cells appears to be a pathological hallmark of als.119 122 interestingly, identical tdp-43 inclusions may also be evident in cortical neurons within the frontal (betz cells) and temporal lobes of als patients,119 122 123 underscoring the link between ftd and als, and thereby a cortical origin of als . Of relevance, molecular approaches have provided further corroborating evidence for glutamate excitotoxicity in als . Specifically, a significant reduction in the expression and function of the astrocytic glutamate transporter, excitatory amino acid transporter 2 (eaat2), has been reported in the sod-1 mouse model and the motor cortex and spinal cord of als patients.124128 in addition, dysfunction of eaat2 transporter appeared to be a preclinical feature in the sod-1 mouse model.129 130 further underscoring the importance of astrocytes in als pathophysiology are recent stem cell studies documenting that motor neuron degeneration appears to be initiated by dysfunction of astrocytes.131 on the postsynaptic side, increased expression of glutamate receptors permeable to excessive influx of na and ca ions132 have been reported in als,133137 potentially rendering the motor neurons more susceptible to glutamate excitotoxicity.138 further support for a role for glutamate excitotoxicity has been indirectly provided by the clinical benefit of riluzole, a glutamate antagonist, in als patients.139142 for the glutamate hypothesis to be a plausible mechanism of motor neuron degeneration, the issue of selectivity of motor neuron involvement in als, together with sparing of motor neurons in non - als conditions exhibiting cortical hyperexcitability,38 must be explained . A number of molecular features may render the motor neurons vulnerable to glutamate toxicity in als . First, motor neurons preferentially express glutamate receptors, such as the ampa receptors, which are more permeable to influx of ca ions.133 134 136 137 in addition, motor neurons in als patients lack the intracellular expression of ca binding proteins parvalbumin and calbindin d28k, both required to buffer intracellular ca.143 144 aberrant activity of the inositol 1,4,5-triphosphate receptor type 2 receptor has been reported in als,145 146 thereby resulting in higher intracellular concentrations of ca within the motor neurons . Ultimately, an influx of ca ions through the ionotropic glutamate receptors nmda occurs in the motor neurons,147 148 resulting in increased intracellular ca concentration and activation of ca - dependent enzymatic pathways that mediate neuronal death.149151 glutamate excitotoxicity may also result in production of free radicals that can further damage intracellular organelles and thereby cause cell death.152154 it could be argued that the finding of widespread fasciculations in als, an important diagnostic criterion,155 may argue against a dying forward mechanism given that fasciculations are thought to originate from the distal motor axon, are associated with abnormalities of sodium and potassium conductance, and may precede the onset of lower motor neuron dysfunction.156162 it seems unlikely that cortical hyperexcitability could lead to changes in distal axonal excitability that would result in widespread fasciculations . Importantly, a supraspinal mechanism for triggering fasciculations in als has been previously reported.34 in agreement with this notion are findings that fasciculations in als may originate at the level of the motor neuron cell body.157 as such, it could be hypothesised that hyperexcitability of descending motor pathways may contribute to generation of fasciculation in als, thereby providing additional support for a dying forward process . In conjunction with glutamate excitotoxicity, there is compelling evidence that mitochondrial dysfunction may exert an important role in the pathophysiology of als.163168 under conditions of excessive ca load, as may be evident with glutamate excitotoxicity,169 mitochondrial production of free radicals increases resulting in injury of critical neuronal cellular proteins and dna . Mitochondrial dysfunction may in turn enhance glutamate excitotoxicity by disrupting the normal resting membrane potential, resulting in loss of the voltage - dependent mg - mediated block of nmda receptor channels.170 from a therapeutic perspective, dexpramipexole, a pharmacological agent that enhances mitochondrial function,171 was effective in slowing als progression in a recent phase ii trial.172 a phase iii, multicentre, international trial was commenced in march 2011 to determine the clinical efficacy of dexpramipexole in als (clinicaltrials.gov-nct01281189). Taken further, it is anticipated that tms studies will be used to determine the efficacy of dexpramipexole in the modulation of cortical excitability in an attempt to provide further insight into als pathophysiology . The dying back hypothesis proposes that als is primarily a disorder of the lower motor neurons, with pathogens retrogradely transported from the neuromuscular junction to the cell body where they exert their deleterious effects.173 although some pathological studies have indirectly supported a dying back process,174176 no pathogens of any type have been identified in relation to als . The presence of widespread dysfunction within the frontal cortex, including the primary, supplementary and prefrontal motor cortices in als, remains difficult to reconcile with a dying back process.3 110 177 in addition, the absence of central pathology in other lower motor neuron disorders such as kennedy's disease or poliomyelitis provides a further argument against a dying back process.33 44 the independent degeneration hypothesis suggests that the upper and lower motor neurons degenerate independently.178 some 100 years after the original gowers publication, neuropathological studies provided support for the independent degeneration hypothesis whereby the degeneration of upper and lower motor neurons appeared to be independent.179 180 these correlative morphological techniques, however, may be confounded by the anatomical and functional complexity of the corticomotoneuronal system.181 in particular, there remains considerable variability in the corticomotoneuronal to anterior horn cell ratio, due to synaptic changes, and as such attempts to correlate upper and lower motor neurons on autopsy studies may not be meaningful.33 in addition to the three competing theories of als pathogenesis, a prion - like propagation hypothesis has also been suggested.182 specifically, the previously documented contiguous spread of als5 183 could be explained by direct neuron - to - neuron transmission of pathogenic proteins via exosomes, defined as small lipid membranous microvesicles.182 the pathogenic exosomes could spread in either a rostral direction, explaining the rostral - to - caudal spread of als, or in a lateral horizontal direction accounting for the lateral - to - medial spread of disease . In addition, non - contiguous propagation of als could also be explained by spread of pathogenic proteins or toxic molecules through the blood or csf via exosomes.182 interestingly, the genes implicated in als pathogenesis, including tdp-43 and fus, possess a putative prion domain.184 although a prion - like propagation mechanism may seem an attractive explanation for the spread of als, at present there is no direct evidence to support such a process in als . Although first described by charcot some 150 years ago, the pathophysiological mechanisms underlying als, variability, rate of progression and site of disease onset remain obscure . Objective assessment of umn function in als remains a difficult task in clinical neurophysiology.185 while tms is mainly used as a clinical research tool, conducted in specialised neurophysiological laboratories, there is an urgent need to objectively assess umn function in als . This has been underscored by the recent awaji diagnostic criteria.155 186 although needle electromyography is used by the criteria to objectively assess lower motor neuron dysfunction, the detection of umn involvement is based solely on clinical examination . Much has recently been learnt about als from mri, especially diffusion tensor mri, functional imaging and network analysis,110 187198 but these tools remain prohibitively expensive, not readily available and may exhibit a modest diagnostic sensitivity.190 commercially available tms systems that will enable an objective assessment of umn function could be readily developed, facilitating the diagnosis of als . Such tms systems may result in the development of more functional als biomarkers that could be used in future drug trials for early patient recruitment and monitoring of drug efficacy . Although first described by charcot some 150 years ago, the pathophysiological mechanisms underlying als, variability, rate of progression and site of disease onset remain obscure . Objective assessment of umn function in als remains a difficult task in clinical neurophysiology.185 while tms is mainly used as a clinical research tool, conducted in specialised neurophysiological laboratories, there is an urgent need to objectively assess umn function in als . This has been underscored by the recent awaji diagnostic criteria.155 186 although needle electromyography is used by the criteria to objectively assess lower motor neuron dysfunction, the detection of umn involvement is based solely on clinical examination . Much has recently been learnt about als from mri, especially diffusion tensor mri, functional imaging and network analysis,110 187198 but these tools remain prohibitively expensive, not readily available and may exhibit a modest diagnostic sensitivity.190 commercially available tms systems that will enable an objective assessment of umn function could be readily developed, facilitating the diagnosis of als . Such tms systems may result in the development of more functional als biomarkers that could be used in future drug trials for early patient recruitment and monitoring of drug efficacy.

Macrophages (m) are one of the resident cell types in synovial tissue, along with fibroblasts . While quiescent in health, m become activated in the inflamed joint, where they make up around 3040% of the cellular content, and regulate secretion of pro - inflammatory cytokines and enzymes involved in driving the inflammatory response and joint destruction (firestein and zvaifler, 1990). Their position throughout the sub - lining layer and lining layer at the cartilage it is estimated that rheumatoid arthritis (ra) and psoriatic arthritis (psa) each affects approximately 1% of the population (firestein, 2003; gladman, 2009), leading to patient pain and disability as well as contributing to a great economic burden in terms of lost working days and patient health services (cooper, 2000) and therefore is an area of intense investigation . As our understanding of inflammation progresses, including the recent concept that resolution of inflammation is an active process rather than a passive return to homeostasis, the role of m is increasingly appreciated . The inability to resolve acute inflammation may lead to a chronic inflammatory state . Depending on their phenotype, m can secrete either pro- or anti - inflammatory cytokines and mediate matrix destruction or deposition . Synovial m participate in many of the events driving inflammation including the stimulation of angiogenesis, leukocyte and lymphocyte recruitment, fibroblast proliferation, and protease secretion leading to eventual joint destruction (burmester et al ., 1997; vallejo et al ., 2003; abeles and pillinger, 2006). While ra and psa are considered more inflammatory than osteoarthritis (oa), it can still contain an inflammatory component, of which m play a large part . In all of these conditions depletion of m from both ra and oa synovial cell cultures leads to reduced synovial fibroblast responses such as cytokine and mmp production (janusz and hare, 1993; bondeson et al ., both macrophages and fibroblasts display an activated cell phenotype with increased cell surface expression of hla - dr and leukocyte adhesion molecules (athanasou et al ., 1988; interaction of m with t - cells potentiates the expression of several pro - inflammatory mediators such as il-1 and and mmps (mcinnes et al . Important pro - inflammatory cytokines like tnf and il - l are abundant in the inflamed synovium and are characteristically released by classically activated (m1) m . The importance of m in driving the inflammatory response has been highlighted by several quantitative microscopic studies, where they have shown that m number; correlates with disease activity (tak et al ., 1997), has potential use as a biomarker for disease (kruithof et al ., 2006; bresnihan et al ., 2009) and declines in response to therapy (goedkoop et al ., 2004; canete et al .,, a prominent feature of the inflamed joint, promotes the survival of monocytes / macrophages and induces their anaerobic adaptations including glycolysis (roiniotis et al ., it is long appreciated that m play an important role in the pathogenesis of arthritis and this observation was supported by studies showing that the number of m was increased in clinically affected joints compared to non - affected joints (kraan et al ., 1998). Several studies also linked the number of synovial m to inflammatory cytokine production joint destruction (mulherin et al ., the culmination of this work has led to sub - lining cd68 positive synovial m currently being the only validated biomarker for disease severity (tak et al ., 1997) and response to therapy in arthritis (haringman et al ., 2005), further confirming their importance in the pathogenesis of this disease, a finding which is independent of treatment type (haringman et al ., 2005; thurlings et al ., several studies have concluded that m number is decreased in psa synovial tissue following therapy (goedkoop et al . Besides the abundant pro - inflammatory cytokines and chemokines present in inflamed synovial tissue, activation, and survival of m can be achieved through acetylation or de - acetylation of histones . Downstream effects of tnf and other molecules results in the induction of histone acetyltransferase (hat) activity in m which causes acetylation of histones and subsequent modulation of transcriptional activity . Two recent studies have found evidence of depressed hdac activity in ra, particularly in synovial macrophages and fibroblasts . The ratio of hdac: hat activity was significantly lower in ra synovial tissue compare to healthy controls . In combination with this, hdac inhibition decreases il-10 production from whole tissue synovial explants cultures, indicating a negative effect on anti - inflammatory pathways, which would lead us to believe that a lack of hdac may contribute to perpetuation of inflammation (huber et al ., 2007; grabiec et al . Hdac inhibitors reduced il-6 production from tnf stimulated m and induced apoptosis of ra synovial fluid (sf) m, even in the presence of a pro - inflammatory stimulus (grabiec et al ., 2010). This is of interest considering the ability of synovial cells and infiltrating cells to evade apoptosis during joint inflammation contributing to synovial hypercellularity (salmon et al ., 1997; the potential use of hdac inhibitors has been further promoted by their success in suppressing synovial inflammation and cartilage destruction in a cia mouse model (nasu et al ., 2008). Toll like receptors (tlr) are pattern recognition receptors that mediate response to infection . However, it is becoming apparent that some of these receptors may become activated by non - infectious agents from within the body and may therefore play a role in autoimmune conditions such as ra . Engagement of tlrs induces signaling through a well defined pathway involving myd88 that leads to transcriptional activation (joosten et al ., tlr knockout and arthritis mouse models, or a combination of both, have highlighted the position of tlrs in the pathogenesis of arthritis . In a model of spontaneous arthritis due to il-1 receptor antagonist knockout, simultaneous knockout of tlr4 attenuated inflammation while tlr2 knockout produced a more severe arthritis . Knockout of tlr9 had no effect (abdollahi - roodsaz et al ., 2008). However the role of tlr2 seems less defined as other studies have shown that knockdown of tlr2 produces beneficial effects in arthritis (joosten et al ., 2003). Further to this, many tlr ligands have been identified in synovial inflammation (okamura et al ., 2001; park et al ., 2004). Acute serum amyloid a (saa), which is significantly upregulated in arthritis and propagates pro - inflammatory effects similar to tnf (ohara et al ., 2000; mullan et al ., 2006; connolly et al ., 2011), is a functional ligand for tlr2 and may contribute to the deleterious effects of saa in arthritis (cheng et al ., 2008). Ra m are more responsive to stimulation than m from other forms of inflammatory arthritis, despite no difference in m number (huang et al ., 2007). Therefore, engagement of tlr2 and 4 may contribute to m activation and a sustained m response in ra . Rheumatoid factor (rf) is one of the diagnostic criteria for ra and can help to distinguish ra from similar arthropathies like psa . Classification of ra as an autoimmune disease came initially from the discovery of igg auto - antibodies in the blood of patients (waaler, 1940; franklin et al ., 1957). Rf is mostly igm - rf, but igg - rf and iga - rf can also be detected in some patients . The cellular receptors for igg are the fc receptors, fcri (cd64), fcrii (cd32), and fcriii (cd16). Fcriii has been demonstrated to play a role in the development of arthritis through animal models . Mice deficient in fcriii are protected from the development of collagen induced arthritis without alteration of their humoral response, and therefore the protection is not due to alterations in t - cell responses (sthl et al ., 2002; andrn et al ., polymorphisms in fc receptors are associated with incidence of ra as well as response to therapy (morgan et al ., 2006; canete et al ., 2009; thabet et al . In the immune system m are effective antigen presenting cells with phagocytic activity which respond to lymphocyte derived cytokines . However, the responses elicited by m are variable and depend entirely on the tissue environment . Dedicated reviews on this topic discuss in more detail the cytokines and chemokines involved in promoting one phenotype over another (mantovani et al ., 2004; murray and wynn, 2011) but an overview of the main components are outlined in figure 1 . Classically activated m1 m have a pro - inflammatory phenotype, producing high levels of tnf, il-1, il-6, il-12, il-23, reactive oxygen species, and low levels of il-10 . Alternatively activated m, of which there are three subsets (mantovani et al ., 2004; martinez et al ., 2008), display and anti - inflammatory phenotype, producing high levels of il-10, il-1 receptor antagonist, decoy il-1rii, tgf, and low levels of il-12 . An interesting, and potentially useful, property of these m is that they remain plastic and polarization into one phenotype does preclude re - polarization (stout et al ., 2005). Therefore, if we could elucidate the exact pathways and transcription factors involved in promoting one phenotype over the other in vivo, this system could be exploited for therapeutic gain . Ifn along with lps or tnf drive polarization of m1 (classically activated) macrophages which participate in pro - inflammatory activities . On the other hand, il-4 + il-13, il-10, or immune complexes drive m2 (alternatively activated) macrophages, which participate in anti - inflammatory responses . There appears to be a lack of evidence for m polarization in either direction in the inflamed joint . It has been suggested that spondyloarthropathies such as psa display a more m2 profile compared to ra patients and that m1 mediators correlate with joint inflammation in ra (vandooren et al ., 2009). However, in general, most studies of m in arthritis focus on important m functions and not polarization . The mediators that can control m polarization are indeed present in the synovium and some show potential as therapeutic targets . Synovial lining layer thickness is greater in ra, compared to psa or healthy control subjects, which is associated with an increase in synovial m and fibroblasts . (2000) also found similar levels of il-10 in ra and psa synovium, despite the difference in synovial lining layer m numbers, however levels were described as being quite low . It is difficult to determine if this lack of il-10 is a contributor to or consequence of the overwhelming inflammation in the joint . A study by mottonen et al . (1998) found that 68% of m isolated from ra sf were cd86 positive and that sf m can take on a dendritic cell phenotype when exposed to a combination of il-4 and gm - csf and that these cells were more effective at activating t - cells than control or tnf stimulated m . The effects of il-4 + gm - csf were mediated through cd86, a marker of classically activated m . Il-10 was able to inhibit the observed effects with il-4 + gm - csf as it downregulated the expression of cd86, as well as cd-40 and hla - dr which also participate in m mediated t - cell activation . This is consistent with the classification that m2c m, which are driven by il-10 are involved in suppression of the immune response (mantovani et al ., 2004). These results may appear confusing as il-4 along with il-13 drive the m2a or alternative m phenotype which should be involved in anti - inflammatory responses . However gm - csf drives the m1 phenotype in monocyte derived macrophages so this may be the driving force for inflammatory responses in these experiments . The m1 m phenotype is induced by interferon- (ifn) in combination with either lipopolysaccharide (lps) or tnf. Ifn is highly expressed in ra synovial tissue and its levels significantly correlate with disease severity (milman et al ., 2010). Exposure to inf increases the response of m exposed to other stimuli by either upregulating pro - inflammatory cytokines, like tnf, or downregulating anti - inflammatory cytokines, like il-10 (erwig et al . Tnf is a master cytokine in inflammation and as such is a potent inducer of other pro - inflammatory cytokines (nawroth et al ., 1986; butler et al ., 1995), is chemotactic for leukocytes, is a potent inducer of angiogenesis (leibovich et al ., 1987), stimulates adhesion molecule expression in sfc in vitro (marlor et al ., 1992), and lymphoid migration into inflamed synovial tissue in vivo (wahid et al ., 2000). Within the inflamed joint macrophages, fibroblasts, lymphocytes, and endothelial cells produce tnf. An important role for tnf in arthritis was confirmed by studies which showed its potential to degrade both cartilage (dayer et al ., 1985) and bone (bertolini et al ., 1986). Further rationale for the involvement of tnf in the progression of inflammatory arthritis was provided when transgenic mice expressing a modified human tnf gene spontaneously developed arthritis which exhibited increased human tnf protein, joint inflammation, bone erosion, and cartilage destruction . In this study, antibodies specific for human, but not mouse tnf reduced disease severity (keffer et al ., 1991). In subsequent studies administration of a monoclonal antibody to tnf ameliorated inflammation and joint damage after disease onset in a cia model of arthritis (williams et al ., 1992). Tnf cytokine targeted therapies have now been developed for inflammatory arthritis . The first clinical trial was undertaken in the uk in 1992 and demonstrated that targeted biologic therapy decreased serum il-6 levels, swollen joint numbers and levels of the acute phase proteins crp and a - saa which are markers of inflammation (elliott et al ., 1993). Alternatively, anti - inflammatory and m2 polarizing cytokines like il-10 are lowly expressed in arthritis as its signaling is blocked during fc receptor ligation (ji et al ., 2003), and treatment with the pro - resolving mediator annexin a1 stimulates release of il-10 (ferlazzo et al ., 2003). Treatment of pbmc with il-10 caused a change in the ratio of th17:treg cells in favor of treg cells and decreased production of the pro - inflammatory cytokine il-17 (heo et al ., 2010). Animal models of arthritis have also demonstrated how treatment with il-10 can suppress the development and progression of joint inflammation, even in established disease (walmsley et al ., 1996 the cytokines involved in promoting polarization are well defined, however less is known about which transcription factors are utilized to induce polarization . Irf5 (interferon regulatory factor 5) has been implicated in driving the m1 phenotype as well as actively suppressing m2 polarization and driving th1 and th17 responses (krausgruber et al ., (2011) was not performed in synovial m, animal studies suggest that inflammation in ra is driven by th1 cytokines such as ifn, which is upregulated early in the disease process (miltenburg et al ., 1992; schulze - koops and kalden, 2001) and a rapid growth in interest in the th17 pathway and indeed il-17 itself in the last few years would suggest that this would warrant investigation in the inflamed joint . Recent reports confirm that alterations in the irf5 gene confers susceptibility to ra (dieguez - gonzalez et al . 2011) as well as many related illnesses such as inflammatory bowel disease, sjogrens syndrome, and systemic lupus erythematosus (dideberg et al ., 2007;, 2006) and irf4 (satoh et al ., 2010) have been implicated in promoting m polarization in other disease settings, and irf family members contribute to determination of dendritic cell fate (tamura et al ., 2005). These findings make the irf family attractive candidates to study in the context of m s in arthritis . Nr4a is part of the orphan nuclear receptor superfamily which have roles in lipid metabolism and inflammation (desreumaux et al ., 2001; receptors in the same superfamily as nr4a are downregulated in arthritic tissue and their activation appears to play a role in inhibiting disease progression (bonnelye et al . However members of the nr4a subfamily appear to have less clearly defined effects to the anti - inflammatory family members liver x receptor and peroxisome - proliferator - activator receptor and drive inflammation in human synovial tissue (murphy et al ., 2001). The role of nr4a receptors specifically in m polarization has not yet been elucidated, however, any role for nr4a in m polarization would be an interesting finding due to the modulation of nr4a by both dexamethasone and methotrexate, which are effective treatments for joint inflammation in some patients ., 2006) where it promotes transcription of pro - inflammatory genes . In arthritis, and inflammation in general, nfb can be considered a master transcription factor as it is utilized by many ligand tnf and il-1 which are abundant in the inflamed joint employ this transcription factor and in turn can be regulated by it . Nfb activation has been detected prior to the clinical onset of arthritis in animal models (tsao et al ., 1997; han et al ., 1998) and the nfb pathway has been directly targeted as a treatment method for ra confirming its essential role in the pathogenesis of this disease (wakamatsu et al ., 2005). Immunohistochemical staining has confirmed nuclear expression of nfb subunits in synovial m (handel et al ., 1995). The nfb family consists of five proteins; p50, p52, rela (p65), relb, and c - rel . Rela, relb, and c - rel contain a transcriptional activation domain and therefore upregulate gene expression, however p50 and p52 do not contain the transcriptional activation domain and homodimers of these proteins can sometimes have a repressing function (bohuslav et al ., nfb p50 activation has been linked to promoting m2 polarizing genes in m (porta et al ., 2009). This study found that knockout of the nfb p50 subunit prevented the development of tolerance in lps challenged m by restoring m1 mediators and inhibiting m2 cytokines . (2006) found that accumulation of the p50 homodimer occurred in the nuclei of tumor associated m and that these m expressed an m2 phenotype . Therefore due to the prominence of the nfb pathway in ra there is a growing understanding of the molecular drivers of inflammation and an appreciation that the resolution of inflammation is an active process rather than a passive return to homeostasis . Endogenously produced mediators that actively promote the resolution of inflammation are now under investigation for their therapeutic use . Lipoxin a4 (lxa4) is an eicosanoid produced by the transcellular metabolism of arachidonic acid by 15/5- or 5/12-lipoxinagese (serhan et al ., 1984). Its biosynthesis is co - incident with the resolution phase of inflammation and many of its bioactions are mediated through ligation of its receptor, alx / fpr2 (fiore et al ., 1994). Lxa4 is produced in inflamed synovial tissue (thomas et al ., 1995) where it can downregulate pro - inflammatory activities of activated fibroblasts and upregulate anti - inflammatory activities, even in the presence of a pro - inflammatory stimulus which acts through the same receptor (sodin - semrl et al ., 2004; kronke et al ., 2009; chan and moore, 2010). In other disease models, lxa4 has been shown to induce anti - inflammatory / pro - resolving actions such as inhibition of neutrophil recruitment and activation (filep et al ., 1999), regulation of nfb activation (decker et al ., 2009), and the clearance of apoptotic cells by m (godson et al ., 2000) once these cells have carried out their functions in regard to host defense they are programmed to die by apoptosis . Resolution of inflammation and return to homeostasis involves phagocytosis of apoptotic neutrophils to prevent the persistence to necrosis and leakage of cellular contents, which may itself begin an inflammatory reaction . Despite the lack of apoptosis occurring in all cell types in the inflamed synovium, resident synovial m retain the capacity to phagocytose apoptotic cells, even at an early timepoint after arthritis induction (van lent et al ., 2001). If normal apoptosis and phagocytosis could be induced in the inflamed synovium, possibly by native lxa4 or its stable analogs, this process may trigger a normal resolution of inflammation . In order to encourage phagocytosis, apoptotic cells release mediators that attract phagocytes toward them, essentially flagging themselves for engulfment . One such mediator is the anti - inflammatory compound annexin a1 (arur et al ., 2003; annexin a1 is a 37-kda protein of the annexin superfamily where all family members contain a similar core region and a distinct n - terminal region which confers specificity of function . Generally annexin a1 is localized to the cytoplasm where, upon stimulation, it is mobilized to the cell membrane and secreted (for an extensive review on annexin a1 see perretti and dalli, 2009). Interestingly annexin a1 also signals through alx / fpr2, the same receptor utilized by lxa4 and saa . Immunohistochemical analysis has demonstrated an increased expression of annexin a1 in the ra synovial lining layer macrophages and fibroblasts compared to oa and normal joints . This may, however, be due to the increased lining layer thickness in this condition (goulding et al ., 1995) as other studies have shown decreased binding of annexin a1 to several cell types in ra (goulding et al . Glucocorticoid stimulation causes annexin a1 mobilization to the cell surface and secretion where it mediates glucocorticoid induced anti - inflammatory effects . This is of particular interest in arthritis as glucocorticoid therapy is one of the current treatments for this condition (flower, 1988; podgorski et al ., 1992; yang et al ., 1998, 1999; maderna et al ., 2005). However, as is increasingly the case for many mediators, the role of annexin a1 may not be as unambiguous as initially described and it may also potentiate pro - inflammatory actions in arthritis . (2008) has revealed synergistic actions with tnf and annexin a1 in terms of mmp production from synovial fibroblast cells . They saw firstly that tnf can induce expression of endogenous annexin a1 and secondly that tnf along with the annexin a1 mimetic peptide ac2 - 26 enhanced secretion of mmp-1 which was dependent on fpr2/alx, erk, jnk, and nfb (tagoe et al ., as mentioned, this study was not performed in synovial m, but as they have similar actions to synovial fibroblasts, the same results may be produced by these cells once investigated . Further to this, it has also been shown that administration of human recombinant annexin a1 during the immunization phase of the collagen induced arthritis model perpetuated the development of the signs and symptoms of arthritis . This may have been due to the increased t - cell activation and skewing toward a th1 phenotype by annexin a1 acting through fpr2/alx (dacquisto et al ., 2007). T - cells from ra patients 48 h post steroid therapy demonstrated depressed expression of annexin a1 (dacquisto et al ., 2008) further lending support to the possibility that annexin a1 may also mediate pro - inflammatory actions . However we must be careful to acknowledge the actions of specific cleavage products from full length annexin . One such cleavage product has been identified as causing neutrophil extravasation, an important event in inflammation, where other truncated forms of annexin cannot (williams et al ., 2010). In the study of inflammation and our efforts to promote its normal resolution, m remain to the fore of our interest . In the inflamed joint, m will continue to be a focal point for therapeutic intervention which, currently, centers around cytokine blockade but now has the possibility of extending into m re - programming . This remains an interesting and a yet to be fully explored option in terms of treatment for synovial inflammation . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

A critical component of successful patient care in total knee arthroplasty (tka) is a blood management strategy . Tka can result in substantial perioperative blood loss, rendering patients at increased risk of requiring allogenic blood transfusion12). Total knee and hip arthroplasty and fracture surgery is the number one reason for transfusion in patients undergoing surgery and accounts for 9.8% of all transfused red blood cell units3). Complications of allogenic blood transfusion include the risk of disease transmission, hemolytic reaction, fluid and hemodynamic overload, acute lung injury, coagulopathy, allergic reaction and febrile non - hemolytic reaction4). Allogenic transfusion is associated with immunomodulation, and an increased incidence of prosthetic infection56). Bierbaum et al.7) reported a transfusion rate of 39% following tka, with an increased risk of fluid overload, infection rate and duration of hospitalization in the patients who received allogenic transfusion . Several studies have highlighted the disadvantages of allogenic blood including a negative effect on postoperative complications, length of hospital stay, cost and mortality8910). The fundamental aim of blood management is to eliminate the need for allogenic blood whilst at the same time preventing anaemia . Thereby the risk of transfusion is removed, hemoglobin (hb) status and oxygen carrying capacity is maximized, leading to a positive effect on the patient's recovery and both early and long - term outcomes . Blood management strategies should be individualized, based on patient specific risk factors including preoperative hb level, anticipated difficulty of the procedure and expected blood loss, and associated medical comorbidities . Hb loss in routine primary tka has been calculated to be 3.8 g / dl11). The transfusion trigger should be individualized based on the risks and benefits for each patient . Two recently published studies highlighted the benefits of evidence - based, multidisciplinary, multimodal approach to optimizing care in joint replacement patients potentially requiring allogenic transfusion1213). Both studies stressed the importance of optimizing preoperative red cell mass, minimizing perioperative blood loss and being judicious with the threshold for transfusion based on each individual's clinical status . By introducing a multimodal program supported by evidence - based guidelines, transfusion rate was markedly reduced with a significant reduction in complications, 30-day readmission rates, length of hospital stay and mortality . Available blood management strategies can be broadly divided into 3 stages: preoperative optimisation, intraoperative and postoperative protocols14). Several studies have highlighted the significant influence of preoperative hb on the requirement for transfusion in tka1115). G / l preoperatively required allogenic blood whilst patients with preoperative hb level less than 110 similarly, pierson et al.11) found an algorithm - based strategy aimed at improving preoperative hb level was most effective in reducing transfusion rate . Other risk factors associated with an increased need for transfusion include weight, age greater than 75 years, male gender, hypertension and body mass index less than 27 kg / cm16). Whilst many factors are non - modifiable, pola et al.17) showed more than one risk factor had a compounding effect on transfusion rate . Therefore, in patients with multiple risk factors, it is vitally important to correct anaemia and maximize preoperative red cell mass . Correcting anaemia not only reduces the risk of allogenic transfusion but also has a positive impact on the patient's rehabilitation and functional recovery . Patients with postoperative hb between 8 to 10 g / dl may not be low enough to warrant transfusion but often feel lethargic, with a higher risk of syncopal episodes, impairing their ability to mobilize and undergo rehabilitation . In our centre, patients are screened 3 months prior to surgery with full blood count, proceeding to iron studies if the preoperative hb is less than 120 g / dl . Any patient identified with anaemia is referred to the hematology unit for further investigation of the underlying cause and management . A common reason in elderly patients is iron deficiency, as a result of poor dietary intake and occult gastrointestinal bleeding secondary to non - steroidal anti - inflammatory drug use . The parameters measured to investigate iron deficiency are listed in table 2 with threshold cut - off values . Both have been shown to be effective, however, oral iron may not be efficacious in patients with malabsorption such as coeliac disease . Another disadvantage of oral iron supplements is the slow effect and therefore it needs to be implemented well in advance of surgery . A cohort study of 156 patients treated with ferrous sulfate 256 mg / day for 1 month preoperatively, in with combination vitamin c which enhances iron absorption, showed a reduced transfusion rate for non - anemic patients18). For our patients with deficient iron stores, the hematologists administer 5001,000 mg ferritin carboxymaltose as a rapid intravenous infusion over 15 minutes . The infusion needs to be given minimum of 3 weeks preoperatively, and is expected to improve the hb 1 g / dl over 10 days . We have observed intravenous iron to be more effective than oral supplements (d'costa e, unpublished data). Munoz et al.19) reported a significant increase of 1.8 g / dl in hb level and 67% resolution of anaemia using intravenous iron sucrose . Erythropoietin is a synthetic hormone, stimulating progenitor cells in the bone marrow to differentiate into red blood cells and activating hematopoiesis . Erythropoietin is a powerful agent in correcting anaemia . In a systematic review, spahn20) showed erythropoietin to be successful in improving mean preoperative hb and postoperative hb with reduced transfusion rates when combined with iron therapy in patients undergoing tka . The main disadvantage of erythropoietin is cost and at this stage, its routine use in australia is not approved in tka patients unless the patient suffers anaemia secondary to chronic renal failure . Patients undergoing tka frequently take antiplatelet and anticoagulant medications that affect the risk of bleeding . The decision and timing of cessation of antiplatelelet and anticoagulant therapy needs to take into consideration risks of thrombosis versus risk of bleeding . Platelet activation occurs with non - cardiac surgery, making myocardial infarction the most common major vascular complication after surgery . Under usual circumstances, warfarin should be discontinued 5 days prior to tka21) and recommenced postoperatively when the risks of acute bleeding are believed to be stable . Bridging anticoagulation therapy is commonly used in the interim period with agents such as low molecular heparin, which has a shorter half - life22). There are no clear guidelines or consensus on the optimal bridging therapy for patients on warfarin for conditions such as atrial fibrillation, previous embolic cerebrovascular events or mechanical valve replacement, and further clinical trials are required to clarify the optimal regime . With regards to aspirin and antiplatelet therapy, its cessation prior to surgery is believed to result in an increased risk of cardiovascular complications and major cardiac events2324). However, a recent large randomized controlled trial of 10,010 patients including 39% orthopaedic procedures, comparing aspirin versus placebo with 30-day follow - up after surgery, found conflicting results25). There was no difference in the primary outcome of death or myocardial infarction between the 2 groups, regardless of whether the patient was taking aspirin prior to surgery or not . The most common reported site of bleeding was the surgical site in 78.3% and gastrointestinal tract in 9.3% . The authors concluded aspirin administration before surgery and throughout the early postsurgical period had no significant effect on the rate of composite of death or nonfatal myocardial infarction but increased the risk of major bleeding . Allogeneic transfusion rates were reduced from 40%52% to 3%18% in the preoperative autologous donor group in two cohort studies2627). However preoperative autologous donation is associated with a high rate of wasted blood and is no longer deemed to be cost effective . There remains the potential for wrong blood being returned to the patient due to clerical errors2829). The use of preoperative autologous blood donation has therefore fallen out of favour and we no longer use it in our tka patients . The risk of intraoperative bleeding is influenced by difficulty of the procedure and patient factors such as obesity, comorbidities and bleeding disorders . Meticulous efficient surgical technique with careful dissection, soft tissue handling and bleeding control assists with diminishing blood loss . Maintaining steady blood pressure and normothermia is accepted to be important in limiting blood loss, we found rigid temperature control is not necessary in a prospective consecutive observational cohort study of patients undergoing primary tka30). As long as patient axillary temperature is maintained within the range of 34.737.8 during the perioperative period, our study demonstrated no effect of patient temperature on transfusion rate or blood loss . The technique of acute normovolemic hemodilution attempts to achieve a similar effect to preoperative autologous blood donation without the preoperative inconvenience . Blood is collected from the patient in the immediate preoperative period and volume is replaced with colloid or crystalloid fluid . The rationale is surgical blood loss will have a lower hematocrit, and the collected whole blood is transfused in the immediate postoperative period, negating the downsides of blood storage . However, the effectiveness of acute normovolemic hemodilution in reducing allogenic transfusion is debatable20). It may be appropriate in selected cases where blood cross matching is difficult due to the presence of antibodies however we do not recommend its routine use . Perioperative red cell salvage collects blood lost during the operative procedure and immediate postoperative period, and returns the blood to the patient . Perioperative red cell salvage reinfuses fresh blood, thereby avoiding problems associated with storage, seen with autologous predonation and allogeneic blood . This translates to more efficacious oxygen carrying capacity with a higher mean erythrocyte viability31) and increased preservation of 23 diphosphoglycerate32). Red cell salvage also incorporates washing the blood loss volume . Washing the blood removes biochemical, cellular and non - cellular debris31). Unwashed cell salvage is associated with adverse postoperative effects due to the presence of cytokines including hypotension, hyperthermia, increased postoperative bleeding and non - cardiogenic pulmonary edema3334). We have been using intraoperative red cell salvage for primary and revision tka, with success in reducing allogenic transfusion requirement (dan m, unpublished data). The efficacy of cell salvage in tka in our cohort compared to previously published studies353637) is outlined in table 3 . We concluded perioperative red cell salvage reduces but does not eliminate the need for allogenic blood . The effectiveness of intraoperative red cell salvage is dependent on preoperative hb and hematocrit of blood lost and actual blood loss volume, which in turn determine the ability to return red cells . We believe intraoperative red cell salvage is most effective in patients with preoperative hb between 120 to 150 g / dl, further emphasizing the importance of correcting preoperative hb above 120 g / dl prior to tka . Above 150 g / dl, topical fibrin sealant, composed of fibrinogen and thrombin, mimics the final step of coagulation cascade when mixed together during the application process . Randelli et al.38) performed a randomized trial of topical fibrin versus control group in tka and found no difference in hb levels, postoperative decrease in hb, drainage or mean total blood loss . In particular, the transfusion rate was 32.3% in the control group compared with 25.8% in the fibrin group, with no significant difference . The authors concluded topical application of fibrin sealant was not effective in reducing perioperative blood loss in tka . Another randomized study comparing topical fibrin spray to intravenous tranexamic acid (txa) demonstrated comparable reduction in blood loss but the cost of the fibrin spray was significantly greater39). The routine use of intra - articular wound drainage in tka has been shown to increase blood transfusion requirement40). This needs to be balanced with the reported increased risk of persistent ooze, bruising and hematoma formation41). Evidence for use of an intra - articular drain in tka therefore remains inconclusive and very much an individual decision based on surgeon preference . Postoperative reinfusion drains are commonly employed in tka and previous investigations suggest reduction in allogeneic transfusion rate . A meta - analysis by huet et al.33) showed a relative risk reduction of 0.35 for allogeneic transfusion need with reinfusion drains . Zacharopoulos et al.42) performed a prospective randomized controlled trial with reinfusion drains, demonstrating a decrease in allogenic blood transfusion . In contrast, hazarika et al.43) showed reinfusion drains had no significant benefit with the downside of additional cost . Reinfusion drains carry the potential for transfusion reaction, as the unwashed blood contains fibrin degradation products and other potential contaminants4445). The drained blood needs to be reinfused with 6 hours of commencement to avoid the potential for hemolysis . We no longer use reinfusion drains, as the cost does not seem to be justified, especially with the increasing use of txa in reducing postoperative blood loss . Txa is one such agent, being a synthetic plasminogen - activator inhibitor, showing both clinical efficacy and an acceptable safety profile . Txa inhibits the activation of plasminogen to plasmin by blocking the lysine binding sites of plasminogen to fibrin . The result is decrease proteolytic action on fibrin monomers and fibrinogen, leading to clot stabilization46). The use of txa in primary tka is associated with reduced transfusion rates, increased discharge to home, and reduced costs47). Txa has desirable features of ease of administration, minimal effect on operative procedure workflow, and extremely low cost as a generic medicine . Intravenous txa has been demonstrated to significantly reduce the amount of blood loss and blood transfusion requirements without an increase in venous thromboembolic risk in multiple studies for tka4849). There is however no clear consensus on ideal dosage, timing, frequency and route of administration for txa in tka . The current recommendation for intravenous use is 10 to 15 mg / kg as a single dose . However significant heterogeneity exists in currently available studies, with doses ranging from 700 to 10,500 mg and often with multiple dosages . Several contra - indications preclude the use of intravenous txa at the time of surgery, including renal insufficiency, history of previous deep venous thrombosis, cerebrovascular and cardiac disease . One study reported 28% of patients were contraindicated to intravenous txa51) and in these patients topical administration may be more appropriate due to delay in systemic absorption after application into the knee . Intra - articular application limits systemic exposure and maximizes drug concentration and activity directly at the site of bleeding . Wong et al.52) proved the efficacy of intra - articular txa in a double - blind, placebo - controlled randomized trial in tka . The authors demonstrated a significant difference in hb reduction and blood loss using 3.0 g of txa in 100 ml of normal saline compared to 1.5 g of txa and placebo, with no difference in thromboembolic complications . Plasma levels of txa following topical administration were 70% less than an equivalent intravenous dose . More recently, a retrospective study found intra - articular and pericapsular injection of txa after capsular closure resulted in a transfusion rate reduction from 17.5% to 5.5% as well as a significantly higher postoperative hb in the txa group51). Alshryda et al.53) performed a systematic review and meta - analysis showing topical txa to significantly reduce the rate of blood transfusion and was safe . A number of studies have directly compared intravenous txa with topical txa demonstrating the efficacy and safety of topical administration in tka545556). Both patel et al.51), using a single intravenous dose, and soni et al.57), using a 3 dose intravenous regimen, concluded topical txa had similar efficacy to intravenous txa in terms of perioperative change in hb, lowest postoperative hb, total drain output and transfusion rate, and no increase in complications in randomized prospective studies . In a study comparing 3 methods of administration in tka, single dose intravenous txa was more effective than topical and intra - articular txa injected via the drain in reducing hb drop58). Local administration through the drain yielded least blood drainage postoperatively compared to intravenous and topical application, with 80% reduction of drainage volume compared to 45% and 18%, respectively . In contrast, maniar et al.59) found single intravenous dose did not give effective results . A 3-dose regimen of preoperative, intraoperative and postoperative doses of 10 mg / kg produced maximum effective reduction of drain loss and total blood loss in tka . The authors concluded a preoperative dose prior to tourniquet inflation was important to inhibit the activation of the fibrinolysis cascade . Our preference in tka is to use topical txa, with no patients contraindicated to its use . 3.0 g of txa combined with 20 ml normal saline is administered to the operative site after prosthesis cementation and final washout for 5 minutes . After 5 minutes, any residual fluid is removed and wound closure performed without further lavage or intra - articular drain insertion . Another principal arm of effective blood management is to restrict allogenic transfusion to patients meeting well - established transfusion criteria . Adherence to evidence - based transfusion guidelines and utilization of appropriate transfusion triggers is the key element in achieving this . The recommendations for a restrictive transfusion protocol include transfusion in patients with hb<7 g / dl, hb<8 g / dl in setting of cardiac disease, or specific patient situations where additional oxygen carrying capacity is needed . Transfusion of a single unit of packed red blood cells at a time is advised12). The blood management strategy algorithm used in our hospital a blood management program in tka aims to reduce allogenic transfusion rate and its associated risks, whilst at the same time maximizing hb level and oxygen carrying capacity in the postoperative period . Effective blood conservation encompasses optimizing preoperative red cell mass, salvaging blood lost during the perioperative period, minimsing blood loss with hemostatic measures and individualizing the transfusion trigger according to the patient's clinical status and medical comorbidities . We use a combination of preoperative intravenous iron infusion, intraoperative red cell salvage, and topical txa . A proactive approach to blood management will lead to a positive effect on early and long - term outcomes and greater success in care of tka patients.

This infection is re - emerging in china, japan, australia, india, and europe . Leptospirosis is a common cause of acute febrile illness in india, especially during the monsoon months and outbreaks have been reported from the andamans, tamil nadu, karnataka, maharashtra, andhra pradesh, and orissa after heavy rains . Severe disease occurs in 510% of patients associated with high mortality rate in this group and leptospiremia occurs during the 1 week of illness . The majority of the patients present with nonspecific symptoms of acute fever, headache, abdominal pain, myalgia, and conjunctival suffusion, which makes it difficult to differentiate this illness from other causes of acute fever like scrub typhus, dengue, and malaria . Thus, laboratory confirmation of disease is important as clinical management is different for these conditions . Direct detection includes isolating the organism in culture or detecting specific dna while indirect method includes detection of antibodies . The use of culture as a diagnostic method is limited by its long turnover time, requiring at least 68 weeks for growth . Polymerase chain reaction (pcr) targeting the 16s rrna has been used to detect the presence of leptospires in serum, urine, cerebrospinal fluid, and autopsy tissue . Pcr has been done with 16s rrna as the target having a sensitivity of 52.794.4% and a specificity of 90100%, secy gene, lipl32 gene, and rrs gene with the highest sensitivity of 94.8% . Its value lies in the fact that it can diagnose the disease very early in the 1 week of illness before the appearance of antibodies and hence helps in early initiation of treatment . Loop - mediated isothermal amplification (lamp) an isothermal dna amplification method has high specificity and not inhibited by pcr inhibitors . The utility of lamp for the rapid and specific diagnosis of leptospirosis has been evaluated by only five different groups of researchers . Microscopic agglutination test (mat) is the reference method for serological diagnosis of leptospirosis . The mat suffers from drawbacks like complex and labor intensive test procedure, requirement of a large library of strains and paired sera for confirmation . Detection of igm antibodies by elisa is the most widely used method for diagnosis of leptospirosis especially as a part of modified faine's criteria . Like faine's criteria it includes clinical features such as a headache, fever, temperature, conjunctival suffusion, meningism, joint pain, jaundice, albuminuria, and epidemiological features but unlike faine's criteria which use culture and mat for laboratory diagnosis, in addition, modified faine's criteria uses igm elisa also . The advantage of elisa is that it can be performed easily with less infrastructure and technical expertise and is inexpensive and less laborious compared to mat . In addition, the elisa can be automated, the result is objective, especially once a diagnostic cutoff has been decided on, therefore having less inter- and intra - observer variation . As no single test by itself can diagnose all cases of leptospirosis, composite diagnostic criteria, which includes clinical, epidemiological, and laboratory parameters, have been defined called as faines and modified faines criteria . The aim of this study was to compare the utility of lamp, pcr, and elisa for diagnosis of leptospirosis and to correlate clinical features with the diagnosis of leptospirosis . Serum was collected from 150 patients with acute febrile illness from december 2012 to july 2014 . These patients had a fever (100f) of duration 15 days without eschar, who were malaria and blood culture negative . After the study was approved by the institutional review board, clinical information, and 4 ml blood was collected from these patients (after obtaining informed consent) in a red capped tube with clot activator (bd vacutainer, franklin lakes, nj, usa). Igm antibodies to leptospira were detected by elisa (panbio ltd, brisbane, australia) in 150 acute serum samples and 32 convalescent sera . Each elisa run was validated only if the relevant controls (positive, negative, and cutoff controls) were within the range described by the manufacturer . In addition, an in - house qc (close to the cutoff value) sample was used for assay validation . The igm elisa for leptospira was considered to be positive if the value was 20 panbio units . Dna was extracted from the serum samples (200 l) using the qiaamp blood mini kit (qiagen, hilden, germany) and stored at 70c . A nested pcr was performed targeting and amplifying a 547 bp segment of the 16s rrna gene (rrs gene). The primer sequence used was as described by boonsilp et al . In each cycle of the nested pcr, the reaction volume was 50 l which contained 2 pcr mix (thermo fisher scientific, marietta, usa), 20 pmol of each of the primers, 4 mm mgcl2 and pcr grade water along with 5 l of dna . The cycling conditions used for both (first and second round) were the same and included 95c for 2 min for initial denaturation, followed by 95c for 10 s, 67c for 15 s, 72c for 30 s for a total of 40 cycles and one cycle of 72c for 7 min for the first run . The final extension of 72c for 7 min was performed before detection of amplification products . Gel electrophoresis was performed in a 2% agarose gel containing ethidium bromide (10 g / ml), and the 547 bp product was visualized using a gel documentation system (gel doc, bio - rad laboratories, hercules, ca, usa). The lipl32 and lipl41 lamp assay was performed at 63c using the protocol and primer sequence described by chen et al . In each run positive control which was leptospira interrogans strain icterohemorrhagiae obtained from regional medical research centre, port blair, india and a negative control were used . The detection of the lamp products was done by visual detection for turbidity, centrifugation at 14,000 rpm for 1 min for pellet formation and gel electrophoresis using a 2% agarose gel containing ethidium bromide (10 g / ml). The product was visualized using a gel documentation system (gel doc, bio - rad laboratories, hercules, ca, usa). L. interrogans serovar pomona, serovar icterohemorrhagiae, and serovar hardjo (kindly provided by rmrc, port blair, india) were used as positive controls for the nested pcr and the lamp assay . Two amplified products for rrs gene were sequenced to confirm the appropriateness of the target amplified . The abi 310 genetic analyzer (applied biosystems, foster city, ca, usa) was used to enumerate the sequences . The homology of the sequence obtained with that of the existing leptospira sequence in the gene bank was performed using the basic local alignment search tool (blast, available from www.ncbi.nlm.nih.gov/blast) program with the available standard reference sequences in the genebank for homology . The case definition used in this study included the samples which were positive by pcr or lamp or fulfilling modified faine's criteria based on clinical features, epidemiological features and igm elisa for leptospirosis . All the data were entered into an excel spreadsheet 2010 (microsoft office, redmond, washington, usa). The sensitivity and specificity of elisa, pcr, and lamp assay were evaluated using latent class analysis (lca) using stata version 13 (statacorp lp, texas, usa). Chi - square test was used to check the association of categorical variables and a p <0.05 was taken as statistically significant . Serum was collected from 150 patients with acute febrile illness from december 2012 to july 2014 . These patients had a fever (100f) of duration 15 days without eschar, who were malaria and blood culture negative . After the study was approved by the institutional review board, clinical information, and 4 ml blood was collected from these patients (after obtaining informed consent) in a red capped tube with clot activator (bd vacutainer, franklin lakes, nj, usa). Igm antibodies to leptospira were detected by elisa (panbio ltd, brisbane, australia) in 150 acute serum samples and 32 convalescent sera . Each elisa run was validated only if the relevant controls (positive, negative, and cutoff controls) were within the range described by the manufacturer . In addition, an in - house qc (close to the cutoff value) sample was used for assay validation . The igm elisa for leptospira was considered to be positive if the value was 20 panbio units . Dna was extracted from the serum samples (200 l) using the qiaamp blood mini kit (qiagen, hilden, germany) and stored at 70c . A nested pcr was performed targeting and amplifying a 547 bp segment of the 16s rrna gene (rrs gene). The primer sequence used was as described by boonsilp et al . In each cycle of the nested pcr, the reaction volume was 50 l which contained 2 pcr mix (thermo fisher scientific, marietta, usa), 20 pmol of each of the primers, 4 mm mgcl2 and pcr grade water along with 5 l of dna . The cycling conditions used for both (first and second round) were the same and included 95c for 2 min for initial denaturation, followed by 95c for 10 s, 67c for 15 s, 72c for 30 s for a total of 40 cycles and one cycle of 72c for 7 min for the first run . The final extension of 72c for 7 min was performed before detection of amplification products . Gel electrophoresis was performed in a 2% agarose gel containing ethidium bromide (10 g / ml), and the 547 bp product was visualized using a gel documentation system (gel doc, bio - rad laboratories, hercules, ca, usa). The lipl32 and lipl41 lamp assay was performed at 63c using the protocol and primer sequence described by chen et al . In each run positive control which was leptospira interrogans strain icterohemorrhagiae obtained from regional medical research centre, port blair, india and a negative control were used . The detection of the lamp products was done by visual detection for turbidity, centrifugation at 14,000 rpm for 1 min for pellet formation and gel electrophoresis using a 2% agarose gel containing ethidium bromide (10 g / ml). The product was visualized using a gel documentation system (gel doc, bio - rad laboratories, hercules, ca, usa). L. interrogans serovar pomona, serovar icterohemorrhagiae, and serovar hardjo (kindly provided by rmrc, port blair, india) were used as positive controls for the nested pcr and the lamp assay . Two amplified products for rrs gene were sequenced to confirm the appropriateness of the target amplified . The abi 310 genetic analyzer (applied biosystems, foster city, ca, usa) was used to enumerate the sequences . The homology of the sequence obtained with that of the existing leptospira sequence in the gene bank was performed using the basic local alignment search tool (blast, available from www.ncbi.nlm.nih.gov/blast) program with the available standard reference sequences in the genebank for homology . The case definition used in this study included the samples which were positive by pcr or lamp or fulfilling modified faine's criteria based on clinical features, epidemiological features and igm elisa for leptospirosis . All the data were entered into an excel spreadsheet 2010 (microsoft office, redmond, washington, usa). The sensitivity and specificity of elisa, pcr, and lamp assay were evaluated using latent class analysis (lca) using stata version 13 (statacorp lp, texas, usa). Chi - square test was used to check the association of categorical variables and a p <0.05 was taken as statistically significant . Among the 150 patients recruited, 52 were diagnosed to have leptospirosis based on our case definition . Of these three were positive by igm elisa, pcr, and lamp, two were positive only by pcr for rrs gene (547 bp), and 7 were positive only by lamp assay for lipl32 and lipl41 genes, another forty fulfilled modified faine's criteria (clinical criteria plus igm elisa positive). Only, decreased urine output, jaundice, renal compromise, and low platelet count were found to be significantly related to leptospirosis as given in table 1 . The test results were analyzed using lca for the three tests elisa, pcr, and lamp for diagnosis of leptospirosis . However, the specificity was highest for pcr with 98.64%, followed by lamp 95.24% and least for elisa (modified faines criteria) 72.79% . As all patients positive by igm elisa for leptospirosis (as per the inclusion and exclusion criteria) were having a clinical picture compatible with leptospirosis, the lca results for elisa have been extrapolated as results obtained for modified faines criteria for leptospirosis . Clinical features among those with leptospirosis and those without (based on study case definition) it was seen that lamp assay was positive for all 10 (100%) within the 1 week of illness . In case of pcr, three samples were positive in the 1 week of illness and other two in the 2 week of fever . By elisa, igm antibodies were detectable within 47 days of illness for 20 (46.5%), including the three positive by molecular assays and 23 (53.5%) were positive between 8 and 15 days of fever . Sequencing done for two samples (genbank accession numbers kr780767 and kr780768) confirmed the identity with the available sequences as 98% and 97% respectively with l. interrogans . According to the world health organization, the case definition of leptospirosis includes an acute febrile illness with a headache, myalgia, conjunctival suffusion, anuria / oliguria, jaundice, cough, hemoptysis, breathlessness, hemorrhage, rash, nausea, vomiting, abdominal pain, diarrhea, and meningeal irritation . However, only renal compromise (oliguria and raised creatinine), low platelet count and jaundice (bilirubin> 3 mg%) were significantly related to the patients with leptospirosis in this study . In this study, among the leptospirosis patients, in addition to fever, 48.08% had myalgia, 36.54% had a headache, 28.85% had oliguria, 59.61% had raised bilirubin, and 42.3% had renal compromise as evidenced by raised creatinine level . Observed that myalgia was seen in 78.4%, icterus in 74.5%, headache in 41.2%, and oliguria in 29.4% of leptospirosis patients . Chaudhry et al . Reported that the common clinical features were vomiting / nausea (49.4%), headache (50.5%), myalgia (52.8%), renal involvement (54%), and raised bilirubin (59.7%). Using modified faine's criteria, debmandal et al . Found that the most common features were a headache (100%), jaundice (93.92%), whereas 25.23% leptospirosis cases had increased bilirubin . Although all three assays showed excellent sensitivity, the specificity of the lamp and pcr was far superior to that of the igm elisa . In a study done by lin et al . The detection limit of the lamp assay was similar to the pcr (100 genome equivalents) the target being lipl41 gene . Reported that with the target rrs gene and lipl41 gene, the sensitivity was 43.6% and 37.6%, and specificity was 83.5% and 90.2%, respectively for the two targets . In another study conducted by koizumi et al ., the specificity of lamp assay with rrs gene as target was 66.7% . From the last two studies, it is evident that lipl41 has higher specificity compared to rrs gene for detection of leptospira dna by lamp assay . In the present study, the lamp assay had a high specificity as it had two targets lipl32 and lipl41 which is similar to the findings of chen et al . This explains the reason of it picking up the samples which were neither picked up by pcr nor elisa . Interestingly, there were two samples which were positive for rrs gene by pcr but negative by lamp assay and igm elisa, despite being repeated twice . The noteworthy point regarding the molecular assays used in this study is that all 10 samples positive by leptospira lamp assay occurred in individuals whose duration of illness did not exceed 1 week . This suggests that lamp assay is more likely to be positive in those with fever <7 days . The two samples which were negative by lamp but positive by pcr were from patients whose duration of illness was beyond 7 days . Igm antibodies to leptospira are detectable from the 2 week onward, the same was observed in this study . This confirms the finding that all cases of leptospira cannot be detected in blood by nucleic acid amplification tests like pcr or lamp after the 1 week of illness . Hence, igm elisa is still a useful tool for diagnosis of leptospirosis in a tertiary care center like ours . This is of great importance as most of these patients are referred to a tertiary care center in the 2 week of illness as they have not responded to treatment at the primary or secondary health - care level . A robust inclusion and exclusion criteria for recruiting study subjects were used in this prospective study, reference test for leptospirosis diagnosis like culture and mat were not performed . Therefore to assess the efficacy of each test (igm elisa, pcr, and lamp) for diagnosis of leptospirosis, lca was employed . An expert formulated case definition was used to assess the significance of clinical features in those with and without leptospirosis . Among 52 patients diagnosed as cases of leptospirosis, 40 were positive only by igm elisa / modified faines criteria . Using lca, all the three tests had a sensitivity of 100%, whereas a specificity of 98.64%, 95.24%, and 72.79% could be attributed to pcr, lamp, and igm elisa / modified faines criteria for leptospirosis . In the 1 week of illness, lamp assay performed best, whereas igm elisa was the mainstay of diagnosis of leptospirosis from the 2 week onward . Our preliminary data suggest that a combination of lamp and igm elisa is likely to pick up most cases of suspected leptospirosis especially when they have no eschar, are blood culture and malaria negative . Future studies including paired sera for a demonstration of rise in titer or seroconversion and detection of leptospiral dna in urine are required to assess the validity of these findings . Institutional review board, christian medical college, vellore (min no 8109 dated 05.12.2012) for funding the study . Institutional review board, christian medical college, vellore (min no 8109 dated 05.12.2012) for funding the study.

Periodontal diseases comprise of a group of inflammatory diseases affecting the supporting tissues of the teeth resulting from a complex interplay between specific gram - negative microorganisms, their by products, and the host - tissue response . Earlier, periodontitis had been considered as a disease confined to the oral cavity . However, in the past several years, substantial scientific data have emerged to indicate that the localized infections characteristic of periodontitis can have a significant effect on the systemic health . This increase in systemic inflammation has been implicated in having a modulating role in cardiovascular disease (cvd), on an adverse pregnancy outcome, and on diabetes mellitus and in respiratory disease . In recent years evidence suggests that plasma osteopontin levels are associated with the presence and extent of cvd, an inflammatory mediator whose levels are also found to commensurate with the progression of periodontal disease in gingval crevicular fluid as well as in plasma . The concomitant increase of osteopontin in plasma is caused by spillage or overflow of osteopontin from the diseased periodontal tissues, or produced by circulating activated macrophages . Osteopontin (opn) is a non - collagenous, calcium binding, glycosylated phosphoprotien produced by osteoblasts . Studies have shown that opn is a component of human atherosclerotic plaque and could be a mediator of arterial neointima formation . Opn is synthesized by resident macrophages, smooth muscle, and endothelial cells in primary and restenotic human coronary atherosclerotic plaques, which contribute to cellular accumulation and dystrophic calcification in atherosclerotic plaques . Opn levels in blood serum also correlate positively with the extent of coronary atherosclerotic disease, suggesting a role of opn in cvds . Osteopontin levels also reflect active lesions of aggravated periodontal disease accompanied by alveolar bone resorption . Thus by treating periodontal disease, we may lower the risk of future cardiovascular events by reducing opn levels after periodontal therapy . This study is planned with an objective to provide a diagnostic tool which is expected to play an important role in the assessment of periodontal disease severity and it may also help in prevention and control of systemic diseases such as cvd, inflammatory kidney disease, diabetes mellitus, and respiratory disease etc . The study was conducted with the following aims: to estimate and compare the levels of opn in plasma of subjects with healthy periodontium and generalized chronic periodontitis.to estimate opn levels in plasma of generalized chronic periodontitis subjects 2 months after scaling and root planing.to compare opn levels in plasma of generalized chronic periodontitis subjects before and after two months after scaling and root planing.to correlate opn with periodontal disease index before and two months after scaling and root planing . To estimate and compare the levels of opn in plasma of subjects with healthy periodontium and generalized chronic periodontitis . To estimate opn levels in plasma of generalized chronic periodontitis subjects 2 months after scaling and root planing . To compare opn levels in plasma of generalized chronic periodontitis subjects before and after two months after scaling and root planing . To correlate opn with periodontal disease index before and the study was conducted with the following aims: to estimate and compare the levels of opn in plasma of subjects with healthy periodontium and generalized chronic periodontitis.to estimate opn levels in plasma of generalized chronic periodontitis subjects 2 months after scaling and root planing.to compare opn levels in plasma of generalized chronic periodontitis subjects before and after two months after scaling and root planing.to correlate opn with periodontal disease index before and two months after scaling and root planing . To estimate and compare the levels of opn in plasma of subjects with healthy periodontium and generalized chronic periodontitis . To estimate opn levels in plasma of generalized chronic periodontitis subjects 2 months after scaling and root planing . To compare opn levels in plasma of generalized chronic periodontitis subjects before and after two months after scaling and root planing . To correlate opn with periodontal disease index before and in the present study, 40 subjects were selected from the outpatient department of periodontology (post- graduate section) of bharati vidyapeeth university dental college and hospital, pune . Screening examination included: (1) medical history (2) dental history, and (3) periodontal disease index (ramfjord) systemically healthy patientspatients in age group of 20 - 45 yearsrandom selection of male and female patientstwenty subjects with healthy periodontiumtwenty subjects with generalized chronic periodontitis . Systemically healthy patients patients in age group of 20 - 45 years random selection of male and female patients twenty subjects with healthy periodontium twenty subjects with generalized chronic periodontitis . History of systemic diseases (e.g., diabetes mellitus, ischemic heart disease, other cvds contributing to arthrosclerosis, stroke, hypertensionhistory of any bone disorderssubjects who had undergone periodontal treatment in the last six monthssubjects who had taken antibiotics, anti - inflammatory drugs, steroids and contraceptives in the last six monthssubjects who are on antiresorptive drugs such as bisphosphonates (eg, alendronate)pregnant or lactating femalessmokers . History of systemic diseases (e.g., diabetes mellitus, ischemic heart disease, other cvds contributing to arthrosclerosis, stroke, hypertension history of any bone disorders subjects who had undergone periodontal treatment in the last six months subjects who had taken antibiotics, anti - inflammatory drugs, steroids and contraceptives in the last six months subjects who are on antiresorptive drugs such as bisphosphonates (eg, alendronate) pregnant or lactating females informed consent was obtained from those subjects who agreed to participate voluntarily in this study after institutional ethical clearance was obtained . Based upon the periodontal disease index scores, the subjects were divided into two groups: group i- 20 subjects with healthy periodontium . Group ii- 20 subjects with generalized chronic periodontitis . For opn assessment, non - fasting, venous blood samples were collected from the subjects at the time of clinical examination (group i, ii) and two months after scaling and root planing in group ii . Blood was withdrawn by venepuncture from the anterior cubital vein using a sterile syringe and needle at the pathology laboratory at the bharati hospital . Five ml of blood sample was transferred to the vials containing anticoagulant and transferred immediately to the laboratory at interactive research school of health affairs (irsha). The stored plasma was used for estimation of opn levels at a later date . Plasma opn level thereafter, scaling and root planing was carried out for subjects with generalized chronic periodontitis and oral hygiene instructions were given to the subjects . Periodontal disease index was assessed after two months of scaling and root planing and plasma samples were also collected to estimate levels of opn . The data obtained was subjected to statistical analysis using two sample t - tests, paired t - test to compare opn levels in group ii before and after treatment and un - paired t - test to compare opn levels in group i and ii . Correlation of the opn levels with the clinical parameter in each group was analyzed by pearson's correlation coefficient . In the present study, 40 subjects were selected from the outpatient department of periodontology (post- graduate section) of bharati vidyapeeth university dental college and hospital, pune . Screening examination included: (1) medical history (2) dental history, and (3) periodontal disease index (ramfjord) systemically healthy patientspatients in age group of 20 - 45 yearsrandom selection of male and female patientstwenty subjects with healthy periodontiumtwenty subjects with generalized chronic periodontitis . Systemically healthy patients patients in age group of 20 - 45 years random selection of male and female patients twenty subjects with healthy periodontium twenty subjects with generalized chronic periodontitis . History of systemic diseases (e.g., diabetes mellitus, ischemic heart disease, other cvds contributing to arthrosclerosis, stroke, hypertensionhistory of any bone disorderssubjects who had undergone periodontal treatment in the last six monthssubjects who had taken antibiotics, anti - inflammatory drugs, steroids and contraceptives in the last six monthssubjects who are on antiresorptive drugs such as bisphosphonates (eg, alendronate)pregnant or lactating femalessmokers . History of systemic diseases (e.g., diabetes mellitus, ischemic heart disease, other cvds contributing to arthrosclerosis, stroke, hypertension history of any bone disorders subjects who had undergone periodontal treatment in the last six months subjects who had taken antibiotics, anti - inflammatory drugs, steroids and contraceptives in the last six months subjects who are on antiresorptive drugs such as bisphosphonates (eg, alendronate) pregnant or lactating females informed consent was obtained from those subjects who agreed to participate voluntarily in this study after institutional ethical clearance was obtained . Based upon the periodontal disease index scores, the subjects were divided into two groups: group i- 20 subjects with healthy periodontium . Group ii- 20 subjects with generalized chronic periodontitis . For opn assessment, non - fasting, venous blood samples were collected from the subjects at the time of clinical examination (group i, ii) and two months after scaling and root planing in group ii . Blood was withdrawn by venepuncture from the anterior cubital vein using a sterile syringe and needle at the pathology laboratory at the bharati hospital . Five ml of blood sample was transferred to the vials containing anticoagulant and transferred immediately to the laboratory at interactive research school of health affairs (irsha). The stored plasma was used for estimation of opn levels at a later date . Plasma opn level thereafter, scaling and root planing was carried out for subjects with generalized chronic periodontitis and oral hygiene instructions were given to the subjects . Periodontal disease index was assessed after two months of scaling and root planing and plasma samples were also collected to estimate levels of opn . Systemically healthy patientspatients in age group of 20 - 45 yearsrandom selection of male and female patientstwenty subjects with healthy periodontiumtwenty subjects with generalized chronic periodontitis . Systemically healthy patients patients in age group of 20 - 45 years random selection of male and female patients twenty subjects with healthy periodontium twenty subjects with generalized chronic periodontitis . History of systemic diseases (e.g., diabetes mellitus, ischemic heart disease, other cvds contributing to arthrosclerosis, stroke, hypertensionhistory of any bone disorderssubjects who had undergone periodontal treatment in the last six monthssubjects who had taken antibiotics, anti - inflammatory drugs, steroids and contraceptives in the last six monthssubjects who are on antiresorptive drugs such as bisphosphonates (eg, alendronate)pregnant or lactating femalessmokers . History of systemic diseases (e.g., diabetes mellitus, ischemic heart disease, other cvds contributing to arthrosclerosis, stroke, hypertension history of any bone disorders subjects who had undergone periodontal treatment in the last six months subjects who had taken antibiotics, anti - inflammatory drugs, steroids and contraceptives in the last six months subjects who are on antiresorptive drugs such as bisphosphonates (eg, alendronate) pregnant or lactating females informed consent was obtained from those subjects who agreed to participate voluntarily in this study after institutional ethical clearance was obtained . Based upon the periodontal disease index scores, the subjects were divided into two groups: group i- 20 subjects with healthy periodontium . Group ii- 20 subjects with generalized chronic periodontitis . For opn assessment, non - fasting, venous blood samples were collected from the subjects at the time of clinical examination (group i, ii) and two months after scaling and root planing in group ii . Blood was withdrawn by venepuncture from the anterior cubital vein using a sterile syringe and needle at the pathology laboratory at the bharati hospital . Five ml of blood sample was transferred to the vials containing anticoagulant and transferred immediately to the laboratory at interactive research school of health affairs (irsha). The stored plasma was used for estimation of opn levels at a later date . Plasma opn level thereafter, scaling and root planing was carried out for subjects with generalized chronic periodontitis and oral hygiene instructions were given to the subjects . Periodontal disease index was assessed after two months of scaling and root planing and plasma samples were also collected to estimate levels of opn . The data obtained was subjected to statistical analysis using two sample t - tests, paired t - test to compare opn levels in group ii before and after treatment and un - paired t - test to compare opn levels in group i and ii . Correlation of the opn levels with the clinical parameter in each group was analyzed by pearson's correlation coefficient . In this study, an attempt was made to evaluate opn levels in subjects with healthy periodontium and generalized chronic periodontitis and its assessment after scaling and root planing using an osteopontin enzyme immunometric assay kit (quantikine). A total of 40 subjects between 18 to 45 years were included in this study . The mean concentration of opn in plasma was observed to be higher in the generalized chronic periodontitis group (153.08 ng / ml) as compared with the subjects with healthy periodontium (55.09 ng / ml) [table 1]. The difference in the mean of opn levels in group i and ii was 98.00 ng / ml; with t value as 9.249 and p value=0.00 which is statistically significant [table 2]. The opn level in plasma of generalized chronic periodontitis subjects was found to be significantly higher than that of healthy subject . Opn levels in plasma of group i and ii subjects at baseline comparison of opn levels in plasma of group i and ii subjects at baseline opn levels decreased to 91.52 ng / ml in group ii, two months after scaling and root planing . The difference in mean of opn levels was 61.5566 ng / ml witht value as 6.843 and p value as 0.00 which is statistically significant [table 3]. Comparison of opn levels in plasma of group ii at baseline and two months after scaling and root planing the mean periodontal disease index (pdi) score in the generalized chronic periodontitis group was 5.118650.469, whereas the mean pdi score in healthy subjects was 1.000.245 [table 4]. A significant difference (p<0.05) was found in the mean pdi scores between the healthy and generalized chronic periodontitis group . The mean pdi score in the generalized chronic periodontitis group i.e. Group ii was 5.118650.469 which reduced to 3.681.126 as assessed two months after scaling and root planing [table 5]. Statistically significant difference (p<0.05) in the pdi scores between the healthy and generalized chronic periodontitis group with the p=0.00 with higher values in the subjects with generalized chronic periodontitis . Pdi scores in group i and ii subjects at the baseline pdi scores in group ii at baseline and two months after scaling and root planing the opn levels in plasma were correlated with the pdi scores using pearson's correlation coefficient . When all the subjects (group i and ii) were considered together at baseline, the pearson's correlation coefficient was 0.893 was statistically significant (p<0.05). When only the generalized chronic periodontitis group i.e. Group ii (at baseline) was considered, the pearson's correlation coefficient was 0.731 which is also statistically significant (p<0.05). This suggests that opn levels in plasma show a positive correlation with the severity of the periodontal disease . When the generalized chronic periodontitis group (group ii) was considered two months after scaling and root planing, the pearson's correlation coefficient was 0.181 which is statistically not significant (p>0.05) after two months of scaling and root planing [table 6]. This result indicates that the rate of change of pdi is not similar to the rate of change of opn . Both the parameters show improvement after scaling and root planing, but correlation could not be established which can be attributed to the other factors such as hosts response or patients compliance in the resolution of periodontitis after treatment of the same . The results of this study demonstrated the elevated opn levels in plasma in subjects with generalized chronic periodontitis as compared with subjects with healthy periodontium . The results of the study are consistent with outcomes of recent investigations which reported which reported an elevation of opn in periodontitis patients . They found a highly significant elevation of opn plasma in subjects with chronic periodontitis group as compared with the healthy group . The assessment of opn concentration was determined using a sandwich type human osteopontin enzyme immunoesssay kit (titrezyme) which is different from our study where osteopontin enzyme immunometric assay kit (quantikine) was used to assess opn levels . The highest mean plasma opn concentrations observed in the periodontitis group in their study were 1273.21 ng / ml, and in the healthy group was 476.35 ng / ml . This was statistically significant (p0.05). In addition they also assessed and correlated opn levels in plasma with opn levels in gingival crevicular fluid (gcf). The highest mean gingival crevicular fluid concentrations were observed in the periodontitis group 1575.01 ng / ml, and the lowest in the healthy group 1194.80 ng / ml . They postulated that the concomitant increase of opn in plasma may be caused by the spillage or overflow of opn from the diseased periodontal tissues, or produced by the circulating activated macrophages . Subjects in the periodontitis group were treated by scaling and root planing, and strict oral hygiene measures were instituted . The mean concentration of opn in the plasma in the generalized chronic periodontitis group decreased from 153.09 ng / ml to 91.52 ng / ml, which showed a statistically significant relation . The findings of our study are also in agreement with sharma and pradeep . Who found that the level of opn decreased from 1273.21 ng / ml to 1051.68 ng/ ml in plasma of chronic periodontitis patients after treatment i.e. Two months after scaling and root planing . These results also showed a positive correlation with opn levels in gcf which were significantly reduced from 1575.01 ng / ml to 1194.80 ng / ml after treatment of subjects with chronic periodontitis . Also the mean pdi score of generalized periodontitis group decreased from 5.19 to 3.68 as assessed two months after scaling and root planing . Statistically significant positive correlation between opn in plasma and pdi was found at the baseline in subjects with generalized chronic periodontitis . However, weak positive correlation was observed between opn and pdi two months after scaling and root planing in subjects with generalized chronic periodontitis . The result of this study indicates a significant association between inflammatory marker opn and periodontal disease and a tendency for significant reduction of plasma opn levels after treatment of periodontitis . However, a weak correlation was observed between opn and pdi in generalized chronic periodontitis subjects after scaling and root planing . As the correlation between opn and cardiovascular disease has already been established and the opn levels also increase periodontal diseases which is evident from our results; this may indicate a strong correlation between periodontitis and cvd with one of the mediator as opn . Thus, it is clear that the risk of cvd can be reduced in otherwise healthy individuals with prevention/ treatment of periodontitis at an early stage . Scaling and root planing may also help in reducing the severity of pre - existing cvd . This implies that the assessment of periodontal status at the time of cardiovascular examination should also be incorporated in routine practice . From the above observation, it can be concluded that elevated levels of opn were seen in subjects with periodontitis as compared with healthy individuals . It was also found that the opn levels significantly decreases two months after periodontal therapy . As the correlation between opn and cardiovascular disease has already been established and the opn levels also increases in periodontal diseases which is evident from our results; this may indicate a strong correlation between periodontitis and cvd with one of the mediator as opn . Thus, it is clear that the risk of cvd can be reduced in otherwise healthy individuals with prevention / treatment of periodontitis at an early stage . This implies that the assessment of periodontal status at the time of cardiovascular examination should also be incorporated in routine practice . For clinical application of this approach, a long term study of large sample size is required with relevant laboratory investigations to evaluate cardiovascular status . Studies could also be carried out in relation to the subjects with periodontitis and pre - existing cvd to evaluate the effect of periodontal therapy on severity of cvd.

The development of the spinal cord plays a central role towards execution coordinated movements and of sensory inputs as well . Together with sensory inputs from the eye and ear in human they produce a movement output as a consequence of reflexes or higher brain cognitive functions . These circuits are mainly disturbed in motoneuron diseases like amyotrophic lateral sclerosis (als), spinal muscular atrophy (sma) or in cases of lesions caused by accidents . The restauration of such disturbed motor output functions is the main goal for physicians and scientists all over the world . If we therefore take a closer look at the time cell differentiation and establishment of those motor circuits, this may help to restore the original function in disease . The spinal cord as a central nervous system (cns) structure builds up connections to the periphery of the body . This includes muscle movement, breathing and rhythmic activities of muscle cells with a constant feed back to the higher brain regions . Disorders affecting the function of the motor system including als or sma are characterized by the progressive inability not only to walk and move but also suffer from the increasing inability to breathe or speak . The complexity of dysfunctions affecting the motor system makes it unable to apply cures on single cell type level but rather needs a more systemic approach . The fact that the motor system has great abilities to compensate dysfunctions for a longer time even makes it harder to start curing a disease as the loss of functional cells has started sometimes even years before . For example usually more than 50% of all motoneurons are already dysfunctional for a longer period before a patient comes to the clinic due to compensatory effects of the remaining functional cells in the spinal cord . Orphaned muscle cells are taken over by neighboring motoneurons as they send out new axonal side tribes to innervate these muscle fibers . Knowledge on the development of the spinal motor circuits might help to understand and might even help finding cures against such degenerative diseases . The cns epithelial cells of the neural tube are pseudo stratified cells and perform symmetric cell divisions to increase the number of neural precursor cells (npcs). Different regional signals along the rostro - caudal axis start to instruct the positional identity of the cells defining forebrain, midbrain, hindbrain, and spinal cord . Caudalization is induced by the vitamin a derivative retinoic acid (ra) followed by expression of pax3 by neuroepithelial cells . Subsequently, mutant mice deficient for retinaldehyde dehydrogenase 2 (raldh2) show severe alterations in hindbrain and spinal cord patterning . The second early molecule necessary for the specification of the spinal cord is the fibroblast growth factor (fgf). Both fgf and ra form antagonizing gradients to determine the anterior hindbrain and the posterior spinal cord along the rostro - caudal axis . Regionalization within the caudal part is performed by expression of the homeobox domain transcription factors (hoxgenes) (diez del corral et al ., 2003). These hox transcription factors represent the concept for a neuronal subtype identity of the embryonic hindbrain and spinal cord (wu et al ., 2008). While fgfs and ra define the cellular identity for the rostro - caudal axis, cellular identities along the dorso - ventral axis of the developing hindbrain and spinal cord are defined by members of the bone morphogenetic protein (bmp) and of the wingless / int-1 (wnt) family, secreted from the roof plate cells . The respective antagonizing signal comes from the notochord and later on from the floor plate cells which secrete sonic hedgehog (shh) as a ventralization signal for the spinal cord cells (dessaud et al ., 2008). The resulting progenitor cells, as well as the resulting cells from these progenitor pools are characterized by a specific expression patterning of homeodomain transcription factors . Consequently, mutations in patched 1 or smoothened, both being receptor parts of the shh pathway, induce severe patterning defects during embryogenesis . This homeodomain transcription factor concept has been considered as the essential mechanism for specification of neuronal and the latter glial subtype identities . Definition of cells might be in general performed by the transcription factor code but it does not clarify the way towards a specialized cell type . Such signals have to be positioned outside the cells and therefore the extracellular matrix most probably plays a pivotal role in this process . For example, heparan sulfate proteoglycans (hspgs) are found in almost all mammalian cells . They are on cell surfaces (glypicans, syndecans) and in the extracellular space (perlecan, collagen type xviii or agrin). They are composed of a core protein with covalent o - linked heparan sulfate glycosaminoglycan side chains . The fgf2 and fgf4, the wnt and the notch signaling pathways have been reported to be affinity- and position - dependent on the presence of hspgs . The matrix binds and places these factors to the optimal positions and thereby enhances specificity and availability of these factors (androutsellis - theotokis et al ., 2006). Additionally, neuroepithelial cells start their differentiation into neurons, by changing their 6-o - sulfation profile and their hs chain length . Alterations in n - sulfation, 3-o - sulfation and 6-osulfation have been detected during stem cell differentiation . The elimination of sulfation during in vitro neural stem cell differentiation changes the relative proportion of early neurons generated from the stem cell pool and appears to block the further differentiation of these post - mitotic cells . Hspgs have to pass the golgi apparatus as their side chains are sulfated by a subset of (sulfotransferase) enzymes (karus et al ., 2012; karus et al ., 2013 future research will have to focus not only on the transcription factor code but rather on the matrix and their specific discrete changes influencing position, differentiation and the total number of cells . More motoneurons than necessary are generated during embryonic development to serve the needs for adulthood . The excess in cells is reduced first due to the limited amount of trophic support and second by electric activity and connectivity to the target cells, the skeletal muscle . The motoneuron subtypes are well organized along the rostro - caudal and dorso - ventral axis in the spinal cord sorted by function and innervation targets . Neurons innervating the same target are together in a column (jessell, 2000) (see also figure 1). For example the motoneurons of mediomedial column present throughout the spinal cord innervate the axial trunk muscles while the lateral motor column (lmc), which is positioned in the brachial and lumbal part of the spinal cord innervates the skeletal muscles of the limbs and thereby regulates fine motor skills (bonanomi and pfaff, 2010). Segmentation and motoneuron connection during spinal cord development in mice . Motoneurons are positioned in motoneuron pools within the segments of the spinal cord from rostral to caudal . Eight cervical segments (c1 to c8) followed by 12 thoracic (t1 to t12 segments and 7 lumbal segments (l1 to l7). The expression of the homeobox protein hoxc8 marks the area of motoneurons necessary for forelimb prehension efficiency (tiret et al ., 1998). The more rostrally positioned motor columns innervate the forelimbs while the motoneurons of the thoracic segments innervate the sympathetic ganglia, the dermomyotome and the peripheral trunk muscles . The different motor columns along the rostro - caudal axis are characterized by expression of different homeobox transcription factors: isl-1 and isl- 2, (islet-1 and -2), lim-1, lim-3 (lim homeobox transcription factor-1 and -3), lhx4 (lim homeobox transcription factor 4). Three motoneuron subtypes exist in the motor columns, the -, -, and -motoneurons . The large multipolar -motoneurons innervate the extrafusal skeletal musculature receiving input from the proprioceptive sensory afferent neurons . Up to 30% of all motoneurons are smaller -motoneurons controlling the intrafusal muscle fibers in the muscle spindles . They modulate the response of the muscle spindle in accordance to the muscle extension and receive no direct input from proprioceptive sensory afferents . -motoneurons express the spindle - derived glial - derived neurotrophic factor (gdnf) for their survival during the early postnatal period . Experiments with conditional transgenic knock out mice also indicated that - and possibly also -motoneurons in part depend on factors generated from the muscle spindle . The skeleto - fusi motoneurons (-motoneurons) project both on the skeletal muscle and the muscle spindle . They can only hardly be distinguished from the -motoneurons and only little is known about their specific properties (kanning et al ., 2010). Apart from the terminal differentiation and positioning of the motoneuron cell bodies within the motor columns the growth of axons combined with correct targeting is critical for the latter function of the body . The pathfinder structures are capable of recognizing different signals from their surrounding and subsequently react to them . Sperry postulated in 1963 his chemo - affinity theory, by which the axons find their target cells according to the receptors in the growth cone so that they can recognize the guiding molecules along their way (sperry, 1963). Nowadays we know that axonal growth is not exclusively dependent on guidance molecules but also depends on molecules on the cell surface, diffusible trophic factors, electric activity and last not least extracellular matrix molecules (faissner, 1997; klausmeyer et al ., 2011). Diffusible factors can influence growth behavior and survival of neurons over long distances . Basically, diffusible factors and linked signals can act attractively or repulsively on the growing axon and the composition of the receptors on a growth cone determines the chemo - attractively or chemo - repulsively behavior . The combination of attraction and repulsion reveals that the growing axon finds the exit point from the spinal cord to target the muscle tissue . (bcs), make sure that the motor axons pass the neuroepithelium while the cell bodies stay in the neural tube . When they are not present, this leads to emigration of the cell bodies along the growing axons . Therefore the bcs not only influence the correct axon growth but rather take over responsibility for the resting behavior of the cell bodies of motoneurons . In contrast, the dorsal root ganglionic neurons behave totally different . When taken into culture the interaction of the bcs and the growing motor axons is performed by semaphorins and their receptors neuropilin 2 (nrp2) and/or plexin - a2 . The protein family of semaphorins includes membrane bound and soluble proteins and represents one of the largest protein families involved in axonal pathfinding . The metametric segmental patterning of the spinal nerves correlates with the typical segmentation including a repetitive rostro - caudal growth patterning and projection through the anterior part of the somites . Inhibiting factors are the peanut agglutinin (pna)-binding glycoprotein and semaphorin 3f (sema3f). Positioning of motoneuron cell bodies is mainly mediated by signals from the slit and robo family . The slits prevent migration of the motoneurons towards the ventral floor plate and thereby help them to stay in their correct columns . In contrast, the netrin / dcc (deleted in colorectal cancer) system attracts spinal motoneurons . The correct positioning and function of interneurons is important for coordination and gait . Here, the eph / ephrins and netrin / dcc act as important mediators . Effects were observed in knock out mice and could show for developing commissural interneurons aberrant midline axon guidance capabilities while the missing di6 interneuron marker dmrt3 (double sex / male - abnormal-3 related transcription factor) results in divergent gait patterning (vallstedt and kullander, 2013). While the axons of the medio - medial motor column (mmc) target to the dorsal trunk musculature, axons of the lateral motor column (lmc) project ventrally towards the limb musculature . Fibroblast growth factor has been identified as a chemotrophic factor for targeting the mmc motoneuron axons . Repulsive signals originate from the dorsal root ganglionic cells (drgs) and the ventral mesenchyme by receptor tyrosine kinases epha3 and epha4 and their respective ligand ephrina . Epha3/epha4 double mutants display a misguided axon growth as they cannot react to the repulsive signals of ephrina . As a consequence the growing motor axons of the mmc artificially target the drgs . Motor axons of the lmc grow ventrally to the limb musculature as they express other receptors compared to the motoneurons of the mmc . They do not react to the repulsive signals which prevent growth of the mmc motor axons into the limbs . The limb target tissue provides cell adhesion molecules of the immunglobulin superfamily like l1 and the neuronal cell adhesion molecule ncam . If this direct cell to cell interaction is inhibited it results in a stronger fasciculation and a wrong projection pattern . The concerted activity of soluble factors, membrane- bound factors, receptors on the cell surface and finally electric activity of the target cell establish the correct connection to the muscle cells . Experiments have shown that even on the level of already reduced axon numbers on the muscle so that one fiber is innervated by only one axon of a motoneuron there is still possible substantial alteration . This is mainly due to the fact that the initially made synapses have different stabilities . Experiments have shown that synapses at the skeletal muscle can be discriminated into fast synapsing (fasyn) and slow synapsing (desyn) terminals . Treatment of younger mice with -bungarotoxin resulted in selective and permanent denervation of the desyn synapses when applied before 3 months of age . Interestingly the actual more stable fasyn synapses appear more vulnerable in a mouse model for spinal muscular atrophy (murray et al ., 2008).

Humans have domesticated animals and plants through selective breeding, producing individuals with specific traits deemed beneficial (hazel 1950). Hunting and plant harvesting can have selective, evolutionary effects on wildlife behavior and wildlife and plant morphology (skogland 1989; mcgraw 2001; harris et al . 2002; coltman et al . 2003). Fishing can also be selective on certain life history traits; many types of fishing gear are designed to remove some individuals in preference to others (todd and larkin 1971; hamley 1975; law 2000; kuparinen et al . Overall, human exploitation can cause significant changes to life history and morphological traits of wild populations, including fish (darimont et al . Larger fish are preferentially harvested to (i) avoid growth and recruitment overfishing, (ii) reduce harvesting and processing costs, and (iii) meet market demands for bigger fish (walters and martell 2004). The common phenotypic effect of fishing (i.e., reduction in mean age and size) is widely known (trippel 1995; hutchings 2004), but more recently the possible genetic effects of fishery selection on life history traits such as age and size at maturity have received attention (policansky 1991; law 2000; olsen et al . 2004; kuparinen and merila 2007). Experimental exploitation studies on captive atlantic silversides (menidia menidia) showed evolutionary effects of size - selective mortality on somatic growth, yield, and population biomass, among other traits (conover and munch 2002; walsh et al . The researchers concluded that these effects were caused by selection of genotypes with variable growth rates . Among wild populations, significant reductions in age and size at maturity in many canadian atlantic cod (gadus morhua) stocks coincided with dramatic decreases in abundance, and some scientists have suggested that heavy, size - selective fishing contributed to these life history changes (hutchings and myers 1994; olsen et al . 2004). Most forms of fishing gear can be size - selective, but few studies have quantified fishery selection (but see sinclair et al . Such quantifications, though rare (fenberg and roy 2008), are necessary to reliably evaluate the consequences of fisheries - induced selection (law 2007; hutchings and fraser 2008; kuparinen et al . Comparison of the sizes and ages of fish that are caught with those that are not caught is essential for understanding the patterns of size selection, but such data are very difficult to obtain in most wild fish populations and fisheries . Gillnets are especially size - selective because a fish is only caught if it is small enough to enter the mesh but large enough to become entangled by it (hamley 1975; ricker 1981; bromaghin 2005). However, selectivity curves for gillnets of specific sizes are difficult to determine, even with experimental fishing using gillnets of known mesh size (todd and larkin 1971). Additionally, the use of multiple sizes of gillnets, as is frequently the case in commercial fisheries, makes the gillnet selectivity curves even more difficult to estimate . Fishermen are often secretive about the sizes of gillnets they use and may change gear during a season . Finally, many characteristics of fish and fisheries can further complicate size selection patterns, including seasonal migration timing of components of fish stocks that differ in age and size, temporal variation in fishing schedule and intensity, and the efficiency of the fishery when open . Studies of gillnet fishery selection on pacific salmon (oncorhynchus spp .) Are aided by their anadromous and semelparous life history . All salmon that pass through the fisheries and migrate into freshwater (termed the escapement) are maturing adults . These salmon can be counted and sampled for size and age, and those data can then be directly compared with data on samples from the catch because little natural mortality or growth typically takes place during this brief period . Ricker (1981) used catch and escapement data from british columbia, canada populations of all five pacific salmon species and reported that fishery selection contributed to decreasing trends in age and body size in many populations, though he noted that these traits are affected by numerous factors . Given the effects of density (i.e., competition) and climate on growth and age at maturity of salmon (e.g., rogers and ruggerone 1993; pyper and peterman 1999; reviewed in quinn 2005), it is important to carefully document fishery selection patterns over sufficient time periods that enable evolutionary changes to occur before associating fisheries with life history trait changes . In this study, commercial gillnet fishery catch and escapement data from 1946 to 2005 were used to quantify the magnitude and nature of selection on age and size at maturity for a commercially important and biologically diverse population complex of sockeye salmon (o. nerka) from the nushagak district of bristol bay, southwest alaska . This is an ideal study system because (i) there are long term data on size, age, and sex of sockeye in both the catch and the escapement; (ii) the fishery exploits a large percent of the run each year; and (iii) excellent records on the management of the fishery have been maintained over time, allowing us to examine the effects of covariates on the magnitude and direction of selection . First, few studies have quantified harvest selection in wild populations over the extended time periods needed to assess possible long term effects . Previous studies in bristol bay, for example, only examined data over short time periods (burgner 1964; bue 1986; hamon et al . Most commercial fisheries occur over long time periods and experience many changes in environmental conditions, fishing technologies, and management schemes, so variation in selection may occur for a number of reasons . (2009) postulated that harvest selection can be a consistent force, and we wanted to explore annual patterns of selection over many years on a wild population . Second, in many harvest selection studies, only the ages and sizes of individuals that are caught are known; life history traits of individuals that are not caught are unidentified or only indirectly estimated (but see carlson et al . 2007; we employed traditional methods to calculate yearly selection metrics, including selection differentials and vulnerability profiles, and we measured long term trends in these metrics . Using this information we first determined whether the fishery has been generally size - selective over the past six decades . We then assessed the extent to which this selection has changed over the period of record, considering specifically the effects of changes in gear, fishing rate, and average fish body size . We did not seek to determine explicitly whether fishery selection in this system is leading to changes in age and size at maturity, as that topic can only be fully addressed after the selection itself has been quantified (hutchings and fraser 2008), and the effects of selection are integrated with the environmental factors that also affect growth and maturation . However, we present data to help assess the possible evolutionary and ecological consequences of the size - specific fishing pressure at a basic level . 1), produces one of the most abundant and biologically diverse sockeye salmon runs in the world, and these salmon have been exploited by a commercial gillnet fishery since 1884 (bue 1986). The recent 25-year average total run size was 35 million fish, with an average annual catch of 24 million . 1). Sockeye salmon migrate through the nushagak bay on their way to spawn in three separate basins: the igushik, nushagak, and wood river systems (fig . One other basin, the snake river, is so small and supports so few salmon that it is not considered . Most sockeye salmon spawning in these systems spend 1 or, less frequently, 2 years rearing in lakes before migrating to sea, where they spend 14 (typically 2 or 3) more years, returning in june - july and spawning in july - september (quinn et al . The five fishing districts, and associated freshwater systems, of bristol bay, alaska, including the nushagak district . The history of the bristol bay sockeye fishery is well documented and knowledge of its management and its many changes allows greater understanding of the nature of fishery selection . Commercial fishing began in the 1880s using fish traps and gillnets fished from wooden sailboats . Motorized boats were not permitted until 1951, at which time 32 feet was fixed as their maximum length . Motorized vessels have evolved with technology, though the length regulation remains in effect (link et al . Mesh size has been regulated in bristol bay since 1924, first at a minimum of 5 inches (146 mm) and then, in 1962, at a minimum of 5 inches (136.5 mm) to lessen fishing pressure on larger sockeye . These early regulations were intended to increase profitability without reducing spawning success by increased the catch of longer sockeye, including more males, and allowed smaller fish, mostly females, to escape (bue 1986; link et al . After the 1984 season, minimum gillnet mesh size regulations were ended and, since then, for the majority of the season, mesh size is not standardized, though in some years regulations to reduce exploitation of chinook salmon (o. tshawytscha) are enacted for short periods of time (tim sands, alaska department of fish and game, pers . Prior to 1951 most gillnets were made of cotton or linen twine, which caught fish of a narrow size range . Multi - strand nylon web gillnets came into use in 1952, followed by multi - strand nylon monofilament web in 1981 . These materials were superior to cotton and linen, catching more fish of a greater range of sizes because they were lighter, more transparent, and more elastic (bue 1986). Since the 1950s the bristol bay sockeye salmon fisheries have been managed to achieve an escapement goal based on the carrying capacity of the system for spawning by adults and rearing by juveniles (link et al . Fisheries are opened conservatively based on predicted run timing to ensure that escapement goals are met; after that, fisheries are opened to a greater extent . Therefore, fishing rate often changes over the course of the season (quinn et al . The fishery has also seen different levels of sockeye abundance over time, and the varying proportions of the run being caught may affect selectivity . Since 1946, 1986% of the annual sockeye salmon run in the nushagak district was caught, with an average harvest of 54% (fig . This harvest percentage was high in the first years of this dataset, decreased in the 1960s and 1970s, and has been increasing since the late 1970s . Changing ocean environments and other factors caused increased sockeye salmon runs to bristol bay after 1978, also escalating catch rates (hilborn et al . Number of sockeye salmon in the nushagak district run and proportion of the run caught by the fishery, 19462005 . Since 1946 scientists and fishery managers have estimated the nushagak district sockeye salmon catch and escapement, and collected age, sex, and length (asl) data on individual fish on a daily basis throughout the fishing and escapement periods . At fish processing plants, catch numbers are estimated and a sample (range: 10656643 fish per year) is measured for length and weight, scales are collected to be read for age determination, and sex of each fish is recorded . The wood, nushagak, and igushik rivers have counting towers or sonar devices to enumerate upstream migrating salmon that have escaped the fisheries . Beach seine nets, which collect adults of all sizes, are used to sample the escapement for asl data each day (range: 1503542 fish per year per river). Daily catch and escapement counts were available from 1946 to 1959 but raw asl data were not available during this time . (1963) by measuring a sample of the salmon for asl and expanding these by the overall counts during the sampling time periods . Therefore, from 1946 to 1959 these calculations, rather than data on individual fish, were used to characterize fishery selection . No data were available from 1960 to 1962, and daily counts and asl data from individual fish were used from 1963 to 2005 . We used the yearly asl data to characterize length and length at age for all sockeye salmon in the nushagak district, treating males and females separately . Because sockeye salmon of different ages, sizes, and sexes may enter the fishery and migrate upriver at different times (older and larger fish generally enter earlier; quinn 2005) and fish abundance varies greatly throughout the season, it would be imprecise to average length and age data on a seasonal basis to characterize the catch and escapement . Therefore, daily asl data were used to estimate the distribution and abundance of all sockeye sizes and ages by weighting the number of fish sampled daily of a given age, length, and sex by the total number of caught or escaped on that day . On days when asl data were not collected, we estimated sockeye salmon length by interpolation from adjacent days with data . We characterized the age, sex, and length of all individuals escaping into each of the three rivers to avoid biases resulting from variation in proportions migrating to each river among years . To calculate the total escapement on a given day we first performed analyses on fish of all ages and then grouped fish by the number of years that they had been in the ocean (ocean age). Because salmon put on> 99% of their weight at sea, ocean age largely determines their overall size (quinn 2005), and thus vulnerability to being caught in a gillnet . If <40 fish of each of these ages were examined for asl within a given year for the escapement into any of the three river systems, calculations were not made for that year . To calculate the total number of fish being caught or escaping of a given age, we multiplied the total catch or escapement by the proportion of fish of a given age group on a daily basis . We assumed that fish of all sizes and age groups, had, on average, equal contact with the fishery (i.e., opportunity to get caught) in a given year and that differential fishing mortality was due to the effects of the gillnet fishery rather than some other attribute, such as migration route . Fishing occurs throughout the nushagak fishing district, close to shore and in the open water, and the fishery is very effective at catching fish (tim sands, alaska department of fish and game, pers . Doctor (2008) provided evidence of subtle differences in migration timing among some populations within the nushagak fishing district but this complex, like others in bristol bay, is characterized by compressed migration timing and broad overlap among the components . For each year that data were available, we calculated exploitation ratio (total proportion caught) for fish of each age group (all ages, ocean age 2, and ocean age 3) and sex on a yearly basis (py, a, s) (equation 1). Where cy, a, s is the number of fish of a certain age and sex caught in a given year and ey, a, s is the number of fish of a given age and sex in the escapement in that year . We also created yearly length and length at age frequency histograms (in 10 mm bins) of sockeye salmon in the catch and escapement to reconstruct their distribution in the total run . Next we constructed yearly gillnet vulnerability profiles for each sex and age group showing, for each length bin, the proportion of fish that were caught (lagler 1968). Proportions caught were calculated for a given length and age (py, a, l; equation 1). For each year, proportions were scaled to 1 by dividing the proportion for each length by the maximum proportion within that year, allowing comparisons between years . The proportion caught was calculated only for length bins for which more than 3000 fish of all ages or 2000 fish of ocean ages 2 or 3 were caught on a given day to prevent inaccurate results due to small sample sizes . We calculated yearly length - based standardized selection differentials (ssdy) for each sex and ocean age (equation 2). This value is the difference in mean length of fish in the run (, where) versus those in the escapement () (i.e., before versus after fishing) (law and rowell 1993) divided by the standard deviation of length of fish in the run () to allow comparison between years . Confidence bands about the vulnerability profiles and ssds were determined by bootstrapping the asl data on a daily basis, with 500 replicates per year (0.025 and 0.975 quantiles of the replicates). To better understand how changing fishery management, run size, fish size, and catch levels have affected selection over time, we performed ordinary least squares regression analysis of the form: these models regressed ssds and year - specific subsets of the following factors: (i) gillnet mesh size regulations (as a categorical variable), (ii) run size, (iii) length deviation from the long term average, and (iv) date at which half of the total catch is reached (catch date, which describes fishery timing). All regressions were performed for fish of each sex and ocean ages 2 and 3 separately because these groups were selected differently by the fishery . Interactions among all factor combinations were examined for significance along with temporal autocorrelation, and the best models were chosen based on akaike information criterion with a second order correction for small sample sizes (aicc) (burnham and anderson 2002) and r values . Aicc values show how well a model fits the data without being overparameterized and r values show how much of the variation in the data is explained by each model . We picked the model that had the lowest aicc value and used the r value to support these decisions . 1), produces one of the most abundant and biologically diverse sockeye salmon runs in the world, and these salmon have been exploited by a commercial gillnet fishery since 1884 (bue 1986). The recent 25-year average total run size was 35 million fish, with an average annual catch of 24 million . 1). Sockeye salmon migrate through the nushagak bay on their way to spawn in three separate basins: the igushik, nushagak, and wood river systems (fig . One other basin, the snake river, is so small and supports so few salmon that it is not considered . Most sockeye salmon spawning in these systems spend 1 or, less frequently, 2 years rearing in lakes before migrating to sea, where they spend 14 (typically 2 or 3) more years, returning in june - july and spawning in july - september (quinn et al . The five fishing districts, and associated freshwater systems, of bristol bay, alaska, including the nushagak district . The history of the bristol bay sockeye fishery is well documented and knowledge of its management and its many changes allows greater understanding of the nature of fishery selection . Commercial fishing began in the 1880s using fish traps and gillnets fished from wooden sailboats . Motorized boats were not permitted until 1951, at which time 32 feet was fixed as their maximum length . Motorized vessels have evolved with technology, though the length regulation remains in effect (link et al . Mesh size has been regulated in bristol bay since 1924, first at a minimum of 5 inches (146 mm) and then, in 1962, at a minimum of 5 inches (136.5 mm) to lessen fishing pressure on larger sockeye . These early regulations were intended to increase profitability without reducing spawning success by increased the catch of longer sockeye, including more males, and allowed smaller fish, mostly females, to escape (bue 1986; link et al . After the 1984 season, minimum gillnet mesh size regulations were ended and, since then, for the majority of the season, mesh size is not standardized, though in some years regulations to reduce exploitation of chinook salmon (o. tshawytscha) are enacted for short periods of time (tim sands, alaska department of fish and game, pers . Prior to 1951 most gillnets were made of cotton or linen twine, which caught fish of a narrow size range . Multi - strand nylon web gillnets came into use in 1952, followed by multi - strand nylon monofilament web in 1981 . These materials were superior to cotton and linen, catching more fish of a greater range of sizes because they were lighter, more transparent, and more elastic (bue 1986). Since the 1950s the bristol bay sockeye salmon fisheries have been managed to achieve an escapement goal based on the carrying capacity of the system for spawning by adults and rearing by juveniles (link et al . Fisheries are opened conservatively based on predicted run timing to ensure that escapement goals are met; after that, fisheries are opened to a greater extent . Therefore, fishing rate often changes over the course of the season (quinn et al . The fishery has also seen different levels of sockeye abundance over time, and the varying proportions of the run being caught may affect selectivity . Since 1946, 1986% of the annual sockeye salmon run in the nushagak district was caught, with an average harvest of 54% (fig . This harvest percentage was high in the first years of this dataset, decreased in the 1960s and 1970s, and has been increasing since the late 1970s . Changing ocean environments and other factors caused increased sockeye salmon runs to bristol bay after 1978, also escalating catch rates (hilborn et al . Number of sockeye salmon in the nushagak district run and proportion of the run caught by the fishery, 19462005 . Since 1946 scientists and fishery managers have estimated the nushagak district sockeye salmon catch and escapement, and collected age, sex, and length (asl) data on individual fish on a daily basis throughout the fishing and escapement periods . At fish processing plants, catch numbers are estimated and a sample (range: 10656643 fish per year) is measured for length and weight, scales are collected to be read for age determination, and sex of each fish is recorded . The wood, nushagak, and igushik rivers have counting towers or sonar devices to enumerate upstream migrating salmon that have escaped the fisheries . Beach seine nets, which collect adults of all sizes, are used to sample the escapement for asl data each day (range: 1503542 fish per year per river). Daily catch and escapement counts were available from 1946 to 1959 but raw asl data were not available during this time . (1963) by measuring a sample of the salmon for asl and expanding these by the overall counts during the sampling time periods . Therefore, from 1946 to 1959 these calculations, rather than data on individual fish, were used to characterize fishery selection . No data were available from 1960 to 1962, and daily counts and asl data from individual fish were used from 1963 to 2005 . We used the yearly asl data to characterize length and length at age for all sockeye salmon in the nushagak district, treating males and females separately . Because sockeye salmon of different ages, sizes, and sexes may enter the fishery and migrate upriver at different times (older and larger fish generally enter earlier; quinn 2005) and fish abundance varies greatly throughout the season, it would be imprecise to average length and age data on a seasonal basis to characterize the catch and escapement . Therefore, daily asl data were used to estimate the distribution and abundance of all sockeye sizes and ages by weighting the number of fish sampled daily of a given age, length, and sex by the total number of caught or escaped on that day . On days when asl data were not collected, we estimated sockeye salmon length by interpolation from adjacent days with data . We characterized the age, sex, and length of all individuals escaping into each of the three rivers to avoid biases resulting from variation in proportions migrating to each river among years . To calculate the total escapement on a given day we first performed analyses on fish of all ages and then grouped fish by the number of years that they had been in the ocean (ocean age). Because salmon put on> 99% of their weight at sea, ocean age largely determines their overall size (quinn 2005), and thus vulnerability to being caught in a gillnet . If <40 fish of each of these ages were examined for asl within a given year for the escapement into any of the three river systems, calculations were not made for that year . To calculate the total number of fish being caught or escaping of a given age, we multiplied the total catch or escapement by the proportion of fish of a given age group on a daily basis . We assumed that fish of all sizes and age groups, had, on average, equal contact with the fishery (i.e., opportunity to get caught) in a given year and that differential fishing mortality was due to the effects of the gillnet fishery rather than some other attribute, such as migration route . Fishing occurs throughout the nushagak fishing district, close to shore and in the open water, and the fishery is very effective at catching fish (tim sands, alaska department of fish and game, pers . Doctor (2008) provided evidence of subtle differences in migration timing among some populations within the nushagak fishing district but this complex, like others in bristol bay, is characterized by compressed migration timing and broad overlap among the components . For each year that data were available, we calculated exploitation ratio (total proportion caught) for fish of each age group (all ages, ocean age 2, and ocean age 3) and sex on a yearly basis (py, a, s) (equation 1). Where cy, a, s is the number of fish of a certain age and sex caught in a given year and ey, a, s is the number of fish of a given age and sex in the escapement in that year . We also created yearly length and length at age frequency histograms (in 10 mm bins) of sockeye salmon in the catch and escapement to reconstruct their distribution in the total run . Next we constructed yearly gillnet vulnerability profiles for each sex and age group showing, for each length bin, the proportion of fish that were caught (lagler 1968). Proportions caught were calculated for a given length and age (py, a, l; equation 1). For each year, proportions were scaled to 1 by dividing the proportion for each length by the maximum proportion within that year, allowing comparisons between years . The proportion caught was calculated only for length bins for which more than 3000 fish of all ages or 2000 fish of ocean ages 2 or 3 were caught on a given day to prevent inaccurate results due to small sample sizes . We calculated yearly length - based standardized selection differentials (ssdy) for each sex and ocean age (equation 2). This value is the difference in mean length of fish in the run (, where) versus those in the escapement () (i.e., before versus after fishing) (law and rowell 1993) divided by the standard deviation of length of fish in the run () to allow comparison between years . Confidence bands about the vulnerability profiles and ssds were determined by bootstrapping the asl data on a daily basis, with 500 replicates per year (0.025 and 0.975 quantiles of the replicates). To better understand how changing fishery management, run size, fish size, and catch levels have affected selection over time, we performed ordinary least squares regression analysis of the form: these models regressed ssds and year - specific subsets of the following factors: (i) gillnet mesh size regulations (as a categorical variable), (ii) run size, (iii) length deviation from the long term average, and (iv) date at which half of the total catch is reached (catch date, which describes fishery timing). All regressions were performed for fish of each sex and ocean ages 2 and 3 separately because these groups were selected differently by the fishery . Interactions among all factor combinations were examined for significance along with temporal autocorrelation, and the best models were chosen based on akaike information criterion with a second order correction for small sample sizes (aicc) (burnham and anderson 2002) and r values . Aicc values show how well a model fits the data without being overparameterized and r values show how much of the variation in the data is explained by each model . We picked the model that had the lowest aicc value and used the r value to support these decisions . Length frequency histograms showed variation in the length and length at age distributions of males and females over time . As expected, ocean age 3 fish were longer than ocean age 2 fish and males were longer than females for a given age, though overlap was observed among these groups . Patterns of catch and escapement length distributions have also varied greatly among years, suggesting differing patterns of fishery selection . Total yearly exploitation rates, or proportions of the fish that were caught, increased significantly over the years for males and females and fish of all age groups (p <0.05; fig . 3), but they increased more for ocean age 2 fish (of both sexes) than for ocean age 3 fish . In most years, the proportion of males caught was higher than that of females . This difference was attributable to ocean age 2 fish; from 1963 to 2005, an average of 51% of ocean age 2 males were caught compared to 42% of ocean age 2 females . For ocean age 3 fish, an average of 62% of males and 64% of females were caught, and on average 57% of males and 54% of females of all ages were caught . Proportion of the nushagak district sockeye salmon run caught of (a) all ages, (b) ocean age 2, and (c) ocean age 3 as a function of ocean age and sex, 19632005 . Vulnerability profiles revealed significant differences by length within and between sex and age groups over time (fig . 4), 1s . For females of all ages, longer fish (> 550 mm) were most vulnerable during earlier years, indicating directional selection favoring smaller fish (fig . 4a). In later years vulnerability peaked at medium - long lengths, indicating disruptive selection favoring shorter and also the very longest fish . In only 2 years, 1991 and 2001, vulnerability was highest for the shortest females (<450 mm) and decreased for longer fish . Vulnerability profiles for males of all ages were generally similar to those of females (fig . 4b). However, in most years, even the early ones, the longest males (> 600 mm) were less vulnerable than the longest females, and male vulnerability curves peaked for the medium - long fish rather than the longest . This suggests that fishery selection on males has been less directional and more disruptive, compared to females . In recent years length vulnerability profiles of female (a) and male (b) sockeye salmon of all ages from 1946 to 2005 in the nushagak district . Dotted black lines indicate the 95% confidence intervals; data were insufficient for calculations in the early years . We found inconsistent patterns of vulnerability to the fishery over time for ocean ages 2 and 3 sockeye salmon . Longer ocean age 2 fish were, in many years, most vulnerable to the fishery . However, in other years vulnerability profiles were dome - shaped or showed that shorter fish were most vulnerable . In the early years (<1979 for females, <1973 for males), longer ocean age 3 fish were consistently more vulnerable than smaller fish . This pattern then weakened for both sexes, and in the later years smaller fish were most vulnerable, especially males . The different size selection patterns between ocean age 2 and 3 fish were consistent with the greater size of the ocean age 3 fish . However, the overlap in length distributions of the two ages and the generally greater length of males than females made overall fishery vulnerability patterns complicated . Thus, the fishery has been size - selective but the most vulnerable length was not always the largest; it depended on the combination of year, sex, and age of the fish . In 91% of the years (52 of 57), ssds for female sockeye salmon of the nushagak district were negative, indicating that the fishery was catching longer than average fish (fig . However, ssds for females have decreased in magnitude over time and in some recent years they have been positive . However, since 1965 positive or 0 ssds were evident in many years, showing that length selection has become weaker and less directional . Standardized selection differentials for female and male sockeye salmon of all ages (19462005) and ocean age 2 and 3 (19632005) of the nushagak district . Ocean age 2 females that escaped to spawn were, for the most part, shorter than fish in the run as a whole (i.e., before fishing; fig . Selection changed direction in 1982 . In 85% of the years (11 of 13) before that year ssds were positive, indicating that on average shorter males were caught than escaped . However, after 1982 ssds were mostly negative (in 88% of years), so longer males were caught . In the most recent years, the selective trend has weakened and become variable . Size selection on females and males of ocean age 3 was inconsistent over time (fig . 5c). For females, in earlier years (<1979) all ssds were negative, but in 14 of 27 (52%) years since then ssds were positive . A similar long term pattern was revealed for males . Before 1973, all 8 years with data had negative ssds but since then ssds were positive in most years (20 of 31 or 65%). Regression models were consistent for male and female sockeye salmon of the same age group (table 1). Factors most often included in the best fit models to explain ssds included gillnet mesh size regulation, run size, and fish length deviation from the long term average . For ocean age 2 fish, the best models included length deviation from the long term average and gillnet mesh size regulation . Ssds increased, becoming more positive (signifying weaker selection on big fish), as length deviation increased, mesh size decreased, and abundance of salmon increased . More complex models, which had higher r values of 0.540.56, including (i) both gillnet mesh size regulation and run size and (ii) mesh size regulations, run size, and length deviation, explained selection best for ocean age 3 sockeye; the factors affected ssds in the same way they did for ocean age 2 fish . Significant first - order temporal autocorrelation was found for ssd regressions of ocean age 2 male fish . However, such autocorrelations were not detected for females of any age, nor for ocean age 3 males, so we did not analyze this factor further . Models that best predicted standardized selection differentials (ssds) for sockeye salmon in the nushagak district, 19632005, based on aicc and r values aicc, akaike information criterion with a second order correction; ar1, significant first - order autocorrelation coefficient . Our study fills a need for quantifying the intensity of harvest selection and estimating selection differentials directly (law 2007; kuparinen et al . Examination of age- and size - selective harvest of sockeye salmon in a commercial gillnet fishery over 57 years revealed higher susceptibility and exploitation of older and larger fish in most years . This overall result confirmed the general belief that larger is more vulnerable, but the details of our findings revealed a much more intricate and variable pattern of exploitation and vulnerability (fig . Sockeye salmon runs with varying sex ratios and proportions of age classes experienced different selection patterns due to sex- and age - specific difference in fishery selectivity . The gillnet vulnerability curve and the selectivity of the fishery depend on the size distribution of fish that encounter the nets . In the nushagak district fishery, age composition, and thus length frequency, can change dramatically from year to year due to ocean conditions and the strength of different brood years, which can affect the vulnerability curves and size - selectivity . In most years more males than females and more ocean age 3 than ocean age 2 fish were caught (fig . Fishery selection was strongly directional in the early years (1946early 1970s); longer fish were more vulnerable to the fishery than smaller fish (fig . 4). However, during and after the 1970s size selection became less directional and more disruptive, especially for males; fish of intermediate lengths have been the most vulnerable . In many years more large females were caught than large males (figs 4 and 5) because male sockeye salmon are, on average, longer than females . Recently, the magnitude of fishery selection has decreased and the fishery has not consistently selected for or against fish of a given length (fig . 5). In this fishery, gillnet mesh size regulations, salmon abundance, and deviation in fish length from long term average were the most important variables affecting selectivity (table 1). When salmon were very numerous, larger fish experienced less selection than in years when there were fewer fish . The likely explanation is that when salmon were abundant the overall exploitation increased (because the number allowed to escape to spawn is fixed) and so the more intense fishing pressure caught more fish of all sizes . The effects of gillnet mesh size regulations were more obvious; mandates for larger mesh sizes and regulations prohibiting the use of smaller mesh increased the catch of larger fish . Finally, in years when the fish were larger, the largest fish tended to escape, likely because they were too big to be caught . Short - term variability in size - selection patterns was due to different combinations of these factors . Delta aic values were <2 for all models shown in table 1, indicating that each had similar support . For female fish, significant interactions were detected between year and length deviation and between year and run size . This suggests that for females, the effects of length deviation and run size on selectivity varied over time . Just as age composition and length frequency changes can affect fishery selection patterns, changes in population composition over time different patterns of fishery selection and exploitation will be revealed at different spatial scales . Assessing fishery selection on a fishing district scale is important because that is the level at which management actions occur (minard and meacham 1987). Examining harvest selection on a population - level scale is important because that is the scale at which many processes of natural and sexual selection act . Yearly estimates of the proportion of each spawning population passing through the fishery are not available . However, catch and escapement for the three main rivers that drain into the nushagak district (thus a finer spatial scale than the district as a whole but not as fine as discrete spawning populations) have been estimated (adfg unpublished data; kendall and quinn, in press; branch and hilborn, in review). To assess how different proportions of fish returning to these river influenced fishery selection, we quantified the run size for each watershed and included the proportion of the run migrating to the wood river system (the watershed typically with the largest run size) as an additional parameter in our linear regressions of nushagak district - wide ssds . We found that for females, but not males, the proportion of the run heading to the wood river was a significant parameter in models explaining ssds . We also extended our fishery selection quantification to the finer spatial scale, quantifying population - specific exploitation rates, ssds, and vulnerability profiles (kendall and quinn, in press). These analyses revealed that fishery selection and exploitation have not been uniform on populations that differ in average age and length . A long term, decadal perspective of harvest selection on a wild population is necessary to understand potential genetic changes that can result . Short term studies may draw incomplete conclusions about the selective nature of harvest, and studies that examine only life history or morphological endpoints of wild populations (e.g., yoneda and wright 2004; hamilton et al . 2007) may not reveal annual variability and intermediary processes within a population that can have broader ecosystem impacts . For example, burgner (1964) found that gillnets in the nushagak district fishery were highly selective on larger, ocean age 3 fish, particularly females during 19461959 . Thus, using only burgner's results may produce different conclusions about fishery selection patterns and their potential implications than are indicated by a longer perspective . Much recent research has focused on evolution of life history traits in wild fish stocks, both marine and freshwater (law 2000; olsen et al . 2007), and in wildlife (coltman et al . 2003) due to size - selective harvest . In some studies size - selectivity was not directly measured but was assumed to be directional due to gear type used . Our results demonstrate that even when size - selective gear is used and a large proportion of the stock is exploited, harvest selection is not necessarily consistent or predictable . Thus, in modeling the effects of fishery and harvest selection and understanding ecosystem effects of such exploitation, scientists and managers cannot assume consistent, directional selection and the consequences of such . In general, large size at seawater entry or rapid early growth at sea results in early age at maturation, and the older (and ultimately larger) fish are the slower - growing members of the cohort . The effects of disruptive harvest selection on norms of reaction are further complicated by differences in selection between males and females, resulting in uncertain overall consequences for the fish . Thus, the variable nature of fishery selection over time in the nushagak district fishery, and likely many other fisheries, may hinder evolution of fish towards an optimal life history . An additional consideration is that there are many spawning populations within the nushagak district that were sampled collectively in our study . Here we have assessed fishery selection at the fishing district scale and grouped all populations together . However, these populations have consistent differences in average age at maturity and length at age, and so their patterns of exploitation and selection also vary (kendall and quinn, in press). We estimated length - based gillnet fishery selection, but a fish's girth probably has more influence on its vulnerability to a gillnet rather than length per se . Unfortunately, girth data are not available in the nushagak district, nor are they in many fisheries data sets, and they cannot be calculated from the available data . Regier (1969) found that unless precise girth measurements can be taken at the mesh mark, it is better to use length to understand fishery selection . Still, girth is an important consideration in fishery selectivity, and because male and female salmon of the same length may have a different girth and shape, the actual selectivity patterns of male and female salmon may differ from those estimated from length data . Our results revealed that the nushagak district fishery has caught longer than average fish during most of the past 60 years . From an ecological standpoint, beyond the reduction in abundance of spawning adults that inevitably results from fishing, size - selective fishing can reduce per capita productivity if the small fish that survive to breed produce fewer eggs than would have been produced by the prefishery size distribution . Using the mean and maximum selection differentials observed for female sockeye salmon in the nushagak district, we estimated the decrease in egg production by females of average length due to such fishery selection using extensive length - fecundity data from the wood river system (quinn et al . The average fishery selection differential from 1946 to 2005 was 8 mm, reducing the fecundity of an average female by only 5% (104 eggs). At the greatest observed selection differential (29 mm), the average female spawner would have 12% fewer eggs . There are undoubtedly other kinds of ecological effects of size - selection (for example, larger females dig deeper nests than smaller females; steen and quinn 1999) but these lines of evidence suggest that the numerical consequences of the selective fishery in this system have not been great . From an evolutionary viewpoint, it is of great interest whether nushagak district sockeye salmon, and others subject to size - selective harvest, have become smaller and younger as a direct result of such harvest . Size selection patterns by the nushagak fishery, and likely many other fisheries, have varied over time, in part due to stochasticity of environmental and management conditions . In addition, they have also been affected by variation in population contribution over time (kendall and quinn, in press). Size and age at maturity of adult salmon are influenced by many factors, including but not limited to density of conspecifics, density of other salmon species, and ocean conditions (rogers and ruggerone 1993; pyper and peterman 1999; ruggerone et al . Thus, evolutionary effects of fishing cannot be revealed without careful consideration of the many factors affecting growth and maturation . Calculation of probabilistic maturation reaction norms (dieckmann and heino 2007) is a way to integrate these effects with fishery selection (e.g., fukuwaka and morita 2008). Also from an evolutionary perspective, fish whose maturation size coincides with that of maximum vulnerability to its fishery could adjust their size or age to reduce the probability of being caught . A fish given age or mature at an earlier or later age and thus at a different size . Overall, the nushagak district fishery has caught larger than average, but not the largest, sockeye salmon . In general this corresponds to large ocean age 2 fish and smaller ocean age 3 fish, and thus to reduce the probability of being caught, ocean age 2 fish should grow slower and ocean age 3 fish should grow faster . This would seem to require a complex change in the reaction norm between growth and probability of maturation that controls variation in age and size within and among populations (quinn et al . Nushagak district sockeye salmon have become both longer and older in recent decades (fig . 6; p = 0.0004 and r = 0.27 for age of males, p = 0.07 and r = 0.09 for age of females), consistent with the hypothesis that density - dependent effects in the ocean depress growth and result in a phenotypic shift in age at maturation (pyper et al . 1999; holt and peterman 2004). This finding is inconsistent with the expectation that fisheries - induced evolution causes harvested fish populations to become shorter and younger, as was expressed for iteroparous species (law and grey 1989). However, the effects of such evolution on anadromous, semelparous fishes such as pacific salmon may be different and should be explored further . Proportion of ocean age 3 sockeye salmon in the nushagak district run (the vast majority of the remaining fish are of ocean age 2), 19632005 . For fish and wildlife populations under size - selective exploitation, it may be important to maintain large numbers of phenotypically diverse breeders to buffer against the detrimental effects of selection (darimont et al . The nushagak district fishery is managed using biologically - robust escapement goals, which have been increasing in recent years, allowing more sockeye salmon onto the spawning grounds . 1) met or exceeded its escapement goal in 85% of the years from 1962 to 2005 (tim baker, alaska department of fish and game, pers . Additionally, for most of the past 60 years, the fishery has not harvested the biggest fish returning to spawn, benefiting the nushagak district stocks in the short- and long - term (law 2007). The suite of populations thus seems to be very healthy, to the benefit of the ecosystems that depend on them (naiman et al . Thus, the biologically robust escapement goals used to manage the fishery and prevention of harvest of the largest individuals may contribute to the weaker and less consistent size - selectivity in recent years . Such escapement goals and gear that spares the largest individuals may be included in a manager's toolbox to prevent negative effects of size - selective harvest . Finally, fishery and natural, including sexual, selection may act in opposition (carlson et al . 2007; hutchings and rowe 2008), and evolutionary trait changes may result from their combined effects (edeline et al . 2007). For bristol bay sockeye salmon and many other species, age at maturity and length at age result from a blend of natural, sexual, and anthropogenic selection . Ecological processes on the spawning grounds that favor large individuals may compensate to some degree for the reduction in the overall numbers of these individuals . The fact remains the larger than average fish have been harvested in most years from the nushagak district sockeye salmon stock . The effects of such harvest selection on wild populations must be examined from many angles, and conclusions must be drawn using long term studies that incorporate ecological, ecosystem, and evolutionary considerations.

Both innate and adaptive immune responses are, in every way, affected by polarization with cytokines . The expression of costimulatory molecules and chemokines, as well as the execution of effector programs, is affected in monocytes . In humans and mice, t helper (th)1 and th2 polarization with ifn - r and il-4 il-4 polarization, also known as either alternative or m2a activation, stimulates wound recovery and parasite immunity responses . Ifn - r polarization, which is referred to as either classical or m1 activation, is responsible for tumor resistance, intracellular killing, and il-12 production in monocytes . M1 macrophages, which are activated by the classical pathway, are shown to be responsive to two signals: type 1 inflammatory cytokines and microbial products . There are three subsets of m2 macrophages: m2a, induced by il-4 or il-13; m2b, induced by immune complexes and agonists of tlrs or il-1 receptors; and m2c, induced by il-10 and glucocorticoid hormones . M1 and m2 macrophages can be differentiated based on their receptors, expression of cytokines and chemokines, and effector function . M1 macrophages are microbicidal and inflammatory, and m2 macrophages are immunomodulators (m2a and m2c) and possess minimal microbicidal effects . Recently, the activation or polarization of macrophages has been demonstrated to be rapid, plastic, and fully reversible . This shows that macrophages are dynamic when they first engage in the inflammatory response and the resolution process that follows and that changes in function are caused by changes in the microenvironment . Low - level laser therapy (lllt) is a form of light emission with a power output of less than 500 mw and is therefore considered nonthermal irradiation to living tissue . Lllt is known to be a noninvasive treatment modality and has been applied in various fields . Lllt was thought to be effective in pain relief and promoting recovery of some pathology, including tendinopathies, osteoarthritis, temporomandibular joint disorders, wound healing, and nerve injuries [7, 8]. The exact mechanism is still under investigation, but the mechanism is likely to be photochemically related . This would affect the biological regulation of nitric oxide and adenosine triphosphate and would further affect the inflammatory process or cytokine release . Lllt is prevalent in the prevention and treatment of cancer therapy - induced oral mucositis [9, 10] and may alter human immunity . Lllt has also been shown to have several biological effects that favor the healing process . Lllt (660 nm) is able to promote the skin repair of burned rats by decreasing the necrotic area and upregulating cyclooxygenase-2 and vascular endothelial growth factor expression . An in vitro study demonstrated that increased intracellular calcium influx occurred in mast cells, followed by histamine release after laser irradiation, which may explain the biological effect of lllt in promoting wound healing . Cytokine expression in short - term muscle remodeling is also modulated by lllt, which leads to a decline in tnf- and tgf- after cryoinjury . Similarly, the clinical value of the potential immune modulation effect of laser therapy has recently been studied in the treatment of allergic rhinitis . The ability of the ktp/532 yag laser to reduce nasal congestion and discharge in patients with allergic rhinitis has been identified . The ktp/532 yag laser is effective as an additional treatment for patients who are refractory to medications, and the treatment is extremely well tolerated without significant side effects . After one year, nasal obstruction was improved in 69% of cases and nasal discharge in 40% of cases . 308 nm xenon chloride (xecl) uvb irradiation significantly minimized these symptoms, including rhinorrhoea, sneezing, and nasal obstruction, and improved the total nasal scores and the allergen - induced skin prick tests in a dose - dependent manner . The xecl uvb excimer laser may also serve as a new treatment option for treating allergic rhinitis, which is a th2-dominant disease that is suppressed by th1 or m1 immunity . Controlled by the action of histone acetyltransferases (hats), histone deacetylases (hdacs), and methyltransferases, histone acetylation and methylation are important epigenetic modifications that influence gene transcription . Modifications on histones, such as acetylation or trimethylation at h3k4, h3k36, and h3k79, are associated with gene activation . It is unknown, however, whether lllt modulates human monocyte polarization and immune function via epigenetic regulation . Because different types of lasers have been used for the treatment of th2-dominant disease, we evaluate the influence of lllt on monocyte polarization in this study . We investigated the regulatory effects of lllt on monocyte m1 polarization to provide evidence for the use of lllt for immunologic disorders . Louis, mo) supplemented with 10% fetal bovine serum, 100 u / ml of penicillin, and 100 g / ml of streptomycin at 37c with 5% co2 in a humidified incubator . Thp-1 cells were centrifuged, resuspended in fresh media, and plated in 24-well plates at a cell density of 5 10/ml 24 hours before experimental use . The cells were pretreated with a low - power gallium - aluminum - arsenide (gaa1as) laser (03 j / cm; 660 or 808 nm) alone or 2 hours before lps (0.2 g / ml) stimulation . Cell supernatants were collected 12, 24, and 48 hours after lps stimulation . To investigate epigenetic regulation, the cells were pretreated with methylthioadenosine (mta, a histone methyltransferase inhibitor) or anacardic acid (aa, a histone acetyltransferase inhibitor) 1 hour before lllt . To investigate the mitochondria involvement in lllt - related monocyte polarization, the cells were pretreated with oligomycin (1 and 2.5 g / ml, sigma - aldrich, st . Louis, mo, usa) or antimycin (0.1 and 0.5 g / ml, sigma - aldrich, st . The gaa1as ultra red laser with wavelengths of 660 nm and gaa1as near - infrared laser with wavelengths of 808 nm (transverse ind . A total volume of 1 ml of cell - containing media for 12-well plates was added into each well to decrease the refraction during the low - level laser irradiation treatment . The distance between the gaa1as laser source and the culture plate was adjusted to ensure homogeneous laser exposure in 12-well plates . The cells were treated with the gaa1as laser beam to reach a total energy of 0, 1, 2, and 3 j / cm, respectively . Thp-1 cells were treated with different doses of lllt and total rna was isolated from cells immediately (t = 0) or 6 hours after lps stimulation . Total rna was extracted from cells using trizol (invitrogen, carlsbad, ca) according to the manufacturer's instruction . Three g of rna from each sample was then reverse - transcribed into first - strand cdna in 20 l of reaction mixture using the superscript first - strand synthesis system with the real - time pcr kit (invitrogen). Measurements were performed by an abi prism 9700 ht sequence detection system (applied biosystems, foster city, ca) using a predeveloped taqman probe / primer combination for m1-related genes and glyceraldehyde 3-phosphate dehydrogenase (g3pdh) from the same cdna samples . Taqman pcr was performed in 10 l using amplitaq gold polymerase and the universal master mix (applied biosystems). Threshold cycle numbers were transformed using the comparative threshold cycle and relative value methods according to the manufacturer's recommendation and expressed relative to g3pdh, which is used as a housekeeping gene by multiplexing single reactions . The m1-related cytokine and chemokine genes are as follows: ccl2/mcp-1, cxcl10/ip-10, and tnf-. The ccl2/mcp-1, cxcl10/ip-10 and tnf- concentrations in the cell supernatants were determined using commercially available elisa - based assay systems (r&d systems, minneapolis, mn) 5 10 cells were treated with 1% formaldehyde for 10 min at room temperature, followed by sonication of the dna and immunoprecipitation of chromatin overnight with antibodies against acetylated h3 and h4 and trimethylated h3k4 (upstate biotechnology, waltham, ma). Immune complexes were collected using a protein a slurry (invitrogen), and the dna was reverse cross - linked, extracted, and quantified using a taqman sds 7900ht . For pcr amplification of chip products, primers and probes were designed to analyze the proximal promoter and intronic enhancer regions of the tnf- gene as previously described [19, 20], encompassing the following subregions relative to the transcription start site: tnf1 (t1, + 99 to 42); tnf2 (t2, + 32 to 119); tnf3 (t3, 100 to 250); tnf4 (t4, 195 to 345); and + 1417, + 720, and 1700 . Primers and probes were also designed to analyze the proximal promoter regions of the cxcl10/ip-10 gene (cxcl10/ip-10 - 1: + 9 to 172 and cxcl10/ip-10 - 2: 444 to 622). (1 ml / well), treated with lllt (660 nm), and incubated for 24 h. the cells were harvested and washed 3 times with pbs for direct immunofluorescence staining using labeled monoclonal antibodies to cd14, cd45ro, ccr7, or cd86 . The cell surface markers were analyzed using a facscan flow cytometer and the cellquest software (becton dickinson, franklin lakes, nj, usa). According to the manufacturer (invitrogen, carlsbad, ca), an anchored oligo - dt primer was used to reverse - transcribe total rna (1 g) using superscript ii . Primer pairs were designed using primer3 (http://frodo.wi.mit.edu/primer3/) and were validated using in silico pcr (http://genome.ucsc.edu/cgi-bin/hgpcr) and blast (http://blast.ncbi.nlm.nih.gov/blast.cgi). The following primer sequences were used: mt - nd1nadh dehydrogenase, subunit 1 (mt complex i) fw: accatttgcagacgccataa and re: tgaaattgtttgggctacgg; sdha succinate dehydrogenase complex, subunit a, flavoprotein (mt complex ii) fw: caaacaggaacccgaggtttt and re: cagcttggtaacacatgctgtat; mt - cytb mitochondrial cytochrome b (mt complex iii) fw: gccctcggcttacttctctt and re: gacggatcggagaattgtgt; cox1 (mt - coi)cytochrome c oxidase i (mt complex iv) fw: ttcgccgaccgttgactattctct and re: aagattattacaaatgcatgggc; mt - atp6atp synthase, h+ transporting, mitochondrial fo complex, subunit f6 (mt complex v) fw: tttgcggaggaacattggtgt and re: tccagatgtctgtcgcttagat; ucp2uncoupling protein 2 (mitochondrial, proton carrier) fw: cctgaaagccaacctcatgac and re: caatgacggtggtgcagaag; and 18 s rrna fw: tagagggacaagtggcgttc and re: cgctgagccagtcagtgt . For q - pcr time course samples (n = 3), 10 l reactions consisting of 3 l of diluted cdna and 0.3 m of forward and reverse gene - specific primers combined with 2 power sybr green pcr master mix (applied biosystems, foster city, ca) were aliquoted into 96-well plates using a biomeck 2000 laboratory automation workstation (beckman coulter inc ., fullerton, ca). Applied biosystems prism 7900ht sequence detection system was used for the amplification process that included a ten - minute 95c denaturation stage, then forty repetitions of 95c for fifteen seconds, and lastly 60c for one minute . Quantifications were obtained by the comparative ct method (ct) (applied biosystems, foster city, ca). The geometric mean of housekeeping gene (gapdh) expression served as the internal control . The relative copy number of mtdna was computed via normalizing the crossing points in the quantitative pcr curves between the mitochondrial nd1 gene and the nuclear 18s rrna gene, and the ratio was normalized to the control . Differences between experimental and control groups were analyzed by using the mann - whitney u test . Changes in chemokines and cytokines at different doses of lllt alone were analyzed using the wilcoxon signed rank test . A p - value <0.05 was considered indicative of a significant difference between groups . We first tested whether lllt (03 j / cm, 660 and 808 nm) influenced the m1-related chemokine and cytokine expression in thp-1 cells . Real - time pcr data showed that the m1-related chemokine ccl-2 was enhanced by 660 nm (1 - 2 j / cm) and 808 nm (1 - 2 j / cm) lllt 24 hours after irradiation . The most powerful effect was produced by 1 j / cm of 660 nm lllt and 2 j / cm of 808 nm lllt (figures 1(a) and 1(b)). However, 3 j / cm of lllt (660 and 808 nm) suppressed ccl-2 expression in thp-1 cells . Cxcl-10 mrna expression was enhanced by 660 nm lllt but suppressed by 808 nm lllt (figures 1(c) and 1(d)). Tnf-, an m1-related pro - inflammatory cytokine, was also enhanced by 660 nm lllt but suppressed by 808 nm lllt 24 hours after irradiation (figures 1(e) and 1(f)). The effect of lllt on m1-related cytokine and chemokine mrna expression was observed at 12, 24, and 48 h time points (figures 2(a), 2(b), and 2(c)). There were no differences between the control group and all of the other groups with different doses of lllt treatment, indicating that cell viability was not affected by lllt (data not shown). Because lllt could induce m1-related cytokine and chemokine mrna expression in monocytes, we examined whether lllt could also induce m1-related cytokine and chemokine protein expression . One j / cm of 660 nm lllt significantly induced ccl2 and cxcl10 production in human monocytes, whereas 2 j / cm and 3 j / cm did not (figures 3(a) and 3(b)). Tnf- protein production was also enhanced by 660 nm lllt 24 h after irradiation (figure 3(c)). The influence of lllt on m1-related chemokine and cytokine production may also involve mitochondrial biogenesis and activation . It is known that oligomycin hinders atp synthase by blocking its proton channel (fo subunit), which is necessary for oxidative phosphorylation of adenosine diphosphate to atp and leads to an increased proton gradient, which decreases both respiratory activity and oxidative phosphorylation, thereby resulting in mitochondrial dysfunction . Antimycin is a mitochondrial inhibitor that binds in the energy - coupling site and inhibits the flow of electrons from cytochrome b to cytochrome c1 . Low - intensity laser irradiation has been reported to improve mitochondrial dysfunction and leads to mitochondrial alterations [24, 25]. The inhibition of lllt - induced ccl2 mrna expression by oligomycin and antimycin suggested mitochondrial involvement (figure 4). As shown in figures 5(a) and 5(b), 1 j / cm of lllt significantly increased the copy number of mitochondria, but 2 j / cm of lllt did not . The data are similar to the lllt - induced production of m1-related chemokine and cytokine . Next, we evaluated the involvement of respiratory chains including complexes i to v and uncoupling protein . One j / cm of lllt increased the mrna amount of complexes i to v and uncoupling protein, whereas 2 j / cm did not (figures 5(c) and 5(d)). It has been shown that epigenetic modification at the tnf- gene locus occurs by a coordinated and complicated network of regulation involving dna methylation, histone modification, and chromatin remodeling . Studies in monocytes and macrophages have shown that although there are different patterns of histone modifications, the main regulatory regions associated with histone modifications could be identified in lllt - treated monocytes . In fact, the involvement of histone acetylation in the regulation of tnf- expression was further supported by the finding that aa significantly suppressed tnf- expression in lllt - treated thp-1 cells (figure 6(a)). To determine whether histone modifications occurred in thetnf- gene locus in monocytes, chip analysis of thp-1 cells treated with lllt was conducted; pcr primers corresponding to four overlapping subregions (1700 and tnf14, covering the region between 345 and + 99) in the tnf- promoter and two intronic regions (+ 720 and + 1417) in the tnf- gene were used . Compared to the histone modifications found in the medium control cultures, significant histone modifications were detected at the tnf- gene locus in lllt - treated thp-1 cells . As shown in figures 6(b) and 6(c), upregulated tnf- expression in lllt - treated thp-1 cells was associated with an increased level of histone 3 acetylation primarily in the t1, t4, and intron sequence (+ 1720) of the tnf- gene; however, increased histone 4 acetylation was found to be mostly associated with the proximal promoter regions of the tnf- gene in the t1, t2, and intron sequence (+ 1417). We next examined whether the effects of lllt on tnf- expression were due to histone methylation . Moreover, chip analysis also showed elevated levels of tri - methylated h3k4 at the proximal promoter subregion, as well as the tnf1, tnf3, and tnf4 regions of the tnf- gene in lllt - treated cells (figure 6(e)). Next, we investigated whether lllt - induced ip-10 expression in human monocytes was induced by increasing histone acetylation and trimethylation . Pretreatment with aa reversed lllt - induced ip-10 expression in thp-1 cells (figure 7(a)). Chip analysis also showed increased levels of h3 at the proximal promoter subregion cxcl10 - 1 in the ip-10 gene in lllt - treated cells, whereas h4 occupation did not increase (figures 7(b) and 7(c)). Pretreatment with mta did not reverse lllt - induced ip-10 expression in thp-1 cells (figure 7(d)). Therefore, these findings suggested that the effect of lllt on m1 polarization is associated with the cellular regulation of differential histone modification . Polarization of t cells and macrophages with cytokines influences every aspect of the immune response, including innate and adaptive immunity [13]. It is important to understand and be able to control macrophage polarization to eventually be able to enhance our immunity and treat immune disorders . Over the last decades, we have witnessed an increasing prevalence of allergic diseases, which are relatively common and often debilitating diseases . Allergic diseases are caused by elevated th2 cells, but the reason for this preferential activation is unclear . Macrophages are the major antigen - presenting cells involved in the induction of the primary immune response and play a critical role in immunity . Ifn - r polarization, occurring through either classical or m1 activation, programs monocytes for phagocytosis, tumor resistance, and allergy suppression . It is also important to understand how to modulate the function of macrophages, induce m1 immunity to promote intracellular killing and tumor resistance, and prevent allergic reaction . Lllt is a form of light therapy with therapeutic effects on living tissues . In this study, 660 nm lllt promoted m1 polarization and cytokine and chemokine mrna and protein expression . Therefore, the effect of lllt on monocyte polarization may be a potential treatment for allergic diseases and may also promote immunity to viral infections and tumors . The optimal dose of 1 j / cm may be more effective for promoting m1 immunity than 2 j / cm or 3 j / cm . Tnf- is an endotoxin - induced cytokine that causes necrosis and death of tumors and is also a pro - inflammatory cytokine predominantly released by macrophages . Not only is tnf- a pro - inflammatory cytokine, but it is also an immunoregulatory molecule that can modify the balance of t regulatory cells . In addition, tnf- is a central cytokine that triggers inflammation in rheumatoid arthritis (ra), indicating that the inhibition of tnf- is an effective treatment strategy for ra . Following a viral infection, cxcl10/ip-10 is secreted by bronchial epithelial cells, and th1 cells are recruited via cxcr3 to eliminate the intracellular pathogen . Baseline cxcl10 serum concentration is linked to the outcome of antiviral therapy in monoinfected hepatitis patients, as well as in patients coinfected with hiv [30, 31]. Mcp-1/ccl2 is one of the key chemokines that regulate migration and infiltration of monocytes and macrophages . Both ccl2 and its receptor ccr2 have been shown to play vital roles in numerous diseases . The movement of monocytes from the blood stream across the vascular endothelium is required for both regular immunological surveillance and inflammatory response . Ccl2 inhibits the viral attachment of human immunodeficiency virus (hiv-1) to the ccr2 and ccr5 coreceptors . Additionally, the expression of all m1 polarization cytokines and chemokines is promoted by lllt . Therefore, lllt may be useful to promote antiviral immunity but may not be a suitable therapy for autoimmune or rheumatoid diseases . Considering the importance of m1-polarized macrophages in various disease contexts, especially immunity to intracellular microorganisms and tumors, we examined the effects of different doses of lllt on the expression of m1-polarized macrophages related cytokines and chemokines by using human thp-1 monocytes and provided evidence supporting the effects of lllt on macrophage function . In this study, our results showed that after five days of muscular lesion, the activities of complex ii and succinate dehydrogenase elevated considerably in contrast to the control group . Moreover, our results demonstrated that lllt significantly increased the activities of complexes i, ii, iii, and iv and succinate dehydrogenase compared to the muscle injury group without treatment . This study also shed light on the mechanisms of epigenetic regulation by lllt in immune cells . Modifications on histones, such as acetylation or trimethylation at h3k4, h3k36, and h3k79, are associated with gene activation . Recently, histone modification has become a new target for antiallergy drug development . In this study, lllt induced histone h3 and h4 acetylation and h3k4 trimethylation in the tnf- gene promoter area . Lllt also induced histones h3 acetylation in the ip-10 gene promoter region but did not induce acetylation of histone h4 . These results suggest that epigenetic regulation could be one of the important mechanisms by which lllt modulates m1-related cytokine and chemokine expression . In this study, 660 nm lllt appeared to be a potent enhancer of the production of pro - inflammatory cytokines and m1-related chemokines in monocytes . M1-related immunoregulations play important roles in the antiviral and antitumor immunity and the pathogenesis of inflammation in autoimmune diseases . Because tnf-, mcp-1, and ip-10 are important indicators of lllt - induced m1 polarization, lllt may promote anti - viral and anti - tumor immunity but enhance autoimmune and rheumatoid diseases . Lllt may be a potent immune - enhancing agent that is suitable for the treatment of allergic diseases but may not be a good therapy for autoimmune and rheumatoid disorders.

Craniopharyngioma is an uncommon tumor of the nervous system; it is well - known to recur even several years after surgery . We are here with reporting a case of craniopharyngioma which recurred at a site removed from the original site 5 years after surgery and radiotherapy . A 4-year - old girl was admitted for progressive deterioration of vision of 2 months duration . In addition there was no history of endocrinopathy, fits or any symptom of raised intracranial pressure . On examination, visual acuity was questionable perception of light on the right side and counting fingers at 3 m distance on the left . Imaging revealed a solid and cystic craniopharyngioma in the sellar - suprasellar region [figure 1a and b]. She underwent a right frontotemporal craniotomy and transsylvian exploration and almost total excision of the tumor . Postoperative mr showed a tiny residual tumor adherent to the pons [figure 2a and b]. (a and b) showing the preoperative images (before first surgery) (a and b) images after first surgery showing no residual tumour in the primary site but a small fragment adherent to the pons she was given a course of radiotherapy for this residue 54 gy in 30 fractions . Follow - up imaging at the end of 2 years did not reveal any residual tumor [figure 3]. Two years after surgery and radiotherapy no recurrence imaging was being done periodically to check for recurrence . The 5-year surveillance imaging showed a recurrence in the right sylvian fissure along the route taken during the first surgery . There was no evidence of tumor in the sellar - suprasellar area [figure 4a and b]. She underwent reexploration by the same route, and a tiny fragment densely adherent to the middle cerebral artery was left behind . (a and b) showing remote recurrence five years after first surgery and radiotherapy . Although craniopharyngiomas are benign tumors they are known to recur even after years and even after the administration of radiotherapy, recurrence rates ranging from 25% to 70% . Recurrences at a site removed from the original site are very rare <25 cases have been reported . These ectopic recurrences are not to be misinterpreted as ectopic primary occurrences since craniopharyngioma can occur anywhere along the obliterated rathke's pouch . These ectopic recurrences may occur along the surgical pathway or at a site, not along the surgical pathway . The cells of the tumor may get implanted and may subsequently metamorphose into a fresh neoplasm . These tumor cells may in turn give rise to the regrowth of the tumor . The usual time to recurrence is around 4 years . But why this has to be a peculiarity of craniopharyngiomas cannot be explained . Another way the tumor may get seeded at a distant site the evidence for this is strong since tumor cells have been observed in the csf . Although most recurrences are along the surgical corridor an instance where the recurrence has occurred in the spine has been recorded . When the transsphenoidal route is used, the csf spaces are not violated this may explain the absence of recurrences after transsphenoidal route . It is not surprising to observe that the histologic examination of the primary and recurrent lesions are the same . Recurrences rates are said to be low after total surgical excision . But recurrences even decades after a quiescent period are well - known . It can be assumed that radiotherapy would have sterilized the surgical corridor and ectopic recurrences will not occur . But this was not the case in our patient, and in the few that have been reported . Total excision is not an assurance that recurrences at ectopic or primary site will not occur . Certain measures have been proposed to minimize these ectopic recurrences, protecting the operative field with patties to prevent seeding, emptying the cyst prior to removal of tumor, thorough irrigation of the field before dural closure . Probably, a higher mib-1 index and expression of p53 may predispose to these recurrences . But eternal vigilance and regular imaging are mandatory to detect recurrences . Another point worthy of note is why this phenomenon is not seen with respect to other benign tumors like meningiomas or even malignant tumors.

Pathological tissue fibrosis is the abnormal accumulation of collagen - rich extracellular matrix (ecm) after a chronic or misregulated response to injury that progressively disrupts tissue architecture, leading to tissue stiffness, impaired organ function, and eventually organ failure . Fibrosis is featured in diverse conditions, accounts for as much as 45% of all deaths worldwide, and appears to be increasing in prevalence . Fibrosis complications arise in very different disease settings, from autoimmunity and environmentally induced inflammation to cancer, spanning multiple organs . To date, the treatment options are extremely limited for attenuating or reversing this process . Thus, there is an urgent need to delineate underlying pathological mechanisms that may lead to new therapeutic approaches . Both the initiation and persistence of pathological fibrosis involves the activation and differentiation of progenitors to myofibroblasts, the key effectors in fibrosis . Myofibroblasts play an important role in executing physiologic tissue repair, leading to matrix deposition, wound contraction, and healing on one hand, and pathological fibrogenesis leading to chronic fibrosing conditions on the other . Accordingly, prominent molecular pathways in acute tissue repair often recapitulate their fibrogenic function in chronic fibrotic conditions, essentially conditions in which wound healing has gone awry; these include platelet derived growth factor receptor beta (pdgfr) and transforming growth factor beta (tgf-). However, there are still many gaps in our understanding of the mechanisms underlying fibrogenesis . Due to their morphology and function, these cells are incredibly difficult to study in vitro . Recently, elegant fate mapping studies pointed to a role for pericytes as a significant progenitor pool for myofibroblasts after injury in a variety of organ systems . Liver pericytes, also known as hepatic stellate cells (hscs), have been shown to be the major progenitor pool for myofibroblasts after carbon tetrachloride (ccl4)-induced liver injury and fibrosis,5, 6 and gene expression profiling of these cells isolated at various time points after ccl4 administration identified molecular alterations that might be functionally relevant to fibrogenesis . Likewise, myofibroblasts and their precursors have been transcriptionally profiled during kidney fibrosis in mice using translational ribosome affinity purification technology . Isolation of this cell type induces a lot of alteration in what these cells express; therefore, it is important to study the function of the genes in their native disease environment without disrupting cell - cell and cell - matrix interactions . We aimed to identify novel modifiers of tissue fibrosis expressed in myofibroblasts or their progenitors through rna silencing in vivo . Although much more challenging than conducting a cell - based screen in vitro, this in vivo approach was pursued to enable the interrogation of gene function in the context of the complex tissue environment and thereby yield physiologically relevant fibrosis modifiers . In order to achieve this objective, we employed recently generated transcriptomes from myofibroblasts and their precursors in models of liver and kidney injury and fibrosis.6, 7 to achieve effective gene silencing in vivo, we used small interfering rna (sirna) delivery with lipid nanoparticles (sirna - lnps), an emerging technology for gene silencing in vivo, particularly in the liver, and hence deployed this technology in a model of liver fibrogenesis . The sirna - lnp technology has been previously used to show that silencing of the collagen type i alpha 1 gene (col1a1) reduced its mrna levels and collagen accumulation in liver fibrosis models.9, 10 however, the use of sirna - lnp technology in a targeted assay for identifying novel fibrosis modifiers has not yet been reported . Herein, we report our use of a platform composed of novel sirna targets, sirna - lnp delivery technology, and ccl4-induced liver fibrosis, resulting in the identification of novel modifiers of fibrogenesis in vivo . We aimed to silence genes in key fibrogenic cell lineages, myofibroblasts, and pericytes to identify novel mediators of tissue fibrosis . Candidate genes were selected by the intersection of gene expression datasets for this cell lineage in two different organ systems . We identified genes that were commonly at least 2-fold upregulated in activated hscs isolated from livers of mice treated with ccl4 for 2 months and myofibroblasts and pericytes, their precursors, in the mouse kidney 2 and 5 days after unilateral ureteral obstruction (uuo). We excluded transcripts that were not associated with a gene product, had no human homolog, or had well - known functions in fibrosis (figure 1). Ultimately, we unbiasedly tested 24 genes by sirna - mediated gene knockdown (kd) in vivo (table s1). Ccl4-induced liver injury and fibrosis in mice is a well - characterized model consisting of repeated ccl4 administration that injures hepatocytes, followed by a fibrogenic reaction . Hscs are activated to expand, differentiate to myofibroblasts, and produce increased levels of ecm and pro - inflammatory mediators, thereby also promoting macrophage accumulation; all of these reactions constitute a coordinated response to tissue injury and the progressive accumulation of collagen . We found that animals dosed orally with 1 ml / kg of ccl4 in mineral oil on day 0 and day 7 and euthanized on day 10 exhibited significant liver fibrosis based on increased picrosirius red (psr) and collagen immunopositivity in liver tissue as compared to vehicle - treated mice . Percent area of tissue immunoreactive with asma, the hallmark of myofibroblasts, and iba-1, a macrophage - specific marker, were also increased in ccl4-treated animals, suggesting an increase in myofibroblasts and macrophage numbers in the tissue (figures s1a s1c). Corresponding to increased collagen deposition in tissue, col1a1 mrna was markedly upregulated (figure s2a). The assessment of col1a1 mrna levels was used as an expedient approach to functionally assess a relatively large number of sirna targets and flag fibrogenic genes of interest . Given the sirna - lnp delivery system targets multiple liver cell types, including hscs, hepatocytes, kupffer cells, but not endothelial cells,11, 12, 13, 14 we validated the ability to kd genes expressed in hscs in mice using sirna - lnps (figures s1d s1h). Mice were injected with a single dose of sirna - lnp (1 mg / kg) against reelin (reln - lnps), a gene prominently expressed in hscs . Animals receiving reln - lnps, but not luc - lnps (negative control), showed significant reduction in reln mrna in both oil- and ccl4-treated animals (figure s1e). We also demonstrate the ability to kd the hsc - specific gene col1a1 in liver . Col1a1-lnp reduced col1a1 mrna by 50%, with no effect on reln mrna . Because the tgf- pathway is a recognized fibrogenic mediator, we tested whether kd of transforming growth factor beta receptor 1 (tgfbr1) decreased the transcription and accumulation of collagen indeed, administration of tgfbr1-lnps and col1a1-lnps, but not luc - lnps, reduced the transcription of col1a1 mrna (figure s1f) as well as collagen accumulation (figures s1 g and s1h). To test the role of genes identified in our transcriptomic analysis, we modified the sirna administration protocol to allow pre - existing protein to be turned over and therefore achieve pre - clearance of proteins encoded by the genes of interest and ensure continued kd throughout the experiment (figure 2a). We first used luc - lnps to validate this protocol for detecting differences between oil- and ccl4-treated cohorts, with respect to the levels of col1a1 mrna, our primary parameter for defining target genes . We similarly evaluated differences in the mrna levels for a panel of other genes (figure s2a). The strictly standardized mean difference (ssmd) values for col1a1, collagen type iii alpha 1 (col3a1), tissue inhibitor of metalloproteinases 1 (timp1), and platelet derived growth factor receptor beta (pdgfrb), but not tgfbr1, integrin subunit alpha m (itgam), or alpha - actin-2 (acta2), suggested that these genes were suitable to use as readout genes (figure s2b). Having established the suitability of the ccl4 treatment with the sirna - lnp kd platform, we proceeded to test our candidate genes . We tested the effect of kd of 24 individual genes in vivo (figure 2a). We identified seven genes that significantly reduced the amount of col1a1 mrna (table 1). Five of these seven genes, namely, early growth response 2 (egr2), fk506-binding protein (fkbp10), atpase na / k transporting subunit alpha 2 (atp1a2), follistatin like 1 (fstl1), and hyaluronan synthase 2 (has2), were silenced by 75%100% in whole liver tissue and significantly reduced col1a1 mrna levels . Silencing of these genes did not elicit any overt toxicity, as measured by body weight loss (figure s3). Because the other 19 genes did not meet these criteria (tables 1 and s1), we focused on further analyzing the five modifiers of fibrosis . The kd of the transcription factor (tf) egr2 had the broadest effect by reducing the levels of col1a1 and col3a1 mrna as well as the percent area immunopositive for asma, iba-1, and collagen proteins, although the reduction in collagen by half did not achieve significance (figure 2; table 1). Egr2 silencing also reduced pdgfrfb mrna levels (figure 3a), suggesting a mechanism of decreased fibrosis and macrophage accumulation due to reduced expansion of activated hscs . Given that egr2 has structural similarities to its family members, egr1 and egr3, we confirmed the specificity of the egr2 sirna by transfecting human 293 t cells with plasmids encoding mouse egr1, egr2, or egr3 under the transcriptional control of the cmv promoter . In the tested construct, the expression of mouse egr1, egr2, and egr3 is not under the control of the endogenous promoter . Thus, reduction in gene expression is due to the binding of the sirna egr2 to the mrna . Using the same egr2 sirna that was used for the in vivo experiments, we found that this sirna reduced egr2 mrna levels, but not egr1 or egr3 mrna, unambiguously demonstrating that egr1 and egr3 were not targeted by our egr2 sirna (figures s4a s4c). Interestingly, even though the sirna against egr2 was specific, egr2-lnp treatment in vivo also reduced egr1 and egr3 mrna levels (figures s4d s4f), suggesting transcriptional co - regulation of egr family members . Similar to egr2, kd of fkbp10 or atp1a2 reduced the collagen and iba-1 positive areas as did that of egr2 (figure 2; table 1); however, kd of fkbp10 or atp1a2 did not alter the percent immunopositivity for asma . Fkbp10 kd also decreased pdgfrb mrna levels, but this effect was somewhat weaker than that of egr2 (28% versus 45% reduction; figures 3a and 3b), possibly accounting for its lack of effect on asma immunopositivity . These results suggest that egr2, fkbp10, and atp1a2 regulate fibrogenesis through different mechanisms . Kd of either of the two other fibrosis modifiers, fstl1 and has2, decreased col1a1 mrna levels as well as macrophage and collagen accumulation in the tissue, although has2 kd did not achieve significance for the latter (figure 2). Notably, kd of these genes showed increased amounts of asma immunopositivity, which was highly significant for has2 kd, suggesting increased numbers of myofibroblasts . Corresponding with the increased myofibroblasts, we detected higher levels of the timp1 mrna in the livers of both fstl1 and has2 kd animals (figures 3d and 3e). Despite the increased myofibroblast and timp1 mrna levels,, we also conducted in parallel in vitro studies and showed that three independent fstl1 sirnas reduced col1a1 mrna levels . Thus, the direct reduction of collagen transcription may be sufficient to reduce overall collagen accumulation, despite the elevated number of myofibroblasts and reduced collagen degradation (figure s5). Egr2 emerged as the strongest modifier of fibrosis in the ccl4 liver fibrosis / sirna kd platform . We aimed to directly demonstrate that egr2 kd in an hsc would reduce col1a1 and pdgfrb mrna levels . We tested the effect of egr2 kd in the human hsc line lx-2 using three independent sirnas (figure 4). This experiment required a different sirna to be used because no species cross - reactive sirna was designed (see materials and methods). All sirnas against erg2 reduced its mrna levels as well as col1a1 and pdgfrb mrna levels . These results are consistent with the effect of egr2 kd in our in vivo ccl4 assay platform . As expected, kd of col1a1 reduced its own expression, but not that of egr2 . Interestingly, col1a1 silencing also reduced pdgfrb mrna levels, suggesting a regulatory feedback loop . Taken together, these data support that egr2 is fibrogenic in both rodents and humans . Myofibroblasts are key effectors of fibrosis and therefore the elucidation of pathways that promote this cell lineage would be a significant advance in the field . Here, we report the use of a targeted in vivo sirna kd platform to identify novel mediators of fibrogenesis . We leveraged novel biology - targeting genes upregulated during liver and kidney fibrosis in myofibroblasts and their progenitors and sirna - lnp technology to silence these genes in ccl4-induced liver injury and fibrosis in mice . We identified five genes, namely egr2, atp1a2, fkbp10, fstl1, and has2, which modified fibrogenesis in this system because their kd reduced col1a1 mrna levels and collagen accumulation in the liver . Prior to our study, egr2, atp1a2, and fkbp10 had not been functionally validated in fibrosis in vivo, and our study is the first to validate fstl1 and has2 in liver fibrosis . We further directly demonstrated that egr2 kd in human hscs reduced the expression of fibrotic genes . We conclude that in vivo sirna kd using sirna - lnp is a powerful tool to identify disease - relevant modifiers in vivo . Studying myofibroblasts is extremely difficult because they are in direct contact with multiple cell types, including other myofibroblasts, myeloid cells, mesothelial cells, endothelial cells, epithelial cells, and circulating fibrocytes in situ . Myofibroblasts respond to chemo - mechanical stimuli, and therefore disruption of their native environment during cell isolations alters their activation state . To circumvent these shortcomings this approach allowed us to study functional consequences of silencing of specific genes of interest in vivo in their native environment . It is of note that our sirna - lnp delivery approach allows us to silence gene expression in hscs; however, this lnp formulation also targets other cells in the liver, including kupffer cells and hepatocytes, but not endothelial cells.11, 12, 13, 14 therefore, we cannot rule out the contribution of gene silencing in kupffer cells and hepatocytes on the anti - fibrotic outcome . Our strategy to identify novel players in tissue fibrosis took advantage of recent transcriptomic datasets for myofibroblasts and their precursors isolated from fibrotic liver or kidney in mouse models.6, 7 using sirna - lnp delivery technology, we tested the effect of gene silencing in a physiologically relevant context in vivo . We employed a ccl4 administration model that featured significant collagen accumulation and established several robust rna and histological measures of fibrogenic activity to identify fibrosis modifiers . Using the criteria of significant reduction of col1a1 mrna levels of greatest interest are those that also reduced collagen accumulation in the tissue, namely, egr2, atp1a2, fkbp10, fstl1, and has2 . Notably, these five genes were the most strongly silenced in vivo (by 75% or greater) that significantly reduced col1a1 mrna levels . It is possible that we might have achieved a greater degree of in vivo gene silencing for other target genes with a higher dose or a different dosing paradigm . Thus, although we cannot draw conclusions about the functional role of genes whose silencing was incomplete, our results clearly identify five genes as novel fibrogenic mediators in liver fibrosis in vivo . These genes fell into different groups based on the effects of their silencing on a mini mrna array and histological measures . We propose grouping them as follows: egr2, a gene with potential function in hsc expansion; atp1a2 and fkbp10, genes that regulate mechanosensing; and fstl1 and has2, genes involved in matrix - cell signaling . Egr2, a tf of the egr family, emerged as the strongest effector in the sirna screen . Egr tfs are important for the induction of cellular programs, including cell proliferation, differentiation, and death, in response to stimuli such as cytokines, growth factors, and toxic substances.17, 18, 19 egr2 has not been previously reported to play a role in tissue fibrosis in vivo . Rather, egr2 is prominently known for its role in early myelination of the peripheral nervous system in humans and mice.21, 22, 23 egr2 kd silenced its expression by 94%, reduced col1a1 and col3a1 mrna levels, and diminished accumulation of myofibroblasts and macrophages, each to 15% of control . Thus, our demonstration of reduced fibrogenic activity by egr2 silencing reveals a novel egr2 function . The downregulation of pdgfrb mrna levels by 45% suggests that egr2 may promote hsc expansion . This mechanism would explain the reduced asma - expressing hsc and thereby reduced signals for macrophage accumulation, all of which may have contributed to the reduction in fibrosis . Importantly, we also directly demonstrate that egr2 kd in a human hsc line reduces col1a1 and pdgfrb transcripts, supporting the regulation of a fibrogenic program in hscs by this tf . The comparatively weaker effect of col1a1 silencing in vitro (50%) versus in vivo sirna - lnp- mediated kd (80%) of egr2 is due to the use of different delivery methods as well as the use of different sirna sequences to achieve gene silencing in human cells versus in vivo in mice . Interestingly, col1a1 kd also reduced pdgfrb mrna levels . Because ecm accumulation and expression of pdgfr are linked, it is feasible that decreased collagen production would decrease pdgfr expression in a feedback loop . The relevance of our finding to fibrogenesis in humans is also supported by a prior in vitro study, in which overexpression of egr2 in human skin fibroblasts upregulated collagen gene expression and myofibroblast differentiation, and these profibrotic tgf--induced responses were attenuated by egr2-depletion . We unambiguously confirmed that our sirna is specific for egr2 (figures s4a s4c) and also found that egr2 kd in human hscs reduces col1a1 and egr2, but not egr1 or egr3 mrna (data not shown), confirming the anti - fibrotic effect . However, in vivo egr2 kd also decreased the mrna levels of egr1 and egr3, supporting the co - regulation of these transcription factors . It has been shown previously in vitro that overexpression of egr1 induced egr2 and egr3 expression and likewise egr3 overexpression induced egr1 and egr2 expression, whereas overexpression of egr2 did not have such an effect.25, 26, 27 here, we report that egr2 kd also reduces egr1 and egr3 mrna levels in vivo, a novel aspect of egr tf co - regulation . Although egr2 has not been previously reported to play a role in tissue fibrosis in vivo, egr1 and egr3 have been implicated in the fibrotic response in vitro and in vivo previously.27, 28, 29 therefore, the extent of the anti - fibrotic effect may be due the co - regulation of egr tf . Atp1a2 and fkbp10 were identified as fibrogenic modulators, with mechanisms of action distinct from that of egr2 . Atp1a2 is the large catalytic subunit of an enzyme that catalyzes the hydrolysis of atp, coupled with the exchange of na and k ions across the plasma membrane . Atp1a2 has a known function in the contractility of skeletal and cardiac muscle . On the basis of our results, it is intriguing to speculate that atp1a2 silencing may have reduced the contractility of myofibroblasts, effectively mimicking their behavior in a more compliant matrix environment and hence resulting in a less fibrogenic program.31, 32 supporting this theory, we found that atp1a2 kd reduced fibrogenesis in vivo by significantly limiting the transcription of the col1a1 and timp1 genes, macrophage accumulation, and collagen deposition . However, in contrast to egr2, atp1a2 silencing had no effect on asma expression . This theme of altered mechanosensing may also explain the alleviated fibrosis upon silencing of fkbp10 . Fkbp10 is a molecular chaperone in the endoplasmatic reticulum that directly interacts with collagen i, contributing to the maturation and molecular stability of type i procollagen, promoting normal secretion, stable inter - molecular crosslinking, and collagen deposition in the ecm . Fkbp10 has a well - established role in bone mass in humans and mice, but its role in tissue fibrosis is largely unexplored . Fkbp10 mouse embryos are post - natally lethal and display reduced collagen crosslinking in calvarial bones . In this study, we report our novel finding that fkbp10 silencing reduces collagen deposition to 64%; however, we found no reduction in asma expression . We speculate that fkbp10 silencing alters the quantity or crosslinking of the ecm and thereby alters mechanosensing . Consistent with our in vivo results, a prior in vitro study showed that inhibition of fkbp10 in primary human fibroblasts from pulmonary fibrosis patients attenuates expression of pro - fibrotic genes and decreases collagen secretion . Thus, our findings expand the scope of atp1a2 and fkbp10 functions by demonstrating their novel roles in fibrogenesis in vivo . Fstl1 and has2 silencing also affected multiple fibrogenic readouts in our assay platform, but resulted in a pattern distinct from that of egr2, atp1a2, and fkbp10 . Both fstl1 and has2 silencing reduced col1a1 mrna, macrophage accumulation, and collagen deposition but counterintuitively increased myofibroblast density as well as the level of timp1 mrna, a profibrotic pathway . Fstl1 is a tgf--inducible, secreted, matricellular glycoprotein belonging to the secreted protein acidic rich in cysteines (sparc) family, with pleiotropic functions.37, 38, 39 during the course of our current study, it was reported that haplodepletion of fstl1 or a neutralizing anti - fstl1 antibody reduced bleomycin - induced pulmonary fibrosis . We found that fstl1 gene silencing reduced collagen transcription and accumulation in the context of liver fibrosis but surprisingly increased myofibroblast density, possibly reflecting a compensatory feedback loop . We hypothesize that the overall reduction in collagen accumulation is a direct result of decreased collagen production by fstl1 silencing, so that the increased number of myofibroblasts and reduced activity of collagen degradation would still result in decreased overall collagen accumulation . Indeed, kd of fstl1 in the human hsc line lx-2 resulted in decreased levels of col1a1 mrna . Like fstl1, silencing of has2 resulted in unexpected effects, also likely through a matrix - modifying mechanism . Has2 is one of three isoenzymes responsible for cellular hyaluronan (ha) synthesis, a matrix component normally highly abundant in joint synovium . Ha is well known for its role in wound healing.40, 41 has2 has been previously reported to be pathological in the bleomycin - induced lung fibrosis model, in which mesenchymal cell - specific deletion of has2 abrogated myofibroblast accumulation and inhibited the development of lung fibrosis . We show that has2 silencing also reduces liver fibrosis . Has2 silencing also unexpectedly augmented myofibroblast density . Taken together, our studies have identified fstl1 and has2 as fibrosis modifiers in our in vivo liver fibrosis platform and reveal surprising effects of silencing these genes, supporting their complex role in the regulation of fibrogenesis . To the best of our knowledge, our study is the first example of a targeted sirna assay for the discovery of novel fibrosis modifiers in vivo . The results implicate five novel modulators of the fibrogenic process in the liver and demonstrate the feasibility of sirna - lnp for interrogating gene function in the liver . Because these genes are commonly upregulated in pericytes and myofibroblasts in both liver and kidney fibrosis models, these genes warrant follow - up to further explore their function and mechanism of action in liver and other organs and to inform their role in both physiological and pathophysiological fibrosis . All animal procedures were conducted in accordance with cambridge laws and the institutional animal care and use committee approved protocol no . 657 . 8- to 10-week - old male balb / c mice (taconic bioscience) were given ccl4 by oral gavage (sigma - aldrich; 1 ml / kg dissolved in mineral oil) on days 0 and 7 . Sirna - lnps were either given on day 6 at a concentration of 1 mg / kg or on days 7, 3, 2, and 6 at 0.5 mg / kg . These experiments were controlled with cohorts of mice that received sirna targeting luciferase (luc - lnps) with oil or ccl4, respectively . Animals were sacrificed on day 10 by co2 asphyxiation, followed by cardiac perfusion with 10 ml of pbs, and liver lobes were harvested for qpcr and histopathological analysis . Target fibrosis modifier genes were selected by intersecting transcriptomic data generated from isolated hscs of mice treated with ccl4 for 2 months, and genes specifically expressed in pericytes / myofibroblasts in the mouse kidney 2 and 5 days after uuo.6, 7 169 genes were common to both datasets and significantly upregulated at least 2-fold . Among these, we excluded transcripts that were not associated with a gene product, genes with no known human homolog, and well - known modifiers in fibrosis (validated in vivo by independent investigators), resulting in 24 genes for further evaluation . A set of ten sirnas with canonical sirna structures was defined for each target gene . All sirnas were directed against the coding sequence of their respective target mrna and perfectly matched all known mrna transcript variants of the target gene available in the ncbi reference sequence database (refseq db, release 65, may 2014). The sirnas used in this study were designed to be a perfect match only to their target mrna and to have 2 mismatches within positions 218 of the 19-mer sequence to any other genes . The design as described above is sufficient to ensure specificity.44, 45 specifically, at least four mismatches between the sirna sequences of each of the genes of interest (atp1a2, egr2, fkbp10, fstl1, and has2) and the readout genes col1a1, col3a1, tgfbr1, pdgfrb, and timp1 . Further, there were three mismatches between egr2 sirna and egr1 sequence and more than four mismatches between egr2 sirna and egr3 sequence . The sirna antisense strands lacked a seed region (nucleotides 27) identical to a seed region (nucleotides 27) of known mouse mirnas (mirbase, release 20, june 2013). Additional similarity analysis showed that there were at least four mismatches between the sirna sequences of each of the genes of interest (atp1a2, egr2, fkbp10, fstl1, and has2) and the readout genes col1a1, col3a1, tgfbr1, pdgfrb, and timp1 . Further, there were three mismatches between egr2 sirna and egr1 sequence and more than four mismatches between egr2 sirna and egr3 sequence . From sirnas fulfilling those criteria, the sirnas for each final screening were selected for predicted activity based on analysis with proprietary algorithms (axolabs, gmbh). In vivo grade sirnas each of the ten aforementioned sirna molecules / target gene was screened for its potency to kd gene expression in a cell - based reporter assay . For each target gene, the regions of their coding sequences targeted by the sirnas were synthesized and inserted to the 3 utr of the firefly luciferase gene in pcmvluc(v) validation vector (origene), generating an mrna transcript that encodes both the luciferase (luc) and the target gene when expressed in cells . 293 t cells (atcc) were co - transfected with the validation vector and the sirnas of interest using lipofectamine 2000 (thermo fisher scientific) at 0.1-, 1-, and 10-nm concentrations to assess kd potency . Sirna binding to the target gene leads to degradation of the mrna that encode both luc and the target gene, resulting in reduced luciferase expression . Luciferase expression was measured 24 hr post - transfection in a functional assay using the promega luciferase assay system (promega), and luciferase signal was detected using a perkinelmer envision plate reader (perkinelmer). For each sirna tested, the efficiency of kd was calculated as percent of luciferase signal compared to cells that were transfected with the validation vector for the target gene alone . The most potent sirna for each target gene (> 90% luciferase reduction at 1 nm sirna in vitro) was then formulated as lnps for in vivo application . The sequences of the sirnas that resulted in efficient kd (75%) of their target gene in vivo are provided in table s2 . Sirna - lnps were synthesized by mixing together an sirna - containing aqueous phase with a lipid - containing ethanol phase . The aqueous phase contained sirna in 10 mm citrate buffer (ph 3). The ethanol phase contained ionizable lipid c12 - 200 (wuxi apptec), 1,2-distearoyl - sn - glycero-3-phosphocholine (dspc, avanti polar lipids), cholesterol (sigma), and 1,2-dimyristoyl - sn - glycero-3-phosphoethanolamine - n-[methoxy(polyethylene glycol)-2000] (c14 peg 2000, avanti) at a 50:10:38.5:1.5 molar ratio and 5:1 c12 - 200:sirna weight ratio . The aqueous and ethanol phases were mixed together at a 3:1 volume ratio in a microfluidic chip device using syringe pumps as previously described to a final sirna concentration of 1 mg / ml . The resultant sirna - lnps were dialyzed overnight in a 20,000 molecular weight cut - off (mwco) cassette against 1x pbs at 4c . On average, sirna - lnps had a mean diameter of approximately 100150 nm, with a polydispersity index between 0.1 and 0.2 as measured by dynamic light scattering (zetasizer, malvern instruments). The sirna encapsulation efficiency (approximately 60%) was determined using a modified quant - it ribogreen assay (invitrogen) as previously described . This sirna delivery system can target multiple liver cell types, including hepatocytes, monocytes, tissue macrophages, dendritic cells (dcs), and myofibroblasts / pericytes . Rna was extracted from liver lobes with trizol (thermo fisher scientific), followed by on - column dnase digestion using rneasy mini kits and rnase free dnase sets (both from qiagen). Cdna was generated using the high - capacity cdna reverse transcription kit, and qpcr analysis was performed using pre - designed taqman primer probes (table s3) on the quantstudio 12k flex real - time pcr system (all from thermo fisher scientific) to determine the expression levels of sirna target genes and a panel of readout genes . The relative expression of each gene was normalized to mouse or human glyceraldehyde 3-phosphate dehydrogenase (gapdh) using the 2 method, and the mean expression of each gene in the control group was set to 100% . 5-m sections were stained with psr using an automated leica system according to standard protocols . Anti - alpha - smooth muscle actin (sma) ihc was performed with fluorescein isothiocyanate (fitc)-labeled mouse monoclonal antibody 1a4, followed by an anti - fitc antibody and periodic acid - schiff (pas) counterstain (abcam). Anti - iba-1 and anti - col1a1 ihc was performed using rabbit polyclonal antibodies (cat . #019 - 19741, wako, and genetex, cat . The iba-1 positive area was limited to infiltrating macrophages by differentiating isolated single cells (largely kupffer cells lining sinusoids) from larger round cells in clusters (periportal, largely infiltrating macrophages, sometimes filled with mineral). De novo interstitial asma was differentiated from endogenous asma in muscular arteries by performing a pas counterstain and then programming the algorithm to distinguish vascular morphology for exclusion from quantification . The human hsc line lx-2 (emd millipore) was transfected with sirnas against egr2, col1a1, or luc with lipofectamine rnaimax reagent following the manufacturer s protocol . We used the following predesigned sirnas (listed as sirna i d): egr2: s4540, s4541, and s4542; col1a1: s3276; luc: am4629; and fstl1: s22032, s22033, and s22034 (thermo fisher scientific). Rna was isolated on day 2 after transfection using rneasy kits with on - column dnase digestion (qiagen). 293 t cells (atcc) were co - transfected with pcmv - egr1, pcmv - egr2, or pcmv - egr3 (origene) and either silencer select negative control no . 1 sirna (thermo fisher scientific) or sirna against egr2 (axolabs). Rna was isolated 24 hr after co - transfection using rneasy plus kits (qiagen). Statistical significance was assessed by two - tailed, unpaired student s t test for comparison of two groups or by one - way anova, followed by the dunnett s multiple comparisons test for more than two groups . We used an ssmd method to analyze the suitability of the mrna readout genes in our sirna - lnp / ccl4 liver fibrosis platform (figure s2). The ssmd method was used to calculate the median of differences divided by the standard deviation of the differences between the group treated with oil and the control sirna targeting luciferase (oil / luc - lnp) and versus ccl4/luc - lnp . It represents the average fold change penalized by the variability of the fold change across animals . Ssmd is a suitable method because it takes the variability between animals into account . For our study, a threshold of <1.5 was taken as the cut - off value for suitable readout genes.

Pheochromocytomas are rare catecholamine producing tumors arising from chromaffine cells in the sympatho adrenal system . Its prevalence is estimated at 0.1% to 0.6% . They secrete various catecholamines, predominantly norepinephrine, and epinephrine to small extent . These catecholamines are responsible for the manifestations with sustained or paroxysmal symptoms . Diagnosis is established by measuring metanephrines in the urine or blood . Localization of the tumor is done using computed tomography (ct) or magnetic resonance imaging (mri) scans . Thrombosis of the inferior vena cava (ivc) has comparable etiological factors to lower limb deep venous thrombosis . Hypercoagulability related to hematological or neoplastic abnormalities, venous stasis secondary to extraluminal pressure from tumors or inflammatory processes, and vessel injury due to trauma have all been implicated as primary mechanism in the pathophysiology of ivc thrombosis . However, its association with pheochromocytoma in indian subjects has not been reported till date . A 48-year - old man was admitted to our hospital with complaints of headache, sweating, anxiety, dizziness, nausea and vomiting . The patient was 164 cm tall and weighed 57 kg . On physical examination, there were no caf au lait spots or neurofibromas . Hematological analysis confirmed normocytic anemia with hemoglobin 11.3 gm / dl, a raised erythrocyte sedimentation rate (esr) (130 mm fall in the first hour), while the total and differential leukocyte counts were normal . Biochemical parameters such as liver and kidney functions, and serum electrolytes, calcium, phosphorous, alkaline phosphatase and d - dimer were within normal limits . The endocrinological evaluation revealed increased urine catecholamines and urinary vanillyl mandelic acid (vma) [table 1]. Baseline biochemical parameters of the patient abdominal ct revealed a well defined, heterogenous mass lesion of size 7.6 5.3 4.8 cms with attenuation score of 35 hu at the upper pole of right kidney without any calcifications [figure 1]. There was no involvement of renal vein, hepatic veins and veins of lower limbs demonstrated by doppler ultrasound . Magnetic resonance imaging (mri) revealed intraluminal thrombus extending proximally up to the confluence of hepatic veins immediately inferior to the right atrium without distal extension to femoral veins bilaterally [figure 2]. An ivc venogram via the right jugular vein demonstrated multiple filling defects indicating occlusion of the ivc inferior to the right atrium [figure 3]. There was simultaneous enlargement of distal part of ivc . Computed tomography of the abdomen- showing a well defined, heterogeneously enhancing mass lesion of size 7.6 5.3 4.8 cm at the upper pole of right kidney without any calcifications . The left adrenal gland appeared to be normal t2-weighted axial magnetic resonance imaging demonstrating the mass (predominantly high signal) between the inferior vena cava and right kidney (black arrow) compressing the overlying inferior vena cava (white arrow) ivc venogram showing multiple filling defects indicating occlusion of the inferior vena cava inferior to the right atrium . There is distal enlargement of inferior vena cava a diagnosis of ivc thrombosis with pheochromocytoma was established, and surgical treatment was planned . Alpha receptor blocking therapy with prazosin was instituted, followed by blocker, after testing for adequacy of blockade . The patient was treated conservatively with subcutaneous low molecular weight heparin followed by oral warfarin . After 2 weeks, hypertension was well controlled and the remaining symptoms disappeared . With adequate blood pressure control, biopsy of the specimen revealed a typical organoid or zellballen pattern with no cytoplasmatic inclusion, pleomorphism, cytological alterations or necrosis; and, the mitotic index was low [figure 4]. During the postoperative period, the patient's blood pressure remained normal . A 24-hour urine specimen collected for metanephrine and vma, revealed levels within normal limits . At present, the patient is asymptomatic, requires no medications, and is employed as an engineer . Mri imaging demonstrated resolution of the thrombosis and return of patency of the ivc at 4 months [figure 5]. The typical growth pattern of nests of tumor cells (zellballen) surrounded by a discontinuous layer of sustentacular cells and fibrovascular stroma in the biopsy specimen of the patient in the study . Blood vessels surrounding tumor nests are composed of round to oval cells t2-weighted axial magnetic resonance imaging comparable in position and image acquisition to figure 2 demonstrating complete resolution of inferior vena cava thrombosis (white arrow) after 4-months of oral anticoagulation therapy two aspects render our case unusual: 1) the coexistence of pheochromocytoma with ivc thrombosis 2) though there are case reports citing the association between malignant pheochromocytoma and ivc thrombus, to our sincere belief; this is the first such report citing this uncommon association from india . Although the lifetime incidence of venous thrombosis is 0.1%, it still remains a rare condition especially in patients below 30 years of age . Predisposing factors include alterations in blood flow [stasis], injury to the vascular endothelium and abnormalities in the constitution of blood hypercoagulability (virchow's triad). Endothelial damage is invariably an acquired phenomenon, whereas hypercoagulability may result from both congenital and acquired risk factors (especially in the peri - operative period). The classical presentation of ivc thrombus varies according to the level of the thrombosis with up to 50% of patients presenting with bilateral lower extremity swelling and dilatation of superficial abdominal vessels . Whilst some patients remain asymptomatic, lower back pain, nephrotic syndrome, hepatic engorgement, cardiac failure and pulmonary embolus have also been described . Tsuji et al . Reported a series of 10 patients where 40% were pyrexic at presentation, with an associated elevation in d - dimer levels and inflammatory markers (white cell count, c - reactive protein). Our patient had no lower limb, liver or kidney involvement, and this might be ascribed to the partial occlusion of ivc . We could not explain normal d - dimer levels in the backdrop of such a large thrombus in our patient . Ct scan with contrast enhanced images and mri scan are used to localize adrenal pheochromocytoma . Meta - iodobenzylguanidine (mibg) and positron emission tomography (pet) scanning (gallium- dota - toc / noc and dopa - pet perform better than fdg- pet) are largely reserved for extraadrenal paraganglioma, or very large tumors to rule out metastasis . Heterogeneity, high hounsfield density on ct (> hu), marked enhancement with intravenous contrast and delayed contrast washout (<60% at 10 minutes), high signal intensity on t2 weighted mri, cystic and hemorrhagic changes point to pheochromocytoma, adrenocortical carcinoma or metastasis . However, pheochromocytoma with lipid degeneration can result in low attenuation scores (<10 hu) and> 60% washout at delayed ct scanning . Benign adrenal incidentalomas are characterized by size <5 cm, sharp margins, smooth contours, lack of demonstrable growth on serial examinations, attenuation scores <10 hu, and> 60% washout at delayed ct scanning . In our patient, ct scan revealed nonhomogenous mass of hu 35 without any calcification . Histologically, pheochromocytomas are capsulated and are composed of round or polygonal epithelioid / chief cells arranged in characteristic compact cell nests (zellballen) or trabecular patterns . The chief cells have centrally located nuclei with finely clumped chromatin, and a moderate amount of eosinophilic, granular cytoplasm . Tumors of higher grade are characterized by a progressive loss in the relationship between chief cells and sustentacular cells, and a decrease in the number of sustentacular cells . In our patient, typical zellballen pattern was found . Presence of markers like chromogranin a (cga), neuron specific enloase, synaptophsyin serve as additional tools to confirm the neuroendocrine nature of the chief cells . The only reliable clue to the presence of a malignant pheochromocytoma is local invasion or distant metastases, which may occur as long as 20 years after resection . Benign on pathologic examination, long term follow - up is indicated in all patients to confirm that impression . Other markers for malignancy are absent or weak expression of inhibin / activin- beta b subunit, and presence of succinate dehydrogenase b (sdh b) subunit is seen . In absence of any invasion, we considered the mass in our patient to be benign . The simultaneous occurrence of pheochromocytoma and ivc thrombosis is reported sporadically . Ivc thrombosis in this case could be because of: 1) local compression leading to alteration in blood flow and stasis 2) sustained hypertension leading to vascular endothelial injury and hypercoagulability, 3) association of pheochromocytoma with systemic lupus erythematous and behcet's disease might explain the triggering of an autoimmune phenomenon leading to a hypercoagulable state, and 4) an underlying anatomic abnormality or coagulation disorder . It also could be a chance association between these 2 conditions . In our case, recent advances in the utilization of ultrasound, ct and mri imaging as well as endovascular procedures have resulted in an increase in detection rates of ivc anomalies, as well as an increase in the incidental discovery of such abnormalities during unrelated investigations, therapeutic endovascular or surgical procedures . Contrast venography remains the standard for diagnosis of ivc thrombosis with a low false - positive rate, and the advantage of access for immediate treatment if required . However, it is an invasive procedure associated with a 2%-10% incidence of post - procedural deep venous thrombosis (dvt). Duplex ultrasound scanning has become an accurate non - invasive method of diagnosing ivc thrombosis and is often the first - line investigative modality . However, duplex usg is operator dependant and can be limited by body habitus or the presence of bowel gas and may occasionally fail to identify any ivc anomaly . Ct imaging is a rapid non - invasive method which can accurately diagnose and assess the extent of thrombus as well as delineate any associated abdominal or pelvic abnormality . Mri imaging is now replacing ct as the optimal investigative tool avoiding radiation and giving more accurate delineation of thrombus as well as any ivc anomaly . Mri is also used to follow - up patients to determine morphological changes in the thrombus following therapy . Management of patients with coexisting pheochromocytoma and ivc thrombosis needs operative resection of the adrenal mass and medical / interventional management of ivc thrombosis . The goals of operation include 1) removal of the tumor with postoperative normotension, and 2) ivc luminal restoration and anticoagulation . Minimally invasive techniques are being increasingly used for resection of adrenal tumors and to treat renal artery lesions . Our patient was subjected to laparoscopic adrenalectomy after adequate preoperative blood pressure control by blockers, followed by blockers . Treatment options in the case of ivc thrombus without anatomical variance include anticoagulation, mechanical thrombectomy, systemic thrombolytic therapy, transcatheter regional thrombolysis, pulse - spray pharmacomechanical thrombolysis and angioplasty . There is no specific literature describing the ideal duration of anticoagulation in these instances; however, case evidence identifies a trend toward treatment for a minimum of one year with the interplay of hypercoagulability disorders needing to be factored into any decision . Surgical reconstruction of the ivc and bypass of an aberrant section are both recognized modalities reserved for the most severe cases and are associated with morbidity and mortality risk . Endovascular stent placement in combination with angioplasty is recommended in the cases of residual stenosis and chronic ivc occlusion . In the case of ivc thrombus associated with an aberrant ivc, with no other predisposing factors, treatment involves anti - coagulation . The duration of this treatment is widely debated with no extensive literature to provide an evidence based approach . Dean et al . Took a view, which is quite similar to that of ours, that a caval anomaly is a permanent risk factor for venous stasis and thrombosis and that anticoagulant treatment should be lifelong . Since our patient had no anatomic abnormality or any other predisposing factors, we decided to give the treatment for 4 months only and stopped it then after documenting radiologic luminal restoration . Though cases of renal artery stenosis, renal artery aneurysm and inferior vena cava thrombosis have been described, we found the uncommon association with ivc thrombosis in an indian patient . Ct or preferably mri imaging are required to delineate ivc anatomy and ascertain proximal extent of the thrombus . Although invasive therapeutic modalities exist, long - term and commonly life - long anticoagulation is often required . Pheochromocytoma does not seem to have any effect on the outcome of the coexisting ivc thrombosis.

Cystic fibrosis (cf) is a worldwide disease occurring among virtually all ethnic groups . In caucasians although approximately 1 in 25 are heterozygous carriers, the incidence of clinical disease is approximately 1 in 2500 live births . The condition results from mutations in a single gene of chromosome 7, which encodes the cf transmembrane conductance regulator (cftr). The cftr protein is a membrane - bound camp - regulated chloride channel thought to regulate other cell membrane ion channels . To date, more than 1000 different mutations have been identified; however a phenylalanine deletion in amino acid position 508 is present in approximately 66% of patients . Early genetic tests demonstrating a molecular defect in the cftr gene confirms the clinical diagnosis of cf, improves quality of life and prolongs survival . Recent studies support the theory that cfrd is primarily caused by insulin deficiency due to a loss of beta cells which may occur via a number of mechanisms, including oxidative stress . Cftr mutations affect epithelial ion and water transport, primarily in cells in the respiratory, gastrointestinal, hepatobiliary and reproductive tracts, in addition to the sweat glands . The lack of chloride secretion in the pancreatic duct is responsible for obstruction and autodigestion of the pancreas early in embryonic life leading to severe exocrine pancreatic insufficiency in approximately 85% of cf newborns . Diagnosis is based on clinical findings and sweat chloride levels greater than 60 meq / l . In iran, thus, the present study aims to assess the characteristic demographic findings of cf patients who attended the children s hospital medical center during a ten - year - period . During a ten - year period (1991 - 2000), all patients hospitalized with cf or diagnosed with cf during hospitalization in the children s hospital medical center, tehran, iran were enrolled and related data were extracted from their medical records . Sweat chloride tests the diagnosis of cf was established when relevant clinical manifestations were associated with a positive sweat chloride test . Clinical manifestations included respiratory signs such as chronic cough or recurrent pneumonia and gi manifestations in the form of chronic diarrhea or fatty diarrhea, failure to gain weight and failure to thrive (ftt). Among the 233 patients, 91 (39%) were girls and 142 (61%) were boys . Onset of disease was before the first month of life in 12.1%, between 1 - 6 months of age in 75.1% and between 6 - 12 months of age 6.9% of patients . A positive family history of cf or suspected clinical signs was present in 26.6% of patients . Barium swallow was performed for 138 patients; of those, 102 (74%) had gastroesophageal reflux disease . Other findings such as nasal polyps (6), gallstones (1), sinusitis (14), cholestasis (9) and diabetes (2) were also noted . Edema (19.4%), growth failure in the form of weight below the fifth percentile (89.1%), anemia (69.7%) and hypoalbuminemia (60.5%) were additionally present . Endoscopy was performed in 65 patients and the most frequent finding was esophagitis (81.5%). In stool samples, fat droplets greater than 100 per hpf were reported in 100%, whereas 62.7% had decreased trypsin activity . Among patients with respiratory symptoms, chest radiography was performed in 207 cases and frequent findings were: hyper - aeration with pneumonia (35%), pneumonia (19%) and hyper - aeration (22%). Death was documented in 27 patients which was attributed to respiratory failure (96.3%) and septicemia (3.7%) (table 1). * in hospital inpatient mortality currently, due to newer, more appropriate, modern enzymatic and antibiotic therapies in addition to nebulizer treatments, improvements in lifespan and quality of life are seen . Recent researches and numerous advancements in the field of gene therapy, which can be the definitive therapy of cf, increased the hope for an extended life . Therefore maintenance therapy, with the aim to perform gene - therapy, is of major importance in maintaining growth, preventing respiratory complications and malnutrition . It is important to keep this disease in mind when dealing with patients who present with the vast spectrum of clinical findings of cf, which are to some extent non - specific . Thus, children who receive multiple courses of antibiotics for respiratory or gi diseases will need to undergo additional diagnostic tests . The prevalence of cf in european caucasians is 1:2500 and is rare in asia . Based on the results of the present study and other reports from various locations in asia; we have assumed that cf is not rare, as presumed in iran (table 1). In all studies, the male to female ratio was 1:1.5,the most frequent age of onset of symptoms occurred in the first six months of life (78%) and consanguineous marriages were significant (42%). This might have been due to the fact that barium swallows were performed only in cases with suspected symptoms, whereas it was performed in all patients mentioned in textbooks . The incidence of ftt in the asian population was almost equal (75% - 100%). However in developed countries with the use of new nutritional methods such as alternate tpn in the hospital or at home, and nasogastric tube feedings at night, sufficient calories were obtained and growth failure was less commonly reported . Death occurred in 13.4% of patients in the present study which was less than actual statistical values because a number of cf patients were not followed . In a study from shiraz (iran), the cf mortality rate was 70% but in another study it was 0%, which probably resulted from the lack of follow up . One of the earliest signs of cf was meconium ileus, which ranged from 8% to 20% in different studies . The authors thank miss maral sayyad and the personnel of the archive of medical documents, endoscopy and gastroenterology departments of children hospital medical center for their assistance.

Nasal dermal sinus is a very rare congenital anomaly that is frequently associated with inclusion cysts (dermoid or epidermoid).1 2 3 at the end of the second month of gestation, the nasal and frontal bones are separated by the fonticulus frontalis . In this period, the dura projects into the nasal area through the anterior skull base opening (foramen cecum), and lies in contact with the skin at the tip of the nose . Failure during ossification to obliterate this transcranial connection is the embryological pathway to nasal dermal sinus tract development.1 2 3 4 in the present case, combined use of high resolution magnetic resonance imaging and computed tomography (ct) clearly demonstrated the detailed anatomical relationship of the dermal sinus associated with a dumbbell - shaped dermoid to the surrounding structures such as the fonticulus frontalis and foramen cecum.3 5 the patient was a boy aged 1 year and 4 months who had had a small pit at his nasion from birth and had developed swelling of the forehead . 1a). The sagittal view of a t2-weighted image demonstrated a dumbbell - shaped, mixed intense dermoid at the foramen cecum . The sinus tract was depicted as a strand of isointensity between the dermoid and the nasion . A subcutaneous abscess was noted adjacent to the dermoid, and the subcutaneous swelling of the forehead was demonstrated as hyperintensity (fig . Serial sagittal views of t1-weighted images (t1wi) revealed the capsule of the dermoid enhanced with contrast medium (gadolinium - diethylenetriamine penta - acetic acid [gd - dtpa]), and that the subcutaneous abscess was in continuity with the dermoid cyst . On axial view of the gd - enhanced t1wi, the subcutaneous abscess was also noted adjacent to the dumbbell - shaped dermoid (fig . Serial sections of the sagittal and coronal ct scans clearly showed an enlarged fonticulus frontalis and foramen cecum remnant and dehiscence of the crista galli (fig . 1f, g, h). Three - dimensional ct imaging showed a bony defect at the midline of the junction of the frontal bone and the anterior fossa, with a bifid and bulging crista galli (fig . (a) photograph showing the swelling of the forehead . The black arrow indicates a small pit on the nasion . Inset is the magnified view of the pit, which seems to be closed and has no purulent discharge . There is a dumbbell - shaped mixed intense dermoid (white arrow) at the junction of the frontal bone and the anterior fossa (at the foramen cecum), and a strand of isointensity (nasal sinus tract) between the tumor and the nasion . An abscess in the subcutaneous tissue of the forehead (black asterisk) is noted adjacent to the dermoid . The capsule of the dermoid is enhanced with contrast medium (gd - dtpa). The dermoid is dumbbell - shaped (white arrow indicates the neck of the dumbbell). Both the dermoid (white arrow) and subcutaneous abscess (black asterisk) are demonstrated as a hyperintensity . (f, g, h) serial sections of the sagittal (f, h) and coronal (g) computed tomography scan . The enlarged fonticulus frontalis remnant (white arrow), enlarged foramen cecum remnant (white dotted line), and dehiscence of the crista galli (white arrow heads) are clearly visible . A bony defect is evident at the midline of the junction of the frontal bone and the anterior fossa with bifid crista galli (white arrow heads). (j) schematic drawing demonstrating the anatomical relationship of the dermoid (d), subcutaneous abscess (a), and swelling (s) with surrounding structures . The subcutaneous abscess was evacuated through a coronal skin incision on the frontal region, and then the purulent dermoid cyst including the capsule was removed . The part of the dermoid capsule that was tightly adherent to the dura was carefully coagulated . (a) intraoperative photograph taken after removal of the dermoid through a coronal skin incision showing the bony defect (white arrows). Inset is a three - dimensional computed tomography image shown in the same orientation as (a) the white box indicates the extent of the operative field . (b) the sinus tract including the pit at the nasion was dissected with a tiny skin incision . The dermoid cyst wall is lined by a keratinizing squamous epithelium (white asterisk). Intraluminal keratin (black asterisk) and hair shafts (black arrow) are also demonstrated . The nasal sinus tract is a ductal structure (black star) lined by stratified squamous epithelium . The patient was a boy aged 1 year and 4 months who had had a small pit at his nasion from birth and had developed swelling of the forehead . 1a). The sagittal view of a t2-weighted image demonstrated a dumbbell - shaped, mixed intense dermoid at the foramen cecum . The sinus tract was depicted as a strand of isointensity between the dermoid and the nasion . A subcutaneous abscess was noted adjacent to the dermoid, and the subcutaneous swelling of the forehead was demonstrated as hyperintensity (fig . Serial sagittal views of t1-weighted images (t1wi) revealed the capsule of the dermoid enhanced with contrast medium (gadolinium - diethylenetriamine penta - acetic acid [gd - dtpa]), and that the subcutaneous abscess was in continuity with the dermoid cyst . On axial view of the gd - enhanced t1wi, the subcutaneous abscess was also noted adjacent to the dumbbell - shaped dermoid (fig . Serial sections of the sagittal and coronal ct scans clearly showed an enlarged fonticulus frontalis and foramen cecum remnant and dehiscence of the crista galli (fig . 1f, g, h). Three - dimensional ct imaging showed a bony defect at the midline of the junction of the frontal bone and the anterior fossa, with a bifid and bulging crista galli (fig . (a) photograph showing the swelling of the forehead . The black arrow indicates a small pit on the nasion . Inset is the magnified view of the pit, which seems to be closed and has no purulent discharge . There is a dumbbell - shaped mixed intense dermoid (white arrow) at the junction of the frontal bone and the anterior fossa (at the foramen cecum), and a strand of isointensity (nasal sinus tract) between the tumor and the nasion . An abscess in the subcutaneous tissue of the forehead (black asterisk) is noted adjacent to the dermoid . The capsule of the dermoid is enhanced with contrast medium (gd - dtpa). The dermoid is dumbbell - shaped (white arrow indicates the neck of the dumbbell). Both the dermoid (white arrow) and subcutaneous abscess (black asterisk) are demonstrated as a hyperintensity . (f, g, h) serial sections of the sagittal (f, h) and coronal (g) computed tomography scan . The enlarged fonticulus frontalis remnant (white arrow), enlarged foramen cecum remnant (white dotted line), and dehiscence of the crista galli (white arrow heads) are clearly visible . A bony defect is evident at the midline of the junction of the frontal bone and the anterior fossa with bifid crista galli (white arrow heads). (j) schematic drawing demonstrating the anatomical relationship of the dermoid (d), subcutaneous abscess (a), and swelling (s) with surrounding structures . The subcutaneous abscess was evacuated through a coronal skin incision on the frontal region, and then the purulent dermoid cyst including the capsule was removed . The part of the dermoid capsule that was tightly adherent to the dura was carefully coagulated . (a) intraoperative photograph taken after removal of the dermoid through a coronal skin incision showing the bony defect (white arrows). Inset is a three - dimensional computed tomography image shown in the same orientation as (a) the white box indicates the extent of the operative field . (b) the sinus tract including the pit at the nasion was dissected with a tiny skin incision . The dermoid cyst wall is lined by a keratinizing squamous epithelium (white asterisk). Intraluminal keratin (black asterisk) and hair shafts (black arrow) are also demonstrated . The nasal sinus tract is a ductal structure (black star) lined by stratified squamous epithelium . 1j demonstrates the detailed anatomical relationship between the sinus tract with dumbbell - shaped dermoid and the surrounding structures . The body of the dumbbell - shaped dermoid was located in the enlarged fonticulus frontalis and foramen cecum remnant; the head of the dumbbell was the intracranial extension of the dermoid with bulging dura . A bifid and bulging crista galli was also attributed to the intracranial extension of the dermoid . Although bacteriologic examination failed to reveal the causative agents, the microscopically opened sinus tract resulted in the formation of the subcutaneous abscess adjacent to the purulent dermoid.

Since laparoscopic gastrectomy was introduced by kitano et al ., laparoscopic (assisted) distal gastrectomy (ladg) has become more commonly performed for early gastric cancer in korea [2 - 6]. However, there have been several reports on early surgical outcomes of laparoscopic assisted total gastrectomy (latg) [7 - 10]. In these studies, although latg has been shown to be safe and feasible for early gastric cancer, it has not yet been directly compared with the early surgical outcomes of conventional open total gastrectomy (otg). In fact, ladg had not yet become popularized compared with ladg, because of its technical difiiculties and fear of postoperative complications . Therefore, the purpose of this study was to evaluate the effectiveness of latg and to introduce techniques from our experiences . We retrospectively reviewed the prospectively collected data on 190 consecutive patients who underwent otg and latg, for gastric cancer between january 2009 and april 2010 at a single institution . All patients in whom the proximal margin too short to perform gastrojejunostomy had total gastrectomy: these patients were included in this study . Also, all patients who were preoperatively diagnosed with early gastric cancer were enrolled in this study . After explaining the merits of laparoscopic surgery, the level of difficulty of procedures, and the cost for otg and latg, the decision of otg and latg resided with the patient . A carbon dioxide pneumoperitoneum was created using the umbilical port, and the pressure was maintained between 12 and 15 mmhg . The falciform ligament was fixed to the anterior wall of the peritoneum for retraction of the liver using endo close . If the operating field was not sufficient, an additional 5-mm trocar was inserted into the epigastric area to retract the liver . Dissection was begun by dividing the greater omentum (4 cm from gastroepiploic arcade) from the mid - portion of the gastroepiploic arcade to the short gastric vessels . Dissection of the lymph nodes around the left gastroepiploic vessels and short gastric vessel was performed . After the dissection of the lymph nodes around the right gastroepiploic area, the infrapyloric area was dissected . In some patients, dissection was advanced to the superior mesenteric vein to include enlarged 14v lymph nodes . Lymph nodes around the suprapyloric area; hepatoduodenal ligament (along the hepatic artery), common hepatic, splenic, celiac, and left gastric arteries; and right and left paracardial areas were dissected in that order . The duodenum is transected below the duodenal bulb using an endoscopic linear stapler (endopath ets 60, ethicon endo - surgery inc ., after clearing the lymph nodes, a 4 - 5 cm midline incision was made from the epigastrictrocar site . A wound protector was applied, and esophagojejunostomy was reconstructed using a circular stapler (proximate ils, ethicon endo - surgery inc . ; dst series eea, tyco healthcare group lp, north haven, ct, usa). Clinical data obtained from medical records included patient age, gender, body mass index (bmi), and american society of anesthesiologists (asa) score . Early surgical outcomes included operation time, postoperative complications, intra - operative blood loss, postoperative change in hematocrit, time to first flatus, day of commencement on soft diet, number of administrations of analgesics, numeric rating scale (nrs), and postoperative hospital stay . Pathologic results were analyzed for tumor size, number of retrieved lymph nodes, resection margins, and american joint committee on cancer / international union against cancer staging . To evaluate the intra - operative blood loss, this was based on the observation of the number of surgical sponges used, the amount of fluid in the suction device, and a calculation of the amount of irrigant used during the operation . Preoperative hematocrit was checked before undergoing surgery and postoperative hematocrit was checked on postoperative day one at 7:00 am . Our postoperative pain control consisted of intravenous patient - controlled analgesia (fentanyl 2,500 g, ketorolactromethamine 180 mg, ondansetronhcl 16 mg). To evaluate the patients' postoperative pain, we calculated the number of additional doses of analgesics until the patient was discharged from the hospital . Also, we applied an nrs for all patients . The nrs was checked on postoperative day (pod) 0 at 11:00 pm, pod 1 at 8:00 am, pod 1 at 11:00 pm, pod 2 at 8:00 am, pod 3 at 8:00 am and pod 5 at 8:00 am . Patients were discharged if they had no problems eating a soft diet, showed an absence of inflammatory conditions, including leukocytosis, unstable vital sign and abrupt onset abdominal pain, and were generally comfortable . Also, we left the final decision about discharge up to the patients . Patient data was analyzed by one - way analysis of variance, followed by a post - hoc turkey test and the test . We retrospectively reviewed the prospectively collected data on 190 consecutive patients who underwent otg and latg, for gastric cancer between january 2009 and april 2010 at a single institution . All patients in whom the proximal margin too short to perform gastrojejunostomy had total gastrectomy: these patients were included in this study . Also, all patients who were preoperatively diagnosed with early gastric cancer were enrolled in this study . After explaining the merits of laparoscopic surgery, the level of difficulty of procedures, and the cost for otg and latg, the decision of otg and latg resided with the patient . A carbon dioxide pneumoperitoneum was created using the umbilical port, and the pressure was maintained between 12 and 15 mmhg . The falciform ligament was fixed to the anterior wall of the peritoneum for retraction of the liver using endo close . If the operating field was not sufficient, an additional 5-mm trocar was inserted into the epigastric area to retract the liver . Dissection was begun by dividing the greater omentum (4 cm from gastroepiploic arcade) from the mid - portion of the gastroepiploic arcade to the short gastric vessels . Dissection of the lymph nodes around the left gastroepiploic vessels and short gastric vessel was performed . After the dissection of the lymph nodes around the right gastroepiploic area, the infrapyloric area was dissected . In some patients, dissection was advanced to the superior mesenteric vein to include enlarged 14v lymph nodes . Lymph nodes around the suprapyloric area; hepatoduodenal ligament (along the hepatic artery), common hepatic, splenic, celiac, and left gastric arteries; and right and left paracardial areas were dissected in that order . The duodenum is transected below the duodenal bulb using an endoscopic linear stapler (endopath ets 60, ethicon endo - surgery inc ., after clearing the lymph nodes, a 4 - 5 cm midline incision was made from the epigastrictrocar site . A wound protector was applied, and esophagojejunostomy was reconstructed using a circular stapler (proximate ils, ethicon endo - surgery inc . ; dst series eea, tyco healthcare group lp, north haven, ct, usa). Clinical data obtained from medical records included patient age, gender, body mass index (bmi), and american society of anesthesiologists (asa) score . Early surgical outcomes included operation time, postoperative complications, intra - operative blood loss, postoperative change in hematocrit, time to first flatus, day of commencement on soft diet, number of administrations of analgesics, numeric rating scale (nrs), and postoperative hospital stay . Pathologic results were analyzed for tumor size, number of retrieved lymph nodes, resection margins, and american joint committee on cancer / international union against cancer staging . To evaluate the intra - operative blood loss, the attending anesthesiologist recorded the estimated blood loss . This was based on the observation of the number of surgical sponges used, the amount of fluid in the suction device, and a calculation of the amount of irrigant used during the operation . Preoperative hematocrit was checked before undergoing surgery and postoperative hematocrit was checked on postoperative day one at 7:00 am . Our postoperative pain control consisted of intravenous patient - controlled analgesia (fentanyl 2,500 g, ketorolactromethamine 180 mg, ondansetronhcl 16 mg). To evaluate the patients' postoperative pain, we calculated the number of additional doses of analgesics until the patient was discharged from the hospital . The nrs was checked on postoperative day (pod) 0 at 11:00 pm, pod 1 at 8:00 am, pod 1 at 11:00 pm, pod 2 at 8:00 am, pod 3 at 8:00 am and pod 5 at 8:00 am . Patients were discharged if they had no problems eating a soft diet, showed an absence of inflammatory conditions, including leukocytosis, unstable vital sign and abrupt onset abdominal pain, and were generally comfortable . Also, we left the final decision about discharge up to the patients . Patient data was analyzed by one - way analysis of variance, followed by a post - hoc turkey test and the test . The clinical characteristics of the 190 patients are presented in table 1 . In comparison of patients overall, there was no difference in gender, age, asa score, and bmi between the latg and otg groups . Operation time, it took longer to perform for latg than otg (latg vs. otg; 150.8 minutes vs. 131.2 minutes; p <0.001). There was no significant difference for postoperative complication rate (latg 12.7% vs. otg 18.9%; p = 0.291). There were significant differences for the amount of estimated blood loss (latg 179.7 ml vs. otg 272.7 ml; p <0.001) and postoperative change in hematocrit (hct) (latg 36.2 vs. otg 34.5; p = 0.002). The mean day to first flatus (p <0.001) and commencement of soft diet (p = 0.034) were checked earlier in the latg group than in otg group . The postoperative hospital stay was significantly shorter in the latg group than in the otg group (p = 0.045). Nrs scores were significantly lower in the latg group than in the otg group at pod 0 at 11:00 am, pod 1 at 8:00 am, pod 1 at 11:00 pm, pod 2 at 8:00 am, pod 3 at 8:00 am, pod 5 at 8:00 am (p <0.001, p = 0.003, p = 0.005, p = 0.008, p = 0.010, p = 0.004). In pathologic results, there were no significant differences for tumor size, the number of retrieved lymph nodes, resection margins, tumor's depth and nodal staging (table 3). In patients who underwent latg, postoperative complications occurred in 8 patients . Intra - abdominal abscesses developed in 4 patients . In four of eight patients, extra - luminal bleeding, anastomosis leakage, cholecystitis, and wound complication occurred, respectively . Intra - abdominal abscess were managed by pig - tail insertion and administration of antibiotics . Extra - luminal bleeding was solved by laparoscopic reoperation for bleeding of suprapancreatic branch around the splenic artery . Anastomosis leakage was managed by conservative treatment and upper gastrointestinal series showed closure at postoperative 14 days . The clinical characteristics of the 190 patients are presented in table 1 . In comparison of patients overall, there was no difference in gender, age, asa score, and bmi between the latg and otg groups . Operation time, it took longer to perform for latg than otg (latg vs. otg; 150.8 minutes vs. 131.2 minutes; p <0.001). There was no significant difference for postoperative complication rate (latg 12.7% vs. otg 18.9%; p = 0.291). There were significant differences for the amount of estimated blood loss (latg 179.7 ml vs. otg 272.7 ml; p <0.001) and postoperative change in hematocrit (hct) (latg 36.2 vs. otg 34.5; p = 0.002). The mean day to first flatus (p <0.001) and commencement of soft diet (p = 0.034) were checked earlier in the latg group than in otg group . The postoperative hospital stay was significantly shorter in the latg group than in the otg group (p = 0.045). Nrs scores were significantly lower in the latg group than in the otg group at pod 0 at 11:00 am, pod 1 at 8:00 am, pod 1 at 11:00 pm, pod 2 at 8:00 am, pod 3 at 8:00 am, pod 5 at 8:00 am (p <0.001, p = 0.003, p = 0.005, p = 0.008, p = 0.010, p = 0.004). In pathologic results, there were no significant differences for tumor size, the number of retrieved lymph nodes, resection margins, tumor's depth and nodal staging (table 3). Intra - abdominal abscesses developed in 4 patients . In four of eight patients, extra - luminal bleeding, anastomosis leakage, cholecystitis, and wound complication occurred, respectively . Intra - abdominal abscess were managed by pig - tail insertion and administration of antibiotics . Extra - luminal bleeding was solved by laparoscopic reoperation for bleeding of suprapancreatic branch around the splenic artery . Anastomosis leakage was managed by conservative treatment and upper gastrointestinal series showed closure at postoperative 14 days . Many studies have reported that ladg with gastroduodenostomy (billroth i) is as safe as that of open gastrectomy and less invasive than open gastrectomy [2 - 5]. However, latg is not a generally accepted approach among many surgeons due to technical difficulties and high complication rate . Up to now, there have been some reports about the technical feasibility and safety compared with conventional open gastrectomy [7 - 10]. In practical procedures of latg, we often had difficulty in reconstruction of anastomosis due to limited operation field . One of the difficulties was the process of clamping the distal esophagus through small incision . Another was the process of inserting and extracting of the straight needle into the purse - string clamp . Especially in obese patients, we had difficulties in performing these processes . Although it would be difficult to perform these processes in the latg, our results showed the feasibility of latg for postoperative complications as in other previous reports . We speculate that the accumulated experiences of surgeons in laparoscopic gastrectomy will aid us in getting over these difficulties . In our institution, we had experienced 1,100 cases of laparoscopic gastrectomy including ladg with gastroduodenostomy, ladg with roux - en - y reconstruction, latg and total laparoscopic distal gastrectomy with delta - shaped anastomosis by 2008 . From the accumulated experiences of experts, we could learn the method to reconstruct anastomosis easily . In reconstruction as long as we could, we additionally dissected the crus of the diaphragm . To extract the straight needle from the purse - string clamp easily, we rolled up the straight needle in the abdomen (fig . 2). Also, we were able to obtain a shorter operation field by comparing the end of esophageal stump and the location of midline incision . In the present study, we found that the early surgical outcomes were more favorable for patients who underwent latg, as assessed by estimated blood loss, change of postoperative hct, earlier bowel movement, less pain during recovery, and earlier hospital discharge . Although there was a report which longer operation time and co2 pneumoperitoneum incur the possibility of several hemodynamic consequences in these patients . We could minimize length of incision and manipulation by performing latg . In comparison to the pathologic results, although the current study could not be confirmed for oncologic results of latg, there were no significant differences of pathologic results between the two groups (table 3). In the present study, although there was no significance statistically for nodal staging, the proportion of metastatic lymph nodes is higher in latg group than in otg group . We assume that is just part of the reason why the latg group has more advanced gastric cancer in tumor depth . Therefore, it will require a large volume and long - term follow up to evaluate the oncologic results of latg . Although the baseline characteristics of patients in otg and latg groups were similar, there was the possibility of bias in the study population . Also, although the methods of laparoscopic gastrectomy had been decided on by the selected patients, there was, again, the possibility of bias in the study population . Therefore, it will require a large, randomized, and prospective study to evaluate the effectiveness of latg . In conclusion, the present study has suggested that latg is not only a feasible procedure for postoperative complications but also contributes to the improvement of early surgical outcomes including bowel movement, pain during recovery, and hospital discharge.

Nearest neighbor approaches were developed to predict the folding stabilities of nucleic acid secondary structures (1). These parameter sets utilize empirical rules, generally derived from optical melting experimental data, as the basis of the predictions . For rna, rules exist for predicting both free energy and enthalpy change of watson crick helices, gu pairs and loops (25). Parameters for dna have also been assembled for predicting watson crick pair free energy and enthalpy change and free energy changes of loops (6,7). These parameter sets are the basis of computer programs that predict low free energy secondary structures . Such programs include mfold / unafold (8,9), the vienna rna package (10), rna structure (2), rnasoft (11) and sfold (12). Additional approaches that use statistical learning of parameters for rna folding have also used the rules from the nearest neighbor methods and derived new parameter values (13,14). Nearest neighbor parameter sets include both a set of rules, called either equations or features, for predicting stability and a set of parameter values used by the equations (14). For rna, separate rules exist for predicting stabilities of helices, hairpin loops, small internal loops, large internal loops, bulge loops, multibranch loops, exterior loops and pseudoknots . Given the number of rules and constraints on the length of journal publications, it is difficult to assemble all the parameters in one publication and provide meaningful tutorials for using the parameters . This is a barrier to software development for novel algorithms that could take advantage of the parameters . For example, many software packages that use rna parameters still implement the set of parameters assembled in 1999 (4), in spite of the fact the rna parameters were updated in 2004 (2) based on experimental results . The nearest neighbor database (nndb) is a web - based tool for assembling and archiving complete nearest neighbor sets, including rules and values . Currently, the 1999 and 2004 sets of rna folding parameters are provided (25). The nndb is built using a set of static html, specifically xhtml 1.0 transitional pages with a page hierarchy shown in figure 1 . Text is encoded in unicode (utf-8) to facilitate display of equations in pages with diverse browsers running on diverse operating systems . The top - level page provides access to a help page, available parameter sets and a page of references to rna optical melting experiments . Additionally, links provide downloading of the whole database in either zip or gzipped tar format . The help page introduces the purpose of the database and defines basic terms, including the set of structural features defined by secondary structures . For example, figure 2, from the help page, shows an rna secondary structure that illustrates the loop features covered by nearest neighbor parameter sets . The basic equations for utilizing the parameters to extrapolate folding free energy changes to temperatures other than 37c and to predict melting temperatures are also provided . This figure illustrates the page hierarchy by following the linked pages down through the 1999 parameters and down to the hairpin loop pages . Note that there are five example calculations for hairpin loops to illustrate the separate sequence - dependent rules that are used depending on the specific loop . Figure 2.an rna secondary structure illustrating the types of features included in nearest neighbor parameter sets . Internal loops have nucleotides not in canonical pairs on each of two strands, but bulge loops have nucleotides not in canonical pairs on only one strand . Formally, a pseudoknot occurs when there are at least two pairs, with indices i paired to j and i paired to j, that satisfy the condition i <i <j <j. The pseudoknot helix is often considered to be composed of the fewest pairs that need to be removed to relieve the pseudoknot (19). In this structure, this figure illustrates the page hierarchy by following the linked pages down through the 1999 parameters and down to the hairpin loop pages . Note that there are five example calculations for hairpin loops to illustrate the separate sequence - dependent rules that are used depending on the specific loop . An rna secondary structure illustrating the types of features included in nearest neighbor parameter sets . Internal loops have nucleotides not in canonical pairs on each of two strands, but bulge loops have nucleotides not in canonical pairs on only one strand . Formally, a pseudoknot occurs when there are at least two pairs, with indices i paired to j and i paired to j, that satisfy the condition i <i <j <j. The pseudoknot helix is often considered to be composed of the fewest pairs that need to be removed to relieve the pseudoknot (19). In this structure, the tan nucleotides are in pairs that could be removed to relieve the pseudoknot . For each set of parameters, for example, the 1999 rna rules predict only folding free energy changes (4), but the 2004 rules can be used to predict both folding free energy and enthalpy changes (2,5). For each structural feature, a page defines the basic equations and provides links to parameter values (in plain text and html), references and tutorial pages (e.g. Figure 3). The number of tutorials varies from feature to feature; the set of tutorials is designed to cover each type of rule that can be encountered in practice . Crick helix parameters are covered with two tutorials, one for self - complementary and one for non - self - complementary strands . These two tutorials also demonstrate the difference in the calculation when there are terminal au base pairs, which receive a free energy and enthalpy change penalty (3), because the self - complementary duplex example has two terminal au pairs and the non - self - complementary case has no terminal au pairs . This tutorial demonstrates the prediction of folding free energy change for a hairpin loop of six unpaired nucleotides using the 2004 parameters (2,3). An example tutorial from the database . This tutorial demonstrates the prediction of folding free energy change for a hairpin loop of six unpaired nucleotides using the 2004 parameters (2,3). Individual pages above the level of value tables have top banner, a left navigation bar that allows the user to navigate back up the hierarchy to any level above and a bottom bar with the date of last editing . For pages edited after the database has gone online, previous versions of the page are available using this bottom content bar . To facilitate indexing by search engines, all pages have a descriptive title, including the set of parameters to which it belongs (if applicable). The first release of the nndb contains the rna folding rules assembled in 1999 and 2004 (25). These rules represent the most recent set of parameters and a prior set that is widely used in software packages . Because folding rules are derived to work as a set, the two versions of rules and values should not be mixed and the website hierarchy reinforces this . It is anticipated, for example, that additional pages will be written to include nearest neighbors for dna folding (6,7) and for predicting rna pseudoknot stabilities (1518). Additionally, the values derived from the re - estimation of the values of the 1999 parameter set using the set of known rna secondary structures will also be included (14). The nndb is designed to provide a convenient location for assembling parameter sets for predicting the stability of nucleic acid secondary structures . It is modular in design, which facilitates its future expansion to contain additional parameter sets . Furthermore, the web format makes it feasible to provide extensive tutorials for utilizing the parameters, which is generally not possible in print . The creation of the nndb was supported by united states national institutes of health grants gm076485 to d.h.m . And gm22939 to d.h.t . Funding for open access charge: united states national institutes of health.

Mucocele of the appendix (collection of mucus within the appendiceal lumen) is a rare lesion, found in only 0.2% to 0.3% of 43,000 appendectomies reviewed . Currently, the assessment of pelvic masses relies heavily on usg as the primary diagnostic tool . In such cases, clinical findings and other investigative modalities are warranted to aid the diagnostic process . In spite of extensive preoperative investigations, the diagnosis may still remain elusive and may only be made at the time of surgery . Some regard this lesion as benign, a result of obstruction of the proximal lumen by fibrosis; others believe it to be a neoplasm of the appendix . Is the method of choice in the management of simple mucocele and for cystadenoma with an intact base . Several studies (mostly case reports) on laparoscopic resection of mucocele have been reported . A 60-year - old female presented with pain in lower part of abdomen and palpable tender lump in the right ileac fossa . Ultrasound of the abdomen reports a cystic mass of size 12 15 cm with thin internal septations in the right adnexa . The pneumoperitoneum was created with veress needle using carbon dioxide and the pressure was kept at 11 mmhg . A 0 telescope was introduced through the umbilical port for the complete examination of the abdomen . Diagnostic laparoscopy revealed approximately 14 15 cm large bluish mucocele of the appendix with omental adhesions . Two 5-mm ports were placed in the supra pubic area below the pubic hair line as the working port . The mucocele of the appendix was isolated after separating the mesoappendix from it with the help of bipolar cautery . Following this, mucocele of the appendix [figure 1] was retrieved out in a plastic bag through the umbilical port . Hemostasis was obtained and a suction drain left in situ which was removed when non - productive . Cut section showed appendix was filled with mucin - like material [figure 2]. She was started orally after 4 hours of operation and solid food on the next day . Appendicular lump from the distal portion of appendix after removal the appendicular lump filled with mucinus material mucocele of the appendix is a descriptive term for an appendix distended by mucus, secondary to mucinous cystadenoma (63%), mucosal hyperplasia (25%), mucinous cystadenocarcinoma (11%), and retention cyst . Clinical presentation may include right lower quadrant pain, change in bowel habits, per rectal bleeding, or a palpable mass . Approximately 23 - 50% of patients are asymptomatic, with the lesions being discovered incidentally during surgery, radiological evaluations, or endoscopic procedures . The preoperative clinical diagnosis of appendiceal mucoceles can therefore be difficult because of this lack of clinical symptomotology . The initial detection of the lesion may be facilitated by radiological, sonographic, or endoscopic means . On barium enema, the lesion may be seen as a sharply outlined sub - mucosal or extrinsic mass indenting the cecum and laterally displacing it . Purely cystic lesions with anechoic fluid, hypoechoic masses with fine internal echoes as well as complex hyperechoic masses can be seen depending on the contents . Ct of the abdomen usually shows a cystic well - encapslated mass sometimes with mural calcification, in the expected location of the appendix . It may be causing extrinsic pressure on the cecal wall without any surrounding inflammatory reaction . Colonoscopic findings include the volcano sign, the appendiceal orifice seen in the center of a firm mound covered by normal mucosa or a yellowish, lipoma - like submucosal mass . In our case, usg was unable to provide a preoperative diagnosis . In our case, the decision for excision of the appendiceal mucocele was made as a result of diagnostic laparoscopy and a need to rule out malignancy . Therefore mucocele of the appendix can mimic an adnexal mass and prove to be a diagnostic challenge . In a woman presenting with right iliac fossa mass and with clinical features not indicative of gynecological pathology, an appendiceal origin should be considered in the differential diagnosis . Surgery is the treatment of choice and should be done early as tumor cannot be ruled out as the causative factor for the mucocele . Pre - operative diagnosis is important to avoid unintended rupture and the development of pseudomyxoma peritonei during surgery . However, laparoscopic dissection, grasping of the appendix specimen, pneumoperitoneum, or transport of the specimen through the abdominal wall might contribute to peritoneal dissemination of a tumor, if present . These setbacks can be avoided by taking precautions like using bowel holding graspers (non - traumatic) to handle the mucocele and using a non - permeable bag to deliver the specimen out of the port . Mucocele of the appendix can mimic an adnexal mass and prove to be a diagnostic challenge . Laparoscopic resection of mucocele of the appendix is feasible in spite of the danger of malignancy, provided necessary precautions are taken.

Postpartum psychiatric disorders, described as lactational psychoses by hippocrates in the 4 century bc, have long been of interest to the medical community . Pregnancy and postpartum period are widely considered periods of increased vulnerability to psychiatric disorders . After more than 50 years and four revisions, postpartum disorders were incorporated into the diagnostic and statistical manual of mental disorders, fourth edition text revision (dsm - iv - tr). Although diagnostic guidelines in dsm - iv tr have been restricted to the first 4 weeks after delivery, most clinicians and researchers regard the postpartum period as 6 months or even 1 year after childbirth . In the international classification of diseases-10 edition (icd-10), the postpartum disorders are grouped under behavioral syndromes associated with physiological disturbances and physical factors as mental and behavioral disorders associated with the puerperium, not elsewhere classified (f53.053.9). In icd 10, the duration criteria in contrast to dsm - iv - tr is 6 weeks . Further, in dsm-5, the specifier with postpartum onset has been replaced by with peripartum onset . This specifier is used if the onset of mood symptoms occurs during pregnancy or within the 4 weeks following delivery . However, postpartum psychiatric disorders may manifest weeks beyond the 1 month or 6 weeks after delivery . Hence, the utility of dsm specifiers and icd special code in the classification of puerperal disorders is limited . In addition, very little is known about whether the assessment or screening can be done on the days immediately after birth . The traditional view that there are three postpartum psychiatric disorders such as postpartum blues, depression, and puerperal psychosis is an oversimplification . Childbirth presents many challenges to the mother such as trauma, sleep deprivation, breastfeeding, and adjustments in relationships and is a major life transition and developmental process . These include the blues, which occur in the 1 day after birth and which is very common, ranging from 50% to 75%, and self - limiting . The most severe form of mental disorder associated with postpartum period is postpartum psychosis, observed in 12/1000 child - bearing women occurring as early as 23 days after childbirth . The mild to moderate depression recent studies suggest that postpartum anxiety disorders are underemphasized and are more common than depression . The case series of obsessions of infanticide are many . Also, posttraumatic stress disorders (ptsds) and newer entities such as the morbid preoccupations regarding the childbirth and the disorders of the mother maternal morbidity and mortality are not the only reasons why effective action is necessary to deal with postpartum illnesses, but the impact it has on the family and the child and the subsequent bonding . Maternal psychiatric disorders during pregnancy and the postpartum period are also associated with numerous adverse outcomes for the offspring, including maladaptive fetal growth and development, poor cognitive development and behavior during childhood and adolescence, and negative nutritional and health effects . Hence, our primary objective was to assess the proportion and types of psychiatric morbidity and correlates in postpartum women in a tertiary care hospital as per dsm - iv tr . Our secondary objective was to study the relationship between the psychiatric morbidity and specific sociodemographic and clinical variable correlates in postpartum women (within 4 weeks) in a tertiary care hospital . After obtaining the approval from the institutional ethics committee, the study was conducted in a tertiary care hospital attached to a medical college at mysore, india, during june december 2011 . The subjects were explained in their language about the purpose of the study and that their identity will not be revealed in the published material . Then, written consent was taken on the consent form before recruiting them . The study sample consisted of women getting admitted for delivery in the department of obstetrics and gynecology of the study venue . All consenting consecutive patients who are in the postpartum period (<4 weeks as per dsm iv tr) were considered for the study . Women with mental retardation, organic mental disorders, and severe comorbid medical disorders were excluded from the study . The sociodemographic data were obtained on a semistructured proforma consisting of items relating to patients' age, social, educational, cultural background, education, and occupation of the spouse . Then, clinical data were obtained on a similar semistructured proforma comprising items related to patients' family history of psychiatric illness, history of psychiatric illness, clinical details of delivery, sex of fetus, current episode including onset, duration, and timing of illness, and parity and state of physical health of infant . Following this, the mini international neuropsychiatric inventory (mini), a short, structured diagnostic interview designed to diagnose dsm - iv and icd-10 psychiatric disorders for multicenter clinical trials and epidemiology studies as well as the first step in outcome tracking in nonresearch clinical settings was administered . In our study, an additional question about obsession of child harm was included while assessing the obsessive compulsive disorder (ocd). In the end, the patients were rated on the global assessment of functioning (gaf). It was usually the 3 postpartum day in case of a normal delivery and the 7 or 8 day in case of a delivery by episiotomy or cesarean section . The sample size was calculated at 95% confidence interval and 20% relative precision considering the prevalence of postpartum depression as 23.7% . The sample size was calculated using n master software (developed by department of biostatistics, christian medical college, vellore). The statistical analysis of the data has been done using the statistical package for social sciences (spss) windows version 15 (ibm corporation, new york, usa). For frequencies, test of significance was done using independent t - test and chi - square test . The study venue provides tertiary care and is a referral center for the district of mysore and the four neighboring districts . The age range varied from 18 to 35 years with a mean age of 23 4.8 years . Table 1 shows the sociodemographic picture of the study population . Socio - demographic profile of the 152 patients, 146 (96.1%) had received antenatal care as against only 6 (3.9%) who did not; similar numbers followed in the number of pregnancies planned and unplanned . Majority delivered normally 93 (64.2%) and at term - 148 (97.4%). Only 4 (2.6%) delivered preterm . Fifty - five (36.2%) had undergone episiotomy and only 4 (2.6%) underwent cesarean section . Clinical profile of study population the psychiatric morbidity was seen in 67 (44%) of the study subjects as shown in graph 1 . Depressive disorder not otherwise specified (nos), obsessive harm to the child, panic disorder, and social phobia were the different disorders identified . There were no cases of mania, bipolar disorder, psychosis, ptsd, or substance use disorder diagnosed across the sample . Graph 2 and table 3 represent the different psychiatric disorders seen in the study population . Pie chart showing psychiatric morbidity pie chart of different psychiatric disorders psychiatric morbidity in study population psychiatric illness detected in the study population was studied for association with education, education of spouse, religion, type of family, occupation, occupation of spouse, antenatal care, consanguinity, order of child, number of dead children before this delivery, number of abortions before this delivery, term of delivery, mode of delivery, planning of pregnancy, and congenital anomalies . Statistically significant association was seen to be present between psychiatric illness and number of previous stillbirths and dead children before this delivery (p = 0.045). Association between psychiatric illness and number of children dead (stillbirths and neonatal deaths) prior to the present delivery this is a cross - sectional hospital - based study in which we assessed the proportion of psychiatric morbidity of postnatal women attending the department of obstetrics and gynecology of the hospital . We found that the psychiatric morbidity was as high as 44%, found in 67 of 152 study subjects . The disorders were diagnosed using mini, the diagnostic schedule based on dsm - iv tr . The overall psychiatric morbidity found in our study is comparable with that quoted as 33.4% in an epidemiological study . However, that study gave the prevalence rates of postnatal blues, postpartum depression, and psychosis . The tools used in the study included general health questionnaire, hamilton depression rating scale, and edinburgh depression rating scale . They assessed the psychopathology on day 3 of delivery as well as after 3 weeks . Of 478 subjects, 129 (27%) had postnatal blues, 28 (5.86%) had postpartum depression and 3 (0.63%) had postpartum psychosis . A higher rate reported in our study might be due to the different assessment tools used in our study and difference in the sample size . A majority of the studies have only looked into depression in postpartum period and report a prevalence rate ranging from 10% to 18% . Those earlier studies that have reported psychiatric morbidity in general, have followed the same traditional view of assessing the three frequently reported disorders, mentioned earlier . One of them has studied 100 consecutive postpartum women who are known cases of psychiatric syndromes, according to icd-9 . Interestingly, it infers that 67 patients had schizophrenic psychosis, which was the most common disorder . This was followed by postpartum blues (14), manic excitement (6), depressive psychosis (5), hysteria (4), hysterical psychosis (3), and psychogenic paranoid psychosis (1). However, the recent studies have thrown light on the other postpartum psychiatric syndromes . Different studies across europe report a frequency of ptsd to be 0.18% although no indian data are available, and it is said to be the fourth most common postpartum disorder . Further, many studies observe that other puerperium - related anxiety disorders such as maternity neurosis, phobia, and panic disorder are underemphasized . Even, obsession of child harm is not an uncommon phenomenon, found to be comorbid to postpartum depression in some cases . In our study, though we did not come across any ptsd, there were cases of panic disorder (2%) and social phobia (6%). We have also reported two subjects who had obsessions of child harm and in one subject, it was comorbid to social phobia . The most common psychiatric disorder in our study population was depression, seen in 41 subjects (27%). Among them, 9 had social phobia comorbid to depression and one had obsession of child harm . The diagnosis of nos category of depression was used, due to the fact that the majority of the patients seen were in the 1 week of postpartum period and had onset of mood symptoms following delivery, whereas the mini specifies that the depressive disorder to be present for a duration of 2 weeks . Both indian and western literature quotes that postpartum depression is prevalent in the range of 1015% . An indian study done with a similar methodology as ours quotes the rate of postpartum depression to be 23% . It reports that 16% of those delivering by normal delivery had depression as compared to 20% by cesarean method, though the difference was not statistically significant . Our study reports a slightly higher rate of depression probably due to early assessment during the 1 week of delivery wherein some cases of blues might be identified that recover spontaneously after 2 weeks and are not picked up by mini as separate entity . Obsessions of child harm (10%), panic disorder without agoraphobia (2%), and social phobia (6%) were the other disorders identified in our study . Hysteria (conversion and dissociative reactions according to icd-9) was seen in 7% of all psychiatric morbidity among 100 consecutive postpartum subjects in an indian study though other anxiety disorders were not reported . In another study, social phobia was seen in 10%, simple phobia in 12%, panic disorder with or without agoraphobia in 4%, and ocd in 7% . However, most of them were present antepartum . Further, all cases of social phobia and one case of ocd were antepartum . The number of dead children before the present delivery was the only risk factor contributing for the development of psychiatric morbidity in our study . Among those who had one or more previous deaths, 16 of 19 had developed psychiatric problems, thus significantly differing from those who had no previous fetal deaths (p = 0.045). A review states that perinatal loss is a significant psychological trauma to parents both immediately as well as in the long term, and there is a tendency to focus exclusively on affective symptomatology in such cases . Women with multiple losses were more likely to be diagnosed with major depression or ptsd than women with one pregnancy loss . Another study reports that a history of previous loss by miscarriage and stillbirth is associated with depression during the current pregnancy . However, there is no significant difference in the psychopathology during current pregnancy associated with the type of loss in the past (miscarriage vs. stillbirth). It also infers that the depression persists beyond the current pregnancy even though it resulted in a healthy baby . This is a cross - sectional, hospital - based study and we could analyze the data of all 152 subjects who participated in the study . Some of the studies in this area are longitudinal, involving assessments during different stages of pregnancy and postpartum . Although prospective studies are ideal to study psychopathology in such disorders, there will be attrition due to patients losing for follow - ups . The aim of our study was to assess the proportion and types of psychiatric morbidity and correlates in postpartum women in a tertiary care hospital . The study was based on the thinking that there is a need for the assessment and care of psychiatric morbidity in a tertiary care maternity centre, as the indian data in this area are not exhaustive . We have used mini to evaluate a variety of psychiatric comorbidities unlike the earlier studies focusing on postpartum blue, depression, and psychosis based on unstructured interviews and psychopathology rating scales . We did not administer any psychopathology rating scales as we did not compare psychopathology prospectively . The study reveals that psychiatric comorbidity is very common in the postpartum period and can be detected as early as 1 week after delivery . The overall psychiatric morbidity was 44% and the most common disorder was depression, seen in 26% women . The number of dead children (stillborn and neonatal death) before the present delivery is a risk factor for psychiatric morbidity during the current pregnancy . Social phobia identified as a common association, though antepartum, is a new finding and needs further replication . It needs a larger sample with a prospective assessment to generalize the findings of our study.

Microdissection, genetic, and inhibitor experiments have been used to define the parts of the spindle that are required for cleavage furrow induction . Chromosomes have been shown to be dispensable for cytokinesis (rappaport, 1996; zhang and nicklas, 1996; bucciarelli et al ., 2003; dekens et al ., 2003). Likewise, centrosomes can be ablated or genetically disrupted without preventing cytokinesis (khodjakov and rieder, 2001; megraw et al ., 2001). Though chromosomes and centrosomes are dispensable, they may influence the process when they are present (piel et al ., 2001). In addition to chromosomes and centrosomes, the spindle contains a large array of microtubules . Microtubule depolymerization during metaphase or very early anaphase prevents cleavage furrow formation, indicating that microtubules are essential (hamaguchi, 1975). However, furrow formation can occur if the mitotic spindle is depolymerized later in anaphase, but before ingression has begun (hamaguchi, 1975). Thus, mitotic spindle microtubules are required to induce furrow formation, but they are not, per se, required for ingression . Further insight into the mechanism of cleavage furrow induction has come from experiments in which cells, usually embryos, are physically manipulated and their potential to cleave assessed . These perturbations include alteration of the position of the spindle with respect to the cell cortex, cell shape deformation, and removal of parts of the spindle . For example, the classic torus experiment in which two spindles in a common cytoplasm induce an additional furrow indicates that opposing asters are sufficient to induce a furrow (rappaport, 1961). Additionally, repositioning of the spindle during anaphase results in multiple cleavage furrows whose positions are dictated by the spindle (rappaport, 1985). Results of numerous experiments of this type have led to the astral stimulation model (fig . This concept assumes that astral microtubules provide a cleavage stimulus, which, for example, could be a factor that is transported along astral microtubules . This model proposes that because the equatorial cortex is influenced by astral microtubules from two poles, the strength of this stimulus would be highest at the cell equator . With some assumptions concerning the nature of the signal, its mode of delivery, and the distribution of microtubules, computer modeling indicates that a cleavage stimulus could reach a maximum at the equatorial region (devore et al ., 1989;, asserts that astral rays (i.e., microtubules) cause a reduction of cortical contractility in a density - dependent manner . According to this model, the density of astral rays is higher near the poles than at the equator, assuming spherically symmetric asters in spherical cells . This would cause the polar regions to be less contractile than the equator, and this difference in contractility would induce equatorial furrowing (fig . 1 b; wolpert, 1960). Quantitative modeling confirmed that this model could, in principle, allow furrow formation, but indicated that a positive feedback loop during contractility would be required to allow complete ingression (white and borisy, 1983; yoshigaki, 1999). These two models come to opposite conclusions regarding the role of astral microtubules because they differ in their underlying assumptions about the distribution of microtubules, their lengths, and the way in which they interact with the cell cortex . In addition, it is now apparent that activities exist that bundle microtubules from opposing asters and generate a structure that is called the central spindle (also known as the spindle midzone). The evolutionarily conserved centralspindlin complex containing a kinesin - like protein mklp1 and a rho family gap, hscyk-4/mgcracgap (mishima et al ., centralspindlin is directly involved in central spindle assembly because it localizes to the central spindle and has microtubule - bundling activity (mishima et al ., another important factor in central spindle assembly is the microtubule - binding protein prc1 (mollinari et al ., 2002). Because there is evidence that antiparallel microtubule bundles can regulate furrowing (see below), some of the micromanipulation experiments that have led to the astral stimulation and relaxation models may need to be reinterpreted . Indeed, observations in drosophila provide compelling evidence that astral microtubules may not be critical for furrow formation and that the central spindle is necessary and sufficient to induce furrow formation (fig in particular, cells deficient in the kinesin - like protein pavarotti (the orthologue of hs mklp1/ce zen-4) fail to form a central spindle, have rather normal appearing astral microtubules, and do not form cleavage furrows (adams et al . Conversely, asterless mutants, which lack most astral microtubules but retain a central spindle, are still capable of forming cleavage furrows (bonaccorsi et al ., 1998). These data fit neither the astral stimulation nor the astral relaxation model, and suggest that the central spindle is responsible for furrow induction . Additional evidence supports the notion that the central spindle is involved in furrow formation . In cultured rat cells, if a small perforation is created adjacent to the central spindle, furrow formation occurs on the side of the perforation adjacent to the central spindle and not at the cortical site where furrow formation would have occurred in an unmanipulated cell (cao and wang, 1996). Furthermore, grasshopper spermatocytes have been manipulated to simultaneously remove centrosomes and chromosomes, and the remaining microtubules self - organize into bundles that resemble the central spindle and appear to induce furrow formation (alsop and zhang, 2003). These results, combined with the fact that many key regulators of mitotic events localize to the central spindle, have lead to the proposal that central spindle microtubules (or more generally, antiparallel microtubule bundles) are a principle regulator of furrow formation . However, there is also compelling evidence that the central spindle is dispensable for cleavage furrow formation . In caenorhabditis elegans embryos, cleavage furrows form and constrict, but they fail to complete cytokinesis (powers et al ., 1998; raich et al ., 1998; jantsch - plunger et al ., 2000). The dramatically different requirement for the central spindle in furrow formation in drosophila and c. elegans could result from differences in cell size in these systems . Indeed, some variation has been reported in the localization of critical factors that regulate cytokinesis . For example, in drosophila, in addition to the central spindle localized pool of pavarotti, there is also a cortically localized pool that is not detected in other organisms (sellitto and kuriyama, 1988; adams et al ., 1998; powers et al . Conversely, in mammalian cells, ect2 (a gef for rhoa) is readily detected in association with both the cell cortex and the spindle, but its orthologue in drosophila is primarily associated with the cell cortex (prokopenko et al ., 1999; however, recent results suggest that neither cell size nor lack of conservation underlies the variable degree to which the central spindle controls furrow formation, and indicate that this process is controlled by two parallel pathways . In c. elegans embryos, the central spindle is not generally essential for furrow formation . However, if the extent of spindle elongation during anaphase is reduced by one of several genetic perturbations, the central spindle becomes essential (dechant and glotzer, 2003). In addition, although furrow formation can occur in the absence of the central spindle, initiation of cytokinesis is slightly delayed under these circumstances . Thus, perhaps different cell types use both astral microtubules and the central spindle for furrow formation, albeit to varying degrees . Indeed, there is evidence for plasticity in the induction of cleavage furrows in mammalian cells . Microsurgical experiments indicate that the central spindle has furrow - inducing activity, yet cells depleted for key central spindle components, such as mklp1 or prc1, still form furrows (cao and wang, 1996; matuliene and kuriyama, 2002; mollinari et al ., given that both the central spindle and astral microtubules can contribute to induction of cleavage furrows, at least under some circumstances, proteins that localize to these structures are potential clues to the mechanism of furrow induction ., these factors could regulate furrow formation in two ways: they could be positive inducers of furrow formation, or they could inhibit a negative regulator of furrow formation . There are several factors that concentrate on the central spindle that have been suggested to be inducers of cleavage furrow formation . One candidate is the abi complex consisting of aurora b, incenp, and survivin / bir-1 (adams et al ., 2000;, 2001; bolton et al ., 2002; cheeseman et al ., 2002; honda et al ., 2003; romano et al ., this complex contains a fourth protein, csc-1 (romano et al ., 2003). In mammalian cells, incenp first localizes to chromosomes during prometaphase, then it concentrates on centromeres during metaphase, and then, upon anaphase onset, it localizes to both the central spindle and, interestingly, the overlying cell cortex (cooke et al ., 1987). Both astral microtubules and the central spindle contribute to cortical localization of aurora b (murata - hori and wang, 2002), presumably due to interactions with incenp and survivin, whose sole function appears to be to activate and localize aurora b. interestingly, aurora b localizes to the central spindle in cells that lack chromosomes (bucciarelli et al ., 2003), indicating that these subcellular targeting events are independent . The cortical localization of the abi complex precedes the early stages of cytokinesis (eckley et al ., 1997). Although this localization of the abi complex suggests that it may direct cleavage furrow formation, cells deficient in aurora b (due to mutation, rnai - mediated depletion, or chemical inhibition) are competent to form cleavage furrows (schumacher et al ., 1998; fraser et al ., 1999; kaitna et al ., 2000; hauf et al ., a second potential activator of cleavage furrow formation that could link the central spindle to cleavage furrow formation is the rhogef, pebble . Pebble was recently shown to associate with drosophila centralspindlin (somers and saint, 2003). Pebble (hs ect2/ce let-21) is essential for furrow formation, presumably because it is the critical activator of rhoa in cytokinesis (prokopenko et al . Two - hybrid analysis indicates that the nh2 terminus of pebble binds to the nh2-terminal region of the fly orthologue of cyk-4, racgap50c . Concentration of centralspindlin in the spindle midzone could thereby recruit pebble and induce the local activation of rhoa, followed by actin polymerization and cleavage furrow formation . If this were the case, then cells defective in central spindle formation would also be expected to be defective in furrow formation . Although coupling of these two processes is observed in drosophila, this is not the case in c. elegans embryos or in mammalian cells . Moreover, overexpression of the nh2-terminal domain of the pebble orthologue, ect2, causes a late defect in cytokinesis (tatsumoto et al ., 1999), not the early defect expected if the association of pebble with centralspindlin was essential for spatial regulation of pebble function . Thus, although pebble is critical for furrow formation, its association with the central spindle does not appear to be critical in all species . The association of pebble with centralspindlin might promote the continued ingression of the cleavage furrow by maintaining rhoa in an active state . It will certainly be interesting to understand the interplay between the rhogap and the rhogef in this unusual protein complex . An alternative way to regulate furrow formation is through local inhibition of a negative regulator . Experiments in mammalian cells and c. elegans embryos suggest that during cytokinesis, microtubules inhibit the contractility of the cell cortex . When microtubules are induced to be unusually short by prolonged activation of the katanin microtubule - severing complex, similarly, mammalian cells forced to exit mitosis in the absence of microtubules undergo vigorous unorganized contractions (canman et al ., 2000). Given that there is compelling evidence that microtubules control furrow formation, it is conceivable that modulation of their distribution or properties could control furrow formation . In principle, bundling of microtubules to form the central spindle could quantitatively and/or qualitatively regulate the inhibitory effects of microtubules . Thus, a second mechanism by which the central spindle could promote furrow formation is by inhibiting this negative regulation . Experimental evidence that furrow positioning may result from local relief from microtubule - dependent inhibition of furrow formation . (a) stabilization of the microtubule - severing complex katanin leads to microtubule shortening and ectopic furrowing . (b) either central spindle assembly or spindle elongation are sufficient to induce furrow formation, but when both pathways are inhibited, no furrow formation occurs . (c) in mammalian cells, a subset of the microtubules in the vicinity of the furrow are less dynamic (purple) than elsewhere in the cell . Spindle elongation and central spindle assembly act together to create a local minimum of microtubule density at a position in the cell equator equidistant from the two spindle poles (dechant and glotzer, 2003). Importantly, these two processes also act in parallel to promote furrow formation (fig . These observations are consistent with a model in which the position of the cleavage furrow in the equatorial region is determined by a site where the inhibitory effect of microtubules reaches a local minimum (fig . Central spindle assembly may not only affect the spatial organization of microtubules it could also alter the capacity of microtubules to inhibit contractility by changing the properties of the microtubules . For example, inhibition of cortical contractility could rely on the dynamics of microtubules or microtubule - associated proteins . Binding of factors to the ends of the microtubules could alter their properties or dynamics . Indeed, early work in mammalian cells indicated that midzone microtubules are more stable than elsewhere in the cell (saxton and mcintosh, 1987), and more recent observations confirm and extend these findings . In particular, before furrow ingression, a subset of microtubules in the vicinity of the presumptive furrow are significantly more stable than microtubules near the cell poles (fig . It is not yet known if the stabilization of microtubules in the equatorial region is mediated by the centralspindlin complex, but this seems likely because it is present there, and overexpression of the kinesin subunit of centralspindlin (mklp1/pavarotti) induces hyperstabilization of microtubules (minestrini et al ., 2002). Thus, binding of centralspindlin to microtubules could induce central spindle assembly and simultaneously prevent the microtubule - dependent inhibition of furrow formation . The rhoa exchange factor, dm pebble (hs ect2, ce let-21) is one of the most upstream molecules in this pathway and is a candidate for regulation by microtubules . However, little is known about how this critical exchange factor is regulated, except that its activity requires phosphorylation (tatsumoto et al ., 1999). Additionally, although rhoa and some of its effectors concentrate at the cleavage furrow, there is no direct evidence for local differences in rhoa activity early in cytokinesis . Recently, a fret - based approach to observe active rhoa during cytokinesis was reported . These probes did not reveal detectable amounts of active rhoa during early cytokinesis, but active rhoa did appear late in cytokinesis (yoshizaki et al ., 2003). Because rhoa activity is required for the initial stages of furrow formation, it is possible that low levels of active rhoa drive furrow formation, and these levels of rhoa were below the detection limit of these probes . Second generation probes specific for active forms of rhoa and other molecules essential for cytokinesis may provide further insight into this important question . However, given that there are several precedents for local activation of gtpase signaling complexes, a reasonable working model is that a local increase in rhoa signaling induces furrow formation . If so, furrow positioning could simply be explained if astral microtubules inhibit rhoa activation, thereby inhibiting furrow formation at ectopic sites, and central spindle assembly and spindle elongation conspire to provide local relief from these inhibitory effects and allow rhoa activation at the equatorial region . Interestingly, microtubule depolymerization in interphase cells causes activation of rhoa - gtp (ren et al ., 1999), implying that microtubules can, directly or indirectly, inhibit rhoa . Moreover, a particular rhogef, gef - h1, is inhibited by microtubule - mediated sequestration (krendel et al ., 2002), illustrating one such mechanism . Further analysis of the biochemical events that occur during furrow initiation is absolutely essential, with particular attention paid to how these events might be regulated by microtubules . At this juncture, furrow positioning does not appear to be solely due to induction by astral microtubules or the central spindle, but rather, both components contribute . Cleavage furrow induction through local relief from the inhibitory effects of microtubules is an appealing model because it explains how two pathways, spindle elongation and central spindle assembly, could control furrow formation through a common molecular mechanism . In addition, it accounts for the fact that the central spindle has a positive (though nonessential) role in furrow formation . It also has predictive value in that local depolymerization of microtubules should induce cleavage furrows . In particular, it is tempting to speculate that the signals discussed here are important for patterning of the cortex in response to a local inhomogeneity in the distribution of microtubules . Subsequent reactions may be required to refine this positional information and to amplify the signal that directs assembly of the contractile ring . Alternatively, contractile ring assembly might be a cooperative process that is self - refining and amplifying.

Bacterial adherence is an essential step in all infections which involves surface interactions between specific receptors on the mammalian cell membrane and ligands on the bacterial surface . Tissue specificity of infection is determined significantly by the presence or absence of specific receptors on mammalian cells . The ability of uropathogenic escherichia coli (upec) to adhere to host uroepithelia is an important stage in the successful colonization of the urinary tract and pathogenesis of urinary tract infection (uti). The principal adherence organelle of upec is p fimbriae, which mediates gal(1 - 4)gal - specific binding via the adhesin molecule papg . The three molecular variants (i to iii) of the adhesin are coded by the adhesin gene papg of which there are three known alleles . These variants exhibit different receptor binding specificities . Naturally, papg alleles occurin four combinations, that is, class plus iii, class iii only, class ii plus iii, and class ii only [2, 5]. According to the receptor specificity of the papg adhesin, p - fimbriated uropathogenic e. coli is clinically divided into two subtypes: papg allele ii strains associated with pyelonephritis and bacteremia, and papg allele iii strains associated with cystitis but have been found in pyelonephritis and bacteremia [2, 57]. The most common extraintestinal e. coli infection in healthy women is utis [8, 9] which develop in an ascending manner, with e. coli gaining access to the bladder via the urethra, and the initial colonization of the vaginal mucosa is considered a critical step toward infection [1012]. Acute cystitis is extremely common among reproductive - age women, whereas acute pyelonephritis, while much less common, is associated with high per - episode costs and morbidity and is more common in pregnant women than in nonpregnant women . As vaginal colonization by upec is a possible previous step to urinary tract infection, this work was designed to see if there is any difference in papg alleles' distribution (especially papg allele ii) among e. coli vaginal isolates from pregnant and nonpregnant women and also to evaluate the possible ability of papg allele ii isolates to cause pyelonephritis by genotypic analyses of e. coli phylogenetic groups and extraintestinal pathogenic e. coli virulence factors (expec vfs). This study included 122 e. coli isolates (61 vaginal and 61 fecal isolates). Vaginal isolates (23 from pregnant and 38 from nonpregnant women) were recovered as significant growth from high vaginal swabs collected by gynecologists from pregnant and nonpregnant women (aged 1845 years) clinically diagnosed as having symptomatic genital tract infection, without investigating the exact cause of infection (women with vaginal discomfort, causes of which had not been clarified by gynecological examination). The swabs were streaked immediately after collection on eosine methylene blue agar (emb) (himedia) and blood agar plates . The plates were incubated at 37c for 2448 hours at ambient air . Fecal isolates (included for comparison) were recovered from healthy volunteers (pregnant (30 isolates) and nonpregnant (31 isolates) women, aged 1845 years). The specimens were processed according to plos et al . By dilution streaking the fecal material onto emb . After incubation, from each plate the last three colonies (with the appropriate color and morphology, that is, characteristics of e. coli) at the end of the streak area were selected and subcultured onto emb plate again, incubated, subcultured again onto tryptic soy agar plates (tsa) (himedia), and then kept in the refrigerator for further work . All this study - included isolates were collected over a 2-year period from may 2008 to june 2010 at obstetrics and gynecology clinics in al - kut / wasit province / iraq, and were identified by conventional biochemical tests [16, 17]. All isolates were screened for the presence of the three papg alleles (i, ii, and iii) by a multiplex pcr assay using specific primers (table 1). For template dna extraction, each isolate was subcultured onto tsa plates for 24 h at 37c . From the agar plate, bacterial suspensions were run for 10 min at 94c in a dna thermocycler (multigene, labnet international, inc ., usa), and cell debris was removed by centrifugation (12,000 rpm for 1 min). Pcr amplification reactions were performed in a volume of 25 l containing 12.5 l of kapataq 2x ready mix (kapa biosystems, usa), 20 pmol concentrations of each primer, and 5 l of dna template . The cycling parameters [19, 20] were as follows: an initial denaturation at 94c for 5 min; followed by 26 cycles of 94c for 1 min, 60c for 2 min, and 72c for 3 min; and with a final extension at 72c for 20 min . The amplified pcr products were subjected to electrophoresis at a 2% agarose gel in 0.5x tbe buffer . Phylogenetic classification of e. coli isolates was determined using triplex pcr - based phylotyping described by clermont et al . . Briefly, genomic dna of bacterial strains was amplified by triplex pcr using primers targeted to three markers, chua, yjaa, and tspe4.c2 . The phylogenetic grouping was made on the basis of the presence of specific pcr - amplified fragments as follows: group b2 (chua+, yjaa+, tspe.c2), group d (chua, yjaa+, tspe.c2), group b1 (chua, yjaa, tspec2 +), and group a (chua, yjaa, tspe.c2) (table 2). Multiplex pcr was used to detect five genes encoding virulence determinants usually associated with extraintestinal pathogenic e. coli strains (expec vfs): neuc (k1 capsule antigen), hly (alpha - hemolysin), papc (type p pili), sfa / foc (type s pili and type 1c fimbriae), fimh (type 1 pili), and iucc (aerobactin) [2, 7]. Virulence factor genes were amplified with the primers described in table 3, in a total volume of 50 l containing 25 l of kapataq 2x ready mix (kapa biosystems, usa), 20 pmol concentrations of each primer except hly (30 pmol), and 5 l of dna template . The reaction conditions were as follows: initial denaturation at 94c for 4 min followed by 25 cycles of denaturation at 94c for 30 s, annealing at 63c for 30 s, and extension at 68c for 3 min, followed by a final 10 min extension period at 72c . The amplification products were separated by electrophoresis in a 2% agarose gel containing ethidium bromide . A 100-bp dna ladder (kappa universal) was used in each gel as a molecular size marker . Sixty - one vaginal e. coli isolates from pregnant and nonpregnant women were surveyed for papg alleles as predisposing factor to pyelonephritis . Papg allele ii was the most prevalent allele among both vaginal (32.7%) and fecal (3.2%) isolates, whereas other alleles were found only among vaginal isolates (1.6% for alleles ii + iii). Also 90% (9/10) and 78.5% (11/14) of papg pregnant and nonpregnant women's vaginal isolates were papg allele ii, respectively (table 4). Papg isolates were further genotyped for e. coli phylogenetic groups and expec vfs' genes (table 5). Papg vaginal isolates clustered in groups b2 (78.2%) and d (21.7%), whereas all of the fecal isolates clustered in group d. except for sfa / foc, for all the studied vfs' genes (table 5), papg vaginal isolates did not differ significantly in comparison with papg fecal isolates . Also pregnant and nonpregnant women's vaginal isolates did not differ significantly from each other for the possession of all the studied vfs' genes . The vast majority of papg allele ii vaginal isolates were clustered in group b2 (81.8%) and much less in group d (18.1%) (table 6), whereas all of the fecal isolates clustered in group d. also, most of them were positive for fimh (100%), papc (100%), iucc (90.9%), and hly (72.7%), and about half of them were positive for sfa / foc (45.4%) (table 6). In addition, the mean of vfs' gene possession was 3.5 (range from 2 to 5). Here in this work, the vast majority of papg allele ii vaginal isolates clustered in group b2 and much less in group d, and most of them were positive for fimh, papc, iucc, and hly, and about half of them were positive for sfa / foc (table 6). Previous studies demonstrated that vaginal e. coli share common virulence factor profiles, phylogenetic groups, and serotypes with e. coli strains from urinary and neonatal (blood and csf) origins [11, 20] as the vagina favors colonization by strains that possess features different from those of fecal flora strains, therefore, the vagina can be considered as an anatomical barrier that selects for strains with a greater capacity to cause disease . This high prevalence of phylogenetic group b2 and expec vfs among this work's isolates indicates their pathogenic potential as expec (especially pyelonephritic e. coli) since most of upec strains belong to phylogenetic group b2 and, to a lesser extent, group d . In addition upec strains harbor numerous vfs, such as adhesins (p fimbriae, type 1 fimbriae, s and f1c fimbriae, and afimbrial adhesin), toxins (hemolysin and cytotoxic necrotizing factor), siderophores (the aerobactin system), and polysaccharide coatings (group ii capsules) [7, 27, 28]. In comparison with cystitis and fecal isolates, pyelonephritic e. coli had a much greater prevalence of phylogenetic group b2, uti - associated o antigens, and individual vfs, plus higher aggregate vf scores . Papgii and papc are suggested to be associated with pyelonephritis and that papg allele ii is one of the significant predictors of this infection [2, 29]. All papg allele ii isolates in this work were positive for both papc and fimh and about half of them were positive for papc, fimh, and sfa / foc . This is consistent with others who demonstrated that type 1, p, s, f1c, and dr fimbriae are all known to bind to different sites within the human kidney and that p and type 1 fimbriae appeared to act in synergy to promote colonization of kidney . This possession of multiple fimbrial types contributes to the pathogen's overall success during renal colonization . Pregnant women's isolates did not differ significantly from those of nonpregnant in possession of papg allele ii (39.1% versus 28.9%), whereas both (32.7%) differed significantly (p 0.05) in comparison with fecal isolates (3.2%) (table 4). Also papg allele ii isolates did not differ significantly from each other regarding the phylogenetic groups and expec vfs' genotypes' distribution (tables 5 and 6) this indicates that both pregnant and nonpregnant women have the same chance to get pyelonephritis in accordance with this work's proposal, although, previous studies found that acute pyelonephritis is more common in pregnant than in nonpregnant women [11, 31] which means that physiological differences seem to be the critical determinants of predisposition to this infection due to stasis of urine and bacteriuria in the urinary tract caused by relative obstruction . The vaginal ecosystem and especially lactobacillus, as well as intestinal populations of e. coli, coitus and the physiological and anatomical conditions of the urinary tract also play a major role in the pathogenesis of urinary tract infections . The possible role of vaginal colonization by such isolates as predisposing factor to pyelonephritis cannot be excluded and required further in vitro and in vivo analyses, as it previously had been found that vaginal colonization by e. coli represents an intermediate stage in extraintestinal e. coli pathogenesis and women often suffer from an enhanced susceptibility to recurrent urinary and genital tract infections in association with uropathogenic e. coli strains . So, it can be concluded that vaginal colonization by papg allele ii e. coli is possibly one of the predisposing factors of both pregnant and nonpregnant women to pyelonephritis, but its potential is modified by other factors especially host factors.

The incidence of stbi has been reported at 200 cases per 100,000 people worldwide . According to the world health organization's study on the global burden of disease in 2010, trauma remains as a public health problem and generates a significant burden on healthcare systems in latin american countries . In colombia in particular, the global burden of injuries is bigger in economically active, male population between 12 and 45 years of age . In 2013, for example, about 26,000 deaths resulted from trauma, and most were associated with interpersonal violence; of these injuries, a large percentage were associated with both closed and penetrating tbi . The objective of this study was to evaluate the outcomes of patients with stbi treated with a strategy of early cranial decompression (ecd) as a damage control procedure (dc). This study was undertaken over a period of 4 years in a university hospital in colombia with limited neuromonitoring resources in the intensive care unit (icu). The hospital at which this study was conducted, neiva university hospital (nuh), is a 504-bed, level i trauma center and tertiary referral hospital in southern colombia . Nuh admits approximately 2000 adult trauma patients per year and has 30 adult icu beds . The hospital is the primary trauma center for 3.2 million inhabitants living in an area extending over 60,000 square miles . Its radius of care extends far into the amazonian region, where the most intense fighting between rebel groups, cocaine traffickers, and government forces has taken place for over 40 years . In this setting, tbi is exceptionally common, but few resources have been devoted to neurologic care in the hospital . Nuh has one computed tomography (ct) and one magnetic resonance imaging machine and did not have continuous access to advance neuro - monitoring . Thus, this is an appropriate location to study the effects of a dc procedure that may be implemented in a timely manner without the extensive use of already limited resources . This is a descriptive observational study of head trauma patients, who were managed with ecd as a dc approach in nuh between february 2009 and february 2013 . Approval from the nuh, quality improvement office and the institutional review board of nuh was obtained prior to conducting this study . The patient outcomes were evaluated according to the glasgow outcome scale (gos) at 12 months postinjury . Based on the gos score, a dichotomous variable divided into (gos 4 or 5), and unfavorable (gos 13) groups was created . Patients were evaluated using the gos in both the outpatient clinic and by phone interview . Classic scale scoring was used (1 = dead, 2 = vegetative state, 3 = severe disability, 4 = moderate disability, and 5 = good recovery). Additional criteria include age 18 years old, severe head trauma (glasgow coma score 8 on arrival or head abbreviated injury scale 3) and icd-10 diagnostic codes of s-00 to s-09 or t-00 to t-14 . All of the patients included in the study were operated in less than 12 h post - trauma . We excluded patients with severe extracranial traumatic injuries, patients who do not receive a decompressive craniectomy, and patients operated after 12 h posttrauma . Early decompression included a> 12 cm by 12 cm hemispheric craniectomy either with or without dural closure . Surgical criteria for the procedure included: obliteration of the basal cisterns, midline shift of> 0.5 cm, acute subdural hematoma wider than 1 cm, epidural hematomas of> 30 cc in volume, or intracerebral hemorrhage of> 50 cc in volume [figure 1]. Tbi: traumatic brain injury, er: emergency room, eb: excess of base, asdh: acute subdural hematoma, edh: epidural hematoma, ich: intracranial hemorrhage, mdls: midline shift, cd: cranial decompression, icu: intensive care unit, sbp: sistolic blood pressure, hobe: head of the bed elevation, ab: antibiotic postoperative care includes sedation for at least 5 days with midazolam and fentanyl, 7.5% hypertonic saline in boluses every 6 h for 48 h and control ct at 24 h after surgery . Antibiotic and anti - convulsive prophylaxis was used in penetrating injuries [figure 1]. Documentary review of medical records by data recording was performed using an intake form that included epidemiological, clinical, surgical, and outcomes data . The analysis of clinical, demographic, and imaging variables was performed for patients who had tbi and were operated with an ecd . Variables such as glasgow coma scale at the emergency room, type of trauma, the severity of injuries, ct scan findings including the presence of hematoma, midline shift, and the compression of the basal cisterns were included . The results obtained in the study were analyzed by a statistical r software, version 2.15.2, r foundation, free software foundation (boston ma), usa . Measures of central tendency and dispersion for continuous variables were calculated including frequencies and proportions for categorical variables . The student's t - test was used to compare continuous variables, and pearson chi - square test was used for categorical variables this is a descriptive observational study of head trauma patients, who were managed with ecd as a dc approach in nuh between february 2009 and february 2013 . Approval from the nuh, quality improvement office and the institutional review board of nuh was obtained prior to conducting this study . The patient outcomes were evaluated according to the glasgow outcome scale (gos) at 12 months postinjury . Based on the gos score, a dichotomous variable divided into (gos 4 or 5), and unfavorable (gos 13) groups was created . Patients were evaluated using the gos in both the outpatient clinic and by phone interview . Classic scale scoring was used (1 = dead, 2 = vegetative state, 3 = severe disability, 4 = moderate disability, and 5 = good recovery). Additional criteria include age 18 years old, severe head trauma (glasgow coma score 8 on arrival or head abbreviated injury scale 3) and icd-10 diagnostic codes of s-00 to s-09 or t-00 to t-14 . All of the patients included in the study were operated in less than 12 h post - trauma . We excluded patients with severe extracranial traumatic injuries, patients who do not receive a decompressive craniectomy, and patients operated after 12 h posttrauma . Early decompression included a> 12 cm by 12 cm hemispheric craniectomy either with or without dural closure . Surgical criteria for the procedure included: obliteration of the basal cisterns, midline shift of> 0.5 cm, acute subdural hematoma wider than 1 cm, epidural hematomas of> 30 cc in volume, or intracerebral hemorrhage of> 50 cc in volume [figure 1]. Tbi: traumatic brain injury, er: emergency room, eb: excess of base, asdh: acute subdural hematoma, edh: epidural hematoma, ich: intracranial hemorrhage, mdls: midline shift, cd: cranial decompression, icu: intensive care unit, sbp: sistolic blood pressure, hobe: head of the bed elevation, ab: antibiotic postoperative care includes sedation for at least 5 days with midazolam and fentanyl, 7.5% hypertonic saline in boluses every 6 h for 48 h and control ct at 24 h after surgery . Antibiotic and anti - convulsive prophylaxis was used in penetrating injuries [figure 1]. Documentary review of medical records by data recording was performed using an intake form that included epidemiological, clinical, surgical, and outcomes data . The analysis of clinical, demographic, and imaging variables was performed for patients who had tbi and were operated with an ecd . Variables such as glasgow coma scale at the emergency room, type of trauma, the severity of injuries, ct scan findings including the presence of hematoma, midline shift, and the compression of the basal cisterns were included . The results obtained in the study were analyzed by a statistical r software, version 2.15.2, r foundation, free software foundation (boston ma), usa . Measures of central tendency and dispersion for continuous variables were calculated including frequencies and proportions for categorical variables . The student's t - test was used to compare continuous variables, and pearson chi - square test was used for categorical variables at nuh, 156 patients were admitted with a diagnosis of stbi between february 2009 and february 2013, but only 106 were managed under ecd with all the inclusion criteria [table 1]. At 12 months postsurgery, a favorable clinical outcome (gos 45) was found in 70 patients (66.1%), while an unfavorable clinical outcome (gos 13) was found in 36 patients (33.9%) (p = 0.0001). Of the 36 patients with an unfavorable outcome, mortality (gos = 1) was observed in 27, with an overall rate of 25.4% . 70.1% (20) of the patients who die, were patients admitted for penetrating brain injury . The clinical and demographic characteristics of both groups are described in [table 2]. Clinical characteristics of patients with stbi admitted to nuh clinical and demographic characteristics of patients with stbi the factors that were associated with an unfavorable neurologic outcome were the following injury severity score (iss)> 35.62 (95% confidence interval [ci], 35.645.8), subdural hematoma at the first ct, closed basal cisterns, and unreactive pupils upon emergency room arrival . In [table 3], significant findings were analyzed for both groups . The average length of stay in the icu for the patients with a favorable gos (45) was 12.96 2.67 days while the group with an unfavorable gos (13) spent an average of 26.71 5.35 days in the icu (p = 0.0002). The average total hospital stay for the favorable group was 26.60 5.78 days while the unfavorable group spent 48.07 12.92 days (p = 0.0001). Clinical and radiologic findings of patients with stbi postoperative care of all the patients was performed in the icu and included sedation with midazolam and fentanyl for a mean of 5 days and 7.5% hypertonic saline boluses every 6 h for 48 h. ct imaging was performed at 2472 h. brain swelling was present in 100% of the cases at both time points . Cranioplasty was performed in most of the cases with autologous bone in a mean period between 1 and 3 months after the initial decompression . The world health organization predicts that traffic accidents will be the third leading cause of illness and injuries worldwide by 2020, and this is one of the most common causes of tbi . In our study, we observed a population of 106 patients with stbi managed with ecd, where 84.9% were male, and the mean age was 36 years, representing the population that is at a major risk for trauma in low and middle - income countries . The management of tbi with ecd has been the subject of many studies in recent years, but often these studies do not provide enough scientific evidence for the procedure . These studies, though, utilize small sample sizes of patients, or use a time definition for ecd as> 12 h posttrauma, which disregards the importance of early intervention in regards to the ecd procedure and treatment for stbi . In addition, the results of these studies show high variability in patient age, type of surgery, and time to initiation of edc surgery . Despite this, in many parts of the world ecd surgery as dc therapy has begun to play a critical role as management for neurotrauma . Ecd has been cataloged as an important option to improve survival and reduce disability associated with tbi . This trend has been confirmed in our study where we found that of the 106 patients with stbi receiving ecd, 79 (74.6%) survived and of those 79 surviving patients, 88.6% had a favorable neurological outcome (gos 45) at 12 months after injury . We do not compare results with patients operated after 12 h in our center or with patients without surgical management in order to avoid bias into the final analysis . In addition, this sample has a homogeneous postoperative care as they were managed inside the specifically described algorithm . We do not include the other variables of the postoperative care, as part of the analytical model for the outcome, and maybe this is a limitation for this study . Several studies of ecd have been conducted in centers where there is the availability of continuous medical monitoring in the neurological icu . In our hospital, continuous neuromonitoring in the icu is not an option; however, the results obtained using edc as dc therapy reflected a better neurological outcome in patients with severe head injury . Recent studies using the same technique have shown mixed results, including studies in centers of similar resources . In our study, patients who underwent ecd as dc therapy, an unfavorable neurological outcome was associated with closed trauma, an iss> 16, obliterated basal cisterns, subdural hematoma as the predominant finding on ct, and nonreactive pupils upon admission . Many of these factors have also been described in other studies that recommend ecd as a dc therapy for stbi, but our study findings need to be highlighted in a context of few resources for neuromonitoring and an aggressive surgical care as an option due to this resource limitation . The only available study of ecd in low resources environment includes the analysis of 10 patients in a teaching hospital in africa . At present, the management of patients with stbi should be aggressive from the moment they arrive at the emergency department; different management protocols can be used help increase survival and reduce hospital time for these patients . In our study, hospital stay was significantly shorter for the group of patients with a favorable neurological outcome at 12 months from injury . Twelve months outcome of patients with stbi managed with ecd in a neuromonitoring limited resource university hospital in colombia shows an important survival rate with favorable clinical outcome measure with gos . Authors are supported by the nih - fic grant #r21tw009332 awarded to meditech foundation (col) and the university of pittsburgh (usa). Authors are supported by the nih - fic grant #r21tw009332 awarded to meditech foundation (col) and the university of pittsburgh (usa).

Supported nanoparticles are used on a tremendously large scale for catalytic reactions . Due to the inherent inhomogeneity of these, often industrial, materials, the basic understanding of their exact atomic structure and relation to their functionality can become very complex . One route to overcome this problem is by design of so - called bottom - up experiments in which well - defined nanoparticles are subjected to controlled environments . Such studies can be performed by depositing nanoparticles in ultrahigh vacuum on perfect single crystal substrates, after which their structure is characterized under different thermodynamic conditions and gas environments . In this way, for example, oxidation reduction - induced reversible shape changes in nanoparticles have been discovered . Solid oxide fuel cells (sofcs) are devices used for energy conversion and are considered as an important future green technology . Their function is largely dependent on catalytic processes taking place at their interfaces . Two important chemical reactions between the surrounding gas atmosphere and the solid play a decisive role . At the cathode, oxygen is dissociated, and the ions enter the electrolyte . Fuel is being oxidized at the anode side, for which the required oxygen reaches the interface through the solid electrolyte . Both the cathode and the anode consist of complex materials having a large surface area, such as polycrystalline oxides (cathode) or nickel nanoparticles (anode). Usually, ni is grown on the electrolyte by wet - chemical methods . Here we investigate ni nanoparticles (nps) deposited on a polished yttria - stabilized zirconia (ysz) substrate as sofc model anode by surface sensitive x - ray diffraction methods . Ysz with 9.5 mol% y2o3 content is a widely used sofc electrolyte material because of its high oxygen ion conductivity . Nickel films grown on mgo(100) have been found to show several preferential orientations, forming a complex epitaxial system and of which the core is stable toward high temperature oxidation . This raises the question how smaller particles in the size regime from 310 nm, as typically encountered on the anodes of sofcs behave when in contact with a solid electrolyte . Their sintering behavior in different atmospheres is particularly important for catalytic activity and long - term stability . Here we show the results of such a study, whereby the ni nps are first annealed and finally oxidized . We find that ni nanoparticles grow with two very distinct orientations on ysz(111), in contrast to mgo(100). The nio formed during oxidation grows epitaxially with repect to the ni nanoparticles . From the measured particle heights and widths, the energy of adhesion, which is an important quantity with respect to the nanoparticles sintering stability, is determined . The experiments presented in the following were performed at the mpi beamline of the ngstrm - quelle karlsruhe (anka) using an x - ray energy of 10 kev . X - ray data consist of x - ray reflectivity, extensive reciprocal space mapping, and crystal truncation rod (ctr) data . In addition, ex situ atomic force microscopy (afm) measurements were performed in air once the synchrotron experiments had finished . Polished single crystals of 9.5 mol% yttria - doped zirconia with orientation were used as substrate having a surface diameter of 10 mm . Prior to the ni deposition, the substrates were annealed at 673 k in 10 pa o2 for 120 min, a procedure which was found to result in smooth and well - defined surface structures . The ni nps were grown with a substrate temperature of 623 k at a growth rate of 0.2 nm / min resulting in a nominal 3 nm of deposited material . Here, we present results from two such growth runs with different samples, named sample i and sample ii hereafter . For sample i, only the as - prepared nps were structurally characterized, and after the in situ synchrotron experiment, the sample was investigated by atomic force microscopy (afm) in air . In a second experiment on sample ii, the ni nps were further treated, and extensive x - ray characterization was carried out . The as - prepared ni nps were first annealed at 973 k for 75 min, then exposed to 10 pa of methane at 573 k for 30 min and finally oxidized at 10 pa of o2 at 573 k for 35 min . After each of these steps, extensive x - ray data were taken, which allow us to determine changes in the orientation, size, and composition of the nps . Because the methane exposure did not result in any notable structural changes, these data are not included in the present report . In addition, at each of the sample preparation steps, the ysz surface structure was investigated by measuring several ctrs with a nonzero in - plane momentum transfer . These data do not indicate any considerable changes after ni evaporation and after the oxygen treatment . Because these ctrs probe the 3d atomic structure of the ysz(111) surface, which is partly covered by the nps, we conclude that each of these processing steps does not result in any significant atomic relaxations of the substrate . Afm images were taken ex situ after the first growth run of nickel nanoparticles on ysz(111) without further treatments (sample i). Particles are clearly observed, and typical heights of 3 nm can be derived . Just after growth, with the sample still in the uhv chamber, x - ray reflectivity (xrr) measurements were taken (see figure 2 together with the xrr curves from sample ii described more extensively in this paper). The curves of the as - prepared states in both experiments are very similar . Analysis of the xrr data is performed by fitting the electron density profile along the surface normal . Here we use a so - called slab model, based on the fully dynamical parratt formalism . By comparison of the value obtained for the ni nps to that of a closed bulk ni layer, their coverage can be estimated . At the same time, the average height of the ni nps can be obtained from the xrr measurement . This information is contained mostly in the period of the oscillations of the reflectivity . The result from sample i gives an average height of 3.6 nm, in good agreement with afm performed on the same sample when considering that due to tip convolution effects those values will be systematically lower . In contrast to the height determination procedure described in the section nanoparticle shape and adhesion energy, xrr gives a value averaged over all np orientations . (left) afm phase contrast image of the ysz(111) surface after nickel evaporation (sample i). (middle) height profile from the topographic data along the line as indicated (left). X - ray reflectivity vs the momentum transfer along the surface normal qz(= 4 sin() /, with half the scattering angle and the wavelength) measured after nickel evaporation . Shown are the measurements (symbols) and fits (solid lines) for sample i as - prepared (gray) and sample ii as - prepared (black), annealed (blue) and oxidized (red) nps, whereby the curves are scaled for clarity . The oscillations are a clear indication for the presence of the nps . From fitting an electron density profile to the data, the thickness and coverage of the nps are determined and these results are listed in table 1 . Due to coexistence of ni and nio, it is not possible to reliably determine a coverage and merely the total apparent thickness is determined . Once the crystalline ni nps were grown, the positions of their bragg peaks with respect to those of the underlying substrate were used to determine their orientation . In the following, several notations will be used interchangeably, depending on the particular frame that is referred to . Due to conventions in surface diffraction, use is made of the ysz(111) surface unit cell to construct the reciprocal basis vectors of the substrate frame . The direct space axes of this nonprimitive hexagonal cell are a = b = 0.361 nm and c = 0.921 nm . The cell parameters of the conventional cubic lattices of both materials are ani = 0.354 nm and aysz = 0.541 nm . In the remainder of this article, subscripts of (h, k, l) coordinates are used to indicate with respect to which basis they are defined: ysz for the ysz(111) surface unit cell and ni - bul for the conventional fcc ni lattice and ni-111 for the ni(111) hexagonal surface unit cell . Table 2 lists different (h, k, l) values in the different frames . By mapping out reciprocal space in selected areas, we have found two preferred np orientations and at least one other not yet reported for the epitaxial growth of ni nps . The first major one corresponds to the ni (111)-direction parallel to the substrate surface normal . The in - plane directions of the ni lattice were found to align with the substrate surface unit cell directions . This orientational relationship (or) is described by yszni111 and [110]ysz[110]ni111 and will be denoted or1 in the remainder of this paper . The (1,0,l)ni111 bragg peaks are found in a plane (h,0,l) at h= 1.44 (see figure 3), indicating that the ni is completely relaxed and adopts its bulk lattice parameter because this value corresponds exactly to the ratio between the bulk lattice parameters aysz / ani . Two peaks, which belong to -oriented particles as described above, at h = 1.44 but at different l - values are seen, corresponding to the ni - bul (11 1) and ni - bul (002) reflections . These ni peaks indicate that the ni atoms follow an abc - type stacking along the substrate surface normal . If there were only one unique stacking sequence of the ni atoms, only one of these peaks would be visible, because the 3-fold symmetry axis of the fcc ni along its body diagonal would be preserved . Instead, the observation of both peaks indicates that the ni atoms have two different stackings, which results in an apparent 6-fold symmetry axis around the stacking direction, which was also evident from scanning the sample around the surface normal whereby diffraction peaks separated by 60 appeared (not shown). This diffraction feature indicates that the ni nps possess an internal twin structure, that different nps possess different stacking sequences starting from the substrate, or a combination of both of these . From the peak widths along the l direction, it is concluded that internal twinning does not occur frequently because this effect would lead to additional broadening and would result in lower apparent np heights, as explained in more detail in the section nanoparticle shape and adhesion energy . The substrate bragg peak at (1,0,2) and the corresponding ctr along the l - direction . The (1, 0, 1)ni111 and (1, 0, 2)ni111 bragg peaks from (111)-orientated ni nps . At (1.25, 0, 2.53) a peak belonging to (100)-oriented ni nps and at (1.66, 0, 1.86) a peak orignating from internal twinning as described in the text . The peak at (1.02,0,3.28), which is labeled as (0, 0, 3)ni tilt, originates from the tilted nps as described in the text . Table 2 gives an overview of the (h, k, l) coordinates expressed in different frames . The hk projection (inset) shows the substrate (black) and ni (blue) reciprocal lattice vectors . Another strong ni - bul (111) peak is observed at (1,0,3.28), which originates from np which are 41.33 tilted with respect to the (111)-oriented particles . This or2 is described by yszni111r41.33 and [120]ysz[120]ni111, where r indicates a rotation . The full 3d information is confirmed by the observation of a (2,2,0)ni bul reflection, belonging to or2 and which is rotated by 34.4 from the substrate surface plane . The angular position of this reflection is obtained by rotating the (0,2, 2)ni bul of or1, which makes an angle of 30 with the plane of the rsm shown in figure 3, around the [120]ysz direction by 41.33. the atomic - scale arrangement, schematically depicted as a side view along the rotation axis, is shown in figure 4 . The orientation can be understood from a so - called coherent tilt strain - relieving mechanism, which is rather common in thin film heteroepitaxy . For fcc metals, this epitaxial relationship originates from the diffusion of dislocations along (111) slip planes . The resulting edge dislocations line up laterally at the hetero interface, thereby reducing the strain and tilting the metal lattice . The energetics of this mechanism competes with other types of strain relaxation and can be kinetically hindered by dislocation movement . Therefore, depending on the growth technique in combination with temperature, which determines the supersaturation and surface diffusion, different orientations are expected . Nanoparticles as investigated here, would actually form the very early growth stage of textured polycrystalline thin films . The np nickel lattice is tilted such that the projection of (111) planes fits much better to the substrate atomic distance of 0.314 nm along this direction and therefore accommodates strain . The particular arrangement originates from an interfacial strain driven slip mechanism, which is common in fcc metals . By the diffusion of dislocations along the (111) slip planes toward the interface, the projected d - spacings have a better match with the substrate thereby relieving strain . As a consequence, figure 3 also shows much weaker peaks at (1.25,0,2.53) and (1.66,0,1.86), which are ascribed to (100)-oriented nps and from internal twinning around the ni 111-direction pointing toward a side facet, respectively . Because these orientations represent only a fraction of all the nps, as judged from the much weaker diffracted bragg intensities, these are left out of further consideration . The or1 found here has been reported before for a variety of different growth methods of ni on ysz(111), like pulsed laser deposition and mbe . Because this or results from a simple cube - on - cube stacking and most likely is energetically favorable, it has also been found for the ni - ysz(100) interface grown by directional solidification . These studies also report on other ors, but not on the or2 found by our x - ray diffraction study . Interestingly, from the geometrical analysis of coincident lattice points, sasaki et al . Find that the best match would be formed by yszni bulk and yszni bulk, an or that has experimentally never been verified, also not in this study . This point illustrates that ni - ysz lattice - matching alone is not enough to describe the different ors and that other energy terms such as chemical bonding and dislocation formation and their kinetic interplay during growth play a potentially more important role . Moreover, it has been shown previously that the ysz(111) possesses a surface morphology with 2d monolayer high islands, which is expected to play a role in the np binding . The average size of the nps can be determined from the widths of their corresponding bragg peaks, under the assumption that the line broadening can be mostly attributed to their finite size and that nonuniform strain plays a minor role . The experimentally observed diffraction peaks are further broadened by the instrument resolution, which in the case here is anisotropic due to the synchrotron radiation characteristics in combination with the beamline focusing optics . From the single - crystal substrate bragg peaks the in- and out - of - plane instrument resolution is determined . Because our sample coordinate system is chosen such that the hk - plane lies horizontal and the l - direction is vertical, the instrument resolution can be described by (h, k,l) = (0.025,0.060), expressed in dimensionless reciprocal lattice units . All the experimentally determined diffraction peaks were well described by gaussians, so that the peak breadths are corrected for the instrumental resolution by = exp2res2 . The average height of the nps is given by the following reciprocal relationship:1where c = 0.890 nm is the direct lattice parameter of the ysz(111) surface unit cell and l the peak width (fwhm) along the l - direction corrected for the instrument resolution . A similar expression holds for the determination of the average widths (w), for which the peak profile along the h - direction must be considered together with the fact that the h - direction makes an angle of 30 with the real space atomic layers within the hexagonal surface unit cell . The np heights and widths have been determined after each of the treatments, and the resulting values are presented in table 3 . The errors that are listed are calculated from the spread in values obtained from several bragg peaks at different positions in reciprocal space . In a next step, the average sizes are used together with wulff s construction to deduce the nps equilibrium shape when in contact with a foreign substrate . The underlying principle is that the nps are faceted and that those facets with the lowest surface energy will have the largest surface area . This aspect is now combined with the geometrical constraint that the nickel nps are supported by the ysz substrate . It is important to note that the description of the nps shape used in the following is valid for isolated particles (i.e., in the absence of particle particle interaction). From the afm measurement, shown in figure 1, it can be concluded that coalescence may have set in for certain particles / areas but probably not for all . A more detailed analysis is hampered by the inherent lateral resolution of the used afm . Nevertheless, the sample used for this study is probably not far off a model system with completely isolated nps . For fcc metals like ni, the wulff shape (i.e., without support) is given by a polyhedron with predominantly (111)-oriented hexagonal facets together with smaller square (100) facets . This basic shape is taken as a starting point to construct the shape when in contact with a substrate . Using the dimensions and orientation with respect to the substrate, the wulff shape has to be cut at particular positions . For the (111)-oriented particles, the wulff shape is shown in the upper part of figure 5a). The width of 8 nm and height of 5 nm, as determined previously, require a truncation of the wulff - shape, as shown in the lower part of figure 5a). The resulting shape of the (111)-oriented nps is then given by a large (111)-oriented top facet, six (111)-oriented side facets and three (100)-oriented side facets . The shape of the tilted nps is determined by rotating the wulff - shape by 41.3 in order to comply with the experimentally determined orientation . Then this tilted particle is truncated at the experimentally determined height, see figure 5b). (a) wulff shape for the unsupported (111)-oriented np (top) and when supported by the ysz substrate (bottom). The different treatments did not significantly change the nps shapes, although the heights and widths did change, as described in the text and seen in table 3 . The energy of adhesion for relatively round supported nps (i.e., which are not very flat and at least half as high as the wulff - constructed free particle) is given by2with h the height of the np and h * the height of the buried part . It seems a reasonable approximation to relate the experimentally determined heights and widths to the geometric lengths of eq 2 as w = h + h*. Taking a value of 111 = 1.89 jm, this gives wadh = 1.4 jm for the (111)-oriented ni nps after annealing . (note: these surface - energy values were checked and recalculated with density functional theory (dft) using the latest perdew burke enzerhof (pbe) potential, which does not suffer too much from overbinding .) Because the error bar on the widths is relatively large, the criterion for using eq 2 might not hold anymore and they could actually be much flatter, in which case the following relation holds:3 this relation gives, together with 100 = 2.2 j / m (see parenthetical note above), wadh = 2.1 j / m . The adhesion energy value obtained from eq 2 is somehwat smaller than typical values obtained for other materials systems, such as ptrh - al2o3 and pd al2o3 . The value obtained using eq 3 is much closer to those values and is in very good agreement with the value obtained for much larger (w = 200 nm, h = 150 nm) ni particles . For the tilted nps, a higher h / w ratio is observed, pointing to a reduced adhesion energy . The occurrence of two distinct np growth directions can be related to a difference in interfacial binding which either could originate from a lateral chemical inhomogeneity of the ysz substrate or a kinetically trapped state . Also a size dependence cannot be ruled out which is difficult to investigate due to the inherent size distribution of the nps after growth via thermal deposition . At a temperature of 573 k, the nps were exposed to molecular oxygen at a pressure of 10 pa for approximately 35 min, after which the oxygen was pumped off again . Figure 6 shows a reciprocal space map after oxidation from the same plane as that shown in figure 3 . Clearly observable are two new bragg peaks along the l - direction at h = 1.24, which originate from nio . From the position of these two peaks with respect to the nearby bragg peaks of the ni -oriented nps the average heights and widths of the -oriented and tilted nps after oxidation are listed in table 3 . Additionally, the temporal evolution during oxidation of some structural parameters were followed as well, see figure 7 . The integrated bragg peak intensity, which is proportional to the amount of pure metal, is seen in the decay below half of its initial value, which means that about 65% of the ni contained by the -oriented nps transforms into nio . At the same time, the average height of the -oriented nps changes only by approximately 0.2 nm, which is equal to the estimated error, see table 3 . Nevertheless, the data do indicate a trend, whereby the average height of the pure metal (core) is reduced . The particular bragg reflection that was followed during oxidation gives an average height somewhat smaller than the value obtained from other bragg reflections and therefore is not identical to the values listed in table 3 . The position of the bragg peak along l can be used to determine changes in the uniform strain of the nps ni (111)-planes along the substrate surface normal . By comparing its shift from its initial value, which relates to d0, the relative strain state d / d0 is calculated . It is seen in figure 7 that as oxidation proceeds, the lattice expands along the surface normal and levels off after an approximately 0.5% increase, a value very close to that found during thin ni film oxidation . We argue that this can be attributed to oxygen incorporation into the ni lattice . From the trend in the intensity curve, it is concluded that the oxidation process had not yet finished, although the lattice did not expand anymore, which indicates that the oxygen dissolution has reached a final state . L plane after oxidation at 573 k and 10 pa of molecular oxygen for 35 min . Kinetics of the 111-oriented ni np evolution during oxidation . Shown are the average height (top), relative 111 bragg peak intensity (middle) and relative strain d / d0 (bottom) as a function of oxidation time . In order to rationalize the obtained results, we postulate the following oxidation mechanism . One important ingredient is that small nps oxidize relatively faster than large ones; their so - called burn - up time is even lower than expected from the oxidation rate of planar surfaces, because the geometry of the electric field around these often more - rounded particles is predicted to accelerate the oxidation process . Larger nps will first form an oxide skin around them, and eventually, they also burn up completely, but with a much lower rate . Schematically, an intermediate state of this scenario is depicted in figure 8a, which represents the situation after the oxidation step presented here . Given a certain particle size distribution, the resulting bragg peak shape figure 8 shows the results for such a calculation, using a hypothetical gaussian width distribution, around an average of 8 nm and a standard deviation of ann = 3 nm . Gaussian - shaped diffraction peaks corresponding to each of the np size represented in the distribution are used in the calculation . A cutoff value around 5.5 nm is used, below which the nickel nps are completely oxidized . From the resulting ni and nio therefore, the width of a nio np, which has formed from a metal ni particle, is larger by a factor of 1.19, which reflects the ratio of their lattice parameters . Metal ni . In this particular numerical example, the average ni np width before oxidation is 8 nm, whereas after oxidation, both ni and nio widths are 9 nm . Although this numerical simulation certainly does not include all the details of the oxidation process, it does show how the average np sizes can in principle be affected by a preferential oxidation of small particles and how this can lead to average np widths that are larger after oxidation . The simulation presented here does not differentiate between partially and completely oxidized particles, although the experimental results point toward such a situation . This is mostly seen in the large anisotropy between the oxidation of the nps top 111 facet and the average widths . Both xrr and high - angle bragg peaks indicate that upon oxidation, the average height of the metal ni nps is slightly reduced, at most by 0.2 nm . It has been observed that during the oxidation of a ni(111) single - crystal surface under identical conditions as used in this work, a nio skin of approximately 2 nm forms after approximately 14 h. therefore, it seems reasonable to assume that for the oxidation time investigated here, at most, only one single outermost layer of ni atoms, which constitute the top facets, form an ultrathin nickel oxide . The oxidation process at the other facets, like 100, seems to proceed much faster and even leads to complete oxidation of nickel nps . (a) small nps oxidize comparatively faster and burn up completely, whereas at the same time, an oxide skin has formed on larger nps and the core is still metallic . The evolution of the diffraction peaks is simulated using np width distributions during this partial oxidation process . (b) np width distributions before and after oxidation: initial metallic ni nps (black line) with an average of 8 nm and a spread of = 3 nm . After oxidation, the width distribution of the metallic core of the partially oxidized particles has become asymmetric and peaks at around 9 nm (filled white). The width distribution of the oxidized metallic ni (red) is shifted due to the lattice expansion and is used to calculate the expected nio bragg peaks, see text for more explanation . (c) bragg peaks calculated as weighted averages using the gaussian width distributions . Shown are the initial ni peak (black), the final ni peak (red), and the newly formed nio peak (filled red). From the diffraction lines, average widths of 8, 9, and 9 nm for the initial ni, final ni, and nio particles are found, respectively . The oxidation behavior of the nps belonging to or2 has not been followed in situ, but the overall changes in height and width, as listed in table 3, are very similar to those of or1 . The intensity loss on the metal ni bragg peaks is about 50%, very similar to that of the peaks belonging to or1 . We therefore conclude that the fact that the particles belonging to or1 have different facets exposed to the gas phase leads to minor changes in oxidation behavior and the stability of the particles is not much different . Nickel nps were grown in uhv by pvd using an electron beam evaporator with a nominal average height of approximately 4 nm at substrate temperatures of 623 k. x - ray diffraction revealed that two distinct np orientations form; there is no random orientational growth which would give rise to powderlike diffraction patterns . The np orientations are or1: ni (111) planes parallel to the surface whereby the in - plane directions are also aligned (niysz and ni[1 10]ysz[1 10]) and or2: ni 111 planes tilted by 41.33 from the substrate normal in the plane spanned by ysz and ysz[1 10]. The average heights and widths of the nps were determined from the x - ray diffraction line breadths . The relatively well - defined height is furthermore extracted from x - ray reflectivity and afm in a separate growth run, which all give systematically comparable values . The average heights and width of nps in both ors increase by approximately 25%, indicating that the particles exhibited already equilibrium shape at the growth temperature . From the height - to - width (h - to - w) ratio, together with the ni (111) and (100) surface energies, the adhesion energy is determined . Depending on the np shape being more round or flat, two different relations hold . Because the nps average aspect ratio h / w is close to, either of the relationships might give representative values . This is even more likely when taking into acount the appreciable size distribution, which is more broad in w than in h. the more rounded nps will then have an adhesion energy of 1.4 j / m and the flatter ones 2.2 j / m . This adhesion energy calculation does not hold for the tilted nps forming or2 because of their asymmetric shape . When exposing the nps to methane at a pressure of 10 pa and a temperature of 573 k for 30 min, no changes are observed . A possible adsorption of the hydrocarbons on the nps is thus concluded not to affect the structure of the nps . The most distinct changes are caused by an oxygen treatment at 10 pa and 573 k for 35 min . The intensity of the or1 bragg reflections, which is a measure for the total amount of metal, decreases to less than half its initial value . After the oxidation step, nio bragg reflections are detected, and from their positions in reciprocal space, it is deduced that nio has grown epitaxially, in a cube - on - cube fashion, on the nps from or1 or in contact with the ysz (111) surface . At the same time, the average height has changed by 0.2 0.3 nm and the average width + 1 3 nm . The average size of the nio is approximately equal to that of the remaining pure metal particles . These results can be rationalized by considering a preferential oxidation mechanism in combination with an anisotropic size distribution, whereby the spread in h is much narrower than that in w. it has been predicted that small, more rounded, nps will oxidize at an enhanced rate compared to larger ones . On the basis of these and our experimental results, we postulate that ni nps smaller than approximately 5.5 nm have burnt up completely and that larger ones have a nio skin formed around them . A simulation, using a hypothetical gaussian width distribution, shows that indeed this scenario can explain the experimentally observed average widths before and after oxidation . This description does not include all the details of the oxidation process, such as exact oxidation rate and nio thickness on the different facets, and even assumes that part of the larger nps does not oxidize at all, which is not very realistic . Nevertheless, it shows numerically the effect one important aspect of the mechanism, namely, size - dependence, can have on the final average size . The size - dependent oxidation behavior might also be related to the kink seen after approximately 3 min in the time - dependent intensity reduction of the 111 bragg peak of figure 7 . The average size of the nio particles and/or skin is of the same order of magnitude as the remaining pure ni metal (cores) because of two effects: (1) due to the lattice expansion after oxidation (i.e., nio has larger lattice constants than ni), a completely oxidized np will be larger than the original one . This effect shifts the average oxidized np size to higher values, thereby compensating for the fact that the smaller metal particles have prefentially oxidized . (2) the oxide skin on the top facet is formed by a completely structurally correlated nio lattice . Therefore, the in - plane nio size will be comparable to the underying metal particle . From ni(111) single - crystal oxidation studies, it was found that an approximately 2 nm oxide forms after 14 h at conditions similar to the ones here . Extrapolating to the oxidation time used here, it would be expected to have oxidized only a monolayer from the 111 facets, which is about 0.2 nm thin . This value corresponds very well to the reduction in the average height of the (111)-oriented nps upon oxidation and would imply that the oxidation proceeds mostly along the (100) facets . The results obtained here can be discussed in relation to real sofcs, in particular with respect to the so - called redox cycling (i.e., the oxidation reduction process of ni). During sofc operation, the anode is continuously supplied with fuel, the amount of which is burnt depends on the availability of oxygen . Instabilities around the ideal ratio of fuel and oxygen levels can lead to the formation of nio, which is known to lower the sofc performance and lifetime by stress development, lowering of the metal triple phase boundary density, and mechanical failure . Our results may add another cause to sofc anode failure, namely, that during the time when there exists a surplus of oxygen, probably the smallest ni nps will completely oxidize and, depending on the reducing properties of the fuel, might not revert to pure metal anymore . After many cycles of such a process, the sofc might gradually loose its efficiency because the smallest particles are most likely to be the most reactive and therefore relatively more important for the functionality . Moreover, such a preferential oxidation process, whereby the particle size distribution shifts toward larger values, might result in the sofc operation to drift away from complete reaction leaving unburnt fuel and increasing oxygen levels thereby oxidizing ever more ni . X - ray diffraction revealed two distinct orientations of ni nanoparticles grown in uhv by mbe: -oriented particles and ones with their planes tilted by 41.33 from the surface normal . A combination of diffraction line width analysis, x - ray reflectivity, and afm delivered information on the average np height and width . These sizes were used to determine the energy of adhesion to be in the range of 1.42.2 jm, whereby particles that have a more round shape are more weakly bound than those that have a flatter geometry . Annealing the nps in uhv to 923 k led to the observation of sintering: most significantly, their average height increased and the data also indicate an increase in average width . This sinterering process does not lead to a significant shape change from just after growth . Exposure to methane at 10 pa at a temperature of 573 k did not show any structural changes . However, oxidation at 10 pa of o2 at the same temperature led to the formation of expitaxial nio on the -oriented particles . An oxidation mechanism is postulated, which is based on a preferentially faster burn up rate for small particles and the formation of an oxide skin around larger ones . Such a preferential oxidation mechanism which shifts the np size distribution toward higher values might be one factor responsible for the long - term degradation of sofcs.

The existence of different crystalline forms (polymorphs, hydrates, and solvates) represents one of the most challenging phenomena in solid - state chemistry and related sciences, since we are still not able to predict the number of practically relevant forms and the conditions under which these can be grown or exist . The existence of different solid - state forms of a compound is important as these usually show different physical properties, for example, solubility, density, hardness, melting point, etc . This is true for pharmaceuticals (the majority of the active ingredients are used in a crystalline form(2)), because the solid - state form can profoundly influence the manufacturing process, the long - term stability, and the performance of drug products, and for many other materials used in the chemical industry (plant protection substances, dyes, explosives, etc . ). The present study deals with the solid - state of -resorcylic acid (2,4-dihydroxybenzoic acid, ra, figure 1), a small organic molecule exhibiting molecular flexibility and the ability to form different hydrogen bonding motifs . The compound is used as a starting material for the production of dyestuffs, pharmaceuticals, cosmetic preparations, and fine organic chemicals . The cambridge structural database (csd)(5) contains entries for three ra solid - state forms, namely two anhydrates (zzzeeu:(6)p1, z = 2 and zzzeeu01 to zzzeeu04:(7)p21/n, z = 1, measured at 90, 100, 110, and 150 k), and a hemihydrate (qivtuk:(8)p1, z = 1). For the triclinic anhydrate, only the lattice dimensions have been reported, and the volume of zzzeeu corresponds to a monohydrate rather than an anhydrous form(9) but not to the new monohydrate described in this work . For the monoclinic polymorph (form ii hereafter), the temperature range has been extended very recently down to 20 k.(10) furthermore, different hydrate stoichiometries, ranging from 0.5 to 3 mol water per mol of acid can be found in literature reports, but only the crystal structure of the hemihydrate has been determined . A recent study comparing six isomeric dihydroxybenzoic acids failed to crystallize new polymorphs by melt crystallization and sublimation experiments. (12) joint experimental and computational studies have shown that there is no cooperative hydrogen atom disorder in the cooh and o - oh groups in form ii at temperatures up to 150 k. however, ra was neither subjected to a systematic solution crystallization screen nor to a comprehensive solid - state characterization program, and also theoretical predictions of possible crystal structures have not been reported so far . Global (conf_p1) and second lowest conformational minima (conf_p2) of -resorcylic acid (ra). The intramolecular degrees of freedom (dihedral angles) that were optimized within the crystal energy minimizations are indicated with arrows: 1: c6c1c7o2, 2: c3c2o3h, 3: c5c4o4h and 4: c1c7o1h . Therefore, our investigation aimed at an efficient screening program, using an experimental and computational(16) approach to complement and validate the results and comprehensively characterize all ra solid - state forms at ambient conditions . The experimental screen was based on manual solution crystallizations of the compound in a variety of solvents and crystallization conditions, sublimation and moisture sorption experiments . The thermodynamic and kinetic stability of the solid - state forms were ascertained by hot - stage microscopy, differential scanning calorimetry, thermogravimetic analysis, and solvent - mediated transformation studies . Vibrational spectroscopy (mid infrared and raman) and x - ray diffractometry (powder and single crystal) were employed to determine the structural features of the phases . However, as neither high - throughput methodologies or other widely applied screening strategies(19) guarantee all possible forms will be found, we supported and complemented our manual screen with computational crystal structure prediction (csp). By contrasting the thermodynamically feasible crystal structures with the experimentally observed ones, we discuss the factors that control crystallization and polymorphism of ra . Ra was purchased from fluka (form ii). For the solvent screens, a set of 25 solvents was chosen (supporting information, section 1.1), which were all of analytical quality . Crystallization conditions included solvent evaporation, fast and slow cooling crystallization, precipitation with a miscible antisolvent, vapor diffusion, and solvent - mediated transformation . In total, more than 150 manual crystallization experiments were performed (conditions and crystallization outcomes are provided in the supporting information, tables s1s5). We have named the polymorphs according to the kofler notation using roman numerals in the order of the melting points (i.e., the highest melting is named form i) and flagged the thermodynamically stable form at room temperature with the symbol . Form ii was either prepared by slow crystallization from numerous solvents, including n - butanol, n - propanol, i - propanol, acetonitrile, ethyl methyl ketone, ethyl acetate, or by solvent - mediated transformation of any ra form, using water - free solvents that did not form a solvate . Form i could be obtained from solvent crystallization, but it predominantly grew concomitantly with form ii. The easiest way to produce form i was heating any ra form above the transition temperature of the polymorphic transition ii i (150170 c). However, decomposition, although slow compared to the polymorphic transformation, starts at ca . Other methods included sublimation experiments in the same temperature range or the desolvation of the hemihydrate (hh), dimethyl formamide hemisolvate (sdmf - i), dimethyl sulfoxide hemisolvate (sdmso), or dioxane hemisolvate (sdx) at temperatures above 60 c . The two hydrates could be prepared by crystallization from a hot, saturated water solution, with the resulting solid form depending on the cooling rate . Fast crystallization to the final temperature of 0 c (in ice) led to the monohydrate (mh), whereas slow cooling (test tube wrapped in aluminum foil) produced the hemihydrate (hh). The dioxane hemisolvate (sdx), dimethyl formamide 0.75-solvate (sdmf - ii), and the dimethylsulfoxide hemisolvate (sdmso) were prepared from ii by solvent - mediated transformation experiments in the respective solvent, the acetic acid monosolvate (saa) by fast crystallization (cooling a hot saturated solution in acetic acid to ca . 8 c). Finally, the dimethyl formamide hemisolvate (sdmf - i) was obtained as an intermediate desolvation product of the sdmf - ii solvate . Every crystallization or solvent - assisted grinding experiment with pyridine resulted in the formation of the pyridinium salt. (22) for hot - stage thermomicroscopic (htm) investigations a reichert thermovar polarization microscope equipped with a kofler hot stage (reichert, a) was used . Photographs were taken with a digital camera (olympus colorview iiiu digital camera, d). Dsc was performed with a dsc 7 (perkin - elmer, norwalk, ct, usa) using the pyris 2.0 software . Approximately 13 0.0005 mg sample (um3 ultramicrobalance, mettler, ch) was weighed into al - pans (25 l). Dry nitrogen was used as the purge gas (purge: 20 ml min). The instrument was calibrated for temperature with pure benzophenone (mp 48.0 c) and caffeine (mp 236.2 c), and the energy calibration was performed with pure indium (purity 99.999%, mp 156.6 c, heat of fusion 28.45 j g). Tga was carried out with a tga7 system (perkin - elmer, usa) using the pyris 2.0 software . Two - point calibration of the temperature was performed with ferromagnetic materials (alumel and ni, curie - point standards, perkin - elmer). Heating rates ranging from 10 to 20 k min were applied, and dry nitrogen was used as a purge gas (sample purge: 20 ml min, balance purge: 40 ml min). The stated error limits of thermochemical data are calculated as confidence intervals at a 95% level . Isothermal (25 0.1 c) moisture sorption isotherms were acquired using a sps-11 moisture sorption analyzer (projekt messtechnik, d). The samples were gently ground prior to measurement to exclude the influence of particle size and surface area . Sorption and desorption cycles covered the 1090% rh range in 10% steps and the 010% range in 5% steps . The equilibrium condition for each step was set to a mass constancy of 0.001% over 35 min . Spectra were recorded with a bruker (bruker optic gmbh, d) ifs 25 spectrometer connected to a bruker ir microscope i (15-cassegrain - objective, spectral range 4000 to 600 cm, resolution 4 cm, 64 scans per spectrum). The samples (rolled on a znse disk or fused between two znse windows) were measured in transmission mode . Spectra were recorded with a bruker rfs 100 raman - spectrometer (bruker analytische messtechnik gmbh, d), equipped with a nd: yag laser (1064 nm) as the excitation source and a liquid - nitrogen - cooled, high sensitivity ge - detector . The spectra (128 scans per spectrum) were recorded in aluminum sample holders with a laser power of 200 mw and a resolution of 2 cm . Experiments were performed on an oxford diffraction gemini r ultra (4-circle kappa - goniometer, 135 mm ruby ccd detector, mok radiation, monocapillary collimator) with an oxford cryosystems 700 series cryostream plus low temperature attachment . The single crystal structures of hh, sdmso, and the pyridinium salt were solved by direct methods using the program package wingx(23) (sir2004(24) and shelxl97(25)). All hydrogen atoms bonded to carbon atoms were generated by a riding model on idealized geometries with uiso(h) = 1.2 ueq(c). The polar hydrogens were identified from the difference map and refined isotropically, with the exception of h9 in sdmso, where the position was refined with a constrained oh bond distance . For further details, pxrd was used to determine the structure of form i. the sample was loaded in a rotating 1.0 mm borosilicate glass capillary and mounted on a bruker axs d8 powder x - ray diffractometer equipped with primary monochromator (cuk1, l = 1.54056) and lynxeye position sensitive detector . Data was collected at room temperature using a variable count time scheme (supporting information, table s6). The diffraction pattern indexed to a monoclinic unit cell (omitting an impurity peak at 20.8 2 arising from a suspected decomposition product) and the space group was determined to be p21/a based on a statistical assessment of systematic absences,(26) as implemented in the dash structure solution package. (27) the data were background subtracted and truncated to 50.5 2 for pawley fitting(28) (pawley = 15.91). Simulated annealing was used to optimize the form i model against the diffraction data set (115 reflections) in direct space . The internal coordinate (z - matrix) description was derived from the hf/6 - 31g(d, p) gas phase global conformational minimum (conf_p1), with oh distances normalized to 0.9 and ch distances to 0.95 . The structure was solved using 200 simulated annealing runs of 2.5 10 moves per run as implemented in dash, allowing 7 degrees of freedom (6 external and 1 internal). 4.66 (profile / pawley) and was used as the starting point for a rigid body rietveld refinement(29) in topas v4.1. (30) the rigid body description was derived from the z - matrix used in the simulated annealing runs and the final refinement included a total of 61 parameters (40 profile, 4 cell, 1 scale, 1 uiso, 9 preferred orientation, 3 position, and 3 rotation) yielding a final rwp = 5.53 (figure 2). Powder x - ray diffraction pattern and rietveld fit (rigid body) of ra form i at 25 c . We considered all eight planar hf/6 - 31g(d, p) conformational minima produced by varying the torsion angles 1 3 (figure 1) in the csp searches for anhydrate crystal structures, using a three - stage methodology. (31) first, z = 1 and z = 2 crystal structures were generated using crystalpredictor(32) in 25 common space groups for organic molecules . The molecules were held rigid and the lattice energy was evaluated by an exp-6 potential with atomic charges derived using the chelpg scheme(33) and minimized . All crystallographically distinct low energy crystal structures were used as starting points for optimizing the intermolecular lattice energy (uinter), with an improved model for the intermolecular forces . This was calculated using the fitexp-6 potential parameters and the distributed multipoles(37) derived from the pbe0/aug - cc - pvtz charge density using gdma2. (38) finally the 28 most stable structures were refined with crystaloptimizer(39) to allow small changes in conformation (torsion angles 1 4 in figure 1) by minimizing the lattice energy, elatt = uinter + eintra, where eintra is the conformational energy penalty (with respect to the global conformational minimum) paid to improve the intermolecular interactions . The conformational energy penalty was computed at the pbe0/6 - 31g(d, p) level . All isolated - molecule wave function calculations were performed using gaussian03(40) and intermolecular lattice energies by dmacrys. (41) more details of the conformational analysis, model testing, and search procedure and results are given in supporting information . The solvent screening program resulted in a new ra polymorph (form i), a new monohydrate (mh), and five new solvates, namely acetic acid (saa), dioxane (sdx), dmso (sdmso), and two dmf solvates (sdmf - i and sdmf - ii). The previously described anhydrous form (form ii)(7) and the hemihydrate (hh)(8) could be reproduced . The relationships between the ra solid state forms (figure 3) and their structures are described in experimental section 3.1, and their relationship to the computed possible structures are described in section 3.2 . Transition pathways of the ra forms at different temperatures and relative humidities (rh); mh: monohydrate, hh: hemihydrate, i: form i, ii: form ii, saa: acetic acid monosolvate, sdmf - ii (0.75) and sdmf - i (hemi): dimethyl formamide solvates, sdmso: dimethyl sulfoxide hemisolvate and sdx: dioxane hemisolvate, t: heating, *: removing from the mother liquor, mechanical treatment, for example, grinding form ii occurs in solvent crystallization / evaporation experiments as long needles, whereas form i occurs as a polycrystalline powder comprising multilayered plates . Htm and dsc experiments revealed that form ii transforms to form i upon heating at temperatures above 150 c . Optically this transformation can be recognized by a darkening of the form ii needles due to cleavage and the formation of small aggregates of form i (figure 4). Tga experiments and further thermomicroscopic investigations (silicon oil embedding) showed that no desolvation process is involved in this process, confirming that the reaction is a single component (polymorphic) transition . The weak endotherm in the dsc curve (figure 4) at an experimental transition temperature (ttrs, exp) of 159.8 0.5 c corresponds to the solidsolid transformation ii i with a transition enthalpy of trsh = 2.1 0.1 kj mol . From the fact that the transition is endothermic, it can be concluded that the two polymorphs are enantiotropically related (heat of transition rule). This implies that the melting point of form ii is lower than that of form i, which melts at 231 c with decomposition (second endotherm in dsc curve of figure 4, overlapping with a broader endotherm, indicating the decomposition process). Form ii is thus the thermodynamically stable polymorph at room temperature (rt) and form i represents the high temperature form, which nevertheless shows a high kinetic stability at rt . A reversible transformation i ii was only observed if the sample was mechanically treated (e.g., grinding at room temperature). The fact that form ii is thermodynamically stable at 20 c was also confirmed with solvent - mediated transformation experiments . The energy - temperature diagram of the two polymorphs derived from the thermoanalytical data is provided in supporting information (figure s2). Hot - stage microscopy photographs of the ra form ii to form i transformation, along with the dsc curve that shows the transformation (ii i), melting (mp), and decomposition (dec .) Of form i (heating rate: 10 k min). The hh forms transparent blocklike crystals (figure 5), which are stable when removed from the aqueous mother liquor . Single crystals of hh turn opaque when heated above 70 c, while the original shape of the crystals is more or less maintained (pseudomorphosis). In silicon oil preparations, the release of bubbles accompanies the darkening of the crystals and confirms the desolvation process (see figure s1, supporting information). The mass loss of 5.55% (tga, figure 6) is consistent with the theoretical water content of a hemihydrate (5.52%). The second hydrate (monohydrate, mh) crystallizes as needles and was found to be very unstable at ambient conditions . Tga shows (figure 6) that the dehydration of mh occurs below 60 c resulting in form ii. A transformation of mh to hh can only be observed in a water slurry . The measured mass loss (figure 6) of ca . 9.5% corresponds to 0.9 mol water per acid molecule, which is slightly lower than expected for a monohydrate (theory: 10.47%) due to some loss of water during the preparation of the unstable mh . Photomicrographs (dry preparation) showing the dehydration process of ra hh to form i in a htm experiment (heating rate ca . All five solvates form transparent, thin, needle- or plate - like crystals losing their transparency within hours when removed from the mother liquor . Upon heating (figure 6), desolvation of saa occurs in one step between about 40 and 60 c resulting in needle - shaped form ii crystals . Sdmf - ii shows two desolvation steps under heating . The first desolvation process (figure 6, mass loss ca . 50 and 70 c and corresponds to the transformation of the 0.75-solvate (sdmf - ii) to the hemisolvate (sdmf - i), which then desolvates at ca . 90 c to form i. sdmso shows a peritectic melting / decomposition at 90 c . Upon further holding the temperature, long plates (form i) slowly crystallize from the melt (observed in htm, not visible in shown dsc curve). It was not possible to clearly determine the stoichiometric solvent content from tga experiments, as the desolvation and decomposition process overlaps . However, the course of the first step of the curve shows that the desolvation process decelerates before the fast decomposition process starts at about 150 c, indicating that the majority of the solvent is released . We can extrapolate the end of the first step to about 80%, suggesting that sdmso is a hemisolvate (theoretical mass loss: 20.2%) sdx shows an inhomogeneous melting process consisting of the following events: peritectic melting / decomposition, evaporation of the solvent (dsc: endotherm at ca . 85 c), and the crystallization of form i (exotherm above 110 c). Dsc (black) and tga (red) curves of ra hydrates and solvates (pin - holed dsc capsules and a heating rate of 10 k min was used for all thermograms). Forms i, ii, and hh were subjected to a gravimetric moisture sorption study at 25 c (figure 7). The anhydrous phases absorb water and transform only to hh even at the highest rh value (90%). The moisture sorption cycle of form i was completed within 48 h, whereas only ca . Hh dehydrates only under rather dry conditions (5% rh and below) demonstrating its high stability . Under these conditions, the profile of the moisture sorptiondesorption isotherm (sharp steps, strong hysteresis between sorption and desorption) is a very clear indication that hh is a stoichiometric hydrate. (44) from the huge hysteresis, we can deduce that the anhydrates and hh can be handled and stored as stable phases provided extremely low or high moisture conditions are avoided . Moisture sorption isotherm of ra performed at 25 c showing a moisture sorption cycle of anhydrous ra to hh and a desorption cycle of hh to a polymorphic mixture of forms i and ii . The ft - ir spectra (figure 8) allow an unambiguous identification of all forms, as variations were found in numerous regions, for example, (oh), (carh), (c = o), and (coh) vibrations . The most striking difference in the ir spectra of the two polymorphs concerns the (oh) vibration of the p - oh group . In form ii a sharp band occurs at 3373 cm, whereas in form i the band is broader and shifted to higher wavenumber (3432 cm) implying weaker and more complex hydrogen bonding . Saa exhibits additional bands in the range of 970880 cm due to the out of plane oho hydrogen deformations(45) (most intensive band: 920 cm). The two dmf solvates showed two distinct vibrations at 1107 and 10941095 cm, whereas all other phases exhibit only one or three bands in this region . On the basis of the (c = o) vibrations, the dmf solvates can be discriminated, with sdmf - ii at 1666 cm and sdmf - i at 1652 cm . The (s = o) vibrations(46) in sdmso occur at 1002 cm (strong band). Finally, the symmetric stretch vibrations of the ether group in sdx can be found at 865 cm . Ft - ir spectra of ra polymorphs (i, ii), hydrates (hh, mh), and solvates (saa, sdmf - ii, sdmf - i, sdmso, and sdx). Ft - raman spectroscopy (figure 9) also allows the identification of the different ra solid - state forms . The presence of the solvent molecules (acetic acid, dmf, dmso, and dioxane) can be clearly seen in the spectral range around 2900 cm (stretching vibrations of the aliphatic ch3 and ch2 groups, only present in the solvent molecules). Moreover, the lattice phonon vibrations below 150 cm differ markedly, indicating that the crystal structures of the ra solid - state forms are different and also that the solvates are not obviously isostructural as frequently observed if compounds form a series of such adducts . Ft - raman spectra of ra polymorphs (i, ii), hydrates (hh, mh), and solvates (saa, sdmf - ii, sdmf - i, sdmso, and sdx). The clear differences in pxrd patterns from each phase studied are consistent with the very distinct structures for all ra solid - state forms (supporting information, figure s3 and table s6). Temperature- and humidity - controlled powder x - ray diffraction studies of the dehydration process (supporting information, figures s4 and s5) confirmed the results presented in sections 3.1.2 and 3.1.5 . Form i crystallizes in the monoclinic space group p21/a (z = 1) and form ii in p21/n (z = 1), both adopting a conformation similar to conf_p1 (figure 1). The two polymorphs form inversion related r22(8) dimers and furthermore share the same 1d arrangement (supramolecular construct(49)) of inversion related dimeric units (figure 10a, c) however, they differ in the way the 1d constructs are linked to neighboring units, the o4ho3 hydrogen bonds, and consequently in the packing . In form ii, the o4ho3 interaction exhibits n glide symmetry (figure 10b), leading to puckered hydrogen - bonded sheets (figure 10a) and to a dihedral angle between the 1d constructs (benzene rings) of 31. in form i, where 21 symmetry is present a dihedral angle between the benzene rings of 82 is observed . Hirshfeld dnorm surface(50) plots (figure 10e, f) clearly indicate that the p - oh proton forms only one h - bond in form ii, but that the assumed p - oh conformation in form i corresponds to two hydrogen bonds . The p - oh proton can form a hydrogen bond to either the o- or p - oh oxygen, without otherwise changing the structure . The difference in shape and larger volume of the surface around the p - oh in form i in contrast to form ii is consistent with possible disorder of the p - oh proton between the two positions, which due to the weak scattering contribution of hydrogen could not be verified based on the fit to the pxrd data alone but would be consistent with the broad ir band . It appears that there is an unusual freedom in the position of the p - oh proton in the form i structure and so there will be ambiguities in the proton position . Crystal packing of form ii (a, b) and form i (c, d) viewed along the a - axis (a), direction (b), c - axis (c), and b - axis (d). Black dotted lines indicate the hydrogen bonds . For clarity only selected symmetry symbols are shown . Hirshfeld surfaces for forms ii (e) and i (f) were generated using the program crystal explorer v. 2.1,(52) with ch and oh distances normalized to neutron values, dnorm is mapped on the surfaces over the range 0.48 to 0.78 . This function highlights contact distances relative to the sum of van der waals radii, with closest contracts shown in red . The circles in (e, f) highlight the p - oh group and hirshfeld surface around it, hh crystallizes in the triclinic space group p1 with two molecules of ra (similar to conf_p1 and conf_p2) and one water molecule in the asymmetric unit, in agreement with the stoichiometry determined by tga . The structure comprises columns of r22(8) dimers, formed by symmetrically equivalent, inversion related ra molecules (homodimers). Each dimeric unit is directly linked to the adjacent alternate dimers with an o4ho4 hydrogen bond and indirectly via a water molecule bridge, that forms two hydrogen bonds (o4howater and owaterho4), leading to sheets . In addition to connecting the acid dimers, water forms the only strong hydrogen bond between the parallel stacked sheets, leading to a 3d network structure (figure 11). The dehydration of hh involves a structural collapse, as despite the water interactions the o4ho4 hydrogen bonds also break due to the conformational change, which is around 180 in the torsion angle for the p - oh proton in every second molecule . The units differ from the 1d construct present in the polymorphs in the location of the inversion center (figure 11a). Crystal packing of hh: (a) (046) plane shown, (b) viewed along the a - axis showing the parallel sheets . Hydrogen bonds are denoted with dotted lines, and for clarity the water protons were omitted . Two acid molecules and one dmso molecule are present in the asymmetric unit of sdmso, which crystallizes in the orthorhombic space group p212121 . The two symmetry inequivalent molecules adopt a conformation similar to conf_p1 and form r22(8) heterodimers . Strong hydrogen bonds are only present within the alternating heterodimer - dmso bands (figure 12) and not in between the layers or stacking of the bands, which implies that the solvent could escape easily compared with hh and could explain why sdmso is not a long - living solvate . The solvate and the desolvation product, form i, both contain similar 1d stacks of acids, along a in sdmso (perpendicular distance: 3.024, centroid distance: 6.398) and c in form i (perpendicular distance: 3.489, centroid distance: 5.198). This implies that on losing the solvent a rearrangement of the acid stacks with respect to adjacent stacks is necessary . On the other hand, crystal packing of sdmso: (a) corrugated heterodimer dmso bands, view along the b - axis, (b) viewed along a - axis . The pyridinium cation interacts with ra carboxylate via an ionic nho hydrogen bond (supporting information, figure s5). The crystal energy landscape showed that only the two most stable conformations, differing in the position of the p - oh proton, could generate crystal structures within the likely energy range of polymorphism . The lowest energy crystal structures had the lowest energy conformation (conf_p1, figure 1), there were a few with the alternative p - oh conformation (conf_p2), but the majority of hypothetical structures contained both conformations, conf_p1 and conf_p2, in a 1:1 ratio producing z = 2 structures . The lack of any crystal structures varying the conformation of the intramolecular h - bond, involving the o - oh proton and c = o oxygen, is consistent with the experimental cocrystals, solvates, including hydrates and modifications. (7) experimentally, only conformations closely related to conf_p1 and conf_p2, or a mix of the two, were observed, with the largest deviation of up to 10 in the position of the p - oh proton from planarity . All low - energy structures (figure 13) form one intra- and two intermolecular hydrogen bonds . The majority of computed crystal structures exhibit the experimentally observed r22(8) acid dimer (d), but there are also acid catemer (c), coohoh chain (ch), and the combination of d and ch structures . The two experimental anhydrates were found to correspond to the lowest - energy structures within the two lowest energy groups of structures, with form i being the global minimum . However, there is a low energy catemeric structure that is very competitive in energy with the known forms, and various other high density structures which also appear thermodynamically feasible . Lattice energy landscape for the ra anhydrates (elatt = uinter + eintra) after relaxation of the conformation within the crystal structure, classified by the hydrogen - bonding motif . All structures with the same hydrogen bonding motif (symbol) within an ellipse are closely related . The reproduction of form ii was excellent, given the neglect of thermal effects in our model, with an optimal root - mean square overlay of all non - hydrogen atoms in a 15 molecule coordination cluster (rmsd15)(56) of 0.16 . In contrast, the reproduction of form i was poor with an rmsd15 of ca . 1, and it was wrongly predicted to be denser and more stable than form ii. The estimated helmholtz free energies(57) derived from the elastic constants(58) and k = 0 phonons(59) calculated in rigid - body harmonic approximation (table s11, supporting information) for the two polymorphs bring forms i and ii to within 0.2 kj mol in energy . Hence, the static lattice energy model (figure 13) is certainly overestimating the energy differences between the two polymorphs . Since proton disorder is suggested by the ir spectrum and the hirshfeld dnorm plot (section 3.1.3 and 3.1.4), we computationally generated three alternative ordered versions of form i differing only in the proton conformations which were kept fixed (supporting information, section 2.3). This resulted in structures that were slightly less dense, and in similar or better agreement with the experimental structure than the global minimum on the crystal energy landscape . Hence, proton disorder in form i would result in a less dense structure, and some of the destabilization(60) may be counteracted by configurational entropy . The calculations also showed that there was no barrier in this crystal structure to the proton moving by 30 from the lowest energy planar conformation . Unfortunately, we were not able to grow single crystals suitable for structure determination for all solid - state forms . From the ir and raman spectra, it could be assumed that in all phases the ra molecules are dimerized, as the symmetric (c = o) band appeared in the region 16751625 cm . Furthermore, information about the hydrogen bonding of the p - oh group in the two anhydrates could be derived from the ir spectra . The shift of (oh) in form ii to lower wavenumbers indicates a stronger intermolecular oho hydrogen bond compared to form i. the broadening in the form i spectrum was attributed to the undetermined p - oh proton position between adjacent o- and p - oh groups (see section 3.1.4). On the basis of the experimental as well as theoretical results, we could not rule out the p - oh proton showing static or dynamic disorder . Static proton disorder has been shown to be possible by lattice energy minimization calculations which also show that there is no barrier to changing the proton position within the form i crystal structure, so it could also be dynamically disordered . Further insight into the disorder could be obtained from periodic ab initio calculations,(62) but the possibilities of experimental verification are very limited without neutron diffraction data . The ra solid - state forms differ considerably in their relative stability . At ambient conditions only the two anhydrates and hh are stable . Mh and all five solvates survive only for a short time after harvesting from the mother liquor . The formation of such unstable solvent adducts is common in organic molecules; however, these are easily overlooked, especially when the product is dried prior to analysis or when the analysis is not performed immediately after the removal from the mother liquor. (44) in contrast to the metastable solvates, hh, in which water plays a structural role, is a very stable phase, as dehydration occurs only at temperatures higher than 60 c or under the driest conditions (below 10% rh, 25 c). The extreme hysteresis between the sorption and desorption process of hh attests to the high kinetic barrier of the hydration and dehydration processes with respect to vapor pressure . Hh) exhibit a desolvation temperature above 60 c in the dsc / tga experiments and revert to the metastable form i. the monosolvates (saa and mh) desolvate below 60 c to the thermodynamically most stable form ii. Therefore, it is obvious that the desolvation temperature is critical for the formation of a specific polymorph . Even though a large number of experiments were performed, we cannot guarantee that all possible ra forms were found, as the range of variables in crystallization experiments that could influence the outcome is very large . The anhydrate crystal energy landscape showed that the two known forms are the most likely polymorphs . The alternative dimerbased structures (figure 13) are sufficiently similar to the known polymorphs suggesting that they could readily transform to form i or ii in the unlikely event that they were distinct at the nucleation stage . However, the lattice energy landscape suggests that other polymorphs could exist, which do not have the carboxylic acid dimer motif, but form exclusively cooh catemers or chains . A csd(5) analysis of o - oh benzoic acid derivatives(63) showed that the r22(8) carboxylic acid dimer motif is the predominant hydrogen bonding motif, as seen in all four structurally characterized ra phases . The relative stability of the catemeric structures on the crystal energy landscape may be overestimated by the computational model . We cannot exclude the possibility that the formation of the dimer motif is kinetically favored in all the crystallization conditions we have explored, hence ruling out the formation of catemers during our screening experiments . -resorcylic acid represents another organic molecule exhibiting a complex solid - state behavior, that is, polymorphism, salt, and solvate (hydrate) formation . The experimental search has resulted in seven new solid - state forms (anhydrate, monohydrate, and five solvates), in addition to the previously known, and structurally characterized anhydrate ii and hemihydrate hh. (8) we found no evidence for a triclinic polymorph (zzzeeu(6)) or a hydrate showing a water / acid stoichiometry greater than 1:1. (64) before we can answer the question how exhaustive should a polymorph screen be?, perhaps we must add a supplementary question, namely, how exhaustive does your knowledge of physical form diversity need to be? ; that is, do we need to confirm that the most thermodynamically favorable form at 25 c is already known or do we want to identify all accessible solid forms, perhaps to select a metastable form that has superior properties? It is worth considering these alongside any limitations in terms of available material, stability, time, etc . When designing a comprehensive screening strategy . However, recognizing that it is impractical to sample all possible nucleation and growth conditions for a given molecule, we can conclude that as a minimum, a polymorph screen should include sufficient diversity to at least find the thermodynamically most stable polymorph (non solvated) and hydrate form(s) as well as those thermodynamically unstable forms that show sufficient kinetic stability at ambient conditions (termed metastable forms) to enable them to be isolated and identified . Furthermore, a polymorph screen should identify all crystallization products, including intermediates in the crystallization process, for example, solvates, amorphous form, etc . And characterize transformation pathways in order to find alternative, or perhaps only, routes to obtain a specific form . Therefore, a robust screening approach requires the combination of a variety of experimental approaches(67) including crystallization from solution (evaporation, cooling, slurry conversions), sublimation, crystallization from the melt, thermal and moisture dependent studies and desolvation methods . The statement by maria kuhnert - brandstaetter,(68) probably every substance is potentially polymorphous . The only question is, whether it is possible to adjust the external conditions in such a way that polymorphism can be realized or not, reflects the problem that there are numerous additional strategies, at ambient and nonambient conditions, which might be adequate for the nucleation and growth of further solid - state forms . It is practically not feasible to cover the whole range of techniques that have been shown to produce new polymorphs for certain systems,(21) particularly using all kinds of templates, additives, seeds, or impurities that might generate new forms or stabilize metastable phases . The instability of many solvates of -resorcylic acid, the possibility of considerable variation in the p - oh position in form i, and the computed thermodynamically feasible anhydrates mean that we cannot exclude the discovery of other solid - state forms . Therefore, our results for -resorcylic acid emphasize the problems of determining the complete set of solid - state forms when there is evidence of disorder or short - lived intermediate crystallization products whose lifetime is very dependent on conditions . Thus, the consistency between the experimental and computational techniques used in this study adds confidence that the practically most important -resorcylic acid solid - state forms at ambient conditions have been characterized, showing the value of calculating the crystal energy landscape as part of the screening process.

In orthodontics, it is important to employ a suitable adhesive technique and methods that not only promote satisfactory bond strength during treatment, but also have a simplified protocol for clinical use, thereby reducing procedural errors and minimizing damage to the dental structure.1 self - etching adhesive systems have acidic components in their composition, thus reducing the number of operative procedures and the inconvenience arising from excessive demineralization of the tooth structure, as occurs in the total acid etching technique.1,2 at present, erbium: yttrium aluminum garnet laser laser (er: yag) has been used in dentistry for performing cavity preparations, carious tissue removal, decontamination of cavities and tooth surface conditioning.35 er: yag laser is one of the types most used for hard dental tissue conditioning,5 because it allows the formation of rougher surfaces . When it is used on dentin, it removes the tissue with the absence of a smear layer . Irradiation with erbium laser promotes structural and morphological changes in dental hard tissues.4,6,7 when the tooth surface is conditioned with er: yag laser, a tissue becomes more resistant to acid dissolution around the bracket,4,7 and it appears to be effective for the prevention of caries during orthodontic treatment.8 some studies3,5,911 have pointed out increased retention of the resinous material to enamel irradiated with er: yag laser . However, further studies need to be conducted in order to prove the efficacy of erbium laser for increasing the bond strength of orthodontic adhesives, since these data are controversial in the literature.6,7 a large portion of the studies has evaluated the bond strength of orthodontic brackets immediately after they have been bonded,1,2 but a long - term evaluation deserves emphasis, because once these brackets have been bonded, they have to remain in position throughout the entire orthodontic treatment . Therefore, studies evaluating accelerated artificial aging / thermal cycling have been suggested in the literature.12 thus, while the self - etching system reduces the inconvenience of excessive demineralization of the tooth,1,2 the association of the er: yag laser with the conventional adhesive system should be evaluated, enamel resistance to acid dissolution after irradiation with er: yag is shown in the literature.4,8 in view of the questions raised, the aim of this study was to evaluate the in vitro bond strength of orthodontic brackets bonded with: total etch, total etch with previous application of er: yag laser and the self - etching adhesive systems after thermal - mechanical cycling, simulating 1 year of treatment . The null hypothesis tested was that there would be no statistically significant difference among the bond strength values when the adhesive systems and laser for orthodontic bracket bonding were used . The research project was approved by the ethics commission on animal experimentation of ceuma university (protocol no . 073/2013). The research followed the guidelines of national council of control of animal experimentation (concea). The experimental procedures were performed on 48 recently extracted deciduous bovine incisors obtained from discarded jaws after slaughter of the animals.13 the teeth were extracted following the procedures of a minimum of trauma . The inclusion criteria used for selecting the teeth were tooth enamel without cracks / fractures and without previous application of chemical agents such as thymol, hydrogen peroxide, alcohol or formol . Wallis test power equal to 75% . A sample size of (n) 16 elements in each group was found (pass 11, ncss, llc, kaysville, ut, usa). After this, the coronal pulp was removed with a dentin curette (duflex lucas no . 86, ss white, rio de janeiro, brazil) and the pulp chamber was cleaned and obliterated with utility wax . The teeth were placed in pvc tubes measuring 25 mm20 mm (tigre, joinville, brazil) with the vestibular surface positioned at the bottom of the base, and then they were embedded in acrylic resin (vipi, so paulo, brazil). The surface was abraded with water and abrasived paper of 200, 400, 600 and 1200 grits (3 m, sumar, brazil) with the aid of a polishing machine (panambra tcnica imp . Ltda, so paulo, brazil), under irrigation and uniform, constant pressure in order to obtain a flat vestibular surface . To prepare the experimental groups, a total of 48 stainless steel orthodontic brackets for maxillary central incisors were used, with a mesh base of 1.5 mm height4.0 mm wide (roth 0.022 0.030 kirium abzil indstria e comrcio ltda ., prophylaxis of the tooth enamel on the vestibular surface of all the teeth was performed with pumice stone, without fluoride (ss white) and water for 10 seconds . In the groups, the following adhesive systems were used: transbond xt (xt), transbond plus self etch primer system (sep) and er: yag laser associated with the adhesive system transbond xt (er: yag / xt) as specified in table 1 . In the group in which previous irradiation with er: yag laser (kavo key iii, kavo, kirchdorf biberach, germany) was performed, the wavelength of 2.94 m was used with a #2051 handpiece and spot diameter of 0.63 mm (table 1). For all the groups, the brackets were positioned with transbond xt resin (3 m) on the base, excess was removed and light polymerization was performed for 10 seconds on each surface of the bracket (mesial, distal, cervical and incisal). Maximum pressure was applied during bracket bonding in order to standardize the force exerted and the thickness of the resin pellicle, as soon as they were placed on the teeth . All the procedures were carried out by one single, duly trained and calibrated operator . Light polymerization of the adhesive system and resin was performed with a fast - curing cordless led light (3 m espe dental, landsberg am lech, germany) polymerizing apparatus, with light intensity of approximately 800 mw / cm, checked with a radiometer (gnatus, ribeiro preto, brazil). The experimental groups were submitted to varying thermal - mechanical cycles, using a fatigue simulator appliance (er 11000, erios, so paulo, brazil). In order to simulate 1 year of clinical treatment, 100,000 mechanical cycles and 500 thermal cycles were performed, which ranged between 5c and 55c (iso 11405).14,15 a universal test machine (emic, so jos dos pinhais, brazil) was used, with a 50 kg load applied parallel to the vestibular enamel surface, in the incisor - cervical direction close to the enamel / adhesive interface, at 0.5 mm / min until fracture occurred.15,16 the force required to remove the brackets was measured in newton (n) and the shear strength in megapascals (mpa). The results were obtained with the aid of the computer software program (tesc) connected to the emic universal test machine . After the shear bond test, the samples were analyzed under a stereomicroscope lens (kozo optical and electronical instrumental, nanjing - jiangsu, people s republic of china), at 20 magnification to determine the adhesive remnant index (ari). This measurement was made in accordance with the scores that ranged from 0 to 3: 0 no composite resin adhered to enamel; 1 less than half percent of composite resin on enamel; 2 more than half percent of composite resin on enamel; and 3 all composite resin on enamel, showing the bracket mesh impression.17,18 afterward, the samples were prepared and submitted to analysis by sem in order to visualize the adhesive remnant and/or the enamel condition after bracket removal . Images were captured by means of a specific software program coupled to the sem (inspect 550, fei), allowing photomicrographs to be obtained . The data obtained were statistically analyzed by means of kruskal wallis and mann whitney tests with bonferroni correction to verify differences between the studied groups, since the distribution of data was not considered normal, according to the shapiro wilk test . The ari data, which were presented as an ordinal qualitative variable, were statistically analyzed with kruskal wallis and dunn tests . The analyses were performed using the statistical software program statistical package for the social sciences (spss) statistics version 20.0 (ibm, armonk, ny, usa). The research project was approved by the ethics commission on animal experimentation of ceuma university (protocol no . 073/2013). The research followed the guidelines of national council of control of animal experimentation (concea). The experimental procedures were performed on 48 recently extracted deciduous bovine incisors obtained from discarded jaws after slaughter of the animals.13 the teeth were extracted following the procedures of a minimum of trauma . The inclusion criteria used for selecting the teeth were tooth enamel without cracks / fractures and without previous application of chemical agents such as thymol, hydrogen peroxide, alcohol or formol . Wallis test power equal to 75% . A sample size of (n) 16 elements in each group was found (pass 11, ncss, llc, kaysville, ut, usa). After this, the coronal pulp was removed with a dentin curette (duflex lucas no . 86, ss white, rio de janeiro, brazil) and the pulp chamber was cleaned and obliterated with utility wax . The teeth were placed in pvc tubes measuring 25 mm20 mm (tigre, joinville, brazil) with the vestibular surface positioned at the bottom of the base, and then they were embedded in acrylic resin (vipi, so paulo, brazil). The surface was abraded with water and abrasived paper of 200, 400, 600 and 1200 grits (3 m, sumar, brazil) with the aid of a polishing machine (panambra tcnica imp . Ltda, so paulo, brazil), under irrigation and uniform, constant pressure in order to obtain a flat vestibular surface . To prepare the experimental groups, a total of 48 stainless steel orthodontic brackets for maxillary central incisors were used, with a mesh base of 1.5 mm height4.0 mm wide (roth 0.022 0.030 kirium abzil indstria e comrcio ltda . Prophylaxis of the tooth enamel on the vestibular surface of all the teeth was performed with pumice stone, without fluoride (ss white) and water for 10 seconds . In the groups, the following adhesive systems were used: transbond xt (xt), transbond plus self etch primer system (sep) and er: yag laser associated with the adhesive system transbond xt (er: yag / xt) as specified in table 1 . In the group in which previous irradiation with er: yag laser (kavo key iii, kavo, kirchdorf biberach, germany) was performed, the wavelength of 2.94 m was used with a #2051 handpiece and spot diameter of 0.63 mm (table 1). For all the groups, the brackets were positioned with transbond xt resin (3 m) on the base, excess was removed and light polymerization was performed for 10 seconds on each surface of the bracket (mesial, distal, cervical and incisal). Maximum pressure was applied during bracket bonding in order to standardize the force exerted and the thickness of the resin pellicle, as soon as they were placed on the teeth . All the procedures were carried out by one single, duly trained and calibrated operator . Light polymerization of the adhesive system and resin was performed with a fast - curing cordless led light (3 m espe dental, landsberg am lech, germany) polymerizing apparatus, with light intensity of approximately 800 mw / cm, checked with a radiometer (gnatus, ribeiro preto, brazil). The experimental groups were submitted to varying thermal - mechanical cycles, using a fatigue simulator appliance (er 11000, erios, so paulo, brazil). In order to simulate 1 year of clinical treatment, 100,000 mechanical cycles and 500 thermal cycles were performed, which ranged between 5c and 55c (iso 11405).14,15 a universal test machine (emic, so jos dos pinhais, brazil) was used, with a 50 kg load applied parallel to the vestibular enamel surface, in the incisor - cervical direction close to the enamel / adhesive interface, at 0.5 mm / min until fracture occurred.15,16 the force required to remove the brackets was measured in newton (n) and the shear strength in megapascals (mpa). The results were obtained with the aid of the computer software program (tesc) connected to the emic universal test machine . After the shear bond test, the samples were analyzed under a stereomicroscope lens (kozo optical and electronical instrumental, nanjing - jiangsu, people s republic of china), at 20 magnification to determine the adhesive remnant index (ari). This measurement was made in accordance with the scores that ranged from 0 to 3: 0 no composite resin adhered to enamel; 1 less than half percent of composite resin on enamel; 2 more than half percent of composite resin on enamel; and 3 all composite resin on enamel, showing the bracket mesh impression.17,18 afterward, the samples were prepared and submitted to analysis by sem in order to visualize the adhesive remnant and/or the enamel condition after bracket removal . Images were captured by means of a specific software program coupled to the sem (inspect 550, fei), allowing photomicrographs to be obtained . The data obtained were statistically analyzed by means of kruskal wallis and mann whitney tests with bonferroni correction to verify differences between the studied groups, since the distribution of data was not considered normal, according to the shapiro the ari data, which were presented as an ordinal qualitative variable, were statistically analyzed with kruskal wallis and dunn tests . The analyses were performed using the statistical software program statistical package for the social sciences (spss) statistics version 20.0 (ibm, armonk, ny, usa). The inferential and descriptive statistics of the bond strength of the groups are shown in table 2 . After simulation of 1 year of treatment, it was observed that xt and sep groups presented the highest shear bond strength values, without statistical differences between them . However xt / er: yag group showed a reduction in mean bond strength values (table 2). The condition in which there was greatest predominance of ari=0 was that of group xt / er: yag . The score 0 was the most found in the groups, representing adhesive failures . The exception was group sep, in which there was predominance of ari=3 (all the adhesive remnant on the enamel surface with the impression of the bracket base) (table 3). In group xt / er: yag, it was observed that the dental ablation performed by er: yag laser promoted the formation of craters and imperfections in the enamel, which were restricted to the ablated area, without the occurrence of fractures or cracks (figure 1). In groups xt and sep, by means of sem, the inferential and descriptive statistics of the bond strength of the groups are shown in table 2 . After simulation of 1 year of treatment, it was observed that xt and sep groups presented the highest shear bond strength values, without statistical differences between them . However xt / er: yag group showed a reduction in mean bond strength values (table 2). The condition in which there was greatest predominance of ari=0 was that of group xt / er: yag . The exception was group sep, in which there was predominance of ari=3 (all the adhesive remnant on the enamel surface with the impression of the bracket base) (table 3). In group xt / er: yag, it was observed that the dental ablation performed by er: yag laser promoted the formation of craters and imperfections in the enamel, which were restricted to the ablated area, without the occurrence of fractures or cracks (figure 1). In groups xt and sep, by means of sem, the constant development of materials and techniques for dental bonding offers various clinical options for bonding orthodontic accessories . In this study, after simulation of 1 year of orthodontic treatment, the conventional and self - etching adhesive systems were found to show adequate bond strength; however, previous enamel treatment with er: yag laser (60 mj, energy density 19.24 j / cm) reduced the bond strength of brackets bonded to enamel . The bond strength of orthodontic brackets is usually verified 24 hours after they were bonded.16,18 however, not only the primary stability of orthodontic brackets but also their longevity are extremely important; nevertheless, most of the in vitro studies16,18 do not use artificial fatigue tests before evaluating the bond strength . It is proposed in the literature that thermal or thermal - mechanical cycling12 should be performed before the bond strength test, as was done in the present study . After simulation of 1 year of orthodontic treatment, groups sep (self - etching adhesive\10.3 mpa) and xt (total etch adhesive\10.8 mpa) were statistically similar between them,1,12 and presented mean bond strength values corroborating the findings in the literature.1,6 the group treated with er: yag laser / xt (7.4 mpa) showed the lowest bond strength values, and these findings do not differ from those of studies that observed the bond strength 24 hours after bracket bonding to enamel previously treated with er: yag laser.6 however, it is reported in the literature19 that the variation between 5 and 50 mpa indicates the ideal values of bond strength, contributing to the findings of the present study . Previous studies14,2022 have suggested the use of enamel conditioning with er: yag laser before orthodontic bracket bonding, with the intention of obtaining a tissue that was more resistant to acid dissolution around the brackets . However, it is difficult to compare the results, because various experimental conditions are used; while some combined the use of laser with acid,8,10 others used laser only to promote conditioning.6,21,22 enamel conditioning performed with laser parameters similar to those used for cavity preparations23 has also been suggested,11 and although adequate bond strength was obtained, severe and permanent damage to tooth enamel was generated.10 it has been reported that er: yag laser is a potentially adequate method for conditioning enamel,3,10,11 but it generates lower bond strength values when compared with the conventional acid etching technique.8,24 a low energy level of er: yag laser (60 mj) was used in this study for previous conditioning of the enamel as described25,26 because it has been proposed that low energy levels (6080 mj) are capable of promoting demineralization without causing severe changes in enamel.25 a reduction of bond strength was observed, as has been pointed out in studies,25 in which different adhesive systems have been used, and the laser with the same parameters as those used in this study . However, even with the use of 150 mj and an energy density similar to that used in our study (19.1 j / cm), the study by contreras - bulnes et al,6 who verified this parameter for conditioning enamel with the use of er: yag laser, also presented a significant reduction in bond strength, while other studies found adequate bond strength values after the use of these parameters.21,22 conditioning with er: yag laser promotes lower tensile stress and demineralization when compared with phosphoric acid.8 the reduction in bond strength may also be related to the fact that the microhardness and modulus of elasticity of enamel are increased after irradiation with er: yag laser, when compared with enamel etched with phosphoric acid, which promotes a reduction in microhardness and modulus of elasticity.7 the application of er: yag laser has also been correlated with the presence of micro - fractures in the enamel subsurface and dentin, which are unfavorable to the bonding process.6,24 after treatment with phosphoric acid, a typical etching pattern is formed with mixed areas of removal of nucleus or peripheral portion of the core of the enamel prism.6 er: yag laser increases the free surface energy and roughness of enamel and dentin; however, it does not produce a desirable morphology for the bonding process.27 the bond strength of orthodontic brackets bonded to enamel previously treated with er: yag laser is still controversial, probably due to the difference in the methodologies used, and mainly in the variation of the energy and frequency parameters.10,28 the highest frequency of failures was verified at the adhesive / enamel interface . The exception was group sep, whose bond failure occurred with greater frequency at the adhesive / bracket interface, corroborating the findings in the literature.1 the use of self - etching adhesive appears to favor this condition, which in practice may mean less risk of unpredictable damage to the enamel surface at the time of bracket removal by the professional, however, with the need to remove the adhesive remnant on the tooth surface after debonding . According to the observations by sem, the conventional and self - etching adhesives did not present damage to enamel after debonding . The er: yag laser promoted permanent irregularities in tooth enamel, even when using a low level of energy (60 mj) and may generate an increase in enamel roughness and microfissures.6 in vitro studies have limitations because they do not reproduce the oral environment in all its complexity . However, laboratory studies are important because preliminary evaluations are necessary to indicate the feasibility of the clinical application of dental techniques and materials . Therefore, in vitro studies require further investigation to elucidate the influence of these resinous materials and the behavior of the er: yag laser (associated to different irradiation parameters and/or subjected to erosive cycles) on the surface of the dental enamel, contributing to the improvement of longevity of the adhesive techniques of brackets and their clinical applicability . Within the limitations of this study, after simulation of 1 year of orthodontic treatment, by means of thermal - mechanical cycling, it was possible to observe that: the conventional (xt) and self - etching (sep) adhesive systems presented similar mean bond strength values between them.the previous application of er: yag laser, within the parameters used, associated with the use of the conventional adhesive system (xt) promoted the lowest bond strength values.with exception of the group treated with self - etching adhesive, a large portion of the failures occurred at the enamel / adhesive interface . The conventional (xt) and self - etching (sep) adhesive systems presented similar mean bond strength values between them . The previous application of er: yag laser, within the parameters used, associated with the use of the conventional adhesive system (xt) promoted the lowest bond strength values . With exception of the group treated with self - etching adhesive, a large portion of the failures occurred at the enamel / adhesive interface.

Methylmalonic acidemia (mma) encompasses a heterogeneous group of disorders that is characterized by impaired metabolism of methylmalonic acid that is generated during the metabolism of certain amino acids (isoleucine, methionine, threonine, or valine). The incidence rate of mma is 1 in 50,00080,000 newborns but it is more common in countries with high amount of consanguinity and countries with no systematic newborn screening, like developing countries . Patients typically presents at the age of 1-month to 1-year with varied presentations of symptoms ranging from poor feeding, vomiting, dehydration, shock, hypoglycemia, hyperammonemia and hyperglycemias with high anion gap (ag) metabolic acidosis if left untreated can lead coma or even death . Mma may present suddenly in older infants without initial apparent symptoms, which may mimic septic shock and diabetic ketoacidosis (dka) and without early recognition can lead fatal consequences . Here we are reporting two cases of mma in infants presented with severe high ag metabolic acidosis mimicking as dka in one case and septic shock in an another case even without any initial apparent symptoms . We report an 8-month - old male child presented in an emergency department with hypotensive shock, respiratory failure and disseminated intravascular coagulation with a short history of nonspecific low grade fever associated with upper respiratory infection and vomiting since 1-day . His initial investigation showed: hemoglobin (hb)-6.0 g / dl, total leukocyte count (tlc)-4500 with 55% neutrophil, platelet counts 65/nl, c - reactive protein (crp)-10 mg / dl, protein thiolation index / activated partial thromboplastin time - no clot, international normalized ratio-9, serum glutamic - oxaloacetic transaminase / prothrombin time - 65/42 and arterial blood gas was ph-7.0, hco3 - 2.4, lactate-2.2, ag-28, blood sugar-122 mg / dl, urine analysis 4 + ketones . Blood culture was sterile and cerebrospinal fluid (csf) examination done after stabilization came normal . Ketoacidosis remain persisted even after the 24 h of reversal of shock requiring sodium bicarbonate infusion . The child was conservatively managed with fluids, inotropes, fresh frozen plasma, pack cell transfusion, sodium bicarbonate, antibiotics, low protein diet, methylcobalamin, and carnitine . The child responded well to treatment and was extubated after 72 h of admission was shifted out of pediatric intensive care unit (picu) on 5 day . The child was discharged on 10 day on oral b12 supplementation and low protein diet . We report a 2 case of previously healthy 1-year - old male child with altered sensorium with a short history of vomiting and low grade fever with no history of seizures . On examination child was comatose with glasgow coma scale score 9, kussmaul breathing with signs of dehydration . His initial investigation showed hb-8.4 g / dl, tlc-15,200/cmm with 70% neutrophils, platelet counts - 720/nl, crp - 12 mg / dl, blood gas ph - 7.119, hco3 - 3.7, ag - 44, lactate 1.04, blood sugar - 485 mg / dl, urine 4 + ketones . An initial diagnosis of dka was made, and stranded treatment with fluids and insulin infusion was started . Other causes of poor response to insulin e.g. ; dose, administration, and infection were ruled out . Persistence of severe high ag metabolic acidosis after 24 h of admission with hemoglobin a1c 4.9%, underlying metabolic disorder was suspected and was investigated to rule out organic acidemia and had high levels of methyl malonic acid . Insulin was discontinued and started on b12, carnitine, low protein diet and sodium bicarbonate and the child responded well to treatment, acidosis was corrected after 24 h and he was shifted out of picu on 5 day . We report an 8-month - old male child presented in an emergency department with hypotensive shock, respiratory failure and disseminated intravascular coagulation with a short history of nonspecific low grade fever associated with upper respiratory infection and vomiting since 1-day . His initial investigation showed: hemoglobin (hb)-6.0 g / dl, total leukocyte count (tlc)-4500 with 55% neutrophil, platelet counts 65/nl, c - reactive protein (crp)-10 mg / dl, protein thiolation index / activated partial thromboplastin time - no clot, international normalized ratio-9, serum glutamic - oxaloacetic transaminase / prothrombin time - 65/42 and arterial blood gas was ph-7.0, hco3 - 2.4, lactate-2.2, ag-28, blood sugar-122 mg / dl, urine analysis 4 + ketones . Blood culture was sterile and cerebrospinal fluid (csf) examination done after stabilization came normal . Ketoacidosis remain persisted even after the 24 h of reversal of shock requiring sodium bicarbonate infusion . The child was conservatively managed with fluids, inotropes, fresh frozen plasma, pack cell transfusion, sodium bicarbonate, antibiotics, low protein diet, methylcobalamin, and carnitine . The child responded well to treatment and was extubated after 72 h of admission was shifted out of pediatric intensive care unit (picu) on 5 day . The child was discharged on 10 day on oral b12 supplementation and low protein diet . We report a 2 case of previously healthy 1-year - old male child with altered sensorium with a short history of vomiting and low grade fever with no history of seizures . On examination child was comatose with glasgow coma scale score 9, kussmaul breathing with signs of dehydration . His initial investigation showed hb-8.4 g / dl, tlc-15,200/cmm with 70% neutrophils, platelet counts - 720/nl, crp - 12 mg / dl, blood gas ph - 7.119, hco3 - 3.7, ag - 44, lactate 1.04, blood sugar - 485 mg / dl, urine 4 + ketones . An initial diagnosis of dka was made, and stranded treatment with fluids and insulin infusion was started . Other causes of poor response to insulin e.g. ; dose, administration, and infection were ruled out . Persistence of severe high ag metabolic acidosis after 24 h of admission with hemoglobin a1c 4.9%, underlying metabolic disorder was suspected and was investigated to rule out organic acidemia and had high levels of methyl malonic acid . Insulin was discontinued and started on b12, carnitine, low protein diet and sodium bicarbonate and the child responded well to treatment, acidosis was corrected after 24 h and he was shifted out of picu on 5 day . We report an 8-month - old male child presented in an emergency department with hypotensive shock, respiratory failure and disseminated intravascular coagulation with a short history of nonspecific low grade fever associated with upper respiratory infection and vomiting since 1-day . His initial investigation showed: hemoglobin (hb)-6.0 g / dl, total leukocyte count (tlc)-4500 with 55% neutrophil, platelet counts 65/nl, c - reactive protein (crp)-10 mg / dl, protein thiolation index / activated partial thromboplastin time - no clot, international normalized ratio-9, serum glutamic - oxaloacetic transaminase / prothrombin time - 65/42 and arterial blood gas was ph-7.0, hco3 - 2.4, lactate-2.2, ag-28, blood sugar-122 mg / dl, urine analysis 4 + ketones . Blood culture was sterile and cerebrospinal fluid (csf) examination done after stabilization came normal . Ketoacidosis remain persisted even after the 24 h of reversal of shock requiring sodium bicarbonate infusion . The child was conservatively managed with fluids, inotropes, fresh frozen plasma, pack cell transfusion, sodium bicarbonate, antibiotics, low protein diet, methylcobalamin, and carnitine . The child responded well to treatment and was extubated after 72 h of admission was shifted out of pediatric intensive care unit (picu) on 5 day . The child was discharged on 10 day on oral b12 supplementation and low protein diet . We report a 2 case of previously healthy 1-year - old male child with altered sensorium with a short history of vomiting and low grade fever with no history of seizures . On examination child was comatose with glasgow coma scale score 9, kussmaul breathing with signs of dehydration . His initial investigation showed hb-8.4 g / dl, tlc-15,200/cmm with 70% neutrophils, platelet counts - 720/nl, crp - 12 mg / dl, blood gas ph - 7.119, hco3 - 3.7, ag - 44, lactate 1.04, blood sugar - 485 mg / dl, urine 4 + ketones . An initial diagnosis of dka was made, and stranded treatment with fluids and insulin infusion was started . Other causes of poor response to insulin e.g. ; dose, administration, and infection were ruled out . Persistence of severe high ag metabolic acidosis after 24 h of admission with hemoglobin a1c 4.9%, underlying metabolic disorder was suspected and was investigated to rule out organic acidemia and had high levels of methyl malonic acid . Insulin was discontinued and started on b12, carnitine, low protein diet and sodium bicarbonate and the child responded well to treatment, acidosis was corrected after 24 h and he was shifted out of picu on 5 day . Methylmalonic acidemia is a rare autosomal recessive disease in which there is a deficiency in conversion of methylmalonic coenzyme a (coa) to succinyl coa . Mma appears to be more common than other organic academia perhaps because it has several underlying causes . Affected infants present in the first few days of life with vomiting, respiratory distress, feeding intolerance, lethargy, and severe ketoacidosis, which, if not aggressively treated, often progresses rapidly to coma and death . It occurs in older children who usually have low levels of methyl malonic acid in blood and urine and have normal growth and development . These children present intermittently with acidotic crises and are otherwise normal during crisis - free periods . Increased levels of organic acids including metabolic disease must always be considered as possible diagnosis when an infant presents with a severe metabolic acidosis accompanied by an increased ag and other causes of increased ag metabolic acidosis with increased osmolar gap, e.g. Drug ingestion should be ruled out . We report two cases of infants with mma with sudden decompensation associated with high ag severe metabolic acidosis without any initial signs and symptoms . In first case infant with presented as mimic septic shock responded well to fluid management, but ketoacidosis was persisted even after the shock was corrected . An underlying metabolic disorder was suspected and had very high levels of methylmalonic acids in urine . In another case infant presented with hyperglycemic ketoacidosis with poor response to insulin . Because of persistence of ketoacidosis an underlying metabolic disorder was considered . Although hyperglycemia is an unusual presentation for mma, boeckx and hicks, guven et al . And kumar and suthar reported cases with severe and persistent metabolic acidosis and hyperglycemia, despite large doses of insulin . Dka is most common cause of ketoacidosis, but it shows excellent response to standard treatment; therefore other etiologies of acidosis / hyperglycemia should be investigated in poor responders . Organic acidurias (oas) should be included in the differential diagnosis especially in countries where national newborn screening is not implemented . Determining the etiology of hyperglycemic ketoacidosis is important and can lead to a good outcome . The unusual presentation of our patients, mimicking dka and septic shock reminds us of the wide spectrum of clinical signs of organic acidemia . In very young patients with severe acidosis and metabolic decompensation, or with atypical clinical course should lead a suspicion of a less common diagnosis such as organic academia to prevent severe morbidities and even death.

Reactivation of latent tuberculosis (tb) is a serious hindrance to continuation of therapy . We present here a case of pleural tb in a patient on infliximab for ankylosing spondylitis . A 36-year - old male presented to our hospital in 2006 with low back ache inflammatory type with symmetric joint pains involving large joints such as shoulder joints, hip joints, knee joints, and small joints such as metacarpophalangeal joints, elbow joints, and metatarsophalangeal joints . There was associated early morning stiffness for over an hour . On examination, synovitis was present in peripheral joints with restriction of movement in all joints . Modified schober's test was positive, and the chest expansion (<3 cm) was restricted . On evaluation, he had anemia and elevated erythrocyte sedimentation rate (esr) (46 mm / h) and c - reactive protein (crp) (18 mg / l). Imaging revealed kyphoscoliosis of thoracic spine, syndesmophytes at multiple levels giving the appearance of bamboo spine [figure 1]. Diffuse ossification of interspinous and paraspinal ligaments with fusion of thoracic and lower cervical vertebra was present . Radiograph showing bamboo spine in view of hla - b27, more than 2 spa features and typical radiological features, ankylosing spondylitis was considered . He was started on nonsteroidal anti - inflammatory drugs (nsaids) and dose escalated for symptomatic relief . In view of persisting symptoms and elevated esr and crp in spite of optimal nsaids, following three doses of infliximab and 10 months after initiation of therapy, patient came with complaints of fever and cough for 1 week . On examination, breath sounds were reduced over the right side, and there was dullness on percussion . Diagnostic thoracocentesis showed lymphocytic (total leukocyte count - 4800 cells / cumm, lymphocytes - 90%) exudative type of effusion with high adenosine deaminase (ada) (114 iu / l). According to light's criteria (effusion protein - 6 g / dl, serum protein - 3.37 g / dl, effusion lactate dehydrogenase (ldh) - 575 ankylosing spondylitis is a chronic, systemic, inflammatory disease that affects primarily the sacroiliac joints and spine . It is a spondyloarthropathy with a prevalence of 0.1%0.4% globally . Data from india are sparse . Its more commonly seen among males under 30 years of age . Diagnosis is made after thorough clinical examination and radiography . Infliximab is one such biologic which acts by inhibiting a pro - inflammatory cytokine tnf- and reducing inflammation . Target - related adverse effects with tnf inhibitors are infections, opportunistic infections, malignancies, demyelinating conditions, hematologic abnormalities, congestive heart failure, autoantibodies (antinuclear antibody and anti - double - stranded dna), hepatotoxicity, dermatologic reactions, and lupus - like syndromes, whereas the agent - related adverse effects are administration reactions and immunogenicity . Tnf- is a cytokine that plays an important role in the mediation of inflammation and immune regulation . They are required for inflammatory response against intracellular organisms . In experimental models, fungal and bacterial infections pneumocystis carinii and histoplasma capsulatum are some of the fungal pathogens, whereas the bacterial agents are listeria monocytogene, mycobacterium tuberculosis, and mycobacterium avium . Upper and lower respiratory tract infections are the most commonly seen ones . There was also an increased risk of serious infections compared with controls (3.6% vs. 1.7%). Registries of rheumatoid arthritis patients have shown that the relative risk for infection (3.34.1) as well as serious infection (2.72.8) was significantly higher among patients receiving tnf inhibitors . To conclude, severity of disease, use of other medications such as corticosteroids, and the presence of comorbidities also contribute to infections in addition to tnf inhibitors alone . Opportunistic infections following tnf inhibitor therapy include disseminated m. tuberculosis . In a study of seventy cases of tb following infliximab therapy, thirty were pulmonary tb and of forty were extrapulmonary disease, only two were cases of pleural tb . Around a quarter of the cases were disseminated disease . The majority of cases of tb were observed within a median period of 12 weeks after initiation of therapy and is likely due to reactivation of latent tb . A study by grover et al . In india has shown a high incidence of tb (21%) following biologic therapy . It was also seen that among those who received low doses of infliximab (3 mg / kg body weight) did not develop tb . Another study by malaviya et al . Has found a lower incidence (9.4%) of tb among those on tnf inhibitors . The rate of development of active tb among rheumatoid arthritis patients on anti - tnf therapy has dropped by 83% with the help of screening . Suppressing the action of tnf- can help in relieving the symptoms of ankylosing spondylitis by reducing the inflammatory process, but at the same time, it weakens immune response to microbes such as tubercle bacilli . Hence, meticulous screening and close monitoring of patients on infliximab for any symptoms and signs of tb are important as there is a risk even though the screening tests have come out be negative.

Myoepithelial carcinoma (mc) is a rare tumor with an incidence of 0.2% of all salivary gland tumors . Most of the reported cases of mc arise in the parotid gland (4875%), followed by minor salivary glands, and the submandibular gland . The first case was described by higashiyama et al ., in 1998 . Since then, only seven cases have been reported in literature . A mentally retarded 13-year - old girl, with a history of congenital hypothyroidism and cystic lymphangioma in the left dorsal region, operated in 2004, had consulted for cough and dyspnea in september 2010 . Physical examination showed a decrease in vesicular breath sounds at the basal areas of chest bilaterally, without fever . Pulmonary computed tomography (ct) showed bilateral pleural masses measuring 6.3 cm and 7.4 cm at the right and left bases, respectively, with lymph node metastases [figure 2]. (a) bilateral pulmonary opacities (b) disappearance of pulmonary opacities pulmonary computed tomography (ct): bilateral pulmonary masses a histopathological study of the left pleural biopsy revealed a monomorphic proliferation of round cells with clear cytoplasm and a weak, mitotic hyperchromatic oval nucleus [figure 3]. There were some cohesive layers, separated by bands of sclerosis; the stroma was sparse with foci of necrosis . The immunohistochemistry (ihc) study was focally positive for vimentin, cd99, and ps100 . The abdominal ultrasound, bone scan, and metaiodobenzylguanidine (mibg) scintigraphy were normal . The histopathological and the ihc review at the institut bergoni in france concluded the diagnosis of myoepithelial carcinoma of the soft tissues with intermediate malignancy . Ihc was positive for pancytokeratin (ae1/ae3) and ps100, and negative for ema, cd34, desmin, and cd99 . The progression was marked by the disappearance of the pulmonary opacities [figure 1]. They include mucoepidermoid carcinoma, adenoid cystic carcinoma, acinic cell carcinoma, oncocytoma, epithelial it arises from the submucosal bronchial glands of the lower respiratory tract . In the world health organization classification, published in 2004, mc was cited as being synonymous with epithelial myoepithelial carcinoma . As mc and epithelial myoepithelial carcinoma of the salivary gland are distinguished by the presence or absence of ductal cells, their pulmonary counterparts must also be differentiated . Myoepithelial tumors are low - grade lesions without recurrences or metastasis described after resection, whereas, the rate of metastasis in mc is high, as seen in our case . Our patient represents the first pediatric case, described in the literature, having primitive pulmonary mc . The tumor was peripheral and bilateral, measuring 6 cm and 7 cm, which was in agreement with the literature . In fact, the size of the mc ranged from 15 mm to 130 mm (mean 50.7 mm) [table 1]. Characteristics of pulmonary mc in our case, the histopathological study oriented to the diagnosis of a primitive neuroectodermal tumor or neuroblastoma . The pathological review, with further ihc analysis in france, had concluded the diagnosis of mc . The following markers were found to be useful in myoepithelial carcinoma: cytokeratins (ae1/ae3) and vimentin (reported to be positive in neoplastic myoepithelial cells and negative in normal myoepithelial cells). Other variable markers, such as, ps100, calponin, smooth muscle actin (sma), muscle - specific actin (msa), smooth muscle myosin, and p63 protein, could be positive . However, neoplastic transformation of myoepithelial cells could result in a loss or a modification of their smooth muscle phenotype . In our case, although the eight patients reported in literature were treated with optimal surgery, metastases were reported in seven of them (87.5%) (contralateral lung, forearm, liver, and brain). It was significant that a patient who had not developed metastasis, had the lowest tumor mitotic rate of 5/10 hpfs . This fact reasoned that the mitotic rate could be an important prognostic factor of the clinical outcome and survival in primary myoepithelial carcinoma of the lung . Given the rarity of these tumors, recommendations regarding chemotherapy or radiation, either pre- or postoperatively, are difficult to formulate . The originality of our case is the disappearance of the pulmonary opacity spontaneously, without any treatment . Our case represents, to the best of our knowledge, the first pediatric case having primitive pulmonary mc . The histopathological study familiarizes the diagnosis, but a further ihc study is needed to confirm the diagnosis and to eliminate other etiologies . Surgery represents the main treatment for the operable forms . To the best of our knowledge, we have reported the first case, with spontaneous regression of this tumor, without any treatment.

As environmental and personal sanitation improves, the incidence of typhoidal salmonellosis tends to decrease, while the incidence of non - typhoidal salmonellosis markedly increases, . The most common clinical manifestation of nts is gastroenteritis, and the condition includes bacteremia, focal infection, and an asymptomatic carrier state . Of the manifestations, urinary tract infection (uti) is unusual and rare,, and occurs in immunocompromised individuals, including patients with a malignancy, human immunodeficiency virus infection, or diabetes mellitus and patients receiving corticosteroid therapy or treatment with other immunotherapeutic agents, . Uti caused by nts presents as either pyelonephritis or cystitis,,; cases of hemorrhagic cystitis are extremely rare . We report a case of severe hemorrhagic cystitis caused by nts that resulted in shock and syncope in a patient with uncontrolled diabetes . A 41-year - old man came to the emergency room for a fever that had developed 10 days earlier, and was accompanied by pus - like urine . The patient had watery diarrhea and had lost five kilograms of weight in one month . He had been diagnosed with diabetes mellitus 5 years earlier and his blood sugar level was not well controlled . The patient was a baker, did not have any pets, and did not have a history of recent travel . On admission, his temperature was 38 c, his blood pressure was 110/60 mm hg, and his heart rate was 102 beats / min . Platelets were 209,000/mm, hemoglobin was 13.6 g / dl, hematocrit was 40.9%, bun / creatinine was 34.0/1.0 mg / dl, fasting / postprandial two - hour blood sugar was 330/482 mg / dl, and hba1c was 11.1% . A widal test showed a typhoid o titer of 1:1280 and typhoid h titer of 1:640, and a urine culture grew nts (group d). No bacteria were isolated from the stool or blood culture . On abdomen - pelvis ultrasonography, the urinary bladder was filled with pus, the bladder wall was thickened diffusely (fig . 1a), and hydronephrosis and hydroureter were observed on both sides of the bladder (fig . The level of serum creatinine and urine output remained a consistent level during this period . After 10 days in the hospital, the patient's urine output decreased suddenly and he developed severe lower abdominal distension and syncope . The patient's systolic blood pressure fell to 80 mm hg and hemoglobin to 7.9 g / dl . An emergency ct scan showed that the urinary bladder was severely distended and filled with a mass suspicious of hematoma (fig . 3). However, there was no stone, mass or focal mechanical injury, i.e foley catheter injury . Blood pressure was stabilized after transfusion of three packs of rbc and hemoglobin was elevated to 10.2 g / dl . He responded well to treatment and was discharged in good condition with oral antibiotics and oral hypoglycemic agents . Despite improvements in individual and collective sanitation as well as the careful monitoring of food processing, sporadic episodes and outbreaks of salmonellosis continue to occur in industrialized countries . The overall incidence of typhoidal salmonellosis has decreased, whereas that of non - typhoidal salmonellosis has increased, . Non - typhoidal salmonellosis is a disease of great public health importance . Unlike s. typhi and s. paratyphi, the main mode of transmission is from food products contaminated with animal products or waste, most commonly eggs and poultry, but also undercooked meat, unpasteurized dairy products, seafood, and fresh produce . Nts is an enteroinvasive bacterium and causes infections that may have one of four different clinical presentations . However, invasion beyond the gastrointestinal tract occurs in approximately 5% of patients with nts gastroenteritis, resulting in bacteremia . Extraintestinal manifestations, which have a rare incidence of about 28%, include endocarditis, pericarditis, arteritis, soft tissue infection, uti and pneumonia . The gastrointestinal carrier state is the fourth clinical presentation and is defined as the excretion of nts for months or years after the initial onset of disease . Uti caused by nts is so rare that it comprises only 0.01%3% of positive urinary cultures,, and 3% of nts infections . Nts has been postulated to enter the urinary tract either hematogenously or by direct invasion of fecal flora to the bladder via the urethra . The risk factors of uti caused by nts include old age, chronic illness, immunosuppressive therapy and structural abnormality of the urinary tract . Uti related to nts presents as cystitis, pyelonephritis, renal abscess, or asymptomatic pyuria, . A retrospective analysis of 28 cases of bacteriuria due to nts showed that twenty - one patient (75%) had symptoms of uti (16, cystitis; 3, pyelonephritis; and 2, renal abscess). Another review of nineteen patients with bacteriuria due to nts showed that the frequency of uti due to nts was 0.07% (proportion of positive urine cultures). Eighteen patients (94.7%) had symptoms of uti (12, cystitis; 6, pyelonephritis), and 1 remained asymptomatic . However, case of hemorrhagic cystitis due to nts was very rare . Furthermore, severe hemorrhagic cystitis caused by nts with massive bleeding that resulted in shock and syncope was extremely rare . Uti from salmonella does not differ clinically from uti caused by other members of the enterobacteriaceae . Our patient had uncontrolled diabetes for 5 years and had worked at a job in food handling for a long time . We are not sure of the mode of transmission in our patient's case; however, we propose that he might have been a salmonella carrier or that his illness was caused by bacteremia from a previous gastrointestinal infection . In uncomplicated salmonella gastroenteritis, antibiotic therapy is not recommended because it does not shorten the disease duration . However, in cases of sepsis or local extraintestinal infection, prompt antibiotic administration is needed . Traditionally, antibiotics such as ampicillin, amoxicillin, chloramphenicol, and trimethoprim - sulfamethoxazole are used, but currently the frequency of antimicrobial resistance in salmonella isolates is increasing, . In korea, according to recent reports, group b salmonella is the most common drug - resistant serotype, while the group d serotype has relatively low drug resistance . The treatment of focal extraintestinal salmonella infection often requires both surgical drainage and antibiotic therapy in cases associated with structural abnormality of the urinary tract . Early surgical intervention might be combined with more prolonged therapy to eradicate uti caused by nts, . In this report, we describe a case of hemorrhagic cystitis due to nts, which caused massive bleeding, shock, and syncope in a patient with uncontrolled diabetes.

Binaries composed of neutron stars (nss) and black holes (bhs) have long been of interest to astrophysicists . They provide many important constraints for models of massive star evolution and compact object formation, and are among the leading potential sources for detection by gravitational - wave (gw) observatories . While it remains uncertain whether mergers of compact binaries are an important contributor to the production of r - process elements, they are now thought to be the leading candidate to explain short - duration, hard - spectrum gamma - ray bursts (often abbreviated to short - hard grbs, or merely sgrbs). The first neutron star - neutron star (ns - ns) binary to be observed was psr b1913 + 16, in which a radio pulsar was found to be in close orbit around another ns . In the decades since its discovery, the decay of the orbit of psr b1913 + 16 at exactly the rate predicted by einstein s general theory of relativity (see, e.g., [306, 325]) has provided strong indirect evidence that gravitational radiation exists and is indeed correctly described by general relativity (gr). This measurement led to the 1993 nobel prize in physics for hulse and taylor . According to the lowest - order dissipative contribution from gr, which arises at the 2.5pn level (post - newtonian; where the digit indicates the expansion order in [/c] in the taylor expansion term), and assuming that both nss may be approximated as point masses, a circular binary orbit decays at a rate da / dt = a/gw where a is the binary separation and the gravitational radiation merger timescale gw is given by 1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{array}{*{20}c} {{\tau _ {{\rm{gw}}}} = {5 \over {64}}{{{a^4}} \over {\mu {m^2}}} = {5 \over {64}}{{{a^4}} \over {q(1 + q)m_1 ^ 3}}}\quad\quad\quad\quad\quad\quad\quad\quad\\ {= 2.2 \times {{10}^8}{q^{- 1}}{{(1 + q)}^{- 1}}{{\left({{a \over {{r _ \odot}}}} \right)}^4}{{\left({{{{m_1}} \over {1.4{m _ \odot}}}} \right)}^{- 3}}{\rm{yr}},}\\ \end{array}$$\end{document} where m1, m2, and m m1 + m2 are the individual ns masses and the total mass of the binary, = m1m2/m is the reduced mass, q = m2/m1 is the binary mass ratio, and we assume geometrized units where g = c = 1 (as we do throughout this paper, unless otherwise noted). The timescale for an elliptical orbit is shorter, and it can be shown that eccentricity is reduced over time by gw emission, leading to a circularization of orbits as they decay . A quick integration shows that the time until merger is given by merge = gw/4 . The luminosity of such systems in gravitational radiation is 2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{array}{*{20}c} {{l_{{\rm{gw}}}} = - {{d{e_{{\rm{gw}}}}} \over {dt}} = {{32} \over 5}{{{\mu ^2}{m^3}} \over {{a^5}}} = {{32} \over 5}{{m_1 ^ 2m_2 ^ 2({m_1} + {m_2})} \over {{a^5}}}}\quad\quad\quad\quad\\ {= 5.34 \times {{10}^{32}}{q^2}(1 + q){{\left({{{{m_1}} \over {1.4{m _ \odot}}}} \right)}^5}{{\left({{a \over {{r _ \odot}}}} \right)}^{- 5}}{\rm{erg}}/{\rm{s}}}\quad\;\;\\ {= 8.73 \times {{10}^{51}}{q^2}(1 + q){{\left({{{{m_1}} \over {1.4{m _ \odot}}}} \right)}^5}{{\left({{a \over {100\;{\rm{km}}}}} \right)}^{- 5}}{\rm{erg}}/{\rm{s,}}}\\ \end{array}$$\end{document} which, at the end of a binary s lifetime, when the components have approached to within a few ns radii of each other, is comparable to the luminosity of all the visible matter in the universe (10 the resulting strain amplitude observed at a distance d from the source (assumed to be oriented face - on) is given approximately by 3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$h = {{4{m_1}{m_2}} \over {ad}} = 5.53 \times {10^{- 23}}q{\left({{{{m_1}} \over {1.4{m _ \odot}}}} \right)^2}{\left({{a \over {100\;{\rm{km}}}}} \right)^{- 1}}{\left({{d \over {100\;{\rm{mpc}}}}} \right)^{- 1}},$$\end{document} at a characteristic frequency 4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${f_{gw}} = 2{f_{{\rm{orb}}}} = {1 \over \pi}\sqrt {{m \over {{a^3}}}} = 194{\left({{m \over {2.8{m _ \odot}}}} \right)^{1/2}}{\left({{a \over {100\;{\rm{km}}}}} \right)^{- 3/2}}{\rm{hz}}.$$\end{document} the first measurement that will likely be made with direct gw observations is the orbital decay rate, with the period evolving (for the circular case) according to the relation 5\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${{dt} \over {dt}} = - {{192\pi} \over 5}{({{\mathcal m}_c}\omega)^{5/3}},$$\end{document} where t is the orbital period and the angular frequency, and thus the chirp mass, 6\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${{\mathcal m}_c} \equiv {\mu ^{3/5}}{m^{2/5}} = m_1^{3/5}m_2^{3/5}{({m_1} + {m_2})^{- 1/5}},$$\end{document} is likely to be the easiest parameter to determine from gw observations . Several ns - ns systems are now known, including psr j0737 - 3039, a binary consisting of two observed pulsars, which allows for the prospect of even more stringent tests of gr . Even with the handful of observed sources to date, one may use this sample to place empirical limits on the expected rate of ns - ns mergers and to constrain the many parameters that enter into population synthesis calculations . With regard to the former, the very short merger timescale for j0737, merge = 85 myr, makes it especially important for estimating the overall rate of ns - ns mergers since it is a priori very unlikely to detect a system with such a short lifetime . Although black hole - neutron star (bh - ns) binaries are expected to form through the same processes as ns - ns binaries, none has been detected to date . This is generally thought to reflect their lower probability of detection in current surveys, in addition to intrinsically smaller numbers compared to ns - ns systems . Bh - ns systems are an expected byproduct of binary stellar evolution, and properties of the population may be inferred from population synthesis studies calibrated to the observed ns - ns sample (see, e.g.,). In this review, we will summarize the current state of research on relativistic mergers, beginning in section 2 with a description of the astrophysical processes that produce merging binaries and the expected parameters of these systems . The phases of the merger are briefly described in section 3 . In section 4, we discuss the numerical techniques used to generate quasi - equilibrium (qe) sequences of ns - ns configurations, and we summarize the qe calculations that have been performed . These sequences yield a lot of information about ns physics, particularly with regard to the nuclear matter equation of state (eos). They also serve as initial data for dynamical merger calculations, which we discuss next, focusing in turn on the numerical hydrodynamics techniques used to compute mergers and the large body of results that has been generated, in sections 5 and 6, respectively . We pay particular attention to how numerical studies have taken steps toward answering a number of questions about the expected gw and electromagnetic (em) emission from merging binaries, and we discuss briefly the possibility that they may be the progenitors of sgrbs and a source of r - process elements . While most of this review focuses on ns - ns mergers, many of the methods used to study ns - ns binaries are also used to evolve bh - ns binaries, and it has become clear that both merger types may produce similar observational signatures as well . For a review focusing on bh - ns merger calculations, merging ns - ns and bh - ns binaries, i.e., those for which the merger timescale is smaller than the hubble time, are typically formed through similar evolutionary channels in stellar field populations of galaxies (both may also be formed through dynamical processes in the high - density cores of some star clusters, but the overall populations are smaller and more poorly constrained; see for a review). It is difficult to describe the evolutionary pathways that form ns - ns binaries without discussing bh - ns binaries as well, and it is important to note that the joint distribution of parameters such as merger rates and component masses that we could derive from simultaneous gw and em observations will constrain the underlying physics of binary stellar evolution much more tightly than observing either source alone . Population synthesis calculations for both merging ns - ns and bh - ns binaries typically favor the standard channel in which the first - born compact object goes through a common - envelope (ce) phase, although other models have been proposed, including recent ones where the progenitor binary is assumed to have very nearly - equal mass components that leave the main sequence and enter a ce phase prior to either undergoing a supernova [42, 54]. Simulations of this latter process have shown that close ns - ns systems could indeed be produced by twin giant stars with core masses 0.15 m, though twin main sequence stars typically merge during the contact phase . In the standard channel (see, e.g., [44, 178], and figure 1 for an illustration of the process), the progenitor system is a high - mass binary (with both stars of mass m 810 m to ensure a pair of supernovae). The more massive primary evolves over just a few million years before it leaves the main sequence, passes through its giant phase, and undergoes a type ib, ic, or ii supernova, leaving behind what will become the heavier compact object (co): the bh in a bh - ns binary or the more massive ns in an ns - ns binary . The secondary then evolves off the main sequence in turn, triggering a ce phase when it reaches the giant phase and overflows its roche lobe . Dynamical friction shrinks the binary separation dramatically, until sufficient energy is released to expel the envelope . Without this step, binaries would remain too wide to merge through the emission of gws within a hubble time . Eventually, the exposed, helium - rich core of the secondary undergoes a supernova, either unbinding the system or leaving behind a tight binary, depending on the magnitude and orientation of the supernova kick . Figure 1cartoon showing standard formation channels for close ns - ns binaries through binary stellar evolution . Cartoon showing standard formation channels for close ns - ns binaries through binary stellar evolution . This evolutionary pathway has important effects on the physical parameters of ns - ns and bh - ns binaries, leading to preferred regions in phase space . The primary, which can accrete some matter during the ce phase, or during an episode of stable mass transfer from the companion helium star, should be spun up to rapid rotation (see for a review). In ns - ns binaries, we expect that this process will also reduce the magnetic field of the primary down to levels seen in recycled pulsars, typically up to four orders of magnitude lower than for young pulsars [180, 73]. The secondary ns, which never undergoes accretion, is likely to spin down rapidly from its nascent value, but is likelier to maintain a stronger magnetic field . While this evolutionary scenario has been well studied for several decades, many aspects remain highly uncertain . In particular: the ce efficiency, which helps to determine the expected range of binary separations and the mass of the primary compact object after its accretion phase, remains very poorly constrained [229, 37, 78, 338]. If too much matter is accreted by the ns, it may undergo accretion - induced collapse to a bh, though the growing body of observed ns - ns systems does help place constraints on the allowed range of accretion - related parameters.the exact relation between a star s initial mass and the eventual compact object mass is better understood, but significant theoretical uncertainties remain, and the relation is sensitive to the metallicity (often unknown), mainly through the effects of mass loss in stellar winds, and to the details of the explosion itself [336, 205].the maximum allowed ns mass will affect whether the primary remains a ns or undergoes accretion - induced collapse to a bh; its value is dependent upon the as - yet undetermined nuclear matter eos . At present, the strongest limit is set by the binary millisecond pulsar psr j1614 - 2230, for which a mass of mns = 1.97 0.04 m was determined by shapiro time delay measurements . Determining the ns eos from gw observations may eventually provide stronger constraints [237, 221, 184], including a determination of whether supernova remnants are indeed classical hadronic ns or instead have cores consisting of some form of strange quark matter or other elementary particle condensate [223, 119, 230, 120, 23, 5].the supernova kick velocity distribution is only partially understood, leading to uncertainties as to which systems will become unbound after the second explosion [133, 324, 219, 152]. The ce efficiency, which helps to determine the expected range of binary separations and the mass of the primary compact object after its accretion phase, remains very poorly constrained [229, 37, 78, 338]. If too much matter is accreted by the ns, it may undergo accretion - induced collapse to a bh, though the growing body of observed ns - ns systems does help place constraints on the allowed range of accretion - related parameters . The exact relation between a star s initial mass and the eventual compact object mass is better understood, but significant theoretical uncertainties remain, and the relation is sensitive to the metallicity (often unknown), mainly through the effects of mass loss in stellar winds, and to the details of the explosion itself [336, 205]. The maximum allowed ns mass will affect whether the primary remains a ns or undergoes accretion - induced collapse to a bh; its value is dependent upon the as - yet undetermined nuclear matter eos . At present, the strongest limit is set by the binary millisecond pulsar psr j1614 - 2230, for which a mass of mns = 1.97 0.04 m was determined by shapiro time delay measurements . Determining the ns eos from gw observations may eventually provide stronger constraints [237, 221, 184], including a determination of whether supernova remnants are indeed classical hadronic ns or instead have cores consisting of some form of strange quark matter or other elementary particle condensate [223, 119, 230, 120, 23, 5]. The supernova kick velocity distribution is only partially understood, leading to uncertainties as to which systems will become unbound after the second explosion [133, 324, 219, 152]. Given all these uncertainties, it is reassuring that most estimates of the ns - ns and bh - ns merger rate, expressed either as a rate of mergers per myr per milky way equivalent galaxy or as a predicted detection rate for ligo (the laser interferometer gravitational - wave observatory) and virgo (see section 5.5 below), agree to within 12 orders of magnitude, which is comparable to the typical uncertainties that remain once all possible sources of error are folded into a population synthesis model . In table 1, we show the predicted detection rates of ns - ns and bh - ns mergers for both the first generation ligo detectors (ligo), which ran at essentially their design specifications, and the advanced ligo (adligo) configuration due to go online in 2015 ., the authors used the observed parameters of close binary pulsar systems to estimate the galactic ns - ns merger rate empirically (such results do not constrain the bh - ns merger rate). In [198, 128], the two groups independently estimated the binary merger rate from the observed statistics of sgrbs . In these cases, one does not get an independent prediction for the ns - ns and bh - ns merger rate, but rather some linear combination of the two . In both cases, the authors estimated that, if ns - ns and bh - ns mergers are roughly equal contributors to the observed sgrb sample, ligo will detect about an order of magnitude more bh - ns mergers since their higher mass allows them to be seen over a much larger volume of the universe . As they both noted, should either type of system dominate the sgrb sample, we would expect a doubling of ligo detections for that class, and lose our ability to constrain the rate of the other using this method . Many population synthesis models have attempted to understand binary evolution within our galaxy by starting from a basic parameter survey of the various assumptions made about ce evolution, supernova kick distributions, and other free parameters . In [323, 79], population synthesis models are normalized by estimates of the star formation history of the milky way . In [140, 218], parameter choices are judged based on their ability to reproduce the observed galactic binary pulsar sample, which allows posterior probabilities to be applied to each model in a bayesian framework . A review by the ligo collaboration of this issue may be found in . Table 1estimated initial and advanced ligo rates for bh - ns and ns - ns mergers from population synthesis calculations and other methods . The methods used are, in order, empirical constraints from the observed sample of binary pulsars (empirical), constraints on the combined ns - ns / bh - ns merger rate assuming that they are the progenitors of short - hard gamma - ray bursts (sgrbs), population synthesis models calibrated to the star formation rate in the milky way (pop . Synth . Sfr), and population synthesis calibrated against the observed galactic binary pulsar sample (pop . Synth . Ns - ns). We note that observations of binary pulsars do not yield constraints for bh - ns binaries . Sgrb observations may produce constraints on ns - ns merger rates, bh - ns, merger rates, or both, depending on which sources are the true progenitors, but this remains unclear . The official review of these results and their implications by the ligo / virgo scientific collaborations may be found in .authorns - nsbh - nsmethodligoadligoligoadligokim et al . Ns - ns estimated initial and advanced ligo rates for bh - ns and ns - ns mergers from population synthesis calculations and other methods . The methods used are, in order, empirical constraints from the observed sample of binary pulsars (empirical), constraints on the combined ns - ns / bh - ns merger rate assuming that they are the progenitors of short - hard gamma - ray bursts (sgrbs), population synthesis models calibrated to the star formation rate in the milky way (pop . Synth . Sfr), and population synthesis calibrated against the observed galactic binary pulsar sample (pop we note that observations of binary pulsars do not yield constraints for bh - ns binaries . Sgrb observations may produce constraints on ns - ns merger rates, bh - ns, merger rates, or both, depending on which sources are the true progenitors, but this remains unclear . Therefore, the table quotes results assuming a roughly equal split between the two . The official review of these results and their implications by the ligo / virgo scientific collaborations may be found in . Should the next generation of gw interferometers begin to detect a statistically significant number of merger events including nss, it should be possible to constrain several astrophysical parameters describing binary evolution much more accurately . These include the relative numbers of bh - ns and ns - ns mergers: interferometric detections are sensitive to a binary s chirp mass (see eq . 6), and to the binary mass ratio as well [57, 11, 321, 320] if the signal - to - noise ratio is sufficiently high . Even if the merger signal takes place at frequencies too high to fall within the ligo band, it should still be possible in most cases to determine whether the primary s mass exceeds the maximum mass of a ns.the mass ratio probability distribution for merging binary systems: if both binary components masses are determined, we will be able to constrain both the bh mass distribution in merging binaries and the ns mass ratio distribution . Knowledge of the former would determine, e.g., whether the current low estimates for the mass accreted onto the primary co core during the ce phase are correct, as this model predicts that bh masses in close bh - ns binaries should cluster narrowly around mbh = 10 m. previous calculations assuming larger accreted masses typically favored mass ratios closer to unity, since the primaries often began as nss and underwent accretion - induced collapse to a bh during the ce phase . Whose zero - age main sequence (or zams) masses are so close that they both leave the main sequence before either undergoes a supernova, play a significant role in the merging ns - ns population . The relative numbers of bh - ns and ns - ns mergers: interferometric detections are sensitive to a binary s chirp mass (see eq . 6), and to the binary mass ratio as well [57, 11, 321, 320] if the signal - to - noise ratio is sufficiently high . Even if the merger signal takes place at frequencies too high to fall within the ligo band, it should still be possible in most cases to determine whether the primary s mass exceeds the maximum mass of a ns . The mass ratio probability distribution for merging binary systems: if both binary components masses are determined, we will be able to constrain both the bh mass distribution in merging binaries and the ns mass ratio distribution . Knowledge of the former would determine, e.g., whether the current low estimates for the mass accreted onto the primary co core during the ce phase are correct, as this model predicts that bh masses in close bh - ns binaries should cluster narrowly around mbh = 10 m. previous calculations assuming larger accreted masses typically favored mass ratios closer to unity, since the primaries often began as nss and underwent accretion - induced collapse to a bh during the ce phase . The ns - ns mass distribution will allow for tests of whether twins, i.e., systems whose zero - age main sequence (or zams) masses are so close that they both leave the main sequence before either undergoes a supernova, play a significant role in the merging ns - ns population . While advanced ligo or another interferometer will likely be required to make the first direct observations of ns - ns mergers and their immediate aftermath, it is possible that more than just the high - energy prompt emission from mergers may be observable using em telescopes . Although the particular candidate source they identified resulted from a pointing error, nakar and piran suggest that the mass ejection from mergers should yield an observable radio afterglow, although the afterglows may be too faint to be seen by current telescopes at the observed distances of existing localized sgrbs . While such outbursts could also result from a supernova, the luminosity required would be an order of magnitude larger than those previously observed . Given the length and timescales characterizing radio bursts, no ns - ns simulation has been able to address the model directly, but it certainly seems plausible that the time - variable magnetic fields within a stable hypermassive remnant could generate enough em energy to power the resulting radio burst . If mergers produce sufficiently large ejecta masses, mej 10 m, r - process nuclear reactions may produce a kilonova afterglow one day after a merger with a v - band optical luminosity 10 erg / s (roughly 1000 times brighter than a classical nova). These potential em observations of mergers are likely to spur further research into the amount and velocity of merger ejecta, which could then be coupled to a larger - scale astrophysical simulation of the potential optical and radio afterglows . The qualitative evolution of ns - ns mergers, or indeed any compact binary merger, has long been understood, and may be divided roughly into inspiral, merger, and ringdown phases, each of which presents a distinct set of challenges for numerical modeling and detection . As a visual aid, we include a cartoon summary in figure 2, originally intended to describe black hole - black hole (bh - bh) mergers, and attributed to kip thorne . Drawn before the advent of the supercomputer simulations it envisions, we note that merger waveforms for all compact binary mergers have proven to be much smoother and simpler than shown here . To adapt it to ns - ns mergers, we note that nss are generally assumed to be essentially non - spinning, and that the ringdown phase may describe either a newly formed bh or a ns that survives against gravitational collapse . Figure 2cartoon picture of a compact binary coalescence, drawn for a bh - bh merger but applicable to ns - ns mergers as well (although nss are generally assumed to be non - spinning). Cartoon picture of a compact binary coalescence, drawn for a bh - bh merger but applicable to ns - ns mergers as well (although nss are generally assumed to be non - spinning). Image adapted from kip thorne . Summarizing the evolution of the system through the three phases: after a pair of supernovae yields a relatively tight ns - ns binary, the orbital separation decays over long timescales through gw emission, a phase that takes up virtually all of the lifetime of the binary except the last few milliseconds . During the inspiral phase, binary systems may be accurately described by qe formalisms, up until the point where the gravitational radiation timescale becomes comparable to the dynamical timescale . The evolution in time is well - described by pn expansions, currently including all terms to 3pn, though small deviations can arise because of finite - size effects, especially at smaller separations (see eqs . 16 for the lowest - order 2.5pn expressions for circular inspirals).once the binary separation becomes no more than a few times the radii of the two nss, binaries rapidly become unstable . The stars plunge together, following the onset of dynamical instability, and enter the merger phase, requiring full gr simulations to understand the complicated hydrodynamics that ensues . According to all simulations to date, if the ns masses are nearly equal, the merger resembles a slow collision, while if the primary is substantially more massive than the secondary the latter will be tidally disrupted during the plunge and will essentially accrete onto the primary . Since the nss are most likely irrotational just prior to merging, there is a substantial velocity discontinuity at the surface of contact, leading to rapid production of vortices . Meanwhile, some fraction of the mass may be lost through the outer lagrange points of the system to form a disk around the central remnant . This phase yields the maximum gw amplitude predicted by numerical simulations, but with a signal much simpler and more quasi - periodic than in the original cartoon version . Gw emission during the merger encodes important information about the ns eos, particularly the gw frequency fcut at which the binary orbit becomes unstable (see eq . Meanwhile, the merger itself may generate the thermal energy that eventually powers a sgrb, which occurs when the neutrinos and anti - neutrinos produced by shock - heated material annihilate around the remnant to produce high - energy photons.finally, the system will eventually settle into a new, dynamically stable configuration through a phase of ringdown, with a particular form for the gw signal that depends on the remnant s mass and rotational profile . If the remnant is massive enough, it will be gravitationally unstable and collapse promptly to form a spinning bh . Should the remnant mass be less than the maximum mass miso supported by the nuclear matter eos for an isolated, non - rotating configuration, it will clearly remain stable forever . Instead a remnant that is supramassive, i.e., with a mass above the isolated stationary mass limit but below that allowed for a uniformly rotating ns (typically 1.2 miso, with very weak dependence on the eos; see, e.g., [147, 70, 71], and references therein) may become unstable . Supramassive remnants are stable against gravitational collapse unless angular momentum losses, either via pulsar - type emission or magnetic coupling to the outer disk, can drive the angular velocity below the critical value for stability . If the remnant has a mass above the supramassive limit, it may fall into the hypermassive regime, where it is supported against gravitational collapse by rapid differential rotation . Hypermassive ns (hmns) remnants can have significantly larger masses, depending on the eos (see, e.g., [31, 275, 86, 293, 114]), and will survive for timescales much longer than the dynamical time, undergoing a wide variety of oscillation modes . They can emit gws should a triaxial configuration yield a significant quadrupole moment, and potentially eject mass into a disk around the remnant . Eventually, some combination of radiation reaction and magnetic and viscous dissipation will dampen the differential rotation and lead the hmns to collapse to a spinning bh, again with the possibility that it may be surrounded by a massive disk that could eventually accrete . The energy release during hmns collapse provides the possibility for a delayed sgrb, in which the peak gw emission occurs during the initial merger event, but the gamma - ray emission, powered by the collapse of the hmns to a bh, occurs significantly later.most calculations indicate that a geometrically thick, lower - density, gravitationally bound disk of material will surround whatever remnant is formed . Such disks, which are geometrically thick, are widely referred to as tori throughout the literature, though there is no clear distinction between the two terms, and we will use disk throughout this paper to describe generically the bound material outside a central merger remnant . Such disks are expected to heat up significantly, and much of the material will eventually accrete onto the central remnant, possibly yielding observable em emission . Given the low densities and relatively axisymmetric configuration expected, disks are not significant gw emitters . There may be gravitationally unbound outflow from mergers as well, though dynamical simulations neither confirm nor deny this possibility yet . Such outflows, which can be the sites of exotic nuclear reactions, are frequently discussed in the context of r - process element formation, but their inherently low densities make them difficult phenomena to model numerically with high accuracy . After a pair of supernovae yields a relatively tight ns - ns binary, the orbital separation decays over long timescales through gw emission, a phase that takes up virtually all of the lifetime of the binary except the last few milliseconds . During the inspiral phase, binary systems may be accurately described by qe formalisms, up until the point where the gravitational radiation timescale becomes comparable to the dynamical timescale . The evolution in time is well - described by pn expansions, currently including all terms to 3pn, though small deviations can arise because of finite - size effects, especially at smaller separations (see eqs . Once the binary separation becomes no more than a few times the radii of the two nss, binaries rapidly become unstable . The stars plunge together, following the onset of dynamical instability, and enter the merger phase, requiring full gr simulations to understand the complicated hydrodynamics that ensues . According to all simulations to date, if the ns masses are nearly equal, the merger resembles a slow collision, while if the primary is substantially more massive than the secondary the latter will be tidally disrupted during the plunge and will essentially accrete onto the primary . Since the nss are most likely irrotational just prior to merging, there is a substantial velocity discontinuity at the surface of contact, leading to rapid production of vortices . Meanwhile, some fraction of the mass may be lost through the outer lagrange points of the system to form a disk around the central remnant . This phase yields the maximum gw amplitude predicted by numerical simulations, but with a signal much simpler and more quasi - periodic than in the original cartoon version . Gw emission during the merger encodes important information about the ns eos, particularly the gw frequency fcut at which the binary orbit becomes unstable (see eq . Meanwhile, the merger itself may generate the thermal energy that eventually powers a sgrb, which occurs when the neutrinos and anti - neutrinos produced by shock - heated material annihilate around the remnant to produce high - energy photons . Finally, the system will eventually settle into a new, dynamically stable configuration through a phase of ringdown, with a particular form for the gw signal that depends on the remnant s mass and rotational profile . If the remnant is massive enough, it will be gravitationally unstable and collapse promptly to form a spinning bh . Should the remnant mass be less than the maximum mass miso supported by the nuclear matter eos for an isolated, non - rotating configuration, it will clearly remain stable forever . Instead a remnant that is supramassive, i.e., with a mass above the isolated stationary mass limit but below that allowed for a uniformly rotating ns (typically 1.2 miso, with very weak dependence on the eos; see, e.g., [147, 70, 71], and references therein) may become unstable . Supramassive remnants are stable against gravitational collapse unless angular momentum losses, either via pulsar - type emission or magnetic coupling to the outer disk, can drive the angular velocity below the critical value for stability . If the remnant has a mass above the supramassive limit, it may fall into the hypermassive regime, where it is supported against gravitational collapse by rapid differential rotation . Hypermassive ns (hmns) remnants can have significantly larger masses, depending on the eos (see, e.g., [31, 275, 86, 293, 114]), and will survive for timescales much longer than the dynamical time, undergoing a wide variety of oscillation modes . They can emit gws should a triaxial configuration yield a significant quadrupole moment, and potentially eject mass into a disk around the remnant . Eventually, some combination of radiation reaction and magnetic and viscous dissipation will dampen the differential rotation and lead the hmns to collapse to a spinning bh, again with the possibility that it may be surrounded by a massive disk that could eventually accrete . The energy release during hmns collapse provides the possibility for a delayed sgrb, in which the peak gw emission occurs during the initial merger event, but the gamma - ray emission, powered by the collapse of the hmns to a bh, occurs significantly later . Most calculations indicate that a geometrically thick, lower - density, gravitationally bound disk of material will surround whatever remnant is formed . Tori throughout the literature, though there is no clear distinction between the two terms, and we will use disk throughout this paper to describe generically the bound material outside a central merger remnant . Such disks are expected to heat up significantly, and much of the material will eventually accrete onto the central remnant, possibly yielding observable em emission . Given the low densities and relatively axisymmetric configuration expected, disks are not significant gw emitters . There may be gravitationally unbound outflow from mergers as well, though dynamical simulations neither confirm nor deny this possibility yet . Such outflows, which can be the sites of exotic nuclear reactions, are frequently discussed in the context of r - process element formation, but their inherently low densities make them difficult phenomena to model numerically with high accuracy . Since this three - phase picture is applicable to bh - ns mergers as well, it is worthwhile to compare the two merger processes at a qualitative level to understand the key similarities and differences . Inspiral for bh - ns mergers is also well - described by pn expansions up until shortly before the merger, but the parameter space is fundamentally different . First, since bhs are heavier than nss, the dynamics can be quite different . Also, since bhs may be rapidly - spinning (i.e., have dimensionless spin angular momenta as large as j / m 1), spin - orbit couplings can play a very important role in the orbital dynamics of the binary, imprinting a large number of oscillation modes into the gw signal (see, e.g., [126, 57]). From a practical standpoint, the onset of instability in bh - ns mergers should be easier to detect for ligo, virgo, and other interferometers, since the larger mass of bh - ns binaries implies that instability occurs at lower gw frequencies (see eq . 4, noting that the separation a at which mass - transfer begins scales roughly proportionally to the bh mass). The onset of instability of a bh - ns binary is determined by the interplay of the binary mass - ratio, ns compactness, and bh spin, with the first of these playing the largest role (see figures 1315 of and the summary in). In general, systems with high bh masses and/or more compact nss tend to reach a minimum in the binding energy as the radius increases, leading to a dynamical orbital instability that occurs near the classical innermost stable circular orbit (isco). In these cases, the ns plunges toward the bh before the onset of tidal disruption, and is typically swallowed whole . Leaving behind almost no material to form a disk . The gw emission from such systems is sharply curtailed after the merger event, yielding only a low - amplitude, high - frequency, rapidly - decaying ringdown signal (see, e.g.,). Numerical calculations have shown that even in borderline cases between dynamical instability and mass - shedding the ns is essentially swallowed whole, especially in cases where the bh in either non - spinning or spinning in the retrograde direction, which pushes the isco out to larger radii (see, e.g., [290, 289, 283, 91, 94]). A richer set of phenomena occurs when the bh - ns mass ratio is closer to unity, the ns is less compact, the bh has a prograde spin direction, or more generally, some combination of those factors . In such cases, the ns will reach the mass - shedding limit prior to dynamical instability, and be tidally disrupted . Unlike what was described in semi - analytic newtonian models (see, e.g., [68, 228, 77]) and seen in some early newtonian and quasi - relativistic simulations (see, e.g., [165, 166, 138], stable mass transfer, in which angular momentum transfer via mass - shedding halts the inspiral, has never been seen in full gr calculations, nor even in approximate gr models (see the discussion in). Even so, unstable mass transfer can produce a substantial disk around the bh, though in every gr simulation to data the substantial majority of the ns matter is accreted promptly by the bh (see for a detailed summary of all current results). The exact structure of the disk and its projected lifetime depend on the binary system parameters, with the binary mass ratio and spin both important in determining the disk mass and the bh spin orientation critical for determining both the disk s vertical structure and its thermodynamic state given the shock heating that occurs during the ns disruption . In general, the mass and temperature of the post - merger disks are comparable to those seen in some ns - ns mergers, and inasmuch as either is a plausible sgrb progenitor candidate then both need to be viewed as such . To date, no calculation performed in full gr has found any bound and self - gravitating ns remnant left over after the merger, including both ns cores that survive the initial onset of mass transfer by recoiling outward (predicted for cases in which stable mass transfer was thought possible, as noted above) or those in which bound objects form through fragmentation of the circum - bh disk . Motivated by observations of wide - ranging timescales for x - ray flares in both long and short grbs, the latter channel has been suggested to occur in collapsars and mentioned in the context of mergers, possibly on longer timescales than current simulations permit . Even so, there is no analogue to the hmns state that may result from ns - ns mergers, nor any mechanism for a delayed sgrb as provided by hmns collapse . Constructing qe sequences for a given set of ns parameters requires sophisticated numerical schemes, but not supercomputer - scale resources, as we discuss in section 4 below, focusing first on the numerical techniques used to construct qe binary data in gr, and the astrophysical information contained in the gw emission during the inspiral phase . Merger and ringdown, on the other hand, typically require large - scale numerical simulations, including some of the largest calculations performed at major supercomputer centers, as we discuss in detail section 5 and 6 below . To illustrate the various physical processes that occur during ns - ns mergers, we show the evolution of three different ns - ns merger simulations in figures 3, 4, and 5, taken from figures 46 of . In figure 3, we see the merger of two equal - mass nss, each of mass mns = 1.4 m, described by the apr (akmal - pandharipande - ravenhall) eos . In the second panel, clear evidence of tidal lags is visible shortly after first contact, leading to a slightly off - center collision pattern . By the third panel, an ellipsoidal hmns has been formed, surrounded by a disk of material of lower density, which gradually relaxes to form a more equilibrated hmns by the final panel . In figure 4, we see a merger of two slightly heavier equal - mass nss with mns = 1.5 m. in this case, the deeper gravitational potential limits the amount of mass that goes into the disk, and once a bh is formed (with a horizon indicated by the dashed blue circle in the final panel) it accretes virtually all of the rest mass initially present in the two nss, with only 0.004% of the total remaining outside the horizon . Figure 3isodensity contours and velocity profile in the equatorial plane for a merger of two equal - mass nss with mns = 1.4 m assumed to follow the apr model for the ns eos . Figure 4isodensity contours and velocity profile in the equatorial plane for a merger of two equal - mass nss with mns = 1.5 m assumed to follow the apr model for the ns eos . With a higher mass than the remnant shown in figure 3, the remnant depicted here collapses promptly to form a bh, its horizon shown by the dashed blue circle, absorbing all but 0.004% of the total rest mass from the original system . Figure 5isodensity contours and velocity profile in the equatorial plane for a merger of two unequal - mass nss with m1 = 1.3 m and m2 = 1.6 m, with both assumed to follow the apr model for the ns eos . In unequal - mass mergers, the lower mass ns is tidally disrupted during the merger, forming a disk - like structure around the heavier ns . In this case, the total mass of the remnant is sufficiently high for prompt collapse to a bh, but 0.85% of the total mass remains outside the bh horizon at the end of the simulation, which is substantially larger than for equal - mass mergers with prompt collapse (see figure 4). / m0 vs. dimensionless orbital frequency m0, where m0 is the total adm (arnowitt - deser - misner) mass of the two components at infinite separation, for two qe ns - ns sequences that assume a piecewise polytropic ns eos . The equal - mass case assumes mns = 1.35 m for both nss, while the unequal - mass case assumes m1 = 1.15 m and m2 = 1.55 m. the thick curves are the numerical results, while the thin curves show the results from the 3pn approximation . The lack of any minimum suggests that instability for these configurations occurs at the onset of mass shedding, and not through a secular orbital instability . Isodensity contours and velocity profile in the equatorial plane for a merger of two equal - mass nss with mns = 1.4 m assumed to follow the apr model for the ns eos . Isodensity contours and velocity profile in the equatorial plane for a merger of two equal - mass nss with mns = 1.5 m assumed to follow the apr model for the ns eos . With a higher mass than the remnant shown in figure 3, the remnant depicted here collapses promptly to form a bh, its horizon shown by the dashed blue circle, absorbing all but 0.004% of the total rest mass from the original system . Isodensity contours and velocity profile in the equatorial plane for a merger of two unequal - mass nss with m1 = 1.3 m and m2 = 1.6 m, with both assumed to follow the apr model for the ns eos . In unequal - mass mergers, the lower mass ns is tidally disrupted during the merger, forming a disk - like structure around the heavier ns . In this case, the total mass of the remnant is sufficiently high for prompt collapse to a bh, but 0.85% of the total mass remains outside the bh horizon at the end of the simulation, which is substantially larger than for equal - mass mergers with prompt collapse (see figure 4). Dimensionless binding energy eb / m0 vs. dimensionless orbital frequency m0, where m0 is the total adm (arnowitt - deser - misner) mass of the two components at infinite separation, for two qe ns - ns sequences that assume a piecewise polytropic ns eos . While the unequal - mass case assumes m1 = 1.15 m and m2 = 1.55 m. the thick curves are the numerical results, while the thin curves show the results from the 3pn approximation . The lack of any minimum suggests that instability for these configurations occurs at the onset of mass shedding, and not through a secular orbital instability . Image reproduced by permission from figure 16 of, copyright by aas . In figure 5, we see the merger of an unequal - mass binary, with masses m1 = 1.3 m and m2 = 1.6 m. in this case, the heavier ns partially disrupts the lighter ns prior to merger, leading to the secondary ns being accreted onto the primary . In this case, a much more massive disk is formed and, even after a bh forms in the center of the remnant, a substantial amount of matter, representing 0.85% of the total mass, remains outside the horizon . Later accretion of this material could potentially release the energy required to power a sgrb . While dynamical calculations are required to understand the gw and em emission from bh - ns and ns - ns mergers, some of the main qualitative features of the signals may be derived directly from qe sequences . From the variation of total system energy with binary angular velocity along a given sequence, it is possible to construct an approximate gw energy spectrum degw / df immediately from qe results, essentially by performing a numerical derivative (see figure 6). Doing so for a number of different sequences makes it possible to identify key frequencies where tidal effects may become measurable and to identify these with binary parameters such as the system mass ratio and ns radius . Similarly, since qe sequences should indicate whether a binary begins to shed mass prior to passage through the isco (see figure 7), one may be able to classify observed signals into mass - shedding and non - mass - shedding events, and to use the critical point dividing those cases to help constrain the ns eos . Single - parameter estimates have been derived for ns - ns binaries using qe sequences (and for bh - ns binaries using qe and dynamical calculations). Ns - ns binaries typically approach instability at frequencies fgw 1 khz, where laser shot noise is severely degrading the sensitivity of an interferometer detector . To observe isco - related effects with higher signal - to - noise, it may be necessary to operate gw observatories using narrow - band signal recycling modes, in which the sensitivity in a narrow range of frequencies is enhanced at the cost of lower sensitivity to broadband signals . Figure 7mass - shedding indicator \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\chi \equiv {\left({{{\partial (\ln \,h)} \over {\partial r}}} \right)_{{\rm{eq}}}}/{\left({{{\partial (\ln \,h)} \over {\partial r}}} \right)_{{\rm{pole}}}}$\end{document} vs. orbital frequency m0, where h is the fluid enthalpy and the derivative is measured at the ns surface in the equatorial plane toward the companion and toward the pole in the direction of the angular momentum vector, for a series of qe ns - ns sequences assuming equal - mass components . Here, = 1 corresponds to a spherical ns, while = 0 indicates the onset of mass shedding . More massive nss are more compact, and thus able to reach smaller separations and higher angular frequencies before mass shedding gets underway . Mass - shedding indicator \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\chi \equiv {\left({{{\partial (\ln \,h)} \over {\partial r}}} \right)_{{\rm{eq}}}}/{\left({{{\partial (\ln \,h)} \over {\partial r}}} \right)_{{\rm{pole}}}}$\end{document} vs. orbital frequency m0, where h is the fluid enthalpy and the derivative is measured at the ns surface in the equatorial plane toward the companion and toward the pole in the direction of the angular momentum vector, for a series of qe ns - ns sequences assuming equal - mass components . Here, = 1 corresponds to a spherical ns, while = 0 indicates the onset of mass shedding . More massive nss are more compact, and thus able to reach smaller separations and higher angular frequencies before mass shedding gets underway . It is important to note that, while the potential parameter space for ns eos models is still very large, a much smaller set may serve to classify models for comparison with the first generation of gw detections . Indeed, by breaking up the eos into piecewise polytropic segments, one may use as few as four parameters to roughly approximate all known eos models, including standard nuclear models as well as models with kaon or other condensates . To illustrate this, we show in figure 8 four different qe models for ns - ns configurations with different eos, taken from; all have m1 = 1.15 m and m2 = 1.55 m, and they correspond to the closest separation for which the qe code still finds a convergent result . Figure 8isodensity contours for qe models of ns - ns binaries . In each case, the two nss have masses m1 = 1.15 m (left) and m2 = 1.55 m (right), and the center - of - mass separation is as small as the qe numerical methods allow while able to find a convergent result ., the two nss have masses m1 = 1.15 m (left) and m2 = 1.55 m (right), and the center - of - mass separation is as small as the qe numerical methods allow while able to find a convergent result . The inspiral of ns - ns binaries may yield complementary information about the ns structure beyond what can be gleaned from qe studies of tidal disruption . Nss have a wide variety of oscillation modes, including f - modes, g - modes, and r - modes, any of which may be excited by resonances with the orbital frequency as the latter sweeps upward . Should a particular oscillation mode be excited resonantly, it can then serve briefly as an energy sink for the system, potentially changing the phase evolution of the binary . For example, in a rapidly spinning ns, excitation of the m = 1 r - mode can be significant, yielding a change of over 100 radians for the pre - merger gw signal phase in the case of a millisecond spin period . For ns - ns mergers in the field, this would require one of the nss to be a young pulsar that has not yet spun down significantly, which is unlikely because of the difficulty in obtaining such an extremely small binary separation after the second supernova . Other modes, such as the l = 2 f - mode, may be excited in less extreme circumstances, also yielding information about ns structure parameters . It has long been known that the gw emission from eccentric binaries is very efficient at radiating away angular momentum relative to the radiated energy; as a result, the orbital eccentricity decreases as a binary inspirals, so that orbits should be very nearly circular long before they enter the detection range of ground - based interferometers . The only exception could be from a dynamical capture process that would create a binary with a significant eccentricity and very small orbital separation . Such eccentric binaries have been predicted to form in the nuclear cluster of our galaxy (see, e.g.,) and in core - collapsed globular clusters [127, 167]. However, at present, no formalism exists to construct initial data for such systems, besides superposing the individual components with sufficiently large initial separations to minimize constraint violations . Using this circularity of primordial binaries as a starting point, one may use the constraint equations of gr, along with an assumption of quasi - circularity, to derive sets of elliptic equations describing compact binary configurations . For both qe and dynamical calculations, most groups typically make use of the arnowitt - deser - misner (adm) 3 + 1 splitting of the metric, which foliates the metric into a set of three - dimensional hypersurfaces by introducing a time coordinate . The resulting form of the metric, which is completely general, is written 7\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${g_{\mu \nu}} \equiv (- {\alpha ^2} + {\beta _ i}{\beta ^i})d{t^2} + 2{\beta _ i}dt\;d{x^i} + {\gamma _ {ij}}d{x^i}d{x^j},$$\end{document} where is known as the lapse function, i the shift vector, and ij the spatial three - metric intrinsic to the hypersurface . We are following the standard relativistic notation here where greek indices correspond to four - dimensional quantities and latin indices to spatial three - dimensional quantities . Thus, the shift vector is a 3-vector, raised and lowered with the spatial 3-metric ij rather than the spacetime 4-metric g. to simplify matters, one typically defines a conformal factor that factors out the determinant of the 3-metric, such that 8\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\psi \equiv {[\det ({\gamma _ {ij}})]^{1/12}},$$\end{document} introducing the conformal 3-metric \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\tilde \gamma _ {ij}} \equiv {\psi ^{- 4}}{\gamma _ {ij}}$\end{document} with unit determinant . While the 3-metric is a fundamental component of the geometric structure of the spacetime, the lapse function and shift vector are gauge quantities that simply reflect our choice of coordinates . Thus, while one often determines the lapse and shift in order to construct a appropriately stationary solution in the relevant coordinates between neighboring time slices, their values are often replaced to initialize dynamical runs with more convenient choices and thus different assumptions about coordinate evolution in time . The field equations of general relativity take the deceptively simple form 9\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${g_{\mu \nu}} \equiv {r_{\mu \nu}} - {1 \over 2}{g_{\mu \nu}}r = 8\pi {t_{\mu \nu}},$$\end{document} where g is the einstein tensor, r and r the ricci curvature tensor and the curvature scalar, and t the stress - energy tensor that accounts for the presence of matter, electromagnetic fields, and other physical effects that contribute to the mass - energy of the spacetime . Since gr is a second - order formulation, valid initial data must include not only the metric but also its first time derivative . It generally proves most convenient to introduce the time derivative of the metric after subtracting away the lie derivative with respect to the shift, yielding a quantity known as the extrinsic curvature, kij: 10\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$({\partial _ t} - {{\mathcal l}_\beta}){\gamma _ {ij}} \equiv - 2\alpha {k_{ij}}.$$\end{document} both the 3-metric and extrinsic curvature are symmetric tensors with six free parameters . For systems containing nss, one must consider the effects of nuclear matter through its presence in the stress - energy tensor t. it is common to assume that the matter has the eos describing a perfect, isotropic fluid, for which the stress energy tensor is given by 11\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${t^{\mu \nu}} \equiv ({\rho _ 0} + {\rho _ 0}\varepsilon + p){u^\mu}{u^\nu} + p{g^{\mu \nu}},$$\end{document} where 0,, p and u are the fluid s rest - mass density, specific internal energy, pressure, and 4-velocity, respectively . Many calculations further assume that the ns eos is described by an adiabatic polytrope, for which 12\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p = (\gamma - 1){\rho _ 0}\varepsilon = k\rho _ 0^\gamma,$$\end{document} where is the adiabatic index of the gas and k a constant, though a number of models designed to incorporate nuclear physics and/or strange matter condensates have also been constructed and studied (see sections 4.4 and 6 below). The problem in constructing initial data is not so much producing solutions that are self - consistent within gr, but rather to specify a sufficient number of assumptions to fully constrain a solution . Indeed, there are only four constraints imposed by the equations of gr, known as the hamiltonian and momentum constraints . The hamiltonian constraint is found by projecting einstein s equations twice along the direction defined by a normal observer, and describes the way stress - energy leads to curvature in the metric (see, e.g., for a thorough review): 13\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$r + {k^2} - {k_{ij}}{k^{ij}} = 16\pi \rho,$$\end{document} where r is the scalar curvature of the 4-metric, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$k = k_i^i$\end{document} is the trace of the extrinsic curvature, and 14\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\rho \equiv {\bf{n}}\cdot{\bf{t}}\cdot{\bf{n}} = {\alpha ^2}{t^{00}} = \rho h{(\alpha {u^0})^2} - p$$\end{document} is the total energy density seen by a normal observer . The third term indicates that the total energy density is found by projecting the stress - energy tensor in the direction of the unit - length timelike normal vector n, whose components are given by 15\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${n_\mu} = (- \alpha,0,0,0){. }$$\end{document} in the final expression h 1 + + p/0 is the specific enthalpy of the fluid, and the combination n u represents the lorentz factor of the matter seen by an inertial observer . The notation here makes use of the standard summation convention, in which repeated indices are summed over . Projecting einstein s equations in the space and time directions leads to the vectorial momentum constraint 16\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${d_i}k_j^i - {d_i}k = 8\pi {j_i},$$\end{document} where di represents a three - dimensional covariant derivative and ji 0hnui is the total momentum seen by a normal observer . In order to specify all the free variables that remain once the hamiltonian and momentum constraints are satisfied, one, known as the conformal transverse - traceless (ctt) decomposition, underlies the bowen - york solution for black holes with known spin and/or linear momentum that is widely used in the moving puncture approach . To date, however, the ctt formalism has not been used to generate ns - ns initial data, and we refer readers to [284, 63] for descriptions of the ctt formalism applied to bh - ns and bh - bh initial data, respectively . To date, most groups have used the conformal thin sandwich (cts) formalism to generate qe ns - ns data (see for a review, [13, 137] for the initial steps in the formulation, and [326, 327, 333, 69] for derivations of the form in which it is typically used today). One first specifies that the conformal 3-metric is spatially flat, i.e., \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${{\tilde \gamma}_{ij}} = {\delta _ {ij}}$\end{document}, where ij is the kronecker delta function . Under this assumption, the only remaining parameter defining the spatial metric is the conformal factor, which serves the role of a gravitational potential . Indeed, in the limit of weak sources, it is linearly related to the standard newtonian potential . Next, one specifies that there exists a helical killing vector, so that, as the configuration advances forward in time, all quantities remain unchanged when properly rotated at constant angular velocity in the azimuthal direction . This is sufficient to fix all but the trace of the extrinsic curvature, with the other components forced to satisfy the relation 17\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${k^{ij}} = - {1 \over {2\alpha {\psi ^4}}}\left [{{\nabla ^i}{\beta ^j} + {\nabla ^j}{\beta ^i} - {2 \over 3}{\gamma ^{ij}}{\nabla _ k}{\beta ^k}} \right].$$\end{document} the trace of the extrinsic curvature k remains a free parameter in this approach . While one may choose arbitrary prescriptions to fix it, most implementations choose a maximal slicing of the spatial hypersurfaces by setting k = tk = 0 . Under these assumptions the hamiltonian and momentum constraints, along with the trace of the einstein equations, yield five elliptic equations for the lapse, shift vector, and conformal factor: 18\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\nabla ^2}\psi = - {\psi ^5}\left({{1 \over 8}{k^{ij}}{k_{ij}} - 2\pi \rho} \right),$$\end{document} 19\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\nabla ^2}(\alpha \psi) = \alpha {\psi ^5}({7 \over 8}{\psi ^4}{k_{ij}}{k^{ij}} + 2\pi {\psi ^4}(\rho + 2s),$$\end{document} 20\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\nabla ^2}{\beta ^i} + {1 \over 3}{\nabla ^j}{\nabla _ j}{\beta ^i} = 2\alpha {\psi ^4}{k^{ij}}{\nabla _ j}(\alpha {\psi ^{- 6}}) + 16\alpha {\psi ^4}{j^i},$$\end{document} where 21\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$s = ({g_{\mu \nu}} + {n_\mu}{n_\nu}){t^{\mu \nu}} = s_j^j = 3p + (\rho + p)[1 - \gamma _ n^{- 2}]$$\end{document} is the trace of the stress - energy tensor projected twice in the spatial direction . While these five equations are linked and the right - hand sides are nonlinear, they are amenable to solution using iterative methods . Boundary conditions are set by assuming asymptotic flatness: at large radii, the metric takes on the minkowski form so 1, 1, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\beta _ {{\rm{rot}}}^i \rightarrow \omega \times \vec r$\end{document}. We note that a purely corotating shift term yields zero when we apply the left - hand side of eq . 20, so we may subtract it away and solve the equation with a boundary condition of zero instead . The breakdown in eqs . 18, 19, and 20 is not unique . The meudon group [125, 124], to pick one example, has often chosen to define ln and ln(), and replace eqs . 18 and 19 with the equivalent pair \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{array}{*{20}c} {{\nabla ^2}\nu = {\psi ^4}{k^{ij}}{k_{ij}} - {\nabla _ i}\nu {\nabla ^i}\beta + 4\pi {\psi ^4}(\rho + s),}\quad\quad\quad\quad\\ {{\nabla ^2}\beta = {3 \over 4}{\psi ^4}{k^{ij}}{k_{ij}} - {1 \over 2}({\nabla _ i}\nu {\nabla ^i}\nu + {\nabla _ i}\beta {\nabla ^i}\beta) + 4\pi {\psi ^4}s.}\\ \end{array}$$\end{document} this approach is sufficient to define the field component of the configuration, but one still needs to solve for the matter quantities as well . One starts by assuming that there is a known prescription for reconstructing the density, internal energy, and pressure from the enthalpy h. next, one has to assume some model for the spin of the ns . While corotation is often a simpler choice, since the velocity field of the matter is zero in the corotating frame, the more physically reasonable condition is irrotational flow . Indeed a realistic ns viscosity is never sufficiently large to tidally lock the ns to its companion during inspiral [45, 146]. If we define the co - momentum vector wi = hui, irrotational flow implies the vanishing of its curl: 22\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\nabla \times w = {\nabla _ \mu}{w_\nu} - {\nabla _ \nu}{w_\mu} = {\partial _ \mu}{w_\nu} - {\partial _ \nu}{w_\mu} = 0,$$\end{document} which allows us to define a velocity potential such that w . Using these quantities, one may write down the integrated euler equation 23\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$h\alpha {\gamma _ n}/(1 - {\gamma _ {ij}}{u^i}u_0^j) = {\rm{const}}{. },$$\end{document} where the 3-velocity u of the fluid with respect to an eulerian observer is given by 24\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${u^i} \equiv {{{u^i} + {\beta ^i}{u^0}} \over {{\gamma _ n}}},$$\end{document} and the orbital 3-velocity \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$u_0^i$\end{document} with respect to the same observer by \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$u_0^i = {\beta ^i}/\alpha$\end{document}. For details on the ways in which one may construct an elliptic equation for the velocity potential, we refer to the derivation in . To date, all qe sequences and dynamical runs in the literature have assumed that nss are either irrotational or synchronized, but it is possible to construct the equations for arbitrary ns spins so long as they are aligned [29, 309]. While suggestions are also given there on how to construct qe sequences with intermediate spins using the new formalism similarly, a formalism to add magnetic fields self - consistently to qe sequences has been constructed, as current dynamical simulations typically begin from data assuming either zero magnetic fields or those that only contribute via magnetic pressure . The primary drawback of the cts system is the lack of generality in assuming the spatial metric to be conformally flat, which introduces several problems . The kerr metric, for example, is known not to be conformally flat, and conformally flat attempts to model kerr bhs inevitably include spurious gw content . The same problem affects binary initial data: in order to achieve a configuration that is instantaneously time - symmetric, one actually introduces spurious gravitational radiation into the system, which can affect both the measured parameters of the initial system as well as any resulting evolution . Other numerical formalisms to specify initial data configurations in gr have been derived using different assumptions . Usui and collaborators derived an elliptic set of equations by allowing the azimuthal component of the 3-metric to independently vary from the radial and longitudinal components [319, 318], finding good agreement with the other methods discussed above . A number of techniques have been developed to construct helically symmetric spacetimes in which one actually solves einstein s equations to evaluate the non - conformally - flat component of the metric, which are typically referred to as waveless or formalisms [260, 50, 291]. In terms of the fundamental variables, rather than specifying the components of the conformal spatial metric by ansatz, one specifies instead the time derivative of the extrinsic curvature using a physically motivated prescription . These methods are designed to match the proper asymptotic behavior of the metric at large distances, and may be combined with techniques designed to enforce helical symmetry of the metric and gauge in the near zone the near zone helical symmetry, or nhs formalism) to produce a global solution [315, 334, 316]. Qe sequences generated using this formalism have shown that the resulting conformal metric is indeed non - flat, with deviations of approximately 1% for the metric components, and similar differences in the system s binding energy when compared to equivalent cts results . They suggest that underestimates in the quadrupole deformations of ns prior to merger may result in total phase accumulation errors of a full cycle, especially for more compact ns models . Qe formalisms reflect the assumption that binaries will be very nearly circular, since gw emission acting over very long timescales damps orbital eccentricity to negligible values for primordial ns - ns binaries between their formation and final merger . Binaries formed by tidal capture and other dynamical processes, which may be created with much smaller initial separations, are more likely to maintain significant eccentricities all the way to merger (see, e.g., for a discussion of such processes for bh - bh binaries) and it has been suggested based on simple analytical models that such mergers, likely occurring in or near dense star clusters, may account for a significant fraction of the observed sgrb sample . However, more detailed modeling is required to work out accurate estimates of merger rates given the complex interplay between dynamics and binary star evolution that determines the evolution of dense star clusters, and given the large uncertainties in the distributions of star cluster properties in galaxies throughout the universe . No initial data have ever been constructed in full gr for merging ns - ns binaries with eccentric orbits since the systems are then highly time - dependent, while the calculations performed to evolve them generally use a superposition of two stationary ns configurations . There are a number of numerical techniques that have been used to solve these elliptic systems . The first calculations of ns - ns qe sequences, in both cases for synchronized binaries, were performed by wilson, mathews, and marronetti [327, 328, 189] and baumgarte et al . [25, 26]. The former used a finite differencing scheme, and centered different quantities at cells, vertices, and faces in order to construct a system of equations that was solved using fast matrix inversion techniques, while the latter used a cartesian multigrid scheme, restricted to an octant to increase computational efficiency . After a formalism for evaluating qe irrotational ns - ns sequences was developed [51, 313], some of the first results were obtained by ury and eriguchi, who developed a finite - differencing code in spherical coordinates allowing for the solution of relativistic ns - ns binaries using green s functions[313, 317]. Their method extended the self - consistent field (scf) work of, which had previously been applied to axisymmetric configurations . Irrotational configurations were also generated by marronetti et al ., using the same finite difference scheme as found in the work on synchronized binaries . The most widely used direct grid - based solver in numerical relativity is the bam_elliptic solver, which solves elliptic equations on single rectangular grids or multigrid configurations . It is included within the cactus code, which is widely used in 3-d numerical relativity . In particular it has been used to initiate a number of single and binary bh simulations, including one of the original breakthrough binary puncture works . Lagrangian methods, typically based on smoothed particle hydrodynamics (sph) [181, 118, 194]) have been used to generate both synchronized and irrotational configurations for pn [10, 99, 101, 100] and conformally flat (cf) [211, 210, 97, 212, 207, 209, 208, 34, 35, 33] calculations of ns - ns mergers, but they have not yet been extended to fully gr calculations, in part because of the difficulties in evolving the global spacetime metric . The most widely used data for numerical calculations are those generated by the meudon group (see section 4.4 below for details on their calculations and for a detailed description of their methods). The code they developed, lorene, uses multidomain spectral methods to solve elliptic equations (while the code has been used primarily for relativistic stellar and binary configurations, it can be used as a more general solver). Around each star, one creates a set of nested, contiguous grids, with points arrayed in the radial and angular directions . The outermost grid may be allowed to extend to spatial infinity through a compactification transformation of the radial coordinate . To solve elliptic equations for various field quantities, one breaks each into a sum of two components, each of whose source terms are concentrated in one ns or the other . Similarly, the source terms themselves are split into two pieces, ideally, so each component is well - described by spheroidal spectral coefficients centered around each star . Using the spectral expansion, one may pass values from one star to the other and then recalculate spectral coefficients for the other grid configuration . This scheme has several efficiency advantages over direct grid - based methods, which helps to explain its popularity . First, the domain geometry may be chosen to fit to a ns surface, which eliminates gibbs phenomenon - related errors and allows for exponential convergence with respect to the number of grid points, rather than the geometric convergence that characterizes finite difference - based grid codes . Second, the use of spectral methods requires much less computer memory than grid - based codes, and, as a result, lorene is a serial code that can run easily on any off - the - shelf pc, rather than requiring a supercomputer platform . Ns - ns binaries may be well approximated by qe configurations up until they reach separations comparable to the sizes of the binary components themselves, that latter phase lasting a fraction of a second after an inspiral of millions of years or more . The eventual merger will occur after the binary undergoes one of two possible orbital instabilities . If the total binary energy and angular momenta reach a minimum at some separation, which defines the isco, the binary becomes dynamically unstable and plunges toward merger . Alternately, if the ns fills its roche lobe (typically the lower density ns) mass will transfer onto the primary and the secondary will be tidally disrupted . The parameters of some ns - ns systems could technically allow for stable mass transfer, in which mass loss from a lighter object to a heavier one leads to a widening of the binary separation . This does occur for some binaries containing white dwarfs, but every dynamical calculation to date using full gr or even approximate gr has found that the rapid inspiral rate leads to inevitably unstable mass transfer and the prompt merger of a binary . Many of the results later confirmed using relativistic qe sequences were originally derived in newtonian and pn calculations, particularly as explicit extensions of chandrasekhar s body of work (see). Chandrasekhar s studies of incompressible fluids were first extended to compressible binaries by lai, rasio, and shapiro [156, 155, 158, 157, 159], who used an energy variational method with an ellipsoidal treatment for polytropic nss . They established, among other results, the magnitude of the rapid inspiral velocity near the dynamical stability limit, the existence of a critical polytropic index (n 2) separating binary sequences undergoing the two different terminal instabilities, the role played by the ns spin and viscosity and magnitude of finite - size effects in relation to 1pn terms [158, 157], and the development of tidal lag angles as the binary approaches merger . They also determined that for most reasonable eos models and nonextreme mass ratios, as would pertain to ns - ns mergers, an energy minimum is inevitably reached before the onset of mass transfer through roche lobe overflow . The general results found in those works were later confirmed by, who used a scf technique [131, 132], finding similar locations for instability points as a function of the adiabatic index of polytropes, but a small positive offset in the radius at which instability occurred . Similar results were also found by [311, 312], but with a slight modification in the total system energy and decrease in the orbital frequency at the onset of instability . The first pn ellipsoidal treatments were developed by shibata and collaborators using self - consistent fields [270, 269, 279, 281, 299] and by lombardi, rasio, and shapiro . Both groups found that the nonlinear gravitational effects imply a decrease in the orbital separation (increase in the orbital frequency) at the instability point for more compact ns . This result reflects a fairly universal principle in relativistic binary simulations: as gravitational formalisms incorporate more relativistic effects, moving from newtonian gravity to 1pn and on to cf approximations and finally full gr, the strength of the gravitational interaction inevitably becomes stronger . The effects seen in fully dynamical calculations will be discussed in section 6, below . The first fully relativistic cts qe data for synchronized ns - ns binaries were constructed by baumgarte et al . [26, 25], using a grid - based elliptic solver . Their results demonstrated that the maximum allowed mass of nss in close binaries was larger than that of isolated nss with the same (polytropic) eos, clearly disfavoring the star - crushing scenario that had been suggested by [327, 187] using a similar cts formalism (but see also the error in these latter works addressed in, discussed in section 6.3 below). Also identified how varying the ns radius affects the isco frequency, and thus might be constrained by gw observations . Using a multigrid method, miller et al . Showed that while conformal flatness remained valid until relatively near the isco, the assumption of syncronized rotation broke down much earlier . Usui et al . Used the green s function approach with a slightly different formalism to compute relativistic sequences and determined that the cts conditions were valid up until extremely relativistic binaries were considered . The first relativistic models of physically realistic irrotational ns - ns binaries were constructed by the meudon group using the lorene multi - domain pseudo - spectral method code . Since then, the meudon group and collaborators have constructed a wide array of ns - ns initial data, including polytropic ns models [125, 303, 304], as well as physically motivated ns eos models or quark matter condensates . Irrotational models have also been constructed by ury and collaborators [313, 317] for use in dynamical calculations, and nuclear / quark matter configurations have been generated by oechslin and collaborators [212, 209]. A large compilation of qe cts sequences constructed using physically motivated eos models including fps (friedman - pandharipande), sly (skyrme lyon), and apr models, along with piecewise polytropes designed to model more general potential cases (see), was published in . The most extensive set of results calculated using the waveless / near - zone helical symmetry condition appear in, with equal - mass ns - ns binary models constructed for the fps, sly, and apr eos in addition to = 3 polytropes . . Please refer to section 6 for a discussion of papers that focus on dynamical simulations instead . Gravitational schemes include newtonian gravity (newt. ), lowest - order post - newtonian theory (pn), conformal thin sandwich (cts) including modified forms of the spatial metric (mod . Numerical methods include ellipsoidal formalisms (ellips. ), self - consistent fields (scf), numerical grids (grid), multigrids, and multipatch, green s function techniques (greens), spectral methods (spectral), or sph relaxation (sph). With regard to eos models, physical eos models include the fps, sly, and apr nuclear eos models, along with their parameterized approximations and other physically motivated models . The compactness \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = m / r$\end{document} refers to the value for a ns in isolation before it is placed in a binary, and plays no role in newtonian physics . The mass ratio q = m2/m1 is defined to be less than unity, and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\gamma = {7 \over 5},\,{5 \over 3},\,2,\,\infty$\end{document} n / a1.0syn.lainewt.ellips . \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\gamma = {5 \over 3},\,2,\,3$\end{document} n / a1.0syn./irr.lainewt.ellips . \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\gamma = {7 \over 5},\,{5 \over 3},\,3,\,\infty$\end{document} n / a0.21.0syn./irr.newnewt.scf \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\gamma = {5 \over 3},\,2,\,3,\,{\rm{wd}}$\end{document} n / a1.0syn.urynewt.scf \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\gamma = {5 \over 3},\,2,\,{{17} \over 2},\,2,\,3,\,\infty$\end{document} n / a1.0irr.shibatapngrid = 2 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.08 - 0.12$\end{document} 1.0syn.shibatapngrid = 3 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.03$\end{document} 1.0syn.shibatapnellips . \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\gamma = {5 \over 3},\,2,\,{7 \over 3},\,3,\,5,\,\infty$\end{document} \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0 - 0.03$\end{document} 1.0syn.lombardipnellips. = 2,3 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.12 - 0.25$\end{document} 1.0syn./irr.baumgartectsmultigrid = 2 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.05 - 0.2$\end{document} 1.0syn.usuimod . Ctsgreens = 2,3, \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.05 - 0.25$\end{document} 1.0syn.uryctsgreens = 2 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.1 - 0.19$\end{document} 1.0syn./irr.uryctsgreen s \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\gamma = {9 \over 5},\,2,\,2.25,\,2.5,\,3$\end{document} \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.1 - 0.19$\end{document} 1.0irr.bonazzolactsspectral = 2 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.14$\end{document} 1.0syn / irr.taniguchictsspectral = 2 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.12 - 0.18$\end{document} 0.91.0syn./irr.taniguchictsspectral = 1.8,2.25,2.5 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.08 - 0.18$\end{document} 0.831.0syn./irr.millerctsmultigrid = 2 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.15$\end{document} 1.0syn.bejgerctsspectralphys . \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.14 - 0.19$\end{document} 1.0irr.limousinctsspectralquark \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.19$\end{document} 1.0syn./irr.oechslinctssphquark \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.12 - 0.20$\end{document} 1.0irr.taniguchictsspectralphysical \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.1 - 0.3$\end{document} 0.71.0irr.urywl/nhsmultipatch = 3, physical \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.13 - 0.22$\end{document} 1.0irr . A summary of various studies focusing on qe sequences of ns - ns binaries . Please refer to section 6 for a discussion of papers that focus on dynamical simulations instead . Gravitational schemes include newtonian gravity (newt. ), lowest - order post - newtonian theory (pn), conformal thin sandwich (cts) including modified forms of the spatial metric (mod . Numerical methods include ellipsoidal formalisms (ellips. ), self - consistent fields (scf), numerical grids (grid), multigrids, and multipatch, green s function techniques (greens), spectral methods (spectral), or sph relaxation (sph). With regard to eos models, physical eos models include the fps, sly, and apr nuclear eos models, along with their parameterized approximations and other physically motivated models . The compactness \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = m / r$\end{document} refers to the value for a ns in isolation before it is placed in a binary, and plays no role in newtonian physics . The mass ratio q = m2/m1 is defined to be less than unity, and ns - ns binaries are highly relativistic systems, numerous groups now run codes that evolve both gr metric fields and fluids self - consistently, with some groups also incorporating an ideal magnetohydrodynamic evolution scheme that assumes infinite conductivity . The codes that evolve the gr hydrodynamics or magnetohydrodynamics (grhd and grmhd, respectively) equations are many and varied, incorporating different spatial meshes, relativistic formalisms, and numerical techniques, and we will summarize the leading variants here . All full gr codes now make use of the significant insight gained from bh - bh merger calculations, but much work on these systems predates the three 2005 breakthrough papers by pretorius, goddard, and the group then at ut brownsville (now at rit), with the first successful ns - ns merger calculations announced already in 1999 . A list of the groups that have performed ns - ns merger calculations using full gr is presented below; note that many of these groups have also performed bh - ns simulations, as discussed in the review by shibata and taniguchi . Of the full gr codes used to evolve ns - ns binaries, almost all are grid - based and make use of some form of adaptive mesh refinement . The one exception is the spec code developed by the sxs collaboration, formed originally by caltech and cornell, which has used a hybrid spectral - method field solver with grid - based hydrodynamics . Most make use of the bssn formalism for evolving einstein s equations (see section 5.2.1 below), while the had code uses the alternate generalized harmonic gauge (ghg) approach . This technique is also used by the sxs collaboration and the princeton group, who have both performed simulations of merging bh - ns binaries (see section 6.6) but have yet to report any results on ns - ns mergers . Three groups have reported results for ns - ns mergers including mhd (had, whisky, and uiuc), while the kt (kyoto / tokyo) group has reported magnetized evolutions of hmns remnants (see and references therein for a discussion of their work and that of other numerical relativity groups), but have yet to use that code for a ns - ns merger calculation . While full gr codes were being developed to study ns - ns binaries, a parallel and rather independent track developed to study detailed microphysical effects in binary mergers using approximate relativistic schemes . This includes codes like that developed by the mpg group that accurately track the production of neutrinos and antineutrinos and their annihilation during a merger, as well as post - processing routines that use extensive nuclear chains to track the production of rare high - atomic number r - process elements in merger ejecta . Meanwhile, the bremen group s sph code includes variable - temperature physically motivated equations of state and magnetohydrodynamics, and has been used with a multi - group flux - limited diffusion neutrino code to generate expected neutrino signatures from merger calculations . A summary of groups performing ns - ns merger calculations is presented in table 3 . The asterisk for the kt collaboration s mhd column indicates that they have used an mhd - based code for other projects, but not yet for ns - ns merger simulations . Gravitational formalisms include full gr, assumed to be implemented using the bssn decomposition except for the had collaborations s ghg approach, the cf approximation, or newtonian gravity . Microphysical treatments include physically motivated eos models or quark - matter eos and neutrino leakage schemes.abbrev.refs.grav.mhdmicrophysicskt[134, 144, 145, 265, 264, 287, 288][285, 286, 282, 332]gr*phys . Eos, -leakagehad[7, 6]gr (ghg)ynwhisky[17, 18, 14, 15, 116, 117, 240, 241]grynuiucgrynjenagrnnmpg[34, 35, 33, 32, 123, 209, 208, 296]cfnquark, phys . The asterisk for the kt collaboration s mhd column indicates that they have used an mhd - based code for other projects, but not yet for ns - ns merger simulations . Gravitational formalisms include full gr, assumed to be implemented using the bssn decomposition except for the had collaborations s ghg approach, the cf approximation, or newtonian gravity . Microphysical treatments include physically motivated eos models or quark - matter eos and neutrino leakage schemes . There are two distinct schemes used in all binary merger calculations performed to date, the bssn (baumgarte - shapiro - shibata - nakamura) [277, 27] and generalized harmonic formalisms . For general reviews of these formalisms, as well as other developments in numerical relativity, we refer readers to two recent books on numerical relativity [4, 30]. Here the bssn formalism was adapted from the 3 + 1 adm approach, with quantities defined as in eqs . 7 and 8 . While the original adm scheme proved to be numerically unstable, defining the auxiliary quantities \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${{\tilde \gamma}^i} = - \tilde \gamma _ {, j}^{ij}$\end{document} and treating these expressions as independent variables stabilized the system and allowed for long - term evolutions . While slight variants exist, the 19 evolved variables are typically either the conformal factor or its logarithm, the conformal 3-metric, the trace k of the extrinsic curvature, the trace free extrinsic curvature aij and the conformal connection functions \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${{\tilde \gamma}^i}$\end{document} the evolution equations themselves are given in appendix a. the bssn scheme was used in the binary merger calculations of the kt collaboration [287, 288, 285, 286], the first completely successful ns - ns calculations ever performed in full gr . Ever since the utb / rit and goddard groups showed simultaneously that a careful choice of gauge allows bhs to be evolved in bssn schemes without the need to excise the singularity, these puncture gauges have gained widespread hold, and have been used to evolve ns - ns binaries (and in some cases, bh - ns binaries) by the kt collaboration, uiuc, and whisky . The generalized harmonic formalism, developed over about two decades from initial theoretical suggestions up to its current numerical implementation [112, 115, 232, 130, 231] was used to perform the first calculations of merging bh - bh binaries by pretorius, and has since been applied to ns - ns binaries by the had collaboration and to bh - ns mergers by had, sxs [85, 84, 108], and the princeton group [294, 88]. It involves introducing a set of auxiliary quantities denoted h representing the action of the wave operator on the spacetime coordinates themselves 25\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${h^\mu} \equiv {\gamma ^\mu} \equiv {g^{\alpha \beta}}\gamma _ {\alpha \beta}^\mu = - {1 \over {\sqrt {- g}}}{\partial _ {- g} {g^{\mu \nu}}) = {g^{\alpha \beta}}{\nabla _ \alpha}{\nabla _ \beta}{x^\mu} = \square{x^\mu},$$\end{document} which are treated as independent gauge variables whose evolution equation must be specified . Current first - order formulations [171, 6] evolve equations for the spacetime metric g along with its spatial derivative, i = ig and projected time derivative = ng, subject to consistency constraints on the spatial derivatives . The first bh - ns merger calculations in the gh formalism used a first - order reduction of the einstein equations and specified the source functions to damp to zero exponentially in time, while the first binary ns merger work used a similar first - order reduction and chose harmonic coordinates with h = 0 . In both formalisms, most groups employ grid - based finite differencing to evaluate spatial derivatives . While finite differencing operators may be easily written down to arbitrary orders of accuracy, there is a trade - off between the computational efficiency achievable by using smaller, second - order stencils and the higher accuracy that can be attained using larger, higher - order ones . For the moment, many groups are now moving to at least fourth - order accurate differencing techniques, with a high likelihood that at least the field sector of ns - ns merger calculations will soon be performed at comparable order to bh - bh calculations, at either sixth or eighth - order accuracy, if not higher . The main limitation to date involves the complexity of shock capturing using higher - order schemes, as we discuss in section 5.2.3 below . Ideally, one wishes to impose boundary conditions at large distances that preserve the gr constraints and yield a well - posed initial - boundary value problem . On physical grounds, the boundary should only permit outgoing waves, preventing the reflection of spurious waves back into the numerical grid . Otherwise, reflections may be avoided by placing the outer boundaries so far away from the matter that they remain causally disconnected from the merging objects for the full duration of the simulation . Building upon previous work (see, e.g., [113, 151, 12, 150, 256, 242], winicour derived boundary conditions that satisfy all of the desired conditions for the generalized harmonic formalism . No such conditions have been derived for the full bssn formalism, though progress has been made (see, e.g., [43, 129]) so that we may now construct well - posed boundary conditions in the weak - gravity linearized limit of bssn and for related first - order gravitational formalisms . While unigrid schemes are extremely convenient, they tend to be extremely inefficient, since one must resolve small - scale features in the central regions of a merger but also extend grids out to the point where the gw signal has taken on its roughly asymptotic form . Thus, nearly every code incorporates some means of focusing resolution on the high - density regions via some form of mesh refinement . Coordinates that represent a continuous radial deformation of a grid, a technique that had previously been used successfully, e.g., for bh - bh mergers [21, 62]. While fixed mesh refinement offers the chance for greater computational efficiency and accuracy, much current work focuses on adaptive mesh refinement, in which the level of refinement of the grid is allowed to evolve dynamically to react to the evolving binary configuration . The publicly available carpet computational toolkit [263, 262], which is distributed to the community as part of the open source einstein [90, 175] uses a moving boxes approach, and has been designed to be compatible with the widely used and publicly available cactus framework . It has been successfully implemented by the whisky group to perform ns - ns mergers, by uiuc for their bh - ns mergers, and a host of other groups for bh - bh mergers and additional problems . The kt code sacra also implements an adaptive mesh refinement (amr) scheme for ns - ns and bh - ns mergers, as does the most recent version of the had collaboration s code, which is based on the publicly available infrastructure of the same name [169, 8], and the bam code employed by the jena group [308, 41, 122]. The princeton group also has an amr code, which has been used to perform bh - ns mergers to date [294, 88, 89] one drawback of employing rectangular grids is that memory costs scale like n, where n is the number of grid cells across a side, and total computational effort like n once one accounts for the reduction in the timestep due to the courant - friedrich - levy criterion . Since one does not necessarily need high angular resolution at large radii, there is great current interest in developing schemes that use some form of spheroidal grid, for which the memory scaling is merely n. a group at lsu has implemented a multi - patch method, in which space is broken up into a number of non - overlapping domains in such a way that the six outermost regions (projections of the faces of a cube onto spheres of constant radius), maintain constant angular resolution and thus produce linear dependence of the total number of grid points on the number of radial points . To date, it has been used primarily for vacuum spacetimes and hydrodynamics on a fixed background . The sxs collaboration, begun at caltech and cornell and now including members at cita and washington state, has used a spectral evolution code with multiple domains to evolve bh - ns binaries, which achieves the same scaling by expanding the metric fields in modes rather than in position space . Their first published results on ns - ns binaries are currently in preparation (see for a brief summary of work to date). While all of these grid techniques produce tremendous advantages in computational efficiency, each required careful study since deformations of a grid or the introduction of multiple domains can introduce inaccuracies and non - conservative effects . As an example, in amr schemes, one must deal with the same reflection issues at refinement boundaries that are present at the physical boundaries of the grid, as discussed above, though the interior nature of the boundaries allows for additional techniques, such as tapered grid boundaries, to be used to minimize reflections there . The study of how to minimize spurious effects in these schemes continues, and will represent an important topic for years to come, especially as evolution schemes become more complicated by including more physical effects . Fluids cannot be treated in the same way as the spacetime metric because finite differencing operators do not return meaningful results when placed across discontinuities induced by shocks . Instead, gr(m)hd calculations must include some form of shock - capturing that accounts for these jumps . These are typically implemented in conservative schemes, in which the fluid variables are transformed from the standard primitive set \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\vec p}$\end{document}, which includes the fluid density, pressure, and velocity (and magnetic field in mhd evolutions), into a new set \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\vec u}$\end{document} so that the evolution equations may be written in the form 26\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\partial _ t}(\vec u) = \nabla \cdot \vec f + \vec s,$$\end{document} where the flux functions \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\vec f(\vec p)$\end{document} and source terms \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\vec s(\vec p)$\end{document} can be expressed in terms of the primitive variables but not their derivatives . These schemes allow one to evolve the resulting mhd set of equations so that numerical fluxes are conserved to numerical precision across cell walls as the fluid evolves in time . One widely used scheme, often referred to as the valencia formulation, is described in appendix b .. there are important mathematical reasons for casting the grhd / grmhd system in conservative form, primarily since the mathematical techniques describing godunov methods may be called into play . In such methods, we assume that the evolution of the quantities \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\vec u}$\end{document} may be expressed in the form 27\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\vec u(x = {x_i},t = {t_{n + 1}}) = \vec u(x = {x_i},t = {t_n}) + {{\delta t} \over {\delta x}}\left({\vec f(x = {x_{i - 1/2}}) - \vec f(x = {x_{i + 1/2}})} \right),$$\end{document} where the points have spatial coordinates xi x0 + ix and the timesteps satisfy tn = t0 + nt . The fluxes must be determined by solving the riemann problem at each cell face (thus the half - integer indices), either exactly or approximately . It can be shown that solutions constructed this way, when convergent, must converge to a solution of the original problem, even when shocks are present . First one reconstructs the primitives from the conserved variables on both sides of an interface, using interpolation schemes designed to respect the presence of shocks . Simple schemes involving limiters yield second - order accuracy in general but first - order accuracy at shocks, while higher - order methods such as ppm (piecewise parabolic method) and essentially non - oscillatory (eno) schemes such as ceno (central eno) and weno (weighted eno) yield higher accuracy but at much higher computational cost . Once primitives are interpolated to the cell interfaces, flux terms are evaluated there and one solves the riemann problem describing the evolution of two distinct fluid configurations placed on either side of a membrane (see for a description). While complete solutions of the riemann problem are painstaking to evolve, a number of approximation techniques exist and do not reduce the order of accuracy of the code . Finally, one must take the conservative solution, now advanced forward in time, and recover the underlying primitive variables, a process that requires solving as many as eight simultaneous equations in the case of grmhd or five for grhd systems . A number of methods to do this have been widely studied, and simplifying techniques are known for specific cases (for the case of polytropic eoss in grhd evolutions, one need only invert a single non - analytic expression and the remaining variables can then be derived analytically). The inclusion of magnetic fields in hydrodynamic calculations adds another layer of complexity beyond shock capturing . Magnetic fields must be evolved in such a way that they remain divergence - free, much in the same way that relativistic evolutions must satisfy the hamiltonian and momentum constraints . Brute force attempts to subtract away any spurious divergence often lead to instabilities, so more intricate schemes have been developed . Schemes typically introduce a new field representing the magnetic field divergence and use parabolic / hyperbolic equations to damp the divergence away while moving it off the computational domain; the approach is relatively simple to implement but prone to small - scale numerical errors . Constrained transport schemes stagger the grids on which different physical terms are calculated to enforce the constraints (see, e.g., for a particular implementation), and have been applied widely to many different physical configurations . Recently, a new scheme in which the vector potential is used rather than the magnetic field was introduced by etienne, liu, and shapiro [93, 95], and found to yield successful results for a variety of physical configurations including nss and bhs . One of the largest uncertainties in the input physics of ns - ns merger simulations is the true behavior of the nuclear matter eos . To date, em observations have yielded relatively weak constraints on the ns mass - radius relation, with the most precise simultaneous measurement of both as of now resulting from observations of type 1 x - ray bursts from accreting nss in three different sources . In each case, the ns mass was found to lie in the range 1.3 m mns 2 m and the radius 8 km rns 12 km, implying a ns compactness 28\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\mathcal c} \equiv {{g{m_{{\rm{ns}}}}} \over {{r_{{\rm{ns}}}}{c^2}}} = 0.1476\left({{{{m_{{\rm{ns}}}}} \over {{n _ \odot}}}} \right){\left({{{{r_{{\rm{ns}}}}} \over {10\,{\rm{km}}}}} \right)^{- 1}} \approx 0{. }16 - 0{. }37.$$\end{document} a more stringent constraint on the ns eos is provided by observations of the shapiro time delay in the binary millisecond pulsar psr j1614 - 2230, which was found to have a mass mns = 1.97 0.04 m, which would rule out extremely soft eos models incapable of supporting such a massive ns against collapse . As we discuss in more detail below, gw observations are likely to eventually yield tighter constraints than our current em - based ones, though bh - ns mergers, which can undergo stronger tidal disruptions than ns - ns mergers at frequencies closer to ligo and other gw observatories maximum frequency sensitivity band, may prove to be more useful for the task than ns - ns mergers . Given the large theoretical uncertainties in describing the proper physical ns eos, many groups have chosen the simplest possible parameterization: a polytrope (see eq . The enthalpy h takes the particularly simple form 29\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$h \equiv 1 + \varepsilon + p/\rho = 1 + \gamma \varepsilon.$$\end{document} initial data are generally assumed to follow the relation 30\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p = k{\rho ^\gamma},$$\end{document} where k is constant across the fluid . In the presence of shocks, the value of k for a particular fluid element will increase with time . We note that the whisky group [17, 18] uses the term polytropic to refer to simulations in which eq . 30 is enforced throughout, which implies adiabatic evolution without shock heating, and use the term ideal fluid to describe an eos that includes the effects of shock heating and enforces eq . Since the temperatures of nss typically yield thermal energies per baryon substantially below the fermi energy, one may treat nearly all nss as effectively cold, except for the most recently born ones . During the merger process for ns - ns binaries, the matter will remain cold until the two nss are tidally disrupted and a disk forms, at which point the thermal energy input and substantially reduced fluid densities require a temperature evolution model to properly model the underlying physics . In light of these results, some groups adopt a two - phase model for the ns eos (see, e.g.,), where a cold, zero - temperature eos, evaluated as a function of the density only, encodes as much information about as we possess about the ns eos, and the hot phase depends on both the density and internal energy, typically in a polytropic way, 31\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p(\rho, \varepsilon) = {p_{{\rm{cold}}}}(\rho) + {p_{{\rm{hot}}}}(\rho, \varepsilon)\quad [{p_{{\rm{hot}}}}(\rho, \varepsilon) = (\gamma - 1)\rho (\varepsilon - {\varepsilon _ {{\rm{cold}}}})].$$\end{document} there are a number of physically motivated eos models that have been implemented for merger simulations, whose exact properties vary depending on the assumptions of the underlying model . These include models for which the pressure is tabulated as a function of the density only: fps, sly, and apr; as well as models including a temperature dependence: shen [268, 267] and lattimer - swesty . A variety of models have been used to study the effects of quarks, kaons, and other condensates, which typically serve to soften the eos, leading to reduced maximum masses and more compact nss [223, 119, 230, 120, 23, 5]. Given the variance among even the physically motivated eos models, it has proven useful to parameterize known eos models with a much more restricted set of parameters . In a series of works, a milwaukee / tokyo collaboration determined that essentially all current eos models could be fit using four parameters, so that their imprint on gw signal properties could be easily analyzed [237, 238, 184]. Their method assumes that the sly eos describes ns matter at low densities, and that the eos at higher densities can be described by a piecewise polytropic fit with breaks at = 10 and 10 g / cm . The four resulting parameters are p1 = p (= 10), the pressure at the first breakpoint density, which normalizes the overall density scale, as well as 1, 2, 3, the adiabatic exponents in the three regions . Their results indicate that advanced ligo should be able to determine the ns radius to approximately 1 km at an effective distance of 100 mpc, which would place tight constraints on the value of p1 in particular . Motivated by the evidence that sgrbs frequently appear in galaxies with very low star formation rates [40, 109], astronomers have suggested that their progenitors are likely to be mergers of either ns - ns and/or bh - ns binaries . While soft - gamma repeaters (sgrs) have been confirmed as an sgrb source from observations of the system sgr 1806 - 20, they make up no more than approximately 15% of the total observed sgrb fraction according to the leading population estimates [164, 199]. There has been much interest in predicting the em signatures of ns - ns and bh - ns mergers, along with the associated neutrino emission . The simplest models estimate a local radiation cooling rate for the matter but do not attempt to follow the paths of the photons and/or neutrinos after they are emitted, instead calculating the time - dependent luminosity assuming free streaming . Such models have been used in non - gr simulations of binary mergers going back more than a decade [253, 246], and recently such schemes have been used to perform full gr ns - ns mergers, including a self - consistent evolution of the electron fraction of the material ye, rather than a passive advection approach . More complicated flux - limited diffusion schemes, in which the neutrino fluxes for given species and energies are given by explicit formulae that limit to the correct values for zero optical depth (free - streaming) and very large optical depth (diffusion), have been used as a post - processing tool to investigate the merger remnants in newtonian ns - ns mergers, but have yet to be applied to full gr simulations . Finally, radiation transport schemes to evolve em and neutrino fluxes passing through fluid configurations have been implemented in numerical gr codes [80, 103], but have yet to be used in binary merger simulations . One must determine, using a method unaffected by gauge effects, the perturbations at asymptotically large distances from a source by extrapolating various quantities measured at large but finite distances from the merger itself . In the early days of numerical merger simulations, most groups typically assumed newtonian and/or quasi - newtonian gravitation, for which there is no well - defined dynamical spacetime metric . Gw signals were typically calculated using the quadrupole formalism, which technically only applies for slow - moving, non - relativistic sources (see for a thorough review of the theory). Temporarily reintroducing physical constants, the strains of the two polarizations for signals emitted in the z - direction are \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{array}{*{20}c} h_{+} = {g \over rc^{4}}(\ddot{\rlap{\!-}\bf{i}}_{xx} - \ddot {\rlap{\!-}\bf{i}}_{yy}), \\ h _ {\times} = {2 g \over rc^{4}} \ddot{\rlap{\!-}\bf{i}}_{xy}, \qquad\quad \end{array}$$\end{document} where r is the distance from the source to the observer and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\ddot{{\rlap{\!-}{\bf i}}}_{ij}}$\end{document} it the traceless quadrupole moment of the system . The energy and angular momentum loss rates of the system due to gw emission are given, respectively, by \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{array}{*{20}c} {- {{\left({{{de} \over {dt}}} \right)}_{{\rm{gw}}}} = {g \over {5{c^5}}}{{\overset{\ldots}{{\rlap{\!-}{\mathbf i}}}}_{ij}}{{\overset{\ldots}{{\rlap{\!-}{\mathbf i}}}}_{ij}},}\quad\\ {- {{\left({{{d{l_k}} \over {dt}}} \right)}_{{\rm{gw}}}} = {{2 g} \over {5{c^5}}}{\epsilon _ {ijk}}{\ddot{{\rlap{\!-}\mathbf{i}}}_{il}}{{\overset{\ldots}{{\rlap{\!-}{\mathbf i}}}}_{lj}}. }\\ \end{array}$$\end{document} while only approximate, the quadrupole formulae do yield equations that are extremely straightforward to implement in both grid and particle - based codes using standard integration techniques . Quadrupole methods were adopted for later pn and cf simulations, again because the metric was assumed either to be static or artificially constrained in such a way that made self - consistent determination of the gw signal impossible . One important development from this period was the introduction of a simple method to calculate the gw energy spectrum de / df from the gw time - series through fourier transforming into the frequency domain . Gw signals analyzed in the frequency domain allowed for direct comparison with the ligo noise curve, making it much easier to determine approximate distances at which various gw sources would be detectable and the potential signal - to - noise ratio that would result from a template search . To constrain the nuclear matter eos, one can examine where a gw merger spectrum deviates in a measurable way from the quadrupole point - mass form, 32\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\left({{{de} \over {df}}} \right)_{{\rm{gw}}}} = {{\pi g{m_1}{m_2}} \over 3}{(\pi g({m_1} + {m_2}){f_{{\rm{gw}}}})^{- 1/3}};\quad {f_{{\rm{gw}}}} \equiv 2{f_{{\rm{orb}}}} = {{{\omega _ {{\rm{orb}}}}} \over \pi},$$\end{document} because of finite - size effects, and then link the deviation to the properties of the ns, as we show in figure 9 . Figure 9approximate energy spectrum degw / df derived from qe sequences of equal - mass ns - ns binaries with isolated adm masses mns = 1.35 m and a = 2 eos, but varying compactnesses (denoted m / r here), originally described in . The diagonal lines show the energy spectrum corresponding to a point - mass binary, as well as values with 90%, 75%, and 50% of the power at a given frequency . Asterisks indicate the onset of mass - shedding, beyond which qe results are no longer valid . Approximate energy spectrum degw / df derived from qe sequences of equal - mass ns - ns binaries with isolated adm masses mns = 1.35 m and a = 2 eos, but varying compactnesses (denoted m / r here), originally described in . The diagonal lines show the energy spectrum corresponding to a point - mass binary, as well as values with 90%, 75%, and 50% of the power at a given frequency . Asterisks indicate the onset of mass - shedding, beyond which qe results are no longer valid . Full gr dynamical calculations, in which the metric is evolved according to the einstein equations, generally use one of two approaches to calculate the gw signal from the merger, if not both . The first method, developed first by by regge and wheeler and zerilli and written down in a gauge - invariant way by moncrief involves analyzing perturbations of the metric away from a schwarzschild background . The second uses the newman - penrose formalism to calculate the weyl scalar 4, a contraction of the weyl curvature tensor, to represent the outgoing wave content on a specially constructed null tetrad that may be calculated approximately . The two methods are complementary since they incorporate different metric information and require different numerical integrations to produce a gw time series . Regardless of the method used to calculate the gw signal, results are often presented by calculating the dominant s = 2 spin - weighted spherical harmonic mode . For circular binaries, the l = 2, m = 2 mode generally carries the most energy, followed by other harmonics; in cases where the components of the binary have nearly equal masses and the orbit is circular, the falloff is typically quite rapid, while extreme mass ratios can pump a significant amount of the total energy into other harmonics . For elliptical orbits, other modes can dominate the signal, e.g., a 3:1 ratio in power for the l = 2, m = 0 mode to the l = 2, m = 2 mode observed for high - ellipticity close orbits in . Ns - ns merger simulations address a broad set of questions, which can be roughly summarized as follows (note the same questions apply to bh - ns mergers as well): what is the final fate of the system, assuming a given set of initial parameters? Do we get a prompt collapse to a bh or the formation of a hmns supported against collapse by differential rotation? Other outcomes are disfavored, at least for pre - merger nss with masses mns 1.4 m since the supramassive limit is at most 20% larger than that of a non - rotating ns [70, 71], and even for the stiffest eos these values are typically less than 2.8 m.what is the gw signal from the merger, and how does it inform us about the initial pre - merger parameters of the system?what fraction of the system mass is left in a disk around the central bh or hmns? While deriving exact em emission profiles from a hydrodynamical configuration remains a challenge for the future, minimum conditions that would allow for the energy release observed in sgrbs have been established based on scaling arguments.what is the neutrino and em emission from the system, in both the time and energy domains? Obviously, the answer to this question and those that follow depend critically on the answers above.what role do b - fields play in the gw, em, and neutrino emission, and how does that tie in with other models suspected of having the same disk / jet geometry and gamma - ray emission like active galactic nuclei, pre - main sequence stars, etc. ?do mergers produce a cosmologically significant quantity of r - process elements, or do those likely get produced by other astrophysical events instead? What is the final fate of the system, assuming a given set of initial parameters? Do we get a prompt collapse to a bh or the formation of a hmns supported against collapse by differential rotation? Other outcomes are disfavored, at least for pre - merger nss with masses mns 1.4 m since the supramassive limit is at most 20% larger than that of a non - rotating ns [70, 71], and even for the stiffest eos these values are typically less than 2.8 m. what is the gw signal from the merger, and how does it inform us about the initial pre - merger parameters of the system? What fraction of the system mass is left in a disk around the central bh or hmns? While deriving exact em emission profiles from a hydrodynamical configuration remains a challenge for the future, minimum conditions that would allow for the energy release observed in sgrbs have been established based on scaling arguments . What is the neutrino and em emission from the system, in both the time and energy domains? Obviously, the answer to this question and those that follow depend critically on the answers above . What role do b - fields play in the gw, em, and neutrino emission, and how does that tie in with other models suspected of having the same disk / jet geometry and gamma - ray emission like active galactic nuclei, pre - main sequence stars, etc . ? Do mergers produce a cosmologically significant quantity of r - process elements, or do those likely get produced by other astrophysical events instead? The influence of the gravitational formalism used in a numerical simulation on the answer one finds for the questions above differs item by item . Determining the final fate of a merging system is highly dependent on the gravitational formalism; ns - ns merger remnants only undergo collapse in quasi - relativistic and fully gr schemes . Moreover, orbital dynamics at separations comparable to the isco and even somewhat larger depend strongly on the gravitational scheme . In particular, mass loss rates into a disk are often suppressed by orders of magnitude in gr calculations when compared to cf simulations, and even more so in comparison to pn and newtonian calculations . Em emission profiles from a disk are difficult to calculate accurately without the use of full gr for this reason . On the other hand, while gr is required to calculate the exact gw signal from a merger, even early newtonian simulations predicted many of the qualitative gw emission features correctly, and pn and cf schemes yielded results with some degree of quantitative accuracy about the full wavetrain . B - fields have only begun to be explored, but it already seems clear that they will affect the hydrodynamical evolution primarily after the merger in cases where differential rotation in a hmns or disk winds up magnetic field strengths up to energy equipartition levels, vastly stronger than those found in pre - merger nss . For such configurations, non - relativistic calculations can often reproduce the basic physical scenario but full gr is required to properly understand the underlying dynamics . Finally, the production of r - process elements, which depends sensitively on the thermodynamic evolution of the merger, seems to generally disfavor binary mergers as a significant source of the observed stellar abundances since the temperature and thus the electron fraction of the fluid remains too small, regardless of the nature of the gravitational treatment used in the calculations . This picture may need to be revised if significant mass loss occurs from the hot accretion disk that forms around the central post - merger object, possibly due to energy release from the r - process itself, but numerical calculations do not currently predict sufficient mass loss to match observations . Since the first ns - ns merger calculations, there have been two main directions for improvements: more accurate relativistic gravitation, resulting in the current codes that operate using a self - consistent fully gr approach, and the addition of microphysical effects, which now include treatments of magnetic fields and neutrino / em radiation . Noting that several of the following developments overlapped in time, e.g., the first full gr simulations by shibata and ury are coincident with the first pn sph calculations, and predate the first cf sph calculations, we consider in turn the original newtonian calculations, those performed using approximate relativistic schemes, the calculations performed using full gr, and finally those that have included more advanced microphysical treatments . Before reviewing fully dynamical calculations of ns - ns mergers, it is worthwhile to ask how much information can already be deduced from qe calculations, which may be performed at much smaller computational cost, as well as from semi - analytic pn treatments and related approximate techniques clearly, the details of the merger and ringdown phases fall outside the qe regime, so only dynamical calculations can yield reliable information about the stability of remnants, properties of ejecta, or other processes that arise during the merger itself or in its aftermath . Thus, the primary point of comparison is the gw signal just prior to merger, which is also easier to detect (for first and second generation interferometers). The strength of qe calculations lies in their ability to model self - consistently finite - size effects not captured in pn treatments (which always assume two orbiting point masses). The increased tidal interaction between the objects typically results in a more rapid phase advance of the binary orbit, which is important for constructing template waveforms that cover the entire ns - ns inspiral, merger, and ringdown . While qe sequences potentially offer a wealth of information about well - separated binaries and can help fix the phase evolution of the inspiraling binary, they do have two weaknesses arising as the binary approaches the stability limit . First, most qe methods, including the cts formalism described in section 4.2.1, are time - symmetric, and assume that the ns possess a symmetry plane perpendicular to the direction of motion (i.e., a front - back symmetry whose axis is perpendicular to the orbital angular momentum and the binary separation vector). In reality, tidal lags develop prior to final plunge, with the innermost edge of each ns rotating forward and the outer edge backwards . This effect has been captured in analytic and semi - analytic approaches (see, e.g., for an early example), and is clearly seen in dynamical calculations (see figure 3), but is not captured in cts - based schemes (tidal lags also develop in bh - ns merger calculations when the bh has a non - zero spin, since this breaks the front - back symmetry; see for an example). A second weakness of qe methods is the treatment of the isco, particularly its importance as a characteristic point along an evolutionary sequence that, in theory, could encode information about the ns eos . Simple estimates of the infall trajectory derived solely from qe sequences predict a very sudden and rapid infall near the isco, i.e., the point where the binding energy reaches a minimum along the sequence (see, e.g., the argument in)., binaries transition more gradually to the merger phase, and the inward plunge may occur significantly before reaching the formal isco; this in turns leads to more rapidly growing deviations from the qe approximation . Looking at the gw energy spectrum, one typically sees minor deviations from the point - mass predictions at frequencies below those characterizing the isco, but substantially more power at frequencies above it . Equivalently, the cutoff frequency for gw emission fcut, where the spectrum starts deviating strongly from the point - mass prediction, is usually higher than the qe frequency near the isco, fisco, while simple qe estimates assume these two frequencies to coincide . To date, most attempts to generate waveforms extended back to arbitrarily early starting points involve numerically matching pn signals, typically generated using the taylor t4 approach, onto the early stages of numerically generated waveforms, with some form of maximum overlap method used to provide the most physical transition from one to the other . These approaches may be improved by adding tidal effects to the evolution, typically parameterized by the tidal love numbers that describe how tidal gravity fields induce quadrupole deformations . Tidal effects can be placed into a relativistic framework [46, 74], which may be included within the effective one - body (eob) formalism to produce high - accuracy waveforms . In the eob approach, resummation methods are used to include higher - order pn effects, though some otherwise unfixed parameters need to be set by comparing to numerical simulations . Work is in its early stages to compare directly the gw spectra inferred from qe sequences of ns - ns binaries with those generated in numerical relativity simulations, but this comparison has been discussed at some length with regard to bh - ns mergers . Noting that ns - ns mergers generally correspond more closely to the bh - ns cases in which an isco is reached prior to the onset of tidal disruption, the kt collaboration [283, 276] concluded that the cutoff frequency marking significant deviations from pn point - mass behavior is roughly 30% higher than that marking emission near the classical isco for bh - ns systems (fcut 1.3 fisco). A more detailed study has now been performed comparing eob methods to numerical evolutions . By comparing to long - term simulations of ns - ns mergers, baiotti et al . Find that eob models may be tuned, via careful choices of their unfixed parameters, to reproduce the gw phases and amplitudes seen in nr evolutions up until the onset of merger . They further suggest that the eob approach seems to cover a wider range of phase space than the taylor t4 approach, presumable because of a more consistent representation of tidal effects, and offers the best route forward for construction of more accurate ns - ns inspiral templates . The earliest ns - ns merger calculations were performed in newtonian gravity, sometimes with the addition of lowest - order 2.5pn radiation reaction forces, and typically assumed that the ns eos was polytropic . Both eulerian grid codes [214, 196, 215, 197, 278, 255, 201, 298] and lagrangian sph codes [234, 235, 236, 76, 330, 331] were employed, and gw signals were derived under the assumptions of the quadrupole formalism . Configurations in newtonian gravity cannot collapse, so a stable (possibly hypermassive) remnant was always formed . For polytropic eos models with adiabatic indices larger than the classical minimum for production of a jacobi ellipsoid, 2.6, remnants were typically triaxial and maintained a significant - amplitude gw signal until the end of the simulation . For simulations using smaller values of, remnants rapidly relaxed to spheroidal configurations, quickly damping away the resulting gw signal . Mass loss from the central remnant was often quite significant, with thick accretion disks or completely unbound material comprising up to 1020% of the total system mass mass loss was suppressed in numerical simulations by constructing irrotational, rather than synchronized, initial data . Irrotational flow is widely thought to be the more physically realistic case, since viscous forces are much too weak to synchronize a ns prior to merger [45, 146]. When irrotational nss (which are counter - rotating in the corotating frame of the binary) first make contact, a vortex sheet forms . Since the low - density fluid layers at the contact surface are surrounded at first contact by the denser fluid layers located originally within each ns, the configuration is well understood to be kelvin - helmholtz unstable, resulting in rapid mixing through vortex production . Meanwhile, mass loss through the outer lagrange points is hampered by the reduced rotational velocity along the outer halves of each ns . Chirp, increasing in frequency and amplitude as the nss spiral inward, followed by a ringdown signal once the stars collide and merge . In [330, 331], a procedure to calculate the energy spectrum in the frequency band was laid out, with the resulting signal following the quadrupole, point - mass power - law form up to gw frequencies characterizing the beginning of the plunge . Above the plunge frequency, a sharp drop in the gw energy was seen, followed in some cases by spikes at khz frequencies representing coherent emission during the ringdown phase . The first steps toward approximating the effects of gr included the use of 1pn dynamics or the cf approximation . Using a formalism derived by blanchet, damour, and schfer, the 1pn equations of motion require the solution of eight poisson - like equations in the form 33\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\nabla ^2}\psi = f(\vec x),$$\end{document} where the source terms \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$f(\vec x)$\end{document} are compactly supported, and thus the fields may be determined using the same techniques already in place to find the newtonian potential . Adding in the lowest - order dissipative radiation reaction effects requires solution of a ninth poisson equation for a reaction potential . The 1pn formalism was implemented in both grid - based and sph codes [10, 99, 101, 100]. Unfortunately, physically realistic nss are difficult to model using a pn expansion, since the characteristic ns compactness \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c}\gtrsim 0.15$\end{document}, leads to first order corrections that often rival newtonian terms in magnitude . To deal with this problem ayal et al . Considered large (r 30 km), low - mass (<1 m) nss, allowing them to study relativistic effects but making results more difficult to interpret for physically realistic mergers . In [99, 101, 100], a dual speed of light approach was used, in which all 1pn effects were scaled down by a constant factor to yield smaller quantities while newtonian and radiation reaction terms were included at full - strength . Both sph groups found that the gw signal in pn mergers is strongly modulated, whereas newtonian merger calculations typically yielded smooth, either monotonically decreasing or nearly constant - amplitude ringdown signals . Even reduced 1pn effects were shown to suppress mass loss by a factor of 25 for initially synchronized cases, and disk formation was seen to be virtually non - existent for initially irrotational, equal - mass nss with a stiff (= 3 polytropic) eos . Moving beyond the linearized regime, several groups explored the cf approximation, which incorporates many of the nonlinear effects of gr into an elliptic, rather than hyperbolic, evolution scheme . While nonlinear elliptic solvers are expensive computationally, they typically yield stable evolution schemes since field solutions are always calculated instantaneously from the given matter configuration . 18, 19, and 20, at every timestep, and evolving the matter configuration forward in time . The metric fields act like potentials, with various gradients appearing in the euler and energy equations . While the cts formalism remains the most widely used method to construct ns - ns (and bh - ns) initial data, it does not provide a completely consistent dynamical solution to the gr field equations . In particular, while it reproduces spherically symmetric configurations like the schwarzschild solution exactly, it cannot describe more complicated configurations, including kerr bhs . Moreover, because the cf approximation is time - symmetric, it also does not allow one to consistently predict the gw signal from a merging configuration . As a result, most dynamical calculations are performed by adding the lowest - order dissipative radiation reaction terms, either in the quadrupole limit or via the radiation reaction potential introduced in . The cts equations themselves were originally written down in essentially complete form by isenberg in the 1970s, but his paper was rejected and only published after a delay of nearly 30 years . In the intervening years, wilson, mathews, and marronetti [327, 328, 188, 187] independently re - derived the entire formalism and used it to perform the first nonlinear calculations of ns - ns mergers (as a result, the formalism is often referred to as the wilson - mathews or isenberg - wilson - mathews formalism). The key result in [327, 328, 188, 187] was the existence of a collapse instability, in which the deeper gravitational wells experienced by the nss as they approached each other prior to merger could force one or both to collapse to bhs prior to the orbit itself becoming unstable . Unfortunately, their results were affected by an error, pointed out in, which meant that much of the observed compression was spurious . While their later calculations still found some increase in the central density as the nss approached each other, these results have been contradicted by other qe sequence calculations (see, e.g.,). Furthermore, using a cf - like formalism in which the nonlinear source terms for the field equations are ignored, dynamical calculations demonstrated the maximum allowed mass for a ns actually increases in response to the growing tidal stress . The cf approach was adapted into a lagrangian scheme for sph calculations by the same groups that had investigated pn ns - ns mergers, with oechslin, rosswog, and thielemann using a multigrid scheme and faber, grandclment, and rasio a spectral solver based on the lorene libraries . The effects of nonlinear gravity were immediately evident in both sets of calculations . In, ns - ns binaries consisting of initially synchronized nss merged without appreciable mass loss, with no more that 10 of the total system mass ejected, strikingly different from previous newtonian and pn simulations . When evolving initially irrotational systems, found no appreciable developments of spiral arms whatsoever, indicating a complete lack of mass loss through the outer lagrange points . Both groups also found strong emission from remnants for a stiff eos, as the triaxial merger remnant produced an extended period of strong ringdown emission . Neither set of calculations indicated that the remnant should collapse promptly to form a bh, but given the high spin of the remnant it was noted that conformal flatness would have already broken down for those systems . A summary of full gr calculations of ns - ns mergers is presented in table 4 . The kt collaboration was responsible for the only full gr calculations of ns - ns mergers that predate the breakthrough calculations of numerically stable binary bh evolutions [231, 22, 61], which have since transformed the field of gr hydrodynamics and mhd in addition to vacuum relativistic evolutions (miller et al . Performed ns - ns inspiral calculations in full gr, but were not able to follow binaries through to merger). The first calculations of ns - ns mergers using a completely self - consistent treatment of gr were performed by shibata and collaborators in the kt collaboration using a grid based code and the bssn formalism . Cts initial data consisting of equal - mass nss described by a = 2 polytropic eos were constructed via scf techniques, for both synchronized and irrotational configurations . The hyperbolic system was evolved on a grid, with an approximate maximal slicing condition that results in a parabolic equation for the lapse and an approximate minimal distortion condition for the shift vector requiring the solution of an elliptic equation at every time step . The shift vector gauge condition was found to fail when bhs were produced in the merger remnant, a well - known problem that had long bedeviled simulations involving binary and even single bh evolutions, so modifications were introduced to extend the stability of the algorithm as far as possible . Among the key results from this early work was a clear differentiation between mergers of moderately low - compactness nss \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$({\mathcal c} \gtrsim 0.11)$\end{document}, where the remnant collapsed promptly to a bh, and very low - compactness models, which yielded hypermassive remnants stabilized against gravitational collapse by differential rotation . Virtually all the ns matter was contained within the remnant for initially irrotational models, which served as evidence against equal - mass nss mergers being a leading source of r - process elements in the universe through ejection . The lack of significant mass loss in equal - mass mergers, together with insignificant shock - heating of the material, also argued against the likelihood of such mergers as progenitors for sgrbs if the gamma - ray emission was assumed to be coincident with the gw burst; instead a delayed burst following the collapse of a hmns to a bh appeared more likely . Eos models include polytropes, piecewise polytropes (pp), as well as physically motivated models including cold sly, fps, and apr models to which one adds an ideal - gas hot component to reflect shock heating, as well as the shen [268, 267] finite temperature model and eos that include hyperonic contributions . Co / ir indicates that both corotating and irrotational models were considered; bhb indicates that bh binary mergers were also presented, including both bh - bh and bh - ns types, -leak indicates a neutrino leakage scheme was included in the calculation, gh indicates calculations were performed using the ghg formalism rather than bssn, non - qe indicates superposition initial data were used, including cases where eccentric configurations were studied (eccen . ); mhd indicates mhd was used to evolve the system.groupref.ns eosmass rationoteskt=210.090.15co / ir- = 2, 2.250.8910.10.17-=20.8510.10.12-sly, fps+hot0.9210.10.13-sly, apr+hot0.6410.110.13- = 20.8510.140.16bhb - apr+hot0.810.140.18-apr, sly, fps+hot0.81.00.160.2-shen10.140.16-leak - pp+hot10.120.17-shen, hyp1.00.140.16-leakhad = 21.00.08gh, non - qe- = 21.00.08gh, non - qe, mhdwhisky = 21.00.140.18- = 21.00.20- = 21.00.140.18mhd- = 21.00.140.18mhd-=20.701.00.090.17-[14, 15] = 21.00.120.14- = 21.00.18mhduiuc = 20.8510.140.18mhdjena[308, 41] = 21.00.14- = 21.01.4eccen . A summary of full gr ns - ns merger calculations . Eos models include polytropes, piecewise polytropes (pp), as well as physically motivated models including cold sly, fps, and apr models to which one adds an ideal - gas hot component to reflect shock heating, as well as the shen [268, 267] finite temperature model and eos that include hyperonic contributions . Co / ir indicates that both corotating and irrotational models were considered; bhb indicates that bh binary mergers were also presented, including both bh - bh and bh - ns types, -leak indicates a neutrino leakage scheme was included in the calculation, gh indicates calculations were performed using the ghg formalism rather than bssn, non - qe indicates superposition initial data were used, including cases where eccentric configurations were studied (eccen . ); mhd indicates mhd was used to evolve the system . Later works, in particular a paper by shibata, taniguchi, and ury, introduced several new techniques to perform dynamical calculations that most codes at present still include in nearly the same or lightly modified form . These included the use of a high - resolution shock - capturing scheme for the hydrodynamics, as well as a gamma - driver shift condition closely resembling the moving puncture gauge conditions that later proved instrumental in allowing for long - term bh evolution calculations . In the series of papers that followed their original calculations, the kt group established a number of results about ns - ns mergers that form the basis for much of our thinking about their hydrodynamic evolution: by varying the eos model for the ns as well as the mass ratio, it was possible to constrain the binary parameters separating cases that form a hmns rather than producing prompt collapse to a bh, and it was quickly determined that the total system mass as a proportion of the maximum allowed mass for an isolated ns is the key parameter, with only weak dependence on the binary mass ratio.for polytropic eos models, the critical compactness values leading to prompt collapse for equal - mass binary mergers were found to be \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.14$\end{document} for = 2 and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.16$\end{document} for = 2.25 . As a rough rule, collapse occurred for polytropic eos when the total system rest - mass was at least 1.7 mmax, where mmax is the maximum mass of an isolated non - rotating ns for the given eos . For physically motivated eos models, the critical mass was significantly smaller; indeed, the critical ns mass was found to be 1.35 mmax for the sly eos (i.e., collapse for mtot 2.7 m with mmax = 2.04 m) and 1.39 mmax for the fps eos (collapse for mtot 2.5 m with mmax = 1.8 m). This was not a complete surprise, since for the physically motivated eos the ns radius is nearly independent of the mass across much of the parameter space, limiting the ability of the hmns to expand in response to the extra mass absorbed during the merger.the mass ratio was found to play a critical role in the evolution of the remnant / disk configuration, since unequal - mass cases are better characterized as disruptions of the smaller secondary followed by its accretion onto the primary, rather than a true merger between the two nss . Disk masses from full gr calculations are generically smaller than those predicted from non - gr calculations . For polytropic eos, disks contain approximately 4% of the total system mass for mass ratios q 0.8, varying roughly (1 q) for a fixed total mass, with the disk mass decreasing for heavier binaries (and thus larger compactnesses) given the stronger gravity of the central remnant . Using the stiffer apr eos, the dependence on the mass ratio was seen to be much steeper for a physical eos than for polytropes, scaling like (1 qp), where p 34 .with respect to gw emission, it was determined in that in low - mass cases in which a hmns was formed, stiffer polytropic eos models were able to support the development of a bar - mode instability, leading to transient spiral arm formation from the remnant and an extended period of strong gw emission, in the characteristic modulated form that results from differentially rotating ellipsoids (see, e.g., [160, 274, 259, 16, 183, 72]). Unequal - mass cases typically yielded one high - frequency peak at roughly gw 2 khz corresponding to non - axisymmetric oscillations, and equal - mass cases yielded multiple peaks including those associated with quasi - radial oscillations as well . For physical eos models, mass loss into a disk is reduced relative to the polytropic case given the higher compactness of the central region, and gw oscillation peaks, while very strong, occur at correspondingly higher frequencies . By contrast, prompt formation of a bh led to a ringdown signal with rapidly decreasing amplitude becoming negligible within a few dynamical times.the gw signals were evaluated under the gauge - dependent assumption of transverse tracelessness, and energy and angular momentum loss rates into each spherical harmonic mode were computed using the gauge - invariant zerilli - moncrief formalism [239, 335, 195] in much the same way that is used by some groups in numerical relativity today (many bh - bh and hydrodynamics simulations report gw signals derived from the alternate 4 weyl scalar formulation [202, 60], or use both methods).in, it was concluded that mergers of nss with comparable masses made poor sgrb progenitor candidates, assuming prompt emission (because of the lack of energy available for neutrino annihilation), but that the energy budget in the hmns case is orders of magnitude larger . Remarkably, this discussion from 2005 predates the first identifications of sgrbs with older populations, which greatly improved our theoretical understanding of compact object mergers as their likely progenitors . In the first work that followed the initial localizations of sgrbs, mergers of binaries with relatively small mass ratios, q 0.7, were seen to form sufficiently hot and massive disk to power a sgrb, albeit a relatively brief, low - luminosity one . It was suggested that the more likely sgrb progenitor is indeed a hmns, since dissipative effects within the remnant can boost temperatures up to 10 k.further approximate relativistic investigations of ns - ns mergers, along with bh - ns mergers, as potential sgrb sources quickly swept through the community after the initial localizations of sgrbs, with several groups using a wide variety of methods all concluding that mergers were plausible progenitors, but finding it extremely difficult to constrain the scenario in quantitative ways given the extremely complicated microphysics ultimately responsible for powering the burst (see, e.g., [207, 206] who investigated potential disk energies;, who modeled the fallback accretion phase onto a bh; and, who considered the thermodynamic and nuclear evolution of disks around newly - formed bhs produced by mergers). We will return to this topic below in light of recent grmhd simulations . By varying the eos model for the ns as well as the mass ratio, it was possible to constrain the binary parameters separating cases that form a hmns rather than producing prompt collapse to a bh, and it was quickly determined that the total system mass as a proportion of the maximum allowed mass for an isolated ns is the key parameter, with only weak dependence on the binary mass ratio . For polytropic eos models, the critical compactness values leading to prompt collapse for equal - mass binary mergers were found to be \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.14$\end{document} for = 2 and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${\mathcal c} = 0.16$\end{document} for = 2.25 . As a rough rule, collapse occurred for polytropic eos when the total system rest - mass was at least 1.7 mmax, where mmax is the maximum mass of an isolated non - rotating ns for the given eos . For physically motivated eos models, the critical mass was significantly smaller; indeed, the critical ns mass was found to be 1.35 mmax for the sly eos (i.e., collapse for mtot 2.7 m with mmax = 2.04 m) and 1.39 mmax for the fps eos (collapse for mtot 2.5 m with mmax = 1.8 m). This was not a complete surprise, since for the physically motivated eos the ns radius is nearly independent of the mass across much of the parameter space, limiting the ability of the hmns to expand in response to the extra mass absorbed during the merger . The mass ratio was found to play a critical role in the evolution of the remnant / disk configuration, since unequal - mass cases are better characterized as disruptions of the smaller secondary followed by its accretion onto the primary, rather than a true merger between the two nss . Disk masses from full gr calculations are generically smaller than those predicted from non - gr calculations . For polytropic eos, disks contain approximately 4% of the total system mass for mass ratios q 0.8, varying roughly (1 q) for a fixed total mass, with the disk mass decreasing for heavier binaries (and thus larger compactnesses) given the stronger gravity of the central remnant . Using the stiffer apr eos, the dependence on the mass ratio was seen to be much steeper for a physical eos than for polytropes, scaling like (1 qp), where p 34 . With respect to gw emission, it was determined in that in low - mass cases in which a hmns was formed, stiffer polytropic eos models were able to support the development of a bar - mode instability, leading to transient spiral arm formation from the remnant and an extended period of strong gw emission, in the characteristic modulated form that results from differentially rotating ellipsoids (see, e.g., [160, 274, 259, 16, 183, 72]). Unequal - mass cases typically yielded one high - frequency peak at roughly gw 2 khz corresponding to non - axisymmetric oscillations, and equal - mass cases yielded multiple peaks including those associated with quasi - radial oscillations as well . For physical eos models, mass loss into a disk is reduced relative to the polytropic case given the higher compactness of the central region, and gw oscillation peaks, while very strong, occur at correspondingly higher frequencies . By contrast, prompt formation of a bh led to a ringdown signal with rapidly decreasing amplitude becoming negligible within a few dynamical times . The gw signals were evaluated under the gauge - dependent assumption of transverse tracelessness, and energy and angular momentum loss rates into each spherical harmonic mode were computed using the gauge - invariant zerilli - moncrief formalism [239, 335, 195] in much the same way that is used by some groups in numerical relativity today (many bh - bh and hydrodynamics simulations report gw signals derived from the alternate 4 weyl scalar formulation [202, 60], or use both methods). In, it was concluded that mergers of nss with comparable masses made poor sgrb progenitor candidates, assuming prompt emission (because of the lack of energy available for neutrino annihilation), but that the energy budget in the hmns case is orders of magnitude larger . Remarkably, this discussion from 2005 predates the first identifications of sgrbs with older populations, which greatly improved our theoretical understanding of compact object mergers as their likely progenitors . In the first work that followed the initial localizations of sgrbs, mergers of binaries with relatively small mass ratios, q 0.7, were seen to form sufficiently hot and massive disk to power a sgrb, albeit a relatively brief, low - luminosity one . It was suggested that the more likely sgrb progenitor is indeed a hmns, since dissipative effects within the remnant can boost temperatures up to 10 k. further approximate relativistic investigations of ns - ns mergers, along with bh - ns mergers, as potential sgrb sources quickly swept through the community after the initial localizations of sgrbs, with several groups using a wide variety of methods all concluding that mergers were plausible progenitors, but finding it extremely difficult to constrain the scenario in quantitative ways given the extremely complicated microphysics ultimately responsible for powering the burst (see, e.g., [207, 206] who investigated potential disk energies;, who modeled the fallback accretion phase onto a bh; and, who considered the thermodynamic and nuclear evolution of disks around newly - formed bhs produced by mergers). We will return to this topic below in light of recent grmhd simulations . In the past few years, five groups have reported results from ns - ns mergers in full gr; kt, had, whisky, uiuc, and jena . Much of the work of the had and whisky groups, developers respectively of the code of those names, began at louisiana state university (had) and the albert einstein institute in potsdam (whisky), though both efforts now include several other collaborating institutions . Two other groups, the sxs collaboration that originated at caltech and cornell, and the princeton group, have reported bh - ns merger results and are actively studying ns - ns mergers as well, but have yet to publish their initial papers about the latter . All of the current groups use amr - based eulerian grid codes, with four evolving einstein s equations using the bssn formalism and the had collaboration making use of the ghg method instead . Had, whisky, and uiuc have all reported results about magnetized ns - ns mergers (the kt collaboration has used a grmhd code to study the evolution of magnetized hmns, but not complete ns - ns mergers). The kt collaboration has considered a wide range of eos models, including finite - temperature physical models such as the shen eos, and have also implemented a neutrino leakage scheme, while all other results reported to date have assumed a = 2 polytropic eos model . Given the similarities of the various codes used to study ns - ns mergers, it is worthwhile to ask whether they do produce consistent results . A comparison paper between the whisky code and the kt collaboration s sacra codes found that both codes performed well for conservative global quantities, with global extrema such as the maximum rest - mass density in agreement to within 1% and waveform amplitudes and frequencies differing by no more than 10% throughout a full simulation, and typically much less . Several of the the groups listed above have also been leaders in the field of bh - ns simulations: the kt, had, and uiuc groups have all presented bh - ns merger results, as have the sxs collaboration [85, 84, 108], and princeton group [294, 88] (see for a thorough review). We discuss the current understanding of ns - ns mergers in light of all these calculations below . Using their newly developed sacra code, the kt group, found that when a hybrid eos is used to model the ns, in which the cold part is described by the apr eos and the thermal component as a = 2 ideal gas, the critical total binary mass for prompt collapse to a bh is mtot = 2.82.9 m, independent of the initial binary mass ratio, a result consistent with previous explorations of other polytropic and physically motivated ns eos models (see above). In all cases, the bh was formed with a spin parameter a 0.78 depending very weakly on the total system mass and mass ratio . They further classified the critical masses for a number of other physical eos in, finding that binaries with total masses mtot 2.7 m should yield long - lived hmnss (> 10 ms) and substantial disk masses with mdisk> 0.04 m assuming that the current limit on the heaviest observed ns, m = 1.97 m is correct . In figure 10, we show the final fate of the merger remnant as a function of the total pre - merger mass of the binary . Type i indicates a prompt collapse of the merger remnant to a bh, type ii a short - lived hmns, which lasts for less than 5 ms after the merger until its collapse, and type iii a long - lived hmns which survives for at least 5 ms . The horizontal axis shows the eoss together with the corresponding ns radii for mns = 1.4 m. image reproduced by permission from figure 3 of, copyright by aps . The horizontal axis shows the eoss together with the corresponding ns radii for mns = 1.4 m. image reproduced by permission from figure 3 of, copyright by aps . While all of the above results incorporated shock heating, the addition of both finite - temperature effects in the eos and neutrino emission modifies the numerically determined critical masses separating hmns formation from prompt collapse . Adding in a neutrino leakage scheme for a ns - ns merger performed using the relatively stiff finite - temperature shen eos, the kt collaboration reports in that hmnss will form generically for binary masses 3.2 m, not because they are centrifugally - supported but rather because they are pressure - supported, with a remnant temperature in the range 3070 mev . Since they are not supported by differential rotation, these hmnss were predicted to be stable until neutrino cooling, with luminosities of 310 10 erg / s, can remove the pressure support . Even for cases where the physical effects of hyperons were included, which effectively soften the eos and reduce the maximum allowed mass for an isolated ns to 1.8 m, the kt collaboration still finds that thermal support can stabilize hmns with masses up to 2.7 m. using a carpet / cactus - based hydrodynamics code called whisky that works within the bssn formalism (a version of which has been publicly released as grhydro within the einstein), the whisky collaboration has analyzed the dependence of disk masses on binary parameters in some detail . For mass ratios q = 0.71.0, they found that bound disks with masses of up to 0.2 m can be formed, with the disk mass following the approximate form 34\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${m_{{\rm{disk}}}} = 0{. }039({m_{\max}} - {m_{{\rm{tot}}}}) + 1{. }115(1 - q)({m_{\max}} - {m_{{\rm{tot}}}});\quad {m_{\max}} = 1{. }139(1 + q){m_\ast},$$\end{document} where mmax the maximum mass of a binary system for a given eos (= 2 ideal gas for these calculations), m * is the maximum mass of an isolated non - rotating ns for the eos, and mtot the mass of the binary, with all masses here defined as baryonic . The evolution of the total rest mass present in the computational domain for a number of simulations is shown in figure 11 . Figure 11evolution of the total rest mass mtot of the remnant disk (outside the bh horizon) normalized to the initial value for ns - ns mergers using a = 2 polytropic eos with differing mass ratios and total masses . The order of magnitude of the mass fraction in the disk can be read off the logarithmic mass scale on the vertical axis . The curves referring to different models evolution of the total rest mass mtot of the remnant disk (outside the bh horizon) normalized to the initial value for ns - ns mergers using a = 2 polytropic eos with differing mass ratios and total masses . The order of magnitude of the mass fraction in the disk can be read off the logarithmic mass scale on the vertical axis . The curves referring to different models image reproduced by permisison from figure 5 of, copyright by iop . Using the had code described in that evolves the ghg system on an amr - based grid with ceno reconstruction techniques, anderson et al . Performed the first study of magnetic effects in full gr ns - ns mergers . Beginning from spherical nss with extremely strong poloidal magnetic fields (9.6 10 g, as is found in magnetars), their merger simulations showed that magnetic repulsion can delay merger by 12 orbits and lead to the formation of magnetically buoyant cavities at the trailing end of each ns as contact is made (see figure 12), although the latter may be affected by the non - equilibrium initial data . Both effects would have been greatly reduced if more realistic magnetic fields strengths had been considered . Magnetic fields in the hmns remnant, which can be amplified through dynamo effects regardless of their initial strengths, helped to distribute angular momentum outward via the magnetorotational instability (mri), leading to a less differentially rotating velocity profile and a more axisymmetric remnant . The gw emission in the magnetized case was seen to occur at lower characteristic frequencies and amplitudes as a result . Figure 12fluid density isocontours and magnetic field distribution (in a plane slightly above the equator) immediately after first contact for a magnetized merger simulation . Fluid density isocontours and magnetic field distribution (in a plane slightly above the equator) immediately after first contact for a magnetized merger simulation . The uiuc group was among the first to produce fully self - consistent grmhd results . Using a newly developed cactus - based code, they performed the first studies of unequal - mass magnetized ns - ns mergers . Using poloidal, magnetar - level initial magnetic fields, liu et al . Found that magnetic effects are essentially negligible prior to merger, but can increase the mass in a disk around a newly formed bh moderately, from 1.3% to 1.8% of the total system mass for mass ratios of q = 0.85 and = 2 . They point out that mhd effects can efficiently channel outflows away from the system s center after collapse, and may be important for the late - stage evolution of the system . In, the whisky group performed simulations of magnetized mergers with field strengths ranging from 10 to 10 g. agreeing with the uiuc work that magnetic field strengths would have essentially no effect on the gw emission during inspiral, they note that magnetic effects become significant for the hmns, since differential rotation can amplify b - fields, with marked deviations in the gw spectrum appearing at frequencies of gw 2 khz . They also point out that high - order mhd reconstruction schemes, such as third - order ppm, can produce significantly more accurate results that second - order limiter - based schemes . A follow - up paper showed that a plausible way to detect the effect of physically realistic magnetic fields on the gw signal from a merger was through a significant shortening of the timescale for a hmns to collapse, though a third - generation gw detector could perhaps observe differences in the khz emission of the hmns as well . More recently, they have used very long - term simulations to focus attention on the magnetic field strength and geometry found after the remnant collapses to a bh . They find that the large, turbulent magnetic fields (b 10 g) present in the initial binary configuration are boosted exponentially in time up to a poloidal field of strength 10 g in the remnant disk, with the field lines maintaining a half - opening angle of 30 along the bh spin axis, a configuration thought to be extremely promising for producing a sgrb . The resulting evolution, shown in figure 13, is perhaps the most definitive result indicating that ns - ns mergers should produce sgrbs for some plausible range of initial parameters . Figure 13evolution of the density in a ns - ns merger, with magnetic field lines superposed . The first panel shows the binary shortly after contact, while the second shows the short - lived hmns remnant shortly before it collapses . In the latter two panels, a bh has already formed, and the disk around it winds up the magnetic field to a poloidal geometry of extremely large strength, 10 g, with an half - opening angle of 30, consistent with theoretical sgrb models . Evolution of the density in a ns - ns merger, with magnetic field lines superposed . The first panel shows the binary shortly after contact, while the second shows the short - lived hmns remnant shortly before it collapses . In the latter two panels, a bh has already formed, and the disk around it winds up the magnetic field to a poloidal geometry of extremely large strength, 10 g, with an half - opening angle of 30, consistent with theoretical sgrb models . It is worth noting that all magnetized ns - ns merger calculations that have been attempted to date have made use of unphysically large magnetic fields . This is not merely a convenience designed to enhance the role of magnetic effects during the merger, though it does have that effect . Rather, magnetic fields are boosted in hmns remnants by the mri, whose fastest growing unstable mode depends roughly linearly on the alfvn speed, and thus the magnetic field strength . In order to move to physically reasonable magnetic field values, one would have to resolve the hmns at least a factor of 100 times better in each of three dimensions, which is beyond the capability of even the largest supercomputers at present, and likely will be for some time to come . In, the kt collaboration found a nearly linear relationship between the gw spectrum cutoff frequency fcut and the ns compactness, independent of the eos, as well as a relationship between the disk mass and the width of the khz hump seen in the gw energy spectrum . While fcut is a somewhat crude measure of the ns compactness, it occurs at substantially lower frequencies than any emission process associated with merger remnants, and thus is the parameter most likely to be accessible to gw observations with a second generation detector . The qualitative form of the high - frequency components of the gw spectrum is primarily determined by the type of remnant formed . In figures 14 and 15, we show h(t) and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$\tilde h(f)$\end{document}, respectively, for four of the runs calculated by the kt collaboration and described in . Type i collapses are characterized by a rapid decrease in the gw amplitude immediately after the merger, yielding relatively low power at frequencies above the cutoff frequency . Type ii and iii mergers yield longer periods of gw emission after the merger, especially the latter, with the remnant oscillation modes leading to clear peaks at gw frequencies fgw = 24 khz that should someday be detectable by third generation detectors like the einstein telescope, or possibly even by advanced ligo should the source be sufficiently close (d 20 mpc) and the high - frequency peak of sufficiently high quality . Dh / m0, where d is the distance to the source and m0 the total mass of the binary, versus time for four different ns - ns merger calculations . The different merger types become apparent in the post - merger gw signal, clearly indicating how bh formation rapidly drives the gw signal down to negligible amplitudes . Image reproduced by permission from figures 5 and 6 of, copyright by aps . Figure 15effective strain at a distance of 100 mpc shown as a function of the gw frequency (solid red curve) for the same four merger calculations depicted in figure 14 . Post - merger quasi - periodic oscillations are seen as broad peaks in the gw spectrum at frequencies fgw = 24 khz . The blue curve shows the taylor t4 result, which represents a particular method of deducing the signal from a 3pn evolution . The thick green dashed curve and orange dot - dashed curves depict the sensitivities of the second - generation advanced ligo and lcgt (large scale cryogenic gravitational wave telescope) detectors, respectively, while the maroon dashed curve shows the sensitivity of a hypothetical third - generation einstein telescope . Dimensionless gw strain dh / m0, where d is the distance to the source and m0 the total mass of the binary, versus time for four different ns - ns merger calculations . The different merger types become apparent in the post - merger gw signal, clearly indicating how bh formation rapidly drives the gw signal down to negligible amplitudes . Effective strain at a distance of 100 mpc shown as a function of the gw frequency (solid red curve) for the same four merger calculations depicted in figure 14 . Post - merger quasi - periodic oscillations are seen as broad peaks in the gw spectrum at frequencies fgw = 24 khz . The blue curve shows the taylor t4 result, which represents a particular method of deducing the signal from a 3pn evolution . The thick green dashed curve and orange dot - dashed curves depict the sensitivities of the second - generation advanced ligo and lcgt (large scale cryogenic gravitational wave telescope) detectors, respectively, while the maroon dashed curve shows the sensitivity of a hypothetical third - generation einstein telescope . Image reproduced by permission from figures 5 and 6 of, copyright by aps . Using new multi - orbit simulations of ns - ns mergers, [14, 15] showed that the semi - analytic effective one - body (eob) formalism severely underestimates high - order relativistic corrections even when lowest - order finite - size tidal effects were included . As a result, phase errors of almost a quarter of a radian can develop, although these may be virtually eliminated by introducing a second - order next - to - next - to - leading order (nnlo) correction term and fixing the coefficient to match numerical results the excellent agreement between pre - merger numerical waveforms and the revised semi - analytic eob approximant is shown in figure 16 . Figure 16comparison between numerical waveforms, shown as a solid black line, and semi - analytic nnlo eob waveforms, shown as a red dashed line (top panel). The top panels show the real parts of the eob and numerical relativity waveforms, and the middle panels display the corresponding phase differences between waveforms generated with the two methods . There is excellent agreement between with the numerical waveform almost up to the time of the merger as shown by the match of the orbital frequencies (bottom panel). Comparison between numerical waveforms, shown as a solid black line, and semi - analytic nnlo eob waveforms, shown as a red dashed line (top panel). The top panels show the real parts of the eob and numerical relativity waveforms, and the middle panels display the corresponding phase differences between waveforms generated with the two methods . There is excellent agreement between with the numerical waveform almost up to the time of the merger as shown by the match of the orbital frequencies (bottom panel). The effects of binary eccentricity on ns - ns mergers was recently studied by the jena group . Such systems, which would indicate dynamical formation processes rather than the long - term evolution of primordial binaries, evolve differently in several fundamental ways from binaries that merge from circular orbits . For nearly head - on collisions, they found prompt bh formation and negligible disk mass production, with only a single gw burst at frequencies comparable to the quasi - normal mode of the newly formed bh . For a collision in which mass transfer occurred at the first passage but two orbits were required to complete the merger and form a bh, a massive disk was formed, containing 8% of the total system mass even at time t = 100 mtot 280 m after the formation of the bh . During that time, the black hole accreted an even larger amount of mass, representing over twice the mass of the remaining disk . Between the first close passage and the second, during which the two ns merged, the gw signal was seen to be quasi - periodic, and a a frequency comparable to the fundamental oscillation mode of the two ns, a result that was duplicated in a calculation for which the periastron fell outside the roche limit and the eccentric binary survived for the full duration of the run, comprising several orbits . In parallel to efforts in full gr, there has also been great progress in numerical simulations that include approximate relativistic treatments but a more detailed approach to microphysical issues . The first simulations to use a realistic eos for ns - ns mergers were performed by ruffert, janka, and collaborators [253, 139, 254], who assumed the lattimer - swesty eos for their newtonian ppm - based eulerian calculations . They were able to determine a physically meaningful temperature for ns - ns merger remnants of 3050 mev, an overall neutrino luminosity of roughly 10 erg / s for tens of milliseconds, and a corresponding annihilation rate of 25 10 erg / s given the computed annihilation efficiencies of a few parts in a thousand . This resulted in an energy loss of 24 10 erg over the lifetime of the remnant, a value later confirmed in multigrid simulations that replaced the newly formed hmns by a newtonian or quasi - relativistic bh surrounded by the bound material making up a disk . The temperatures in the resulting neutron - rich (ye 0.050.2) remnant were thought to be encouraging for the production of r - process elements, although numerical resolution of the low - density ejecta limited the ability to make quantitatively accurate estimates of its exact chemical distribution . Further calculations, some of which involved unequal - mass binaries, indicated that the temperatures and electron fractions in the ejecta were likely not sufficient to produce solar abundances of r - process elements, with electron fractions in particular smaller than those set by hand in the r - process production model that appears in [111, 245]. More recently, it was suggested that the decompression of matter originally located in the inner crust of a ns and ejected during a merger has a nearly solar elemental distribution for heavy r - process elements (a> 140). This indicates that ns - ns mergers may be the source of the observed cosmic r - process elements should there be sufficient mass loss per merger event, mej 35 10 m, although these amounts have yet to be observed in full gr simulations which have often admittedly been performed using cruder microphysical treatments . In, rosswog and davies included a detailed neutrino leakage scheme in their calculations and also adopted the shen eos for several calculations, finding in a later paper that the gamma - ray energy release is roughly 10 erg, in line with previous results from other groups, but noting that the values would be significantly higher if temperatures in the remnant were higher, since the neutrino luminosity scales like a very high power of the temperature . These calculations also identified ns - ns mergers as likely sgrb candidates given the favorable geometry, and the possibility that the mri in a hmns remnant could dramatically boost magnetic fields on the sub - second timescales characterizing sgrbs . Rosswog and liebendrfer found that electron antineutrinos \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}${{\bar \nu}_e}$\end{document} dominate the emission, as had ruffert and janka, though the exact thermodynamic and nuclear profiles were found to be somewhat sensitive to the properties of the eos model . More recently, using the vulcan 2-dimensional multi - group flux - limited - diffusion radiation hydrodynamics code to evaluate slices taken from sph calculations, dessart et al . Found that neutrino heating of the remnant material will eject roug hly 10 m from the system . Price and rosswog [233, 247] performed the first mhd simulation of merging ns - ns binaries using an sph code that included magnetic field effects, finding that the kelvin - helmholtz unstable vortices formed at the contact surface between the two nss could boost magnetic fields rapidly up to 10 g. these results were not seen in grmhd simulations, where gains in the magnetic field strength generated by dynamos were limited by the swamping of the vortex sheet at the surface of contact by rapidly infalling ns material that went on to form the eventual hmns or bh . Longer - term simulations did note that shearing instabilities were able to support power - law, or perhaps even exponential, growth of the magnetic fields on longer timescales (10 s of ms), which augurs well for ns - ns mergers as the central engines of sgrbs . An effort to identify potential observational differences between nss and cos with quark - matter interiors has been led by oechslin and collaborators . Using an sph code with cf gravity, oechslin et al . [210, 212] considered mergers of nss with quark cores described by the mit bag model [67, 102, 142], which have significantly smaller maximum masses than traditional nss . They found the hybrid nuclear - quark eos yielded higher isco frequencies for nss with masses 1.5 m and slightly larger gw oscillation frequencies for any resulting merger remnant compared to purely hadronic eos . . Followed up this work by investigating whether strangelets, or small lumps of strange quark matter, would be ejected in sufficient amounts throughout the interstellar medium to begin the phase transition that would convert traditional hadronic nss into strange stars . They determined that the total rate of strange matter ejection in ns - ns mergers could be as much as 10 m per year per galaxy or essentially zero depending on the parameters input into the mit bag model, with the upper values clearly detectable by orbiting magnetic spectrometers such as the ams-02 detector that was recently installed on the international space station [182, 148]. Further calculations concluded that the mergers of strange stars produce a much more tenuous halo than traditional ns mergers, more rapid formation of a bh, and higher frequency ringdown emission, as we show in figure 17 . The spiral arms representing mass loss through the outer lagrange points of the system are substantially narrower than those typically seen in cf calculations of ns - ns mergers with typical nuclear eos models . The spiral arms representing mass loss through the outer lagrange points of the system are substantially narrower than those typically seen in cf calculations of ns - ns mergers with typical nuclear eos models . Oechslin, janka, and marek also analyzed a wide range of eos models using their cf sph code, finding that matter in spiral arms was typically cold and that the dynamics of the disk formed around a post - merger bh depends on the initial temperature assumed for the pre - merger ns . They also determined that the khz gw emission peaks produced by hmnss may help to constrain various parameters of the original ns eos, especially its high - density behavior, with further updates to the prediction provided by bauswein and janka . Most recently, stergioulas et al . Studied the effect of nonlinear mode couplings in hmns oscillations, leading to the prediction of a triplet peak of frequencies being present or low mass (mns = 1.21.35 m) systems in the khz range . While there is a history of newtonian, quasi - relativistic, post - newtonian, and cf gravitational formalisms being used to perform bh - ns merger simulations, their results are nearly always quantitatively, if not qualitatively, different than full gr simulations, and we focus here on the latter (see for a more thorough historical review). Most of the groups that have performed full gr ns - ns merger calculations have also published results on bh - ns mergers, including whisky (for head - on collisions), kt [290, 289, 283, 332, 276, 154, 153], uiuc [91, 94, 92], had, as well as the sxs collaboration [85, 84, 108, 107] and princeton (for elliptical mergers) [294, 88]. Summarizing the results of these works, we get a rather coherent picture, which we describe below . The gw signal from bh - ns mergers is somewhat cleaner than that from ns - ns mergers, since the disruption of the ns and its accretion by the bh rapidly terminate the gw emission . In general, the more compact the ns, the higher the dimensionless cutoff frequency mtotfcut at which the gw energy spectrum plummets, with direct plunges in which the ns is swallowed whole typically yielding excess power near the frequency maximum from the final pre - merger burst . For increasingly prograde bh spins, there is more excess power over the 3pn prediction at lower frequencies, but also a lower cutoff frequency marking the plunge (see the discussion in). From an observational standpoint, the deviations from point - mass form become more visible for a higher mass bh - ns system, because frequencies scale characteristically like the inverse of the total mass . The distinction is particularly important for advanced ligo, as systems with bh 3 m typically yield cutoff frequencies within the advanced ligo band at source distances of d 100 mpc, while for lower - mass systems the cutoff occurs at or just above the upper end of the frequency band . This is significantly different than the situation for ns - ns mergers, in which the characteristic frequencies corresponding to the merger itself typically fall at frequencies above the advanced ligo high - frequency sensitivity limit, and those corresponding to remnant oscillations in the range 24 khz, which will prove a challenge even for third - generation gw detectors . Disk masses for bh - ns mergers were found to be extremely small in the first calculations, all performed using non - spinning bhs [290, 289, 91], but have since been corrected to larger values once more sophisticated grid - based schemes and atmosphere treatments were added to those codes . More recent results indicate disk masses for reasonable physical parameters can be as large as 0 . 4 m, for highly - spinning (abh / m = 0.9) mergers, with values of 0.0350.05 m characterizing non - spinning models with mass ratios q 1/5 . Mass loss into a disk is suppressed by misaligned spins, especially for highly - inclined bhs, so the aligned cases should currently be interpreted as upper limits for the disk mass when alignment is varied . Overall, disk masses for bh - ns merger remnants are comparable to those from ns - ns merger remnants, and may not be clearly distinguishable from them based solely on the emission properties of the disk . For bh - ns mergers with mass ratios q = 1/3 and prograde spins of dimensionless magnitude abh / m = 0.5, the disk parameters found after a run performed with the inclusion of a finite - temperature ns eos indicated that the neutrino luminosity from the disk might be as high as 10 erg / s . While ns - ns merger simulations have led to predictions of neutrino luminosities a few times larger than this, the result does indicate that bh - ns mergers are also plausible sgrb progenitor candidates, possibly with lower characteristic luminosities than bursts resulting from ns - ns mergers . The role of magnetic fields in bh - ns mergers has only been investigated recently [66, 92], in simulations that apply an initially poloidal magnetic field to the nss in the binary . Magnetic fields were found to have very little effect on the resulting gw signal and the mass accretion rate for the bh for physically reasonable magnetic field strengths, with visible divergences appearing only for b 10 g, which is not particularly surprising . Just as in ns - ns mergers, magnetic fields play very little role during inspiral, and unlike the case of ns - ns mergers there is no opportunity to boost fields at a vortex sheet that forms when the binary makes contact, nor in a hmns via differential rotation . While the mri may be important in determining the thermal evolution and mass accretion rate in a post - merger disk, such effects will likely be observable primarily on longer timescales . Just as full - gr ns - ns simulations do not indicate that such mergers are likely sources of the r - process elements we observe in the universe, bh - ns simulations in full gr make the same prediction: no detectable mass loss from the system whatsoever, at least in the calculations performed to date . The picture may change when even larger prograde spins are modeled, since this should lead to maximal disk production, or if more detailed microphysical treatments indicate that a significant wind can be generated from either a hmns or bh disk and unbind astrophysically interesting amounts of material, but neither has been seen in the numerical results to date . As is seen in ns - ns mergers, the pericenter distance plays a critical role in the evolution of eccentric bh - ns mergers as well . Large disk masses containing up to 0.3 m, with an unbound fraction of roughly 0.15 m, can occur when the periastron separation is located just outside the classical isco, with gw signals taking on the characteristic zoom - whirl form predicted for elliptical orbits . In between pericenter passages, radial oscillations of the neutron star produce gw emission at frequencies corresponding to the f - mode for the ns as well . Returning to the questions posed in section 6, we can now provide the current state of the field s best answers, though this remains a very active area of research and new results will certainly continue to modify this picture . With regard to the final fate of the merger remnant, calculations using full gr are required, but the details of the microphysics do not seem to play a very strong role . It is now possible to determine whether or not a pair of nss with given parameters and specified eos will form a bh or hmns promptly after merger, and to estimate whether a hmns will collapse on a dynamical timescale or one of the longer dissipative timescales (see, e.g.,). For ns - ns binaries with sufficiently small masses, it is also possible to determine quickly whether the remnant mass is below the supramassive limit for which a ns is stabilized against collapse by uniform rotation alone, and thus would be unlikely to collapse, barring a significant amount of fallback accretion, unless pulsar emission or magnetic field coupling to the outer disk reduced the rotation rate below the critical value . This scenario likely applies only for mergers where the total system mass is relatively small mtot 2.52.6 m, even taking into account the current maximum observed ns mass of mns = 1.97 m . Based on the wide arrays of eos models already considered, it is entirely possible to infer the likely fate for sets of parameters and/or eos models that have not yet been simulated, although no one has yet published a master equation that summarizes all of the current work into a single global form . While magnetic fields with realistic magnitudes are unlikely to affect the bh versus hmns question [172, 117], finite - temperature effects might play a nontrivial role should nss be sufficiently hot prior to merger (and see also). In the end, by the time the second generation of gw detectors make the first observations of mergers, the high - frequency shot - noise cutoff will prove to be a bigger obstacle to determining the fate of the remnant than any numerical uncertainty . A schematic diagram showing the possible final fates for a ns - ns merger along with the potential em emission (see figure 21 of) is shown in figure 18.gw emission during merger is also well - understood, though there are a few gaps that need to be filled, with full gr again a vital requirement . While the pn inspiral signal prior to merger is very well understood, finite - size tidal effects introduce complications beyond those seen in bh - bh mergers, yet the longest calculations performed to date encompass fewer orbits prior to merger than the longest bh - bh runs . As noted in and elsewhere, longer calculations will likely appear over time, helping to refine the prediction for the ns - ns merger gw signal as the binary transitions from a pn phase into one that can only be simulated using full gr, and teasing out the ns physics encoded in the gw signal . It seems clear from the published work that the emission during the onset of the merger is well - understood, as is the very rapid decay that occurs once the remnant collapses to a bh, either promptly or following some delay . Gw emission from hmnss has been investigated widely, and there have been correlations established between properties of the initial binary and the late - stage high - frequency emission (see, e.g., [145, 117]), but given that magnetic fields, neutrino cooling, and other microphysical effects seem to be important, a great deal of work remains to be done . Perhaps more importantly, since hmnss emit radiation at frequencies well beyond the shot - noise limit of even second - generation gw detectors, while the final inspiral occurs near peak sensitivity, it is likely that the first observations of nss will constrain the nuclear eos (or perhaps the quark matter eos) primarily via the detection of small finite - size effects during inspiral . Since qe calculations are computationally inexpensive compared to numerical merger simulations, there should be much more numerical data available about the inspiral stage than other phases of ns - ns mergers, which should help optimize the inferences to be drawn from future observations.determining the mass of the thick disk that forms around a ns - ns merger remnant remains a very difficult challenge, since its density is much lower and harder to resolve using either grid - based or particle - based simulations . 34 is generally consistent with the gr calculations of other groups (see, e.g.,), and seems to reflect a current consensus . It is also clear that disk masses around hmnss (up to 0.2 m) are significantly larger than those forming around prompt collapses, which are limited to about 0.05 m.it is likely that several orders of magnitude more mass - energy are present in the remnant disk than is observed in em radiation from a sgrb . Modeling the emission from the disk (and possibly a hmns) remains extremely challenging . Neutrino leakage schemes have been applied in both approximate relativistic calculations [252, 246] and full gr, and a more complex flux - limited diffusion scheme has been applied to the former as a post - processing step, but there are no calculations that follow in detail the neutrinos as they flow outward, annihilate, and produce observable em emission . At present, nuclear reactions are typically not followed in detail; rather, the electron fraction of the nuclear material, ye, is evolved, and used to calculate neutrino emission and absorption rates.magnetic fields, on the other hand, are starting to be much better understood . B - fields do seem to grow quite large through winding effects, even during the limited amount of physical time that can currently be modeled numerically [6, 172, 332, 241], with some calculations indicating exponential growth rates . The resulting geometries seem likely to produce the disk / jet structure observed throughout astrophysics when magnetized objects accrete material, which span scales from stellar bhs or pre - main sequence stars all the way up to active galactic nuclei .while recent numerical simulations have strengthened the case for ns - ns mergers as sgrb progenitors, full gr calculations have not generated much support for the same events yielding significant amounts of r - process elements . Noting the standard caveat that low - density ejecta are difficult to model, and that nuclear reactions are rarely treated self - consistently, there is still tension between cf calculations producing ejecta with the proper temperatures and masses to reproduce the observed cosmic r - process abundances (see, e.g.,), and full gr calculations that produce almost no measurable unbound material whatsoever . Figure 18summary of potential outcomes from ns - ns mergers . Here, mthr is the threshold mass (given the eos) for collapse of a hmns to a bh, and qm is the binary mass ratio . Heavy disks imply total disk masses mdisk 0.01 m, 0.01 m mdisk 0.03 m, and mdisk 0.05 m, respectively . B - field and j - transport indicate potential mechanisms for the hmns to eventually lose its differential rotation support and collapse: magnetic damping and angular momentum transport outward into the disk . Spheroids are likely formed only for the apr and other stiff eos models that can support remnants with relatively low rotational kinetic energies against collapse . Image reproduced by permission from, copyright by aps . With regard to the final fate of the merger remnant, calculations using full gr are required, but the details of the microphysics do not seem to play a very strong role . It is now possible to determine whether or not a pair of nss with given parameters and specified eos will form a bh or hmns promptly after merger, and to estimate whether a hmns will collapse on a dynamical timescale or one of the longer dissipative timescales (see, e.g.,). For ns - ns binaries with sufficiently small masses, it is also possible to determine quickly whether the remnant mass is below the supramassive limit for which a ns is stabilized against collapse by uniform rotation alone, and thus would be unlikely to collapse, barring a significant amount of fallback accretion, unless pulsar emission or magnetic field coupling to the outer disk reduced the rotation rate below the critical value . This scenario likely applies only for mergers where the total system mass is relatively small mtot 2.52.6 m, even taking into account the current maximum observed ns mass of mns = 1.97 m . Based on the wide arrays of eos models already considered, it is entirely possible to infer the likely fate for sets of parameters and/or eos models that have not yet been simulated, although no one has yet published a master equation that summarizes all of the current work into a single global form . While magnetic fields with realistic magnitudes are unlikely to affect the bh versus hmns question [172, 117], finite - temperature effects might play a nontrivial role should nss be sufficiently hot prior to merger (and see also). In the end, by the time the second generation of gw detectors make the first observations of mergers, the high - frequency shot - noise cutoff will prove to be a bigger obstacle to determining the fate of the remnant than any numerical uncertainty . A schematic diagram showing the possible final fates for a ns - ns merger along with the potential em emission (see figure 21 of) is shown in figure 18 . Gw emission during merger is also well - understood, though there are a few gaps that need to be filled, with full gr again a vital requirement . While the pn inspiral signal prior to merger is very well understood, finite - size tidal effects introduce complications beyond those seen in bh - bh mergers, yet the longest calculations performed to date encompass fewer orbits prior to merger than the longest bh - bh runs . As noted in and elsewhere, longer calculations will likely appear over time, helping to refine the prediction for the ns - ns merger gw signal as the binary transitions from a pn phase into one that can only be simulated using full gr, and teasing out the ns physics encoded in the gw signal . It seems clear from the published work that the emission during the onset of the merger is well - understood, as is the very rapid decay that occurs once the remnant collapses to a bh, either promptly or following some delay . Gw emission from hmnss has been investigated widely, and there have been correlations established between properties of the initial binary and the late - stage high - frequency emission (see, e.g., [145, 117]), but given that magnetic fields, neutrino cooling, and other microphysical effects seem to be important, a great deal of work remains to be done . Perhaps more importantly, since hmnss emit radiation at frequencies well beyond the shot - noise limit of even second - generation gw detectors, while the final inspiral occurs near peak sensitivity, it is likely that the first observations of nss will constrain the nuclear eos (or perhaps the quark matter eos) primarily via the detection of small finite - size effects during inspiral . Since qe calculations are computationally inexpensive compared to numerical merger simulations, there should be much more numerical data available about the inspiral stage than other phases of ns - ns mergers, which should help optimize the inferences to be drawn from future observations . Determining the mass of the thick disk that forms around a ns - ns merger remnant remains a very difficult challenge, since its density is much lower and harder to resolve using either grid - based or particle - based simulations . 34 is generally consistent with the gr calculations of other groups (see, e.g.,), and seems to reflect a current consensus . It is also clear that disk masses around hmnss (up to 0.2 m) are significantly larger than those forming around prompt collapses, which are limited to about 0.05 m. it is likely that several orders of magnitude more mass - energy are present in the remnant disk than is observed in em radiation from a sgrb . Modeling the emission from the disk (and possibly a hmns) remains extremely challenging . Neutrino leakage schemes have been applied in both approximate relativistic calculations [252, 246] and full gr, and a more complex flux - limited diffusion scheme has been applied to the former as a post - processing step, but there are no calculations that follow in detail the neutrinos as they flow outward, annihilate, and produce observable em emission . At present, nuclear reactions are typically not followed in detail; rather, the electron fraction of the nuclear material, ye, is evolved, and used to calculate neutrino emission and absorption rates . Magnetic fields, on the other hand, are starting to be much better understood . B - fields do seem to grow quite large through winding effects, even during the limited amount of physical time that can currently be modeled numerically [6, 172, 332, 241], with some calculations indicating exponential growth rates . The resulting geometries seem likely to produce the disk / jet structure observed throughout astrophysics when magnetized objects accrete material, which span scales from stellar bhs or pre - main sequence stars all the way up to active galactic nuclei . While recent numerical simulations have strengthened the case for ns - ns mergers as sgrb progenitors, full gr calculations have not generated much support for the same events yielding significant amounts of r - process elements . Noting the standard caveat that low - density ejecta are difficult to model, and that nuclear reactions are rarely treated self - consistently, there is still tension between cf calculations producing ejecta with the proper temperatures and masses to reproduce the observed cosmic r - process abundances (see, e.g.,), and full gr calculations that produce almost no measurable unbound material whatsoever . Summary of potential outcomes from ns - ns mergers . Here, mthr is the threshold mass (given the eos) for collapse of a hmns to a bh, and qm is the binary mass ratio . Heavy disks imply total disk masses mdisk 0.01 m, 0.01 m mdisk 0.03 m, and mdisk 0.05 m, respectively . B - field and j - transport indicate potential mechanisms for the hmns to eventually lose its differential rotation support and collapse: magnetic damping and angular momentum transport outward into the disk . Spheroids are likely formed only for the apr and other stiff eos models that can support remnants with relatively low rotational kinetic energies against collapse . Image reproduced by permission from, copyright by aps . While ns - ns merger calculations have seen tremendous progress in the past decade, the future remains extremely exciting . Between the addition of more accurate and realistic physical treatments, the exploration of the full phase space of models, and the linking of numerical relativity to astrophysical observations and gw detection, there remain many unsolved problems that will be attacked over the course of the next decade and beyond.

Glutamate functions as the major excitatory neurotransmitter by binding to n - methyl - d - aspartate receptors (nmdars) that are widespread in the central nervous system . The nmdars constitute a major class of ionotropic glutamate receptors and play an essential role in synaptic transmission, plasticity, and memory . Activation of nmdars results in cell membrane depolarization with an equilibrium potential near 0 mv, producing the excitatory postsynaptic potential (epsp) and leading to an increase of ca influx into the cell . The intracellular ca can in turn function as a second messenger, mediating a variety of signaling cascades . Excessive activation of nmdars by glutamate mediates neuronal damage in many neurological disorders including ischemia and neurodegenerative diseases (choi et al . The nmdars have long been considered the main target for the treatment of excitotoxicity - related neuronal injury, and a variety of antagonists or blockers of nmdars have been developed . Unfortunately, the results of clinical trials have been disappointing because of the obvious side effects associated with blocking the physiological roles of nmdars (chen and lipton, 2006). Therefore, a better understanding of the mechanism of how nmdars can be modulated by regulatory proteins should help in the development of new therapeutic agents to counteract overactive nmda receptor function, and may represent an alternative to treating nmdar - mediated excitotoxic injury . This short review focuses on the specific negative modulation of nmdars by a neuronal calcium sensor (ncs) protein, dream / calsenilin / kchip3 . Nmdars are believed to be heterotetrameric complexes composed of combinations of the obligatory nr1 subunit and nr2 and/or nr3 subunits (chazot and stephenson, 1997; laube et al ., 1998; schorge and colquhoun, 2003; furukawa et al ., 2005). The nr1 subunit is encoded by a single gene but exists as eight functional splice variants, while the nr2 (nr2a - b) and nr3 (nr3a - b) subunits are encoded by four and two different genes, respectively . The nmdar subunits form a central ion conductance pathway selective for cations such as na, k, and ca, and share a common membrane topology, with each subunit consisting of four transmembrane (tm) domains (m1m4). The long extracellular n - terminal regions of nmdar subunits are organized as a tandem of two domains . The first domain, called the n - terminal domain (ntd) that includes the first 380 amino acids, is involved in tetrameric assembly (mayer, 2006; paoletti and neyton, 2007; stroebel et al ., the second domain of about 300 amino acids is known as the agonist - binding domain (abd) that precedes the tm1 domain . The abd binds glycine (or d - serine) in the nr1 and nr3 subunits, whereas the nr2 abd binds glutamate (furukawa et al ., 2005; yao and mayer, 2006). The pore loop (p loop), or the m2 region, forms the narrowest constriction of the channel ion conductance pathway and determines the permeation properties of nmdars . The nmdars feature an intracellular c - terminal tail of about 400600 residues that has a strong diversity in its amino acid sequence . The c - terminal tails of nmdar subunits contain a series of short motifs that interact with intracellular factors or binding partners involved in receptor trafficking, anchoring and signaling (skeberdis et al . Activation of nmdars requires a simultaneous binding of two co - agonists, glutamate, and glycine with different biophysical properties of ion permeation . The typical nmdars contain nr2 subunits with properties of high permeability to ca and extracellular mg block at hyperpolarized membrane potentials (wrighton et al . Different from conventional nr1/nr2 heterotetramers, nr3-containing nmdars have unique properties with a five to tenfold decrease of ca permeability, insensitivity to mg block, and reduced single - channel conductance and open probability, functioning as a negative modulator for nmda receptor channel function (das et al ., 1998; 2009; cavara et al ., 2010; henson et al ., 2010). Nmda receptors are also regulated by other intracellular signals and proteins, including calcium, protein kinases, protein phosphatase calcineurin, and calcium - sensitive proteins such as calmodulin (legendre et al ., 1993; vyklicky, 1993; lieberman and mody, 1994; tong et al ., 1995; ehlers et al ., 1996). Calcium - dependent nmda receptor desensitization and inactivation provides a feedback mechanism capable of regulating subsequent ca entry into the postsynaptic cell through nmda channels (figure 1). Schematic representation for inhibitory effect of dream / calsenilin / kchip3 on nmdars in a ca - sensitive manner . Upon activation of nmdars by glutamate binding, ca influx through nmdars increases the association between dream and nr1 subunits, resulting in reduced surface expression of nmdars, and subsequent inhibition of nmdars - mediated ca influx and excitotoxicity . Dream functions as a ca - sensitive modulator for the negative feedback control of nmdar function . So far, a number of nr1 or nr2 subunit binding partners have been identified in the postsynaptic density . The nr1 binding proteins include calmodulin (cam) (ehlers et al ., 1996; akyol et al ., 2004), ca / cam - dependent protein kinase ii (camkii) (leonard et al ., 2002), -actinin (wyszynski et al ., 1997; merrill et al ., 2007), tubulin (van rossum et al ., 1999), spectrin (wechsler and teichberg, 1998), neurofilament (ehlers et al ., calmodulin binding to the nr1 subunit is ca dependent and occurs with homomeric nr1 complexes, heteromeric nr1/nr2 subunit complexes from expression systems, and nmda receptors from the brain . Calmodulin binding to nr1 causes a fourfold reduction in nmda channel open probability, mediating the negative modulation of nmdar function (ehlers et al ., 1998). The downstream regulatory element antagonist modulator (dream) protein, first identified in the nucleus as a ca - regulated transcriptional repressor through its binding to dna at specific regulatory elements, contains four ca - binding ef - hand domains and belongs to the ncs family (carrion et al ., 1999; burgoyne, 2007). Dream was named for its ability to block gene expression in its ca - free form via direct binding with the downstream regulatory element (dre) sequence in target genes such as preprodynorphin (ppd), c - fos, hrk, na, and ca exchanger ncx3 (carrion et al ., 1999; sanz et al ., 2001; gomez - villafuertes et al ., dream was also named calsenilin or kv channel interacting protein 3 (kchip3) (buxbaum et al ., 1998; an et al ., 2000), indicating that dream / calsenilin / kchip3 has multifunctional properties . In the nucleus the dream protein functions as a dimer, whereas outside the nucleus kchip3 is a monomer and regulates the surface expression and gating kinetics of kv4 channels (an et al ., 2000; kim and sheng, 2004; scannevin et al ., 2004; pioletti et al . Dream / calsenilin / kchip3 is preferentially expressed in the central nervous system, as well as in non - neuronal tissues (link et al . Dream / calsenilin / kchip3 knock - out mice display a hypoalgesic phenotype, suggesting a critical role of dream / calsenilin / kchip3 in pain modulation (cheng et al ., in addition, emerging evidence reveals the role of dream / calsenilin / kchip3 in long - term potentiation (ltp) (lilliehook et al ., 2003) and learning and memory (alexander et al ., 2009; fontan - lozano et al ., 2009), suggesting a possible connection between dream and nmda function . Kchip13 were initially identified from a rat brain library in yeast two - hybrid (yth) screens using the cytoplasmic n - terminal domain (amino acids 1180) of rat kv4.3 as a bait (an et al ., 2000). Similarly, kchip4 from mouse and human was accidentally cloned using the c - terminal 43 amino acid residues of presenilin 2 (ps2, amino acids 406448) as a bait in the yth system (morohashi et al ., 2002). Kchip4, also known as calsenilin - like protein (calp), binds to ps2 which is known to facilitate intramembranous -cleavage of -amyloid protein precursor (app) (morohashi et al ., 2002). Kchip14 (216 256 amino acids) can co - immunoprecipitate and co - localize with either kv4 from co - transfected cells or kv4 -subunits from tissues, and thus constitute integral components of native kv4 channel complexes (wang, 2008). Kchip14 all share a conserved carboxy - terminal core region that contains four ef - hand - like calcium binding motifs, but have a variable amino - terminal region that causes diverse modulation of kv4 trafficking and channel function (an et al ., 2000; holmqvist et al ., 2002; scannevin et al ., 2004; findings from co - immunoprecipitation experiments show that dream antibody can immunoprecipitate endogenous nr1 subunit and dream protein from rat hippocampal tissue (zhang et al ., 2010). In the reciprocal co - ip studies in hek 293 cells expressing dream and nr1 - 1a (nr1a) proteins, nr1 antibody can also immunoprecipitate dream along with the nr1 subunit . Gst pull - down assays reveal that the n - terminus of dream directly interacts with the nr1a c - terminus, and that the dream - nr1 interaction is sensitive to ca and depends on the ef hand domains of dream (zhang et al ., 2010). Psd-95 is a major scaffolding protein in the postsynaptic density, tethering nmdars to signaling proteins, and is critical for nmda receptor function (kim and sheng, 2004). Wu et al . Generated a line of transgenic mice (tgdream) overexpressing a dominant active dream mutant, and compared nmda receptor - mediated epscs in tgdream and wild - type mice under conditions of various stimulation intensities (wu et al . They found that the amplitude of nmda receptor - mediated epscs in tgdream mice is significantly reduced compared to that in wild - type mice (wu et al ., 2010). In addition, ltd is significantly reduced in tgdream mice whereas ltp is not affected by dream, demonstrating that dream interacts with psd-95, and that the interaction is negatively regulated by calcium (wu et al ., 2010). In xenopus oocytes expressing nr2b - containing nmdars alone or together with dream, two - electrode voltage clamp recordings show that, in the absence of dream, the peak currents of nmda channels activated by glutamate (plus glycine) are suppressed by dream, and the current decrease is caused by a reduction in the density of nmdars at the cell surface (figure 1; zhang et al ., 2010). Fontan - lozano et al . Recently provided another piece of evidence that dream negatively regulates the function of nmda receptors (fontan - lozano et al ., 2011). By taking advantage of mice lacking the dream protein, they demonstrated that the facilitated learning induced by decreased expression of kv4.2 in dream mice requires the activation of nmda receptors containing the nr2b subunit (fontan - lozano et al ., 2011). This study not only indicates the significance of the balance between kv4 channel function and nmdar activity, but also suggests the formation of a functional complex between dream / kv4.2/nmdars that regulates the synaptic efficacy mediating synaptic plasticity and learning . Excitotoxicity is caused by overactivation of nmda receptor function, and inhibition of nmdars can reverse the neuronal toxicity . The data available so far support both the pro - apoptotic and anti - apoptotic roles of dream . In general, the pro - apoptotic role of dream closely correlates with its interaction with presenilins, the production of amyloid beta (a) and the modulation in ca signaling, whereas the anti - apoptotic role of dream is conferred by its transcriptional repressor activity on the apoptotic protein hrk . Jo et al . Reported that hela cells transiently transfected with dream exhibit the morphological and biochemical features of apoptosis and that expression of presenilin potentiates dream - induced apoptosis (jo et al ., 2001). Jo et al . Also reported that dream expression increases in either human neuroblastoma sk - n - be2(c) cells or rat neuroblastoma b103 cells after exposure to a, but no other apoptotic inducers such as staurosporine, thapsigargin, and calcium ionophore a23187 . The pro - apoptotic role of dream is selectively induced during ab toxicity . Because of the involvement of presenilins/-secretase in a formation and neuronal death, dream coordinates with presenilin activity to play a crucial role in these processes through binding with the c - terminus of presenilins (jo et al ., 2003, 2004). Stably expressed dream in h4 neuroglioma cells which showed no initiation of apoptosis in the absence of apoptosis triggers, and the apoptosis - associated caspase and calpain activities were not affected by dream (lilliehook et al . On the other hand, binding of the transcriptional repressor dream to the hrk gene avoids inappropriate hrk expression and apoptosis in hematopoietic progenitor cell lines (sanz et al ., 2001, 2002). Nevertheless, the precise function of dream in pro - apoptosis and anti - apoptosis remains to be explored . From our previous observations, we noticed that cell viability is affected by the amount of exogenous dream gene and the method of transfection . However, we could not observe any obvious morphological changes associated with cell death after the transfection of dream . To prove the cytoprotective role of dream, we utilized cell lines and primary cultured hippocampal neurons with dream overexpression or sirna - mediated knockdown, and evaluated lactate dehydrogenase (ldh) leakage and propidium iodide (pi) uptake both in nmda and oxygen - glucose deprivation (ogd) -induced excitotoxic injury models (zhang et al ., 2010). Administration of nmda markedly increases the number of pi - positive cells (dead cells) in nmdar - transfected cho cells, whereas co - expression of dream greatly reduces pi - positive cells (zhang et al ., 2010). Ogd is commonly used in vitro to mimic ischemia - reperfusion insult to the brain, and ogd treatment induces a significant increase of ldh release (dawson et al ., 1994). With over - expression of dream, however, ogd treatment induces a smaller increase in ldh release . These results indicate that the over - expression of dream attenuates nmdar - mediated excitotoxicity (zhang et al ., 2010). We have previously tested the effect of dream sirna on nmda - induced current and excitotoxic injury in hippocampal neurons (zhang et al ., 2010). Knockdown of endogenous dream with sirna results in an increased amplitude of nmda current recorded by whole - cell patch - clamp assays . After nmda exposure, pi - positive cells in the dream sirna group increase compared with control sirna, indicating the inhibitory effect of dream on nmdar - mediated current and excitotoxic injury (zhang et al ., 2010). The ncs protein dream / calsenilin / kchip3 acts as an auxiliary subunit and suppresses nmda receptor channel function . This negative modulation of nmda receptor function by dream likely provides a feedback mechanism by which overactive nmda receptors are inhibited . Therefore, targeting regulatory proteins of nmdars may represent an alternative approach to treating nmdar - mediated excitotoxic damage and providing neuroprotection . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Amisulpride came into the indian market a few years back with hypes and hopes in the management of schizophrenia . Its broad spectrum effectiveness with lower chances of extrapyramidal symptoms (eps) and metabolic syndrome did help psychiatrists to treat schizophrenia and related disorders more effectively . Although this antipsychotic does not block serotonin receptors at all, it is a high - affinity and highly selective d3/d2 receptor antagonist with atypical properties . Its selective affinity for dopamine receptors in the limbic structures, but not in the striatum, leads to a low risk of extrapyramidal side effects . All available reports suggest that chance of eps is very less with amisulpride at doses <400 mg / day . However, there are sporadic reports of drug - induced eps including dystonia and akathisia even in patients receiving low doses of amisulpride . Here a 30-year - old male with schizophrenia for the past 10 years now presented with predominantly negative symptoms . He was on olanzapine 15 mg / day for more than 6 months without much improvement . Hence, amisulpride was instituted with a starting dose of 50 mg / day with a gradual increment up to 300 mg / day within 14 days . The patient came after 14 days to the casualty with features of parkinsonian syndrome such as slowed gait, mild rigidity, salivation, and bradykinesia . He was hospitalized, amisulpride was immediately stopped, and trihexyphenidyl 4 mg / day was given to manage the side effect . His eps gradually subsided and for negative symptoms, clozapine was introduced at a small dose of 25 mg / day and gradually increased to 200 mg / day over a period of 10 days . At the time of discharge, on the 14 day, he was free from parkinsonian symptoms . Subsequent follow - up showed no parkinsonian symptoms and he had modest improvement in negative symptoms . A 48-year - old male with schizophrenia for the last 20 years was treated with various antipsychotics without much improvement . Since the last 6 months, he was on olanzapine 15 mg / day . As there was no significant improvement, his olanzapine dose was gradually tapered and stopped over a period of 14 days and was started on amisulpride 100 mg / day and was increased to 200 mg / day over a period of 3 weeks . The patient returned on the 24 day with severe parkinsonian symptoms . In this patient also, there was no prior history of parkinsonism . We managed him with injection promethazine 25 mg intramuscular bid first 3 days along with trihexyphenidyl 2 mg bid after stopping amisulpride . After 7 days, parkinsonian symptoms improved considerably and clozapine was introduced at a dose of 25 mg / day which was subsequently increased to 100 mg / day on the 10 day and the patient was discharged . Since the discovery that clozapine induces fewer eps and is more effective for negative symptoms than conventional antipsychotics for the treatment of schizophrenia, psychopharmacological research has focused on the development of drugs that block central 5-ht2 receptors more than d2 receptors . Combined 5-ht2/d2 receptor antagonism is the most current explanation for the so - called atypical profile of some antipsychotics . Amisulpride at low doses binds selectively to dopamine d2, d3 autoreceptors, thereby enhancing dopaminergic transmission and thus might be effective for negative symptoms . It has no affinity for d1, d4, and d5 receptor subtypes . At higher doses, it blocks postsynaptic receptors, thus inhibiting dopaminergic hyperactivity . At the same time, amisulpride has greater specificity for the limbic system and thus has low incidence of eps . Amisulpride binds more loosely than dopamine to the dopamine d2 receptor and is rapidly dissociated from the dopamine d2 receptor . Low - dose therapy with amisulpride is associated with a significantly lower blockade of striatal dopamine d2 receptors than is seen during high - dose treatment . However, a significant striatal d2 blockade was demonstrated at therapeutically effective dose ranges, and a good relationship between the degree of striatal dopamine d2 receptor occupancy and the amisulpride plasma concentration or the administered dose was shown . In general, asians are slow metabolizers . Low body weight and slow metabolism may increase the plasma concentration of drugs causing side effects . Reported a low postsynaptic d2 occupancy in the striatum at low doses of amisulpride (50100 mg / day). It has also been suggested that extrastriatal binding could mediate the effect on negative symptoms . The probable causes of eps with low doses of amisulpride could be that it blocks postsynaptic d2 receptors significantly in striatum without much effect in the mesolimbic pathway ., the lower incidence of eps which is claimed by western researchers as well as pharmaceutical companies should be studied well in the indian context . We should at least keep this side effect in our minds while starting or increasing the doses.

The world health organization has defined health literacy (hl) as the cognitive and social abilities which determine the incentive and ability of individuals to increase access to understand and use information in ways, which promote and preserve good health . The hl of patients has obtained more attention as a risk factor for poor adherence to treatment and adverse outcomes in chronic disease's management particular in diabetes care . Diabetes is the most common metabolic disease with a dramatic increase rate of prevalence throughout the world, which has an important impact on the public health and quality of life of the patients . There is a developing frame of the literature that discovers the association between hl and health outcomes in people with diabetes . Older studies of low hl reported adverse effects on diabetes - related health outcomes; however, more recent studies showed no association between hl levels and intensity, frequency or incidence of outcomes, and thus the effect of hl on the health of people with diabetes is yet unclear . Based on national reports, the prevalence of diabetes has been raised during three decades in iran and also a recent national survey about hl has shown that majority of people has inadequate knowledge . However, there are different tools to measure hl and numeracy skills in general population in different languages, only diabetes numeracy test-15 (dnt-15) has been developed specifically to measure numeracy skills in patients with diabetes as first scale by huizinga et al ., in english language . With regard to lacking of appropriate measurement tool for patients with diabetes in persian (farsi) language, this study aimed to provide evidence for the psychometric properties of the iranian (persian language) version of dnt-15 . The dnt was designed to evaluate nutrition, exercise, glucose monitoring, oral medication, and insulin skills that patients may encounter during daily diabetes self - management . Blood - glucose monitoring skills are evaluated by three items about number hierarchy, glaciated hemoglobin, and calculating supplies needed . Eight items assess the oral medication use and insulin use . Oral medication (one question) use refill patterns and dates, and oral titration schemes and insulin use (seven questions) including interpretation of syringes, correction or sliding - scale insulin use, insulin adjustment for carbohydrate intake, and titration instructions [table 1]. Items are scored as binary outcomes correct or incorrect and no partial credit is given . Many patients with diabetes use calculators; therefore, participants were allowed to use calculators during the administration of the dnt to emulate real - life circumstances . Dnt scores are reported as percent correct (with a possible range of 0% to be 100%). Description of diabetes numeracy test items in this phase, the original questionnaire was translated by two independent health professionals from english to persian . After translation, by consultation with the principal investigators, the results were rechecked . Finally, they achieved a precision translation for the questionnaire . In this phase, the questionnaire that translated in the previous step, gave to two professional translators whose native language were english, and they are sufficient dominance in persian language . The translators did not communicate with one another and did not know the original english version . Translated versions by consultation with the principal investigators of conversion backward translation were combined . In this phase, a group of experts was reviewed, all phases, including verification and cross - cultural equivalent (cross - cultural equivalence). Cultural equivalent to the word (semantic), a term equivalent (idiomatic), and equivalent experience (experiential), and conceptually equivalent (conceptual) were performed by an expert panel . This group included experts in diabetes, certified diabetes educators, methodologist, primary care providers, and registered dietitians, behavioral researchers in diabetes, and literacy and numeracy experts . Finally, the dnt was to address the clarity of items for patients with diabetes . Interviewees were asked specific questions about each item to evaluate the understandability of the wording . If an item was unclear, the interviewee was told the purpose of the item and then encouraged to suggest a different format or wording . In response to the interviews, the scale was reformatted and slightly reduced to the final 15-items . Reliability was evaluated by internal consistency (kuder - richardson 20), and validity was evaluated through content validity ratio (cvr) and content validity index (cvi). A convenience sample of 120 patients with diabetes was interviewed in the diabetes clinic affiliated to institute of endocrinology and metabolismof an item at clinic visits . Any person diagnosed with type 1 and or type 2 diabetes which was able to read (at least eight grades) and speak persian language . Potential participants were excluded if they corrected visual acuity was> 20/50 using a rosenbaum pocket vision screener, or if they had a diagnosis of significant dementia, psychosis, or blindness . The dnt was designed to evaluate nutrition, exercise, glucose monitoring, oral medication, and insulin skills that patients may encounter during daily diabetes self - management . Blood - glucose monitoring skills are evaluated by three items about number hierarchy, glaciated hemoglobin, and calculating supplies needed . Eight items assess the oral medication use and insulin use . Oral medication (one question) use refill patterns and dates, and oral titration schemes and insulin use (seven questions) including interpretation of syringes, correction or sliding - scale insulin use, insulin adjustment for carbohydrate intake, and titration instructions [table 1]. Items are scored as binary outcomes correct or incorrect and no partial credit is given . Many patients with diabetes use calculators; therefore, participants were allowed to use calculators during the administration of the dnt to emulate real - life circumstances . Dnt scores are reported as percent correct (with a possible range of 0% to be 100%). In this phase, the original questionnaire was translated by two independent health professionals from english to persian . In this phase, the questionnaire that translated in the previous step, gave to two professional translators whose native language were english, and they are sufficient dominance in persian language . The translators did not communicate with one another and did not know the original english version . In this phase, a group of experts was reviewed, all phases, including verification and cross - cultural equivalent (cross - cultural equivalence). Cultural equivalent to the word (semantic), a term equivalent (idiomatic), and equivalent experience (experiential), and conceptually equivalent (conceptual) were performed by an expert panel . This group included experts in diabetes, certified diabetes educators, methodologist, primary care providers, and registered dietitians, behavioral researchers in diabetes, and literacy and numeracy experts . Finally, the dnt was to address the clarity of items for patients with diabetes . Interviewees were asked specific questions about each item to evaluate the understandability of the wording . If an item was unclear, the interviewee was told the purpose of the item and then encouraged to suggest a different format or wording . In response to the interviews, the scale was reformatted and slightly reduced to the final 15-items . Reliability was evaluated by internal consistency (kuder - richardson 20), and validity was evaluated through content validity ratio (cvr) and content validity index (cvi). A convenience sample of 120 patients with diabetes was interviewed in the diabetes clinic affiliated to institute of endocrinology and metabolismof an item at clinic visits . Any person diagnosed with type 1 and or type 2 diabetes which was able to read (at least eight grades) and speak persian language . Potential participants were excluded if they corrected visual acuity was> 20/50 using a rosenbaum pocket vision screener, or if they had a diagnosis of significant dementia, psychosis, or blindness . Difficult issues for participants included titration schemas, food label interpretation, insulin adjustment instructions, and items that required multi - step math (e.g., calculating insulin dosage based on carbohydrate intake and glucose level). Questions 2, 5, 6, 7, 8, 9, and 11 were answered accurately respectively by 89.1%, 78.2%, 87.4%, 72.3%, 85.7%, 84%, and 83% of participants for this study . However, questions 14 and 15, which required patients to interpret a word problem and apply multiple numerical steps to determine their insulin dosage, was only answered correctly, respectively by 41%, 54% of the participants . The 15-item persian version of the dnt has highly reliable, as determined by internal consistency kuder - richardson (kr-20 = 0.90). Content validity was examined by the expert panel (cvr: 089 and cvi: 0.86). The short version of the dnt-15 demonstrated internal consistency and construct validity in relation to reading skills in persian (farsi) language in iranian population . Scores on the dnt-15 showed a direct correlation with level of education in this study which is consistent with other reports . Although there have been some reports about hl in iran they were not specific about diabetes in iran . Other studies have identified the role of hl techniques in the improvement of health outcomes in diabetes and congestive heart failure . Patients with low hl may benefit from interventions that address numeracy, particularly in the setting of diabetes management . The dnt-15 can provide a measurement of diabetes - specific numeracy and provide more information on the role of disease - specific numeracy in future studies . More studies are needed to further understand the role of numeracy tailored interventions for the management of diabetes . For example, study participants had a difficult time with the multi - step math required to calculate a correction dosage of insulin when instructions were presented as a sequence of sentences . This item was encompassed to mirror clinical practice regarding how patients are currently instructed to take their insulin . This example provides an important lesson for health care providers and educators in effective communication styles for all clinical care recommendations . The persion (farsi) version of dnt-15 is a reliable and valid tool to measure of diabetes - specific numeracy skills for patients with diabetes.

Pulmonary hypertension (ph) encompasses a diverse group of disorders, all characterized by an elevation in pulmonary arterial pressure and pulmonary vascular resistance (pvr). Pediatric ph is associated with significant morbidity and mortality, and differs from ph as manifest in adults in several important ways, such as the development of ph in a growing lung . Medical treatment of pediatric ph has been challenging due to a lack of accessible, noninvasive, objective measures that can aid in managing these patients . Specifically, there is a need for better tools for prognosis and assessment of the progression of the disease [1, 3, 4]. Outcomes of most interest to clinicians and ph patients include death, hospitalization for ph - related events, right ventricular failure, initiation of intravenous prostanoid therapy, and lung transplantation . Although definitive, these end points are often difficult to study in pediatric ph due to their infrequent occurrences and the requirement for long - term followup . Currently, disease progression is most commonly assessed through a 6-minute walk distance and hemodynamic assessments, but both of these suffer from practical drawbacks and neither is thoroughly validated in the pediatric population . These limitations in current outcomes and prognostic variables have spurred our search for reliable, noninvasive, objective, and cost - effective alternatives that are easily measured in children [1, 4]. Circulating protein biomarkers have the potential to meet these objectives . The role of inflammation in the pathobiology of ph has recently been emphasized [69]. Cytokine- and growth factor - dependent mechanisms lead to inflammatory cell recruitment and are prominent in ph [911]. Of these factors, for example, il-6 administration in rats induces ph, and il-6 augments hypoxia - induced ph . In addition, it has been reported recently that transgenic mice overexpressing il-6 display ph, vascular remodeling, and an exaggerated response to hypoxia . Further, circulating levels of cytokines are reportedly important in the pathogenesis of a wide range of other conditions including chronic heart failure, acute renal failure, and sepsis . Recent developments in protein array technology allow high throughput, multiplex analysis with excellent sensitivity, precision, and specificity . The approach is also cost effective and uses minimal sample because all the analytes are measured on a single chip simultaneously . The requirement for low sample volumes is of special interest in the management of pediatric patients . We therefore applied a protein array approach that provides accurate and precise quantification of twelve proteins with known lung or vascular effects in a cohort of pediatric patients with ph . Our objective was to determine whether there is a clinically relevant association between any of the panel constituents, individually or combined, with hemodynamic parameters, disease prognosis, and relevant adverse outcomes . Prior approval for these studies was obtained from the colorado multiple institutional review board (comirb, approval #05 - 0551). Written informed consent was obtained from the parents or guardians of all children who served as subjects of the investigation, and when appropriate, from the subjects themselves . Plasma samples were collected from 70 pediatric patients with ph ranging in age from newborn to 21.3 years old . All patients were being treated with appropriate therapies to manage their ph during sample collection (table 1). Patients were classified as idiopathic pediatric pulmonary arterial hypertension (ipah) or associated pulmonary arterial hypertension (apah) according to published criteria . In this study, disease prognosis / severity was determined using hemodynamic parameters measured in the cardiac catheterization laboratory during a routine pulmonary hypertension visit . The data were obtained with the patient breathing room air, prior to testing pulmonary reactivity with the use of vasodilator therapy . For right - heart catheterization, we used a swan - ganz catheter in the femoral vein or internal jugular vein to determine mean right atrial pressure (rap), mean pulmonary artery pressure (pap), pulmonary capillary wedge pressure (pcwp), cardiac index (ci), and pulmonary vascular resistance index (pvri). Invasive arterial monitoring was used to measure the systemic vascular resistance index (svri). We used fick with assumed oxygen consumption in those patients with shunts and thermodilution in all others to measure cardiac output and then calculate cardiac index . Most subjects were ventilated because they were children . In addition, the reactivity to inhaled nitric oxide was calculated by taking the difference in mean pap between room air and with nitric oxide . The adverse outcome used in the predictive models was defined as initiation of intravenous prostanoids (epoprostenol or treprostinil), transplantation, and/or death occurring within 12 months from the collection of the blood sample . Admission for right heart failure is a rare event in children and was not included in the adverse outcome definition . Blood (5 ml) was drawn, plasma isolated, and this was frozen at 70c until analysis . Protein determinations were performed on an evidence analyzer (randox laboratories, northern ireland) according to the manufacturer's protocol for the simultaneous quantification of the following analytes: interleukin-1alpha (il-1), interleukin-1beta (il-1), interleukin-2 (il-2), interleukin-4 (il-4), interleukin-6 (il-6), interleukin-8 (il-8), interleukin-10 (il-10), tumor necrosis factor alpha (tnf), gamma interferon cytokine (ifn), monocyte chemotactic protein-1 (mcp-1), endothelial growth factor (egf), and vascular endothelial growth factor (vegf). Values for individual proteins measured by this multiplexed protein array technology have been shown to correlate with single elisa measurements . Further, intra- and interassay coefficients of variation of less than 10% are typical for most protein measured by this multiplexed approach with this system . Determinations were made in duplicate and all calculations were based on the average of the two measurements for each sample . Descriptive statistics were calculated using mean standard deviations or medians and the interquartile range (iqr) for continuous variables and percentages for categorical variables . Comparisons across groups were made by wilcoxon rank sum or chi - squared tests, as appropriate . Spearman rank correlation coefficients were used to estimate the association between the hemodynamic variables and protein markers . Logistic regressions were fit to investigate the association between the dichotomous adverse outcome variable (outcome observed within 12 months) and the protein measurements . Mean standardization and principal component analysis (pca) were performed for dimension reduction across the protein measurements, resulting in a single value representing a weighted combination of all twelve markers . A score statistic was used to select the principal component (pc) most associated with the outcome and the best subset of two pcs and clinical variables in a multivariate logistic regression . The predictive ability of the model was investigated using a c - index (area under the roc curve). The improvement in risk prediction associated with the addition of the protein biomarker pc was assessed by calculation of a net reclassification improvement (nri) measure . To estimate the predictive ability of the logistic regressions to an independent set of observations, c - indices were calculated using the leave - out - one cross - validation approach . All analyses were performed using sas version 9.2 software (sas institute inc ., cary, nc, usa, 2008). The study population consisted of 70 pediatric patients with ph: 36% ipah and 64% with apah . Of these, the median pap was elevated at 34 mm hg (the interquartile range (iqr) was 2356 mm hg) with a median rap value of 5 mm hg (iqr, 37 mm hg). Nine (13%) patients experienced an adverse event within 12 months of sample collection . These patients had worse mpap levels ranging from 30 to 76 with a median of 65.5 mm hg as well as a median pvri of 15.5 wood units m ranging from 5.120.4 . Only 39 of the 48 patients with vasoreactivity tests had complete data in order to assess the responder status based on the pediatric definition . Based on these data 2 (5%) were classified as responders and neither of these patients experienced an adverse event . There were no significant differences between the ipah and apah groups for any of the protein levels . Thereafter, only 59 (84%) of the patients had a catheterization performed on the same day as blood collection for the correlation analysis, and of these, 48 individuals also had a vasoreactivity test in response to inhaled nitric oxide (no). The following pairs of hemodynamic and circulating protein markers had correlation coefficients (r) significantly different from zero: il-1 and ci (r = 0.31, cl = 0.53 to 0.04); egf and mpap (r = 0.45, cl = 0.63 to 0.21); egf and pvri (r = 0.37, cl = 0.57 to 0.12); egf and pvr / svr (r = 0.42, cl = 0.62 to 0.17); il-6 and mpap (r = 0.27, cl = 0.01 to 0.49); il-6 and pvri (r = 0.32, cl = 0.06 to 0.53). None of the biomarkers correlated with the change in mean pap in response to inhaled no . To assess the potential additive predictive ability of the proteins we measured, the first of these were univariate models that were estimated to determine the association of each protein individually with the adverse outcome variable . Vegf and il-6 were significantly associated with the adverse outcome: (or (95% ci) were as follows: 0.56 (0.330.98) and 1.69 (1.032.77), respectively . In addition to vegf, il-1, il-2, il-4, mcp1, and egf also had negative associations, indicating that lower values of these proteins were associated with the adverse event outcome . Pca was performed on the protein marker data to condense the 12 measurements to a few orthogonal components . The 3rd component was significantly associated with the outcome, with higher values corresponding to an increased risk of an adverse event . The risk associated with this protein index was weighted by higher values of il-1 and il-6 and lower vegf values (figure 2). This finding corresponds well with the results from the univariate analyses and gave a c - index of 0.81 . Score statistics were used to identify the top predictive clinical markers and determine the added value of a protein marker index over the top clinical predictor . The resulting clinical model identified pap as the top predictor . Using this model as a base model, the pcs of the protein measurements were added as predictors and the selection process was repeated . After mpap, the 4th pc was the top predictor indicating it contains information orthogonal to the hemodynamic variable . The risk associated with the 4th pc was weighted by higher values of mcp1 and il-6 and lower il-10 values . To evaluate the added predictive value of the protein measurements in addition to mpap, roc curves, corresponding c - indices, and nri measures were utilized (figure 3). The inclusion of these two proteins increased the c - index from 0.81 to 0.90 . Significant improvement was seen with the addition of the protein measurements (nri p value = 0.01) indicating that their inclusion enhanced the models ability to correctly classify patients . This result was verified with a resampling approach used to estimate the models predictive ability when applied to an independent set of observations . The estimated c - indices for the model with mpap alone, and with mpap and the protein measurements, were 0.69 and 0.82, respectively . Our data (table 1) indicate a surprisingly high morbidity and mortality, even in children with mild pulmonary hypertension, and they underscore the fact that this is a very high - risk group . This observation stimulated our efforts to develop a practical and noninvasive approach to the management of pediatric pulmonary hypertension that can be used in a routine setting . Of interest and clinical relevance is the fact that we have shown that by simply adding the quantification of a set of plasma proteins, it is possible to markedly improve our ability to predict outcomes in children with ph . Specifically, the addition of a protein index, weighted mostly by il-6, il-10, and mcp-1 concentrations, significantly increased the probabilities for those patients with an adverse event compared to hemodynamic measurements alone . When investigating the plasma proteins univariately, vegf and il-6 were associated with occurrence of an adverse event and egf and il-6 were correlated with mean pap and pvri . In addition, we identified a combination of all twelve proteins which associated well with adverse events and had similar predictive ability compared to the top hemodynamic predictor . Interest in the role of cytokines and growth factors in the development of ph has grown . Recent evidence is consistent with the view that circulating factors and inflammatory cells contribute to remodeling in chronic ph [11, 24, 25]. Circulating and lung levels of the proinflammatory cytokine il-6 are increased in patients with idiopathic ph and ph associated with inflammatory diseases [1215]. Il-6 may also be a mediator of disease in ph because overexpression of il-6 in a mouse model exacerbated ph by both proproliferative and antiapoptotic mechanisms . For example, il-6 treated mice are prone to develop hypoxia - induced pulmonary hypertension which may be mediated in part by an inflammatory process . In our study, we found that increased levels of circulating il-6 were significantly associated with an increased risk of an adverse event but when considered multivariately with pap, ci, and vegf, it was replaced with an anti - inflammatory cytokine, il-10 . Recently there has also been increased interest in the role of vegf in pulmonary arterial hypertension . Vegf is responsible for angiogenesis and vasculogenesis, and animal models indicate that when vegf signaling is impaired, this contributes to the pathogenesis of ph [28, 29]. Alternatively, growth factors may be important for the maintenance of continued lung growth in patients with pulmonary arterial hypertension, and a favorable phenotype may be associated with increased vegf and egf . Farkas et al . Found a similar inverse relationship between vegf and pap in rats and lassus et al . The search for biomarkers that are useful in the management of pediatric ph is in its infancy, but the ideal marker would be obtained noninvasively, easily measured, and would offer high sensitivity and specificity . Currently, the brain natriuretic peptide system and neurohumoral markers have been evaluated in children with ph [3234]. Our study demonstrates that quantification of a panel of cytokines and growth factors has potential applications in clinical trial design by identifying patients at risk for an adverse event . In addition, patients at higher risk for an adverse event may need to be treated more aggressively with continuous intravenous therapy or listed for lung transplantation . This study adds to the growing body of literature indicating that inflammation is important in pediatric ph and that circulating (blood) biomarkers can be important tools in prediction and prognostic evaluation of pediatric patients with ph . The potential for growth factors, egf and vegf, to aid in the management of ph is important and novel . Serial sampling and assessment of longitudinal changes might provide important additional insights, but these findings indicate that even a single point in time determination can predict the future clinical course . We intentionally examined a heterogeneous group of patients in this study in order to explore patterns of biomarker expression . It is clear that the next step is to validate these findings in a larger scale study including several groups of well - characterized subjects . We suggest that, based on our findings, additional evaluation of cytokines and growth factors is warranted because there is growing evidence that these determinations may be relevant for disease management.

T1d is a chronic autoimmune disease where cd4 + and cd8 + t cells recognizing islet autoantigens are likely the mediators of selective destruction of pancreatic islet beta cells . Although direct demonstration of the prominent role of t cells in the disease progression is provided only in animal models, the preclinical period of the disease in humans is marked by the presence of circulating islet - related autoantibodies to beta cell antigens including insulin, glutamic acid decarboxylase (gad), isoforms gad65 and gad67, the insulinoma - associated antigen (ia2)/tyrosine phosphatase - like molecule, ia-2 or phogrin, and proinsulin . From the 1990s onwards several laboratories produced an increasing number of reports regarding the detection of t cells directed against these antigens in the peripheral blood . The first attempts employed [h]thymidine incorporation / proliferation assays setup with pbmc of t1d patients (at onset or long - standing) and their high - risk subsequently, elispot assays were implemented for measuring cell - mediated immune (cmi) responses in t1d [35] and immunoblot assays . Costimulatory anti - cd28 antibodies were shown to enhance autoreactive t cell responses to gad65 peptides in t1d patients, while, in a previous set of experiments, the expansion of the gad65 (whole molecule) reactive t cells was costimulation dependent in healthy controls, as opposed to t1d patients . Nevertheless, t cell results were largely inconclusive because autoantigen - specific t cells in an in vitro expansion could indeed be grown both from patients and controls, as evidenced by 4 international workshops of the immunology diabetes society and by multicenter - blinded control trials, organized under the auspices of the immune tolerance network several explanations were put forward for justifying these difficulties including their low precursor frequency, the inhability to identify them from the vast excess of t cells, and their low to moderate affinity to self - antigens . Cytotoxicity assays, set in vitro, offered proofs that t lymphocytes are potentially able to kill target cells also in vivo . To this end hla - a*0201 restricted cd8 + cytotoxic t lymphocytes, specific for a gad65 decapeptide (114123), were first detected in pbmc of recent onset t1d patients and in high - risk (ica+) individuals by using the classical [cr] release cytotoxicity assay . In more recent investigations elispot assays revealed ifn- production when pbmc from t1d patients were challenged with proinsulin peptides (3039; 3442; 4150) and the amyloid polypeptide precursor protein (ppiapp513) peptides . The nonapeptides ppiapp917, igrp152160, and igrp215223 from the islet - specific glucose-6-phosphatase catalytic subunit related protein and nonapeptides 172180 and 482490 from the islet autoantigen ia-2 that would bind to and stabilize the hla - a2 molecules were also identified . Mhc tetramer technology was initially introduced to target antigen - specific cd4 + t cells in patients with viral, bacterial infections, tumors . In reference to human autoimmunity class ii tetramers successfully detected gad65, proinsulin, ia-2, and preproinsulin reactive cd4 + t cells in pbmc of t1d patients, low percentages of cd4 + t cells autoreactive to gad65, the melanocyte differentiation antigen tyrosinase and the testis tumor antigen ny - eso-1 (epitope 120131) in pbmc of healthy individuals, and cd4 + gluten - specific t cells in pbmc of celiac disease patients . The hla class i tetramer technology successfully detected circulating cd8 + t lymphocytes autoreactive to the melan a autoantigen in patients with vitiligo, the pbc - e2 autoantigen in patients with primary biliary cirrhosis (pbc), vimentin in patients who were heart transplanted, and insulin beta chain nonapeptide (insb10 - 18). In a recent investigation hla - a*0201 gad65 (114122) pentamers detected an increased percentage of autoreactive t cells in the cd45ro+ subset in t1d patients as compared with controls . In long - standing t1d patients who, after islet transplantation, have a loss of islet allograft and recurrent autoimmunity a high frequency of gad65-specific t cell clones was found within the expanded autoreactive memory t cell compartment . In the light of all the aforegoing, we attempted in this preliminary study to device a more sensitive methodology than those currently available for measuring cmi responses and, in particular, gad65 autoreactive t cells in t1d . Preliminary data indicate that it is possible to implement an assay that still will require appropriate standardization before being used in large scale screening programs . In our protocol, after stimulation of the cells with the gad65 114 - 122 epitope, we successfully detected a percentage of cd8 + gad autoreactive t cells in a sample population including 15 t1d patients (9 newly diagnosed and 6 long - standing) by using hla class i tetramers . 9 hla - a*0201 positive pediatric patients (4 males and 5 females, age of onset range 9.2 years to 16.4 years, mean 12.8 years) were recruited from lazio region at the onset of t1d at the unit of pediatric endocrine autoimmune diseases at the children's hospital bambino ges, rome (table 1). We also included 6 long - term hla - a*0201 positive pediatric t1d patients (between 8 months to 4 years and 5 months after diagnosis). The control population was recruited at the blood transfusion center of our hospital including 10 hla - a*0201 positive nondiabetic healthy blood donors . They had no history of autoimmunity and no islet - related autoantibodies were detected in their serum . After obtaining informed consent from parents of childrens and normal controls, pbmc were separated by ficoll - hypaque (histopaque, sigma - aldrich chemical c, st louis, mo, usa) from 510 ml sodium - heparinized venous blood samples, washed twice in pbs, and then frozen down in liquid nitrogen . Hla - a2 typing was initially performed by flow cytometry analysis and subsequently confirmed by standard allele - specific pcr . In the initial screening, 1 10 cells were incubated, for 30 minutes in ice, with an anti - hla - a2 mouse mab (1: 10 dilution, one lambda, inc, canoga park, ca, usa). After washing by centrifugation at 1500 rpm for 5 minutes at room temperature (rt) in wash buffer [0,1% sodium azide, 2% fetal bovine serum (fbs, hyclone, south logan, ut, usa) in pbs], cells were resuspended in the residual volume (approximately 50 l). 1 l of fluorescent- (fitc-) conjugated goat anti - mouse igg (fc fragment specific antibody) (jackson immunoresearch laboratories inc, west grove, pa, usa) was added . Cells were then incubated in ice for 30 minutes in the dark, washed in wash buffer, and acquired for the analysis in a becton & dickinson facscalibur flow cytometer equipped with the cell quest software program . Hla - a2 subtyping was carried out using a molecular system (genovision inc ., west chester, pa, usa); high - resolution dna - based hla typing of polymorphic class i loci hla - a, -b, and -c was also carried out according to a reverse line blot system . At the time of tetramer assay, cells were thawed and resuspended, at a density of 1 10/ml, in rpmi-1640 (gibco / brl, invitrogen, gaithersburg, ca, usa), supplemented with 2 mmol / l l - glutamine, 100 g / ml penicillin / streptomycin, and 10% v / v fbs; cells were then cultured in the presence of the gad65 peptide aa 114122 (vmnillqyv) at a concentration of 30 g / ml, for 4 days in 24-well round - bottomed plates (falcon, labware bd biosciences, oxnard, ca, usa) (1 10 cells / well). The gad65 nonapeptide had been selected for its high affinity binding to hla a*0201 in an hla peptide motif search database (http://www-bimas.cit.nih.gov/molbio/hla_bind). In parallel experiments control cell cultures were set up by incubating pbmc from the same individual with il-2 (25 iu / ml, sigma) for 4 days, in place of the gad65 peptide, in order to ensure that pbmc would live for the entire culture period prior to the flow cytometry analysis (vide infra). At the end of the 4 days, pbmc, either stimulated with the gad65 peptide or incubated with il-2, were washed in calcium - magnesium free dulbecco's phosphate - buffered saline 1x (euroclone, wethersby, west york, uk), by centrifugation at 1500 rpm for 5 minutes at rt . This washing was introduced to remove the excess of gad65 peptide and il-2 from the culture, so to maximally reduce the risk of nonspecific binding, when pbmc will subsequently be stained with labeled tetramers . The two sets of pbmc were cultured for additional two days with il-2 (25 iu / ml) in the same medium (rpmi-1640, 2 mmol / l l - glutamine, 100 g / ml penicillin / streptomycin, 10% v / v fbs). Phycoerythrin (pe) labeled tetramers were generated, using either the gad65 peptide (vmnillqyv) or the flu peptide (gilgfvftl), known to have a high - affinity binding with hla - a*0201 (purchased from proimmune limited, oxford, uk). On day 6, approximately 5 10 cells, stimulated with the gad65 peptide or cultured with il-2, were allocated for staining conditions . Cells were washed by centrifugation at 1500 rpm for 5 minutes at rt in wash buffer (0.1% sodium azide, 2% fbs in pbs) and resuspended in the residual volume (approximately 50 l). 1 l of phycoerithrin (pe) labeled gad65 peptide (vmnillqyv) tetramer was added to each cell preparation and incubated in ice for 30 minutes in the dark, then washed in wash buffer . 1 l of mab anti - human cd8 (fitc labelled (becton & dickinson, pharmingen, san diego, ca, usa)) and 5 l of mab anti - human cd3 [allophycocyanin (apc) labelled (becton & dickinson)] were added for further staining the different cell preparations . In alternative for cd8 staining, 1 l of biotinylated mab anti - human cd8 (1: 10, becton dickinson) was used followed by streptavidin cychrome (cys5) conjugate (1: 10, southern biotechnology, birmingham, al, usa). Cells were incubated in ice for at least 30 minutes in the dark, washed twice in wash buffer, and then immediately acquired for the analysis in a beckton & dickinson facscalibur flow cytometer and cellquest software program . In order to verify the sensitivity of the hla - a*0201 tetramer assay, the flu nonapeptide (gilgfvftl) was used to stimulate pbmc of one hla - a*0201 normal individual . This test was performed in order to verify that we could obtain an increased sensitivity of the flu tetramer staining after flu peptide stimulation . The staining with the flu tetramer was carried out either by direct assay ex vivo or after stimulation of the same pbmc first with the flu peptide (3.5 g / ml) for 4 days followed, after washing the cells, by an incubation with il-2 for 2 days . A positive control of stimulation was introduced in all the experiments in order to prove that in vitro stimulation worked in all subjects, including those from whom no gad specific t cells were detected . The presence of flu tetramer positive cells was assessed in randomly selected samples by staining after flu peptide stimulation . In order to verify the specificity of the reactivity of the gad65 hla a*0201 tetramer in the detection of gad65 nonapeptide reactive t cells and as control of nonspecific binding, pbmc of randomly selected t1d patients and controls were cultured separately with the gad65 nonapeptide, the flu nonapeptide, and il-2 . The flu and gad65 nonapeptides were used at the same concentration (1030 g / ml). After 4 days, pbmc, cultured in the 3 different conditions, were washed and subsequently incubated with il-2 alone for an additional 2 days . Cells were then recovered, washed, and stained with the gad65 nonapeptide hla a*0201 tetramers and analyzed by flow cytometry . Differences in the percentages of cd3+/cd8+/gad65 reactive t cells between normal controls and t1d patients in each (il-2 and gad65 peptide) stimulated pbmc populations were assessed by mann - whitney - u test . Variations in the response of pbmc, either treated with il-2 or stimulated with the gad65 peptide within each group (i.e., controls versus t1d patients), were evaluated by wilcoxon's test . It is well known that hla class i molecules bind peptides 810 aminoacids long, but preferentially nonapeptides [35, 36]. After database search for nonamers of the gad65 protein sequence (p48320, ncbi database), we selected peptide gad65 114 - 122, on the basis of its high score of affinity binding (1080.239) to hla - a*0201 . Direct staining ex vivo with hla a*0201 flu peptide tetramers of pbmc of a normal hla a*0201 positive individual detected 0.03% of cd3+/cd8+/flu reactive t cells . The percentage increased to 0.23%, when pbmc of the same individual were first stimulated for 4 days with the same flu peptide (data not shown). Normal controlsin pbmc of normal individuals no significant variations were found in the percentage of cd3/cd8/gad65 reactive t cells between pbmc cultured with either il-2 or the gad65 peptide (mann - withney test versus pbmc il-2 treated p = .05, figure 1). In pbmc of normal individuals no significant variations were found in the percentage of cd3/cd8/gad65 reactive t cells between pbmc cultured with either il-2 or the gad65 peptide (mann - withney test versus pbmc il-2 treated p = .05, figure 1). Td patientsin pbmc of t1d patients the percentage of cd3+/cd8+/gad65 reactive t cells were significantly more pronounced in comparison to those registered with pbmc of controls after stimulation with the same gad65 peptide (p = .001 t1d versus controls, figures 1 and 2). Figure 2 shows pbmc of a representative t1d patient treated with il-2 (panel (a), (b), (c)) and with gad65 peptide (panel (d), (e), (f)). The analysis was conducted only in r1 region (living cells as evidenced by morphological parameters) and in the r2 region (cd3+/cd8 + cells). The population of cd3+/cd8+/gad65 reactive cells was shown in panel (f) (4.04% of total cell population).il-2 treatment affected differentially the detection of cd3+/cd8+/gad65 reactive t cells in t1d patients versus control (p = .07 t1d patients versus controls) (figure 1). In pbmc of t1d patients the percentage of cd3+/cd8+/gad65 reactive t cells were significantly more pronounced in comparison to those registered with pbmc of controls after stimulation with the same gad65 peptide (p = .001 t1d versus controls, figures 1 and 2). Figure 2 shows pbmc of a representative t1d patient treated with il-2 (panel (a), (b), (c)) and with gad65 peptide (panel (d), (e), (f)). The analysis was conducted only in r1 region (living cells as evidenced by morphological parameters) and in the r2 region (cd3+/cd8 + cells). The population of cd3+/cd8+/gad65 reactive cells was shown in panel (f) (4.04% of total cell population). Il-2 treatment affected differentially the detection of cd3+/cd8+/gad65 reactive t cells in t1d patients versus control (p = .07 t1d patients versus controls) (figure 1). Specificity of the gad65 peptide responsethe percentage of cd3+/cd8+/gad65 reactive t cells estimated in pbmc of single patients after gad65 peptide stimulation was higher than after flu peptide stimulation or when cultured with il-2 alone (data not shown). With pbmc of the normal controls, the percentage of cd3/cd8/gad65 reactive t cells was comparable in the 3 stimulation conditions . In principle, we assume that the specific reactivity could be detectable in each single sample only after gad65 peptide stimulation . This test is an alternative to control the nonspecific binding of tetramer to t cells with the use of an irrelevant peptide . The percentage of cd3+/cd8+/gad65 reactive t cells estimated in pbmc of single patients after gad65 peptide stimulation was higher than after flu peptide stimulation or when cultured with il-2 alone (data not shown). With pbmc of the normal controls, the percentage of cd3/cd8/gad65 reactive t cells was comparable in the 3 stimulation conditions . In principle, we assume that the specific reactivity could be detectable in each single sample only after gad65 peptide stimulation . This test is an alternative to control the nonspecific binding of tetramer to t cells with the use of an irrelevant peptide . Tetramers containing autoantigenic peptides have clinical utility in autoimmunity for diagnostic and, potentially, therapeutic applications [1929]. Previous studies [19, 20] clearly demonstrated that mhc class ii tetramers can efficiently detect gad65 reactive cd4 + t cells in pbmc of t1d patients . Gad65-specific hla dr0401-restricted clones could be even derived from a diabetic patient using tetramers as stimulating agent . These encouraging data prompted us to trace gad65 autoreactive t cells in t1d; in the present investigation hla - a*0201 tetramers were therefore constructed with a natural peptide (gad65 (aa114122), half - time disassociation 1080,239). This peptide has been used in previous class i tetramer investigations [28, 29] and now employed to establish a more sensitive assay . We could have chosen the gad65 decamer (aa114123) but the peptide ranked low in the affinity binding scale (half time disassociation, 35.012). In addition, the terminal valine in position 122 seems to be relevant for the antigenic presentation of the motif, as the very low - affinity binding of the nonapeptide 115123 to hla a*0201 (half time disassociation, 0.316) demonstrates . Peptides for assembling tetramers employed in previous investigations in order to increase their affinity binding to the tetramer . The first is by direct ex vivo staining with labeled peptide / tetramer complexes; in the second method pbmc are preincubated and stimulated with the peptide and then stained with the labeled peptide / tetramer or pentamer complexes [2529]. We have chosen the second approach, because we believe that preincubation with the peptide might induce a limited specific t cell expansion in vitro and, therefore, may increase the chance to awake autoreactive cd8 + t cells . Novel steps in the experimental procedure were designed as follows: (1) a reduced period of antigen - specific cell expansion (4 days rather than 21 days, 28 days, 10 days, time course selected in other hla class i tetramer assays); (2) an intermediate washing step after cells were stimulated with the gad65 nonapeptide; (3) a 2-day incubation with il-2 in the absence of the gad65 nonapeptide; and (4) a final washing step, before staining the cells with the labeled tetramers . In addition, we relied only on the autologous apcs, present in the pool of the pbmc, not prepulsed with the nonapeptide, as it was done in previous assays, and we set up parallel pbmc cultures either with il-2 alone, an internal cell culture control . The short period of peptide stimulation has the advantage that cultures are terminated before clonal expansion and/or in vitro we need also to underline that the possibility of testing frozen / defrosted pbmc is of paramount importance when planning large retrospective epidemiological investigations . By applying these novel experimental conditions, the recovery of cd3+/cd8+/gad65 reactive t cells in t1d patients ranged from 0.5% to 15.6% after gad65 peptide stimulation of pbmc . To our knowledge, this is the highest percentage of autoreactive cd8 t cells ever captured by hla class i tetramers in pbmc of patients with a human autoimmune disease (0,1% to 1% in vitiligo 4,2% in heart transplantation; up to 0.4% of cd8 + cd45ro+ t cells in newly diagnosed t1d patients; between 2.6% and 8.3% within the ki-67+cd8 + cell fraction (1.65% + /0.25% of the total cd8 + lymphocytes) in islet transplanted t1d patients). This can be achieved by testing pbmc of a large number of t1d patients, normal controls, and especially prediabetic high - risk individuals . A valid statistical evaluation of results will help to establish an appropriate cutoff value of positivity in the assay.

Transcription factors are a class of proteins that regulate gene expression by binding to specific dna sequences within the regulatory regions of genes (1). Due to their important role in the regulation of gene expression, transcription factors are vital for cell development, differentiation and growth in biological systems (24). Typically, transcription factors exist in the cell in an inactive state and become activated by the presence of a specific ligand, leading to the expression of target gene(s). As a result, the inhibition or undesired activation of transcription factors can lead to a number of diseases which include developmental disorders (58), abnormal hormone responses (911), inflammation (12,13) and cancer (1416). Therefore, the rapid and convenient detection of transcription factor activity is important for the development of inhibitors for the treatment or prevention of these diseases . Current methods for the detection of transcription factor activity include dna footprinting, western blotting, the gel mobility shift assay, affinity chromatography and visual microscopy (1719). However, the aforementioned methods are generally tedious, laborious and expensive for the routine detection of transcription factor activity in the laboratory (20). Fluorescence methodologies are an attractive alternative to the traditional methods of transcription factor activity detection due to their simplicity, low cost, high sensitivity and most importantly, amenability to high - throughput screening (21). Current fluorescence - based methods for the detection of transcription factors require labeled oligonucleotides containing the sequence recognized by the appropriate transcription factor (2225). The basic principle behind this molecular beacon approach for the detection of transcription factors involves monitoring the conformational change of the oligonucleotide upon binding by a transcription factor . This conformational change leads to the fluorophore and the quencher being brought closer together or further apart, leading to a switch - off or switch - on fluorescence effect, respectively . In 2000, tan and co - workers (22) described a switch - on probe for the escherichia coli single - stranded binding protein using a classical stem loop, doubly labeled with dabcyl and tamra at the 3- and 5-terminus . In 2002, heyduk and heyduk (23) developed a switch - off detection platform that utilized two independently labeled dna fragments each containing one - half of the transcription factor binding site . Recently, mirkin and co - workers (25) described a fluorescence recovery assay for the detection of protein dna binding, utilizing a doubly labeled short dna duplex and an exonuclease . While these fluorescence approaches to the detection of transcription factor activity are more convenient compared to the traditional methods, they are still limited by the high cost of the labeled oligonucleotides . Luminescent transition metal complexes have received increasing attention in photochemistry, organic optoelectronics and luminescent sensors (2633). We previously developed oligonucleotide - based, label - free detection methods for nanomolar quantities of hg and ag ions by employing luminescent platinum(ii) metallointercalators (34,35), as well as for assaying exonuclease activity by using crystal violet as a g - quadruplex probe (36). Consequently, we were interested in developing a label - free alternative to the molecular beacon approach through modification of the fluorescence recovery assay developed by mirkin and coworkers by utilizing unmodified oligonucleotides and a luminescent transition metal complex as a dna probe . Luminescent transition metal complexes typically contain a metal center bound to by organic ligands arranged in a precise 3d arrangement . The 3d nature of transition metal complexes allows selective interactions with biomolecules (36). In addition, the photophysical (i.e. Emission wavelength), physical (i.e. Solubility and stability) and selectivity (duplex dna versus single - stranded dna) of these complexes can be modulated through ligand modifications . Examples of luminescent metallointercalators used for the detection of dna include ruthenium (3741), osmium (4244), iridium (4547) and platinum complexes (4851) that bear planar aromatic ligands suitable for intercalation . We chose the classical molecular light switch complex [ru(phen)2(dppz)] (phen = 1,10-phenanthroline; dppz = dihydro[3,2-a:2,3-c]phenazine) as a probe due to its avid dna binding affinity (> 10 m). In addition, this complex possesses a strong luminescence response when bound to duplex dna but is only weakly emissive when free in aqueous solution or in the presence of single - stranded dna . The complex [ru(phen)2(dppz)] has also been employed for the detection of aptamer / protein binding using unlabeled oligonucleotides (52). Based on our past experience in the design of label - free oligonucleotide - based luminescent assays for metal ions (34,35), we were interested to see if we could develop a label - free detection method for the p50 subunit of the transcription factor nf-b . The transcription factor nf-b has been identified as an important regulator for key pro - inflammatory mediators such as tnf-, which is involved in the immune response, apoptosis and cell cycle regulation (53). The deregulation of tnf- has been linked with inflammatory and autoimmune diseases such as rheumatoid arthritis and osteoarthritis (54). The ability to screen a large library of compounds against an important protein target such as nf-b using aluminescence assay amenable to high - throughput screening would be invaluable in developing new treatments and diagnostic tools for inflammation and autoimmune diseases . All reagents were purchased and used as received unless otherwise stated . The p50 protein was expressed and purified based on a modified procedure from leung et al . (55). The cells were grown at 37c in a shaking incubator until the absorbance of the culture at 600 nm was 0.6 . Expression of the p50 protein from the t7 promoter was induced for 5 h at 30c by the addition of 0.1 mm isopropyl-1-thio--d - galactopyranoside (final concentration). The cells were then harvested in lysis buffer (25 mm tris, ph 7.4, 150 mm nacl, 1 mm edta, -mercaptoethanol, phenylmethylsulfonyl fluoride) and lysed by sonication . The cell debris was pelleted by ultracentrifugation (27 500 rpm, 4c and 40 min). The supernatant was diluted with binding buffer (25 mm, tris ph 7.4, 500 mm nacl and 20 mm imidazole) and loaded onto a his - bind quick columns (novagen, madison, wi, usa) and washed with washing buffer (25 mm tris ph 7.4, 500 mm nacl and 40 mm imidazole), then eluted with elution buffer (25 mm tris ph 7.4, 500 mm nacl and 200 mm imidazole). The fractions containing the p50 protein were combined and dialyzed against 10 mm tris buffer solution (ph 7.9, 10% glycerol, 1 mm edta, 50 mm nacl and -mercaptoethanol). The purity of the expressed p50 proteins were estimated to be> 90% pure using electrophoresis on sds (hp) containing one nf-b binding site: 5-agttgaggggactttcccaggccagaaggagcctgggaaagtcccctcaact-3 5-agttgaggggactttcccaggccagaaggagcctgggaaagtcccctcaact-3 double - strand containing one nf-b binding site: 5-agttgaggggactttcccaggc-33-tcaactcccctgaaagggtccg-5 5-agttgaggggactttcccaggc-3 3-tcaactcccctgaaagggtccg-5 double - strand containing two nf-b binding site: 5-ttgagggactttccgaacatgcaggcaagctggggactttccagg-33-aactccctgaaaggcttgtacgtccgttcgacccctgaaaggtcc-5 5-ttgagggactttccgaacatgcaggcaagctggggactttccagg-3 3-aactccctgaaaggcttgtacgtccgttcgacccctgaaaggtcc-5 double - strand without nf-b binding site: 5-ttgttacaactcactttccgctgctcactttccagggaggcgtgg-33-aacaatgttgagtgaaaggcgacgagtgaaaggtccctccgcacc-5 5-ttgttacaactcactttccgctgctcactttccagggaggcgtgg-3 3-aacaatgttgagtgaaaggcgacgagtgaaaggtccctccgcacc-5 the appropriate oligonucleotide (0.02 m) was first annealed in tris buffer solution (10 mm, ph 7.4, 100 mm nacl, 1 mm edta, final concentration) by incubating at 95c for 5 min, followed by gradual cooling to room temperature over a period of 1 h. the p50 subunit and the annealed oligonucleotide mixture in tf buffer (10 mm tris, ph 7.4, 50 mm kcl, 1 mm dtt, 1 mm mgcl2, 10% glycerol) were incubated for 20 min at 37c, after which 40 units of exoiii (neb) were added and the mixture was incubated for an additional 50 min at 37c . The digestion reaction was quenched by the addition of 25 mm edta and diluted to 1 ml with a solution of the ruthenium complex (1 m, final concentration) and [fe(cn)6] (600 m, final concentration) in tf buffer (10 mm tris, ph 7.4, 50 mm kcl, 1 mm dtt, 1 mm mgcl2, 10% glycerol). The solution was then allowed to stand for 10 min and the luminescence spectrum was measured using an excitation wavelength of 450 nm . The cells were grown at 37c in a shaking incubator until the absorbance of the culture at 600 nm was 0.6 . Expression of the p50 protein from the t7 promoter was induced for 5 h at 30c by the addition of 0.1 mm isopropyl-1-thio--d - galactopyranoside (final concentration). The cells were then harvested in lysis buffer (25 mm tris, ph 7.4, 150 mm nacl, 1 mm edta, -mercaptoethanol, phenylmethylsulfonyl fluoride) and lysed by sonication . The cell debris was pelleted by ultracentrifugation (27 500 rpm, 4c and 40 min). The supernatant was diluted with binding buffer (25 mm, tris ph 7.4, 500 mm nacl and 20 mm imidazole) and loaded onto a his - bind quick columns (novagen, madison, wi, usa) and washed with washing buffer (25 mm tris ph 7.4, 500 mm nacl and 40 mm imidazole), then eluted with elution buffer (25 mm tris ph 7.4, 500 mm nacl and 200 mm imidazole). The fractions containing the p50 protein were combined and dialyzed against 10 mm tris buffer solution (ph 7.9, 10% glycerol, 1 mm edta, 50 mm nacl and -mercaptoethanol). The purity of the expressed p50 proteins were estimated to be> 90% pure using electrophoresis on sds hairpin (hp) containing one nf-b binding site: 5-agttgaggggactttcccaggccagaaggagcctgggaaagtcccctcaact-3 5-agttgaggggactttcccaggccagaaggagcctgggaaagtcccctcaact-3 double - strand containing one nf-b binding site: 5-agttgaggggactttcccaggc-33-tcaactcccctgaaagggtccg-5 5-agttgaggggactttcccaggc-3 3-tcaactcccctgaaagggtccg-5 double - strand containing two nf-b binding site: 5-ttgagggactttccgaacatgcaggcaagctggggactttccagg-33-aactccctgaaaggcttgtacgtccgttcgacccctgaaaggtcc-5 5-ttgagggactttccgaacatgcaggcaagctggggactttccagg-3 3-aactccctgaaaggcttgtacgtccgttcgacccctgaaaggtcc-5 double - strand without nf-b binding site: 5-ttgttacaactcactttccgctgctcactttccagggaggcgtgg-33-aacaatgttgagtgaaaggcgacgagtgaaaggtccctccgcacc-5 5-ttgttacaactcactttccgctgctcactttccagggaggcgtgg-3 3-aacaatgttgagtgaaaggcgacgagtgaaaggtccctccgcacc-5 the appropriate oligonucleotide (0.02 m) was first annealed in tris buffer solution (10 mm, ph 7.4, 100 mm nacl, 1 mm edta, final concentration) by incubating at 95c for 5 min, followed by gradual cooling to room temperature over a period of 1 h. the p50 subunit and the annealed oligonucleotide mixture in tf buffer (10 mm tris, ph 7.4, 50 mm kcl, 1 mm dtt, 1 mm mgcl2, 10% glycerol) were incubated for 20 min at 37c, after which 40 units of exoiii (neb) were added and the mixture was incubated for an additional 50 min at 37c . The digestion reaction was quenched by the addition of 25 mm edta and diluted to 1 ml with a solution of the ruthenium complex (1 m, final concentration) and [fe(cn)6] (600 m, final concentration) in tf buffer (10 mm tris, ph 7.4, 50 mm kcl, 1 mm dtt, 1 mm mgcl2, 10% glycerol). The solution was then allowed to stand for 10 min and the luminescence spectrum was measured using an excitation wavelength of 450 nm . The principle behind our assay for the detection of transcription factor activity is based on the 35 activity of exoiii and a luminescent transition metal complex which is switched - on in the presence of double - stranded dna (scheme 1). In the presence of double - stranded dna, the ruthenium complex [ru(phen)2(dppz)] (scheme 1) intercalates into the double - stranded dna and is emissive, presumably through suppression of non - radiative decay by solvent interactions . A 35 exoiii is added to the reaction mixture and digests the double - stranded oligonucleotide from the 3-end, leading to the formation of single - stranded fragments . Due to the weak binding affinity of the ruthenium complex to single - stranded dna, the luminescence response of the complex is reduced (scheme 1a). In the presence of a transcription factor that binds to the double - stranded substrate with the cognate binding site, the digestion of the oligonucleotide is blocked, allowing the oligonucleotide to retain its double - stranded structure in the presence of exoiii (scheme 1b). The intercalation of the ruthenium complex into the double - stranded dna substrate leads to a strong luminescence response . Scheme 1.the principle of the label - free detection of transcription factor activity using a combination of a luminescent ruthenium - based metallointercalator [ru(phen)2(dppz)] and 35 exoiii . The principle of the label - free detection of transcription factor activity using a combination of a luminescent ruthenium - based metallointercalator [ru(phen)2(dppz)] and 35 exoiii . To validate our label - free detection assay for transcription factors, we designed a hairpin oligonucleotide that contained the nf-b binding site [-gggactttc-] (56). The hairpin substrate was incubated at 95c for 5 min, followed by gradual cooling to room temperature to ensure the formation of the double - stranded structure . The luminescence response of the ruthenium complex in the presence of the hairpin substrate was enhanced by 4.6-fold due to intercalation of the ruthenium complex into the dna (figure 1). The addition of exoiii leads to the digestion of the oligonucleotide, converting the hairpin structure into short single - stranded dna fragments . Due to the weak binding of the ruthenium complex with the single - stranded dna, emission intensity potassium ferrocyanide k3[fe(cn)6] was used to quench the background emission of the ruthenium complex in aqueous solution or when bound to single - stranded dna . A ferrocyanide concentration of 600 m was found to give the highest degree of discrimination between double - stranded and single - stranded dna . Figure 1.the luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of (a) the hairpin dna (0.02 m); and (b) the hairpin dna (0.02 m) and exoiii (40 u). The luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of (a) the hairpin dna (0.02 m); and (b) the hairpin dna (0.02 m) and exoiii (40 u). After confirming the activity of the exonuclease, we next investigated the effect of adding the transcription factor . When the hairpin substrate was incubated with the nf-b subunit p50 before the addition of exoiii, a luminescence enhancement of 3.6 was observed relative to the control (no transcription factor added) (figure 2). Presumably, the p50 subunit bound the hairpin substrate and inhibited the digestion of the oligonucleotide, allowing the ruthenium metallointercalator to bind to the intact double - stranded dna . Figure 2.the fold change luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture containing the hairpin dna substrate (0.02 m) and 40 u of exoiii as a function of the concentration of the p50 subunit (0, 0.06, 0.20 and 0.40 m). The fold change luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture containing the hairpin dna substrate (0.02 m) and 40 u of exoiii as a function of the concentration of the p50 subunit (0, 0.06, 0.20 and 0.40 m). It has been previously shown that the structure of the oligonucleotide substrate can influence the digestion rate of exoiii (57). To examine the effect of a double - stranded dna substrate on the performance of this label - free assay, we annealed a duplex dna sequence containing the nf-b binding site . In the absence of the p50 subunit, a weak luminescence response as the concentration of the p50 subunit was increased, there was a corresponding enhancement in the luminescence response of the ruthenium complex, with saturation occurring at about 160 nm (figure 3). A maximum fold change of 4.5 was observed . Figure 3.the fold change luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture containing the double - stranded dna substrate (0.02 m) and 40 u of exoiii as a function of the concentration of the p50 subunit (0, 0.04, 0.08, 0.12, 0.16, 0.20 m). The fold change luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture containing the double - stranded dna substrate (0.02 m) and 40 u of exoiii as a function of the concentration of the p50 subunit (0, 0.04, 0.08, 0.12, 0.16, 0.20 m). We next investigated the effect of introducing two binding sites on the double - stranded oligonucleotide substrate . The luminescence spectrum of the ruthenium complex in the presence of the double - stranded substrate containing two binding sites after digestion is shown in figure 4 . When this oligonucleotide was incubated in the presence of the p50 subunit and subjected to exo iii digestion, a maximal 8-fold increase in the luminescence response was observed, compared to only 4.5-fold for the oligonucleotide containing one binding site . We postulate that in the case of the double - stranded substrate containing one binding site, complete digestion by exo iii from the 3 would be expected to generate long 5-overhangs with limited duplex regions (figure 5a). Thus, even though digestion was inhibited relative to the control, the luminescence response of the ruthenium complex would still be reduced . However, when two p50 subunit binding sites are present, the complete digestion of the double - stranded substrate from the two 3-termini does not occur (figure 5b), preserving the duplex structure of the substrate and allowing the intercalation of the ruthenium complex . Using the double - stranded substrate with two p50 subunit binding sites, we observed a linear luminescence response (up to 8-fold intensity enhancement) to changes in the concentration of the p50 subunit in the concentration range of 30220 nm with a detection limit of 30 nm . Figure 4.the fold change luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture containing the double - stranded dna substrate with two nf-b binding sites (0.02 m) and 40 u of exoiii as a function of the concentration of the p50 subunit (0, 0.03, 0.05, 0.06, 0.11, 0.18, 0.20, 0.22, 0.28, 0.30 and 0.38 m). Figure 5.a schematic representation of the digestion products for oligonucleotides containing one (a) and two (b) nf-b subunit binding sites . The fold change luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture containing the double - stranded dna substrate with two nf-b binding sites (0.02 m) and 40 u of exoiii as a function of the concentration of the p50 subunit (0, 0.03, 0.05, 0.06, 0.11, 0.18, 0.20, 0.22, 0.28, 0.30 and 0.38 m). A schematic representation of the digestion products for oligonucleotides containing one (a) and two (b) nf-b subunit binding sites . In the original report by heyduk and heyduk (23), the molecular beacon approach could effectively sense down to 10 nm of catabolite activator protein, a bacterial transcription factor . The fluorescence recovery assay developed by mirkin and co - workers (25) gave a 32% decrease in the fluorescence intensity upon addition of 130 nm of estrogen receptor-. Thus, the sensitivity of our assay for transcription factor activity is at least comparable to that of previously reported methods . Furthermore, a significant advantage of the method presented here is its label - free nature, which obviates the requirement for the expensive labeling of oligonucleotides, contrasting favorably with previous methods . Reducing the cost of the assay is important for potential adaptation into a high - throughput format . Finally, both literature methods were switch - off with respect to transcription factors, which may suffer from false positives due to non - specific quenching by environmental samples . The switch - on detection mode reported here is advantageous and is generally preferable for analytical purposes . This label - free assay is based on the inhibition of exoiii catalyzed digestion of the oligonucleotide by the binding of the p50 subunit . To validate the mechanism of this method, we replaced the p50 subunit with the non - dna binding protein bovine serum albumin (bsa). The luminescence response of the ruthenium complex in the presence of the oligonucleotide containing the double p50 binding site and bsa after exoiii digestion is shown in figure 6 . Figure 6.the fold change luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture containing the double - stranded dna substrate with two nf-b binding sites (0.02 m) and 40 u of exoiii as a function of the concentration of bsa (0, 0.08, 0.20 and 0.40 m). The fold change luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture containing the double - stranded dna substrate with two nf-b binding sites (0.02 m) and 40 u of exoiii as a function of the concentration of bsa (0, 0.08, 0.20 and 0.40 m). The emission spectrum in figure 6 shows that incubation of the oligonucleotide substrate with bsa did not produce the same emission enhancement (fold change of 1.1) as observed for the p50 subunit . To further provide evidence that the inhibition of exoiii digestion was due to the selective binding of the p50 subunit, we replaced the oligonucleotide substrate with a dna sequence that cannot bind to the p50 subunit . The non - nf-b - binding substrate was incubated in the presence of the p50 subunit and the luminescence spectrum of the ruthenium complex in the presence of the digestion mixture was measured (figure 7). In the presence of 0.4 m p50 subunit, a fold change of 2.4 was observed, which was significantly lower than the 8-fold enhancement observed with the wild - type sequence . Figure 7.the fold change luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture containing double - stranded non - nf-b - binding substrate (0.02 m) and 40 u of exoiii as a function of the concentration of the p50 subunit (0, 0.10, 0.20 and 0.40 m). The fold change luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture containing double - stranded non - nf-b - binding substrate (0.02 m) and 40 u of exoiii as a function of the concentration of the p50 subunit (0, 0.10, 0.20 and 0.40 m). To provide additional evidence that the selective binding of the p50 subunit is responsible for the inhibition of exoiii catalyzed digestion of the double - stranded substrate, we repeated the luminescence measurements in the presence of oridonin, a known inhibitor of nf-b dna binding activity (58). In the presence of the nf-b inhibitor (figure 8, orange), a significant reduction in the luminescence response of the ruthenium complex was observed compared to the sample that does not contain the inhibitor (figure 8, purple). Oridonin is presumed to inhibit binding of p50 to the double - stranded substrate and exoiii is able to digest the dna into short single - stranded fragments resulting in a reduced luminescence response . Taken together, these series of negative control experiments demonstrate that the luminescence enhancement observed in the presence of the p50 subunit is probably due to the binding of the transcription factor to the oligonucleotide, inhibiting the exoiii catalyzed digestion of the double - stranded substrate . Figure 8.the luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture with the double - stranded dna substrate (0.02 m) containing two nf-b binding sites incubated with p50 (0.12 m) with or without oridonin (20 m). The luminescence response of [ru] (1 m) in tf buffer solution containing k3[fe(cn)6] (600 m) in the presence of the digestion mixture with the double - stranded dna substrate (0.02 m) containing two nf-b binding sites incubated with p50 (0.12 m) with or without oridonin (20 m). The above results also highlight the amenability of this assay to the high - throughput screening of small molecules as inhibitors of the p50 subunit of nf-b . Nf-b is found in the cytoplasm bound to the inhibitory protein ib (59). In the presence of activators, such as ultraviolet irradiation, cytokines, bacterial and viral products the overactivation of nf-b has been associated number of autoimmune and inflammatory diseases and it is thus considered an important drug target (53,54). The label - free assay described herein can be readily applied to a high - throughput format using 96-well plates . Wells showing a reduction in luminescence intensity of the ruthenium complex contain a potential inhibitor of the p50 subunit . Due to the low cost of the label - free oligonucleotides and the ruthenium metallointercalator, large chemical libraries can be screened in an inexpensive and high - throughput manner, allowing the identification of small molecule nf-b inhibitors for treating autoimmune and inflammatory diseases . In conclusion, we have described the first label - free luminescence detection method for transcription factor activity . Our method is based on the principle that the binding of the transcription factor prevents the exoiii catalyzed digestion of a double - stranded substrate . A luminescent ruthenium metallointercalator is used to probe the double - stranded substrate leading to a switch - on effect in the presence of the transcription factor . The luminescence enhancement was shown to be proportional to the concentration of the transcription factor nf-b subunit p50 . This method allows the detection of transcription factor activity without the need for time - consuming experiments such as gel mobility shift assays or dna footprinting . We have also demonstrated that in the presence of a known nf-b inhibitor oridonin, the luminescence response of the ruthenium complex was decreased . Therefore, this assay can be used to identify modulators that can activate or inhibit transcription factor dna binding, for the diagnosis and treatment of diseases linked with irregular transcription factor activity . Furthermore, this technique is readily amenable to high - throughput screening, allowing rapid and economical identification of the target compounds . We anticipate that this assay can be adapted to selectively detect any transcription factor simply by changing the binding site sequences . Due to the modular synthesis of the transition metal complexes, we envisage that there is considerable scope to adjust the selectivity of the complexes toward particular dna structures which would further improve this assay for transcription factor detection . Funding for open access charge: the hong kong baptist university (frg2/09 - 10/070).

Although considered the gold standard for evaluating treatment effectiveness, randomized clinical trials (rcts) have important limitations . Because randomization removes potential bias from unknown and unmeasured confounders, observed differences in measured outcomes can be reasonably attributed to the treatment alone.1 for valid experimental reasons, however, rcts frequently restrict enrollment based on existing comorbidities, treatment history, and disease severity, among other criteria . As a result, outcomes observed in rcts cannot necessarily be generalized to the real world of clinical practice, where patients present with varying degrees of disease severity and a range of comorbidity profiles . While there has been a call for increasing the number of pragmatic clinical trials, trials that examine outcomes among diverse populations of patients in typical practice settings are still rare.2 retrospective, observational studies are valuable because they contribute pragmatic knowledge about treatment risk, effectiveness, and cost in clinical practice settings knowledge that is critical to health care decision makers . In addition, observational studies are less costly and more quickly accomplished than rcts, and can utilize large databases, permitting analysis of infrequent events . Because observational studies do nt involve randomization of patients to treatment groups, however, selection bias can occur, and unmeasured variables can confound the associations between treatments and outcomes . Multivariable regression (mr) methods are commonly used to control for confounding factors in observational studies . It can be done at the individual level, as in case control matching, or at the group or frequency level, as in stratified random sampling . The matching process involves diagnostic checks regarding the balance of covariates across groups and provides information about the quality of the inferences that can be drawn from the subsequent analysis.3 propensity score matching (psm) has been increasingly used in epidemiologic studies of medical treatment effectiveness.1 a propensity score represents the propensity of a particular subject to receive a particular treatment, based on the subject s pre - treatment characteristics.1,4,5 the score combines many covariates into a single variable and enables individuals from each treatment group with similar covariate values to be matched, as a quasi - randomization method.3 subjects who cannot be matched are excluded from the analysis . An advantage of psm is that matched sets with comparable covariate distributions can be created without the need for exact matches of each variable, which is problematic when there are more than a few covariates.3 propensity matching works best if there is a fairly large overlap between the groups in terms of propensity to be given a treatment . When there is not, underlying selection bias may exist.3 despite this method s theoretical benefits, in studies where both mr and psm analysis methods have been used, only a small percentage of results (10% in one review and 13% in another) have been markedly different.1,6 disease exacerbations are important events in the course of copd . Moderate and severe exacerbations adversely affect lung function, potentially accelerating disease progression.7,8 frequency of exacerbations is a significant factor in deteriorating health.9,10 exacerbations also contribute substantially to health care utilization and costs . In the united states in 2010, direct medical costs were estimated to be $29.5 billion, including $13.2 billion for copd - related hospital care.11 reducing exacerbations is thus a singularly important goal of copd management, both to improve patient quality of life and to reduce the indirect and direct medical costs of the disease . As pharmacotherapy is a primary means for reducing exacerbations, data concerning real world treatment effectiveness is of interest to health care providers, health care organizations, and health plans . Agents for the relief and prevention of symptoms in copd include short- and long - acting beta - agonists (including albuterol and salmeterol), short - and long - acting anticholinergics (including ipratropium bromide [ipr], tiotropium [tio]), and inhaled corticosteroids (ics).12 fluticasone propionate 250 g / salmeterol 50 g combination therapy (fsc) is an ics plus long - acting beta - agonist used for treatment of airflow obstruction and reduction of exacerbations . Previously, we reported cost and utilization outcomes following initiation of copd maintenance therapy with tio, ipr (with or without albuterol), or fsc, using mr as the analysis method.13 to our knowledge, this was the first observational study to directly compare these three maintenance therapies . Compared to tio and ipr, fsc was associated with lower copd - related costs and utilization (hospitalizations, emergency department [ed] visits, and outpatient visits associated with an antibiotic or oral corticosteroid prescription). The objective of the present study was to perform a parallel analysis employing psm to investigate the equivalency of results with those obtained in the prior mr analysis . Using psm methods, we conducted a parallel analysis of copd - related health care utilization and costs in patients with copd receiving initial maintenance therapy (imt) with fsc, tio, or ipr, and we compared the results to those of a previous mr analysis . The term imt refers to the patient s first instance of a pharmacy claim for a copd maintenance medication; prior to this point, the patient s records indicated that he / she had not received maintenance therapy, only reliever medications or no medication . We assessed exacerbations using claims data to measure health care utilization events related to exacerbations . There is no universally accepted definition of exacerbation . In clinical research, exacerbations generally are defined in terms of worsening symptoms, unscheduled medical attention, and courses of antibiotics and/or oral corticosteroids . 14 in observational studies such as ours, in which clinical and laboratory data are absent, exacerbations typically have been defined in terms of copd - related health care utilization events, including hospitalizations, ed visits, physician visits, and outpatient pharmacy fills for oral corticosteroids / antibiotics . Administrative data were obtained from the ims lifelink health plan claims database (ims health, watertown, wa), which contains enrollment and demographic data, and health care and outpatient pharmacy claims from more than 40 million members of more than 70 us health plans . Calculated costs were based on allowed amounts, which most closely resemble the direct health care cost burden of illness . This is typically the amount the health plan pays, plus any member liability (eg, co - payment, deductible, or coinsurance amount). For claims with missing charges due to capitation arrangements, the dataset included patient demographic and enrollment data, outpatient pharmacy claims, and medical services claims (outpatient, ed, and inpatient claims, including both facility claims and professional services claims) for january, 2004 to june, 2009 . The specific content of the dataset has been described previously.13 in the prior retrospective, observational cohort study, copd - related clinical and economic outcomes were evaluated in patients who received one of three imt medications for copd (fsc, tio, or ipr).13 the study perspective was that of the health plan provider organization, and only direct costs were considered . The study population included health plan members with diagnosed copd who were new to maintenance therapy with fsc 250 g/50 g, tio, or ipr (alone or in fixed dose combination with albuterol). The members were age 40 years and older, had a primary or secondary diagnosis of copd (at least one ed visit, one hospitalization, or two outpatient visits with a primary or secondary international classification of disease, 9th edition, clinical modification [icd-9-cm] diagnosis code of 491.xx, 492.xx, or 496.xx), had an imt pharmacy claim between july 1, 2004 and june 30, 2008 (the date of the first identified prescription claim was the index date), had at least 6 months of continuous health plan enrollment prior to the index date (the baseline period), and at least 12 months of continuous enrollment following the index date (the follow - up period). Patients were excluded if they had a prescription drug fill for a copd maintenance medication (fsc, ipr, tio, budesonide / formoterol, inhaled corticosteroid alone, or long - acting beta - agonist alone) during the baseline period, or a pharmacy fill for an alternate study imt medication (fsc, tio, or ipr) within 60 days of the index date . Patients were excluded if they had a primary or secondary diagnosis of respiratory tract cancer (larynx, trachea, or pleura [icd-9-cm codes of 161, 161.x, 162, 163, 163.x, 231, 231.x]) during the baseline period . The patient eligibility criteria and selection process have been described in detail previously.13 the primary utilization outcomes were incidence and mean number of copd - related outpatient visits, outpatient visits associated with an antibiotic prescription fill, outpatient visits associated with an oral corticosteroid fill, hospitalizations, ed visits, and hospitalization and/or ed visits (combined endpoint). Encounters with a primary diagnosis code of 491.xx, 492.xx, or 496 were defined as copd - related . The primary cost outcomes were mean copd - related medical services costs, outpatient pharmacy costs (copd controller and relief medications, oral corticosteroids, and antibiotics), and total costs (the sum of the two). Medical services costs comprised inpatient, outpatient, and ed care (including facility charges and professional service fees). Costs were inflated to 2009 dollars on a monthly basis using the medical care portion of the us consumer price index.15 as outcomes were evaluated over a 12-month follow - up period, no discounting was applied to events or costs . Bivariate analyses were used to compare differences between treatment cohorts in health care utilization and cost outcomes for the 12-month follow - up period . Multivariable logistic regression was used to model the risk for any health care utilization event as an odds ratio (or). Negative binomial and poisson regression were used to calculate incidence rate ratios (irrs). Because of the right - skewed nature of the cost distribution, a generalized linear model using a gamma distribution was used to estimate differences in treatment costs . Estimates of mean differences and 95% confidence intervals (cis) were calculated from the predicted cost values . The multivariable models controlled for age, sex, treatment, comorbidities (including asthma and heart disease), and copd - related health care utilization at baseline . Starting with the original patient sample identified for the mr analysis, we created matched cohorts for the psm analysis . The tio patients and ipr patients were separately matched to fsc patients based on propensity score; that is, patients initiating therapy with tio were matched to patients initiating with fsc, and patients initiating therapy with ipr were matched to patients initiating with fsc . The matched samples were created based on each patient s predicted probability (propensity) of assignment to the case treatment (tio or ipr). The propensity to be a patient whose initial maintenance therapy was tio (or alternatively, ipr) incorporated the following baseline factors in the logistic regression equation: sex, age category, geographic region, comorbidities, copd - related health care utilization, non - copd - related health care utilization, copd medication use, and copd - related medical services costs . The utilization factors were hospitalization count and binary variables for outpatient visit, outpatient visit associated with an oral corticosteroid fill, outpatient visit associated with an antibiotic fill, ed visit, and hospitalization and/or ed visit (combined endpoint). Medication use was included using binary variables for short - acting beta - agonist (sabas), oral corticosteroid, oral antibiotic, leukotriene modifier, and methylxanthine . The greedy match algorithm was used, which performs matching using as much information as possible through the nearest available pair (or nearest - neighbor) matching method with a caliper component.1618 once a match is made, the greedy algorithm does not reconsider the match . Because no available matches could be identified for some patients in the original cohorts, the patient sample for the psm analysis was a smaller subset of the sample used in the mr analysis . Bivariate analyses were used to compare differences in outcomes in the 12-month period following initiation of maintenance therapy for the fsc - tio and fsc - ipr matched cohorts . Logistic regression was used to model the risk for any health care utilization event (or), and negative binomial and poisson regression were used to calculate irrs . Mean cost differences and 95% cis were assessed using least squares estimates from generalized linear models using a gamma distribution . Since the psm treatment groups were already matched for baseline characteristics, and our interest was only in the treatment effect, the psm regression models contained only a factor for case imt (tio or ipr), with fsc used as the reference medication . For both the mr and psm analyses, statistical tests were two - sided, with an -level of 0.05 for statistical significance . Demographic, clinical, and health care utilization characteristics were assessed as counts and percentages for categorical variables, and as standard measures (mean and sd) for continuous variables . Both unpaired and paired t - tests the chi - square test and mcnemar s test were used to test paired proportion differences because significance tests that do not consider the non - independence of matched data have been found to be more conservative than tests for paired comparisons.19,20 adequacy of matching was assessed using p values for comparison tests and standardized percentage differences.4,21 all analyses were conducted using sas software (v 9.2 for windows; sas institute, cary, nc). Administrative data were obtained from the ims lifelink health plan claims database (ims health, watertown, wa), which contains enrollment and demographic data, and health care and outpatient pharmacy claims from more than 40 million members of more than 70 us health plans . Calculated costs were based on allowed amounts, which most closely resemble the direct health care cost burden of illness . This is typically the amount the health plan pays, plus any member liability (eg, co - payment, deductible, or coinsurance amount). For claims with missing charges due to capitation arrangements, the dataset included patient demographic and enrollment data, outpatient pharmacy claims, and medical services claims (outpatient, ed, and inpatient claims, including both facility claims and professional services claims) for january, 2004 to june, 2009 . In the prior retrospective, observational cohort study, copd - related clinical and economic outcomes were evaluated in patients who received one of three imt medications for copd (fsc, tio, or ipr).13 the study perspective was that of the health plan provider organization, and only direct costs were considered . The study population included health plan members with diagnosed copd who were new to maintenance therapy with fsc 250 g/50 g, tio, or ipr (alone or in fixed dose combination with albuterol). The members were age 40 years and older, had a primary or secondary diagnosis of copd (at least one ed visit, one hospitalization, or two outpatient visits with a primary or secondary international classification of disease, 9th edition, clinical modification [icd-9-cm] diagnosis code of 491.xx, 492.xx, or 496.xx), had an imt pharmacy claim between july 1, 2004 and june 30, 2008 (the date of the first identified prescription claim was the index date), had at least 6 months of continuous health plan enrollment prior to the index date (the baseline period), and at least 12 months of continuous enrollment following the index date (the follow - up period). Patients were excluded if they had a prescription drug fill for a copd maintenance medication (fsc, ipr, tio, budesonide / formoterol, inhaled corticosteroid alone, or long - acting beta - agonist alone) during the baseline period, or a pharmacy fill for an alternate study imt medication (fsc, tio, or ipr) within 60 days of the index date . Patients were excluded if they had a primary or secondary diagnosis of respiratory tract cancer (larynx, trachea, or pleura [icd-9-cm codes of 161, 161.x, 162, 163, 163.x, 231, 231.x]) during the baseline period . The patient eligibility criteria and selection process have been described in detail previously.13 the primary utilization outcomes were incidence and mean number of copd - related outpatient visits, outpatient visits associated with an antibiotic prescription fill, outpatient visits associated with an oral corticosteroid fill, hospitalizations, ed visits, and hospitalization and/or ed visits (combined endpoint). Encounters with a primary diagnosis code of 491.xx, 492.xx, or 496 were defined as copd - related . The primary cost outcomes were mean copd - related medical services costs, outpatient pharmacy costs (copd controller and relief medications, oral corticosteroids, and antibiotics), and total costs (the sum of the two). Medical services costs comprised inpatient, outpatient, and ed care (including facility charges and professional service fees). Costs were inflated to 2009 dollars on a monthly basis using the medical care portion of the us consumer price index.15 as outcomes were evaluated over a 12-month follow - up period, no discounting was applied to events or costs . Bivariate analyses were used to compare differences between treatment cohorts in health care utilization and cost outcomes for the 12-month follow - up period . Multivariable logistic regression was used to model the risk for any health care utilization event as an odds ratio (or). Negative binomial and poisson regression were used to calculate incidence rate ratios (irrs). Because of the right - skewed nature of the cost distribution, a generalized linear model using a gamma distribution was used to estimate differences in treatment costs . Estimates of mean differences and 95% confidence intervals (cis) were calculated from the predicted cost values . The multivariable models controlled for age, sex, treatment, comorbidities (including asthma and heart disease), and copd - related health care utilization at baseline . Starting with the original patient sample identified for the mr analysis, we created matched cohorts for the psm analysis . The tio patients and ipr patients were separately matched to fsc patients based on propensity score; that is, patients initiating therapy with tio were matched to patients initiating with fsc, and patients initiating therapy with ipr were matched to patients initiating with fsc . The matched samples were created based on each patient s predicted probability (propensity) of assignment to the case treatment (tio or ipr). The propensity to be a patient whose initial maintenance therapy was tio (or alternatively, ipr) incorporated the following baseline factors in the logistic regression equation: sex, age category, geographic region, comorbidities, copd - related health care utilization, non - copd - related health care utilization, copd medication use, and copd - related medical services costs . The utilization factors were hospitalization count and binary variables for outpatient visit, outpatient visit associated with an oral corticosteroid fill, outpatient visit associated with an antibiotic fill, ed visit, and hospitalization and/or ed visit (combined endpoint). Medication use was included using binary variables for short - acting beta - agonist (sabas), oral corticosteroid, oral antibiotic, leukotriene modifier, and methylxanthine . The greedy match algorithm was used, which performs matching using as much information as possible through the nearest available pair (or nearest - neighbor) matching method with a caliper component.1618 once a match is made, the greedy algorithm does not reconsider the match . Because no available matches could be identified for some patients in the original cohorts, the patient sample for the psm analysis was a smaller subset of the sample used in the mr analysis . Bivariate analyses were used to compare differences in outcomes in the 12-month period following initiation of maintenance therapy for the fsc - tio and fsc - ipr matched cohorts . Logistic regression was used to model the risk for any health care utilization event (or), and negative binomial and poisson regression were used to calculate irrs . Mean cost differences and 95% cis were assessed using least squares estimates from generalized linear models using a gamma distribution . Since the psm treatment groups were already matched for baseline characteristics, and our interest was only in the treatment effect, the psm regression models contained only a factor for case imt (tio or ipr), with fsc used as the reference medication . For both the mr and psm analyses, statistical tests were two - sided, with an -level of 0.05 for statistical significance . Demographic, clinical, and health care utilization characteristics were assessed as counts and percentages for categorical variables, and as standard measures (mean and sd) for continuous variables . Both unpaired and paired t - tests were used for determining significant differences in mean measures . The chi - square test and mcnemar s test were used to test paired proportion differences because significance tests that do not consider the non - independence of matched data have been found to be more conservative than tests for paired comparisons.19,20 adequacy of matching was assessed using p values for comparison tests and standardized percentage differences.4,21 all analyses were conducted using sas software (v 9.2 for windows; sas institute, cary, nc). A total of 32,338 patients met patient selection criteria in the mr analysis: 12,595 fsc patients, 9126 tio patients, and 10,617 ipr patients . For the psm analysis, 89.1% (8135) of the tio patients were matched to fsc patients (64.6% of the original fsc cohort) and 80.2% (8514) of the ipr patients were matched to similar fsc patients (67.6% of the original fsc cohort). There was a large degree of overlap in the populations and good balance was achieved between the matched groups . Baseline demographic, clinical, and utilization characteristics of the cohorts after matching on propensity score are shown in table 1 (tio - fsc) and table 2 (ipr - fsc), along with p values for unpaired significance tests . Paired significance tests showed similar results although the p values were almost always lower (data not shown). After matching, the tio and fsc groups were well balanced with respect to baseline characteristics; the groups were different only in mean copd - related outpatient visits (p <0.001). Matching between the ipr and fsc patients involved more factors . After matching, differences were present for some baseline characteristics: mean copd - related outpatient visits (p = 0.02), mean all - cause outpatient visits (p <0.001), and mean days supply of sabas (p = 0.007). Figures 2 and 3 show absolute standardized difference percentages for baseline characteristics prior to and after matching . These graphs further illustrate that, while some significant differences remained after matching, they were small from a clinical standpoint . Absolute standardized percentage differences were less than 10% for all assessed baseline characteristics in both groups, supporting an assessment of balance between groups.22 we compared differences in baseline characteristics between excluded patients and matched patients (figures 2 and 3). Characteristics with large differences between excluded and matched patients tended to be the same characteristics as those associated with large standardized differences prior to matching . The excluded tio and ipr patients were older, and had more comorbidities and higher health care utilization . The excluded tio patients, when compared to fsc patients who were not matched to tio patients, were older (mean, 66.9 vs 60.1 years, p <0.001) and more likely to be male (68.7% vs 39.8%, p <0.001), not to have asthma (4.4% vs 46.8%, p <0.001), to have lower use of leukotriene modifiers (2.4% vs 12.6%, p <0.001), and sabas (15.4% vs 32.9%, p <0.001), and to have significantly higher copd - related medical service costs (us$3734 vs $365, p <0.001). Similarly, excluded ipr patients, when compared to fsc patients not matched to ipr patients, were older (68.6 vs 60.4 years, p <0.001) and more likely to be male (58.4% vs 37.0%, p <0.001), not to have asthma (6.6% vs 45.3%, p <0.001), to have lower use of leukotriene modifiers (1.5% vs 14.6%, p <0.001) and sabas (6.2% vs 45.1%, p <0.001), and to have significantly higher copd - related medical service costs ($5437 vs $220, p <0.001). Utilization and cost outcomes in the 12 months following initiation of maintenance therapy are shown in table 3 and figure 4, respectively . For the utilization comparisons, as described above, some subjects in the original mr cohorts were excluded from the psm cohorts during the matching process . Those excluded were predominantly older (and costlier) tio and ipr patients, and younger fsc patients . This resulted in changes in the frequencies and means for outcomes in all treatment groups in the psm analysis . For example, in the mr analysis, 3.6% of fsc patients, 4.7% of tio patients, and 7.3% of ipr patients had one or more ed visit (p <0.001 for all differences between tio and fsc and between ipr and fsc).19 in the tio - fsc psm analysis, 3.4% of fsc patients and 4.5% of tio patients had one or more ed visit . In the ipr - fsc psm analysis, 3.8% of fsc patients and 6.6% of ipr patients had one or more ed visit (p <0.001 for both comparisons). Thus, in both analysis methods, the incidence of ed visits was lower in the fsc group, and differences between treatment groups were similar in magnitude . The excluded fsc patients had almost no impact on mean cost estimates for patients treated with fsc . However, for patients treated with tio and ipr, the exclusion of older and sicker patients resulted in lower cost estimates for copd - related medical services and total copd - related costs (figure 4). Several significant differences between the tio and fsc groups seen in the mr analysis were also seen in the psm analysis . The fsc group had a lower percentage of patients with an outpatient visit, outpatient visit associated with an oral corticosteroid, ed visit, or hospitalization / ed visit . In contrast to the mr analysis, the psm analysis found no difference in the percentage of patients with a hospitalization (p = 0.25) or outpatient visit associated with an oral corticosteroid (p = 0.08). For each outcome measure, the percentage of patients with an encounter was lower in the fsc cohort than in the tio and ipr cohorts, although, in the psm analysis, because of the excluded younger fsc and older tio patients, the fsc percentages increased slightly and the tio percentages decreased slightly, diminishing the absolute differences between the two groups . With the exception of pharmacy costs, differences in costs that were significant in the mr analysis were also significant in the psm analyses . Fsc was associated with lower medical services costs (fsc, us$1085 [95% ci: $10611108]; tio, us$1316 [95% ci: $12881345]), and total health care costs compared to tio (fsc, $2037 [95% ci: $19932081]; tio, us$2267 [95% ci: $22182316]). The original mr analysis found that, in each of the five categories of utilization events, a lower percentage of fsc patients compared to ipr patients experienced events . These findings were essentially duplicated in the psm analysis, despite the exclusion of 20% of the ipr patients . (p values for all differences were <0.001 in the mr analysis, and ranged from <0.001 to 0.03 in the psm analysis). Differences in copd - related costs that were significant in the mr analysis were also significant in the psm analysis . Fsc was associated with higher pharmacy costs (fsc, $917 [95% ci: $897936]; ipr, us$614 [95% ci: $601627]), but lower medical service costs (fsc, $1122 [95% ci: $10991146]; ipr, us$1746 [95% ci: $17091784]), and total costs compared to ipr (fsc, us$2039 [95% ci: $19962083]; ipr, us$2360 [95% ci: $23112411]). The mr and psm analyses produced fairly similar ors for various categories of health care utilization, with ors produced by the psm analysis being slightly lower . For example, in the mr analysis, the statistically significant hospitalization / ed visit ors for tio and ipr (with respect to fsc) are 1.28 and 1.72, respectively; these values are 1.21 and 1.67 in the psm analysis, respectively . Nonetheless, both analyses show that tio and ipr patients have higher ors, compared to fsc patients, for outpatient visit, outpatient visit with oral corticosteroid, ed visit, and hospitalization / ed visit . The ipr and fsc comparison also showed higher ors for hospitalization and for an outpatient visit with an antibiotic . However, while the mr analysis calculated slightly higher odds for hospitalization for tio (or: 1.19 [95% ci: 1.041.37]) compared to fsc, the psm analysis found no difference (or: 1.10 [95% ci: 0.941.28]), nor was any difference in risk found between tio and fsc for an outpatient visit with an antibiotic (or: 1.14 [95% ci: 0.981.32]). The irrs for health care utilization events in the tio and ipr groups with reference to the fsc group are shown in figure 5 . Again, both analytic methods yielded fairly similar irrs, with the psm analysis producing slightly lower irrs for all categories of utilization . In all comparisons in the psm analysis, as in the mr analysis, ipr patients were found to be at significantly higher risk for events, compared to fsc patients . For the tio group compared to the fsc group, all irrs in the mr analysis were significantly higher . However, in the psm analysis, irrs for outpatient visits with oral corticosteroid and for hospitalizations were no longer significant . Baseline demographic, clinical, and utilization characteristics of the cohorts after matching on propensity score are shown in table 1 (tio - fsc) and table 2 (ipr - fsc), along with p values for unpaired significance tests . Paired significance tests showed similar results although the p values were almost always lower (data not shown). After matching, the tio and fsc groups were well balanced with respect to baseline characteristics; the groups were different only in mean copd - related outpatient visits (p <0.001). Matching between the ipr and fsc patients involved more factors . After matching, differences were present for some baseline characteristics: mean copd - related outpatient visits (p = 0.02), mean all - cause outpatient visits (p <0.001), and mean days supply of sabas (p = 0.007). Figures 2 and 3 show absolute standardized difference percentages for baseline characteristics prior to and after matching . These graphs further illustrate that, while some significant differences remained after matching, they were small from a clinical standpoint . Absolute standardized percentage differences were less than 10% for all assessed baseline characteristics in both groups, supporting an assessment of balance between groups.22 we compared differences in baseline characteristics between excluded patients and matched patients (figures 2 and 3). Characteristics with large differences between excluded and matched patients tended to be the same characteristics as those associated with large standardized differences prior to matching . The excluded tio and ipr patients were older, and had more comorbidities and higher health care utilization . The excluded tio patients, when compared to fsc patients who were not matched to tio patients, were older (mean, 66.9 vs 60.1 years, p <0.001) and more likely to be male (68.7% vs 39.8%, p <0.001), not to have asthma (4.4% vs 46.8%, p <0.001), to have lower use of leukotriene modifiers (2.4% vs 12.6%, p <0.001), and sabas (15.4% vs 32.9%, p <0.001), and to have significantly higher copd - related medical service costs (us$3734 vs $365, p <0.001). Similarly, excluded ipr patients, when compared to fsc patients not matched to ipr patients, were older (68.6 vs 60.4 years, p <0.001) and more likely to be male (58.4% vs 37.0%, p <0.001), not to have asthma (6.6% vs 45.3%, p <0.001), to have lower use of leukotriene modifiers (1.5% vs 14.6%, p <0.001) and sabas (6.2% vs 45.1%, p <0.001), and to have significantly higher copd - related medical service costs ($5437 vs $220, p <0.001). Utilization and cost outcomes in the 12 months following initiation of maintenance therapy are shown in table 3 and figure 4, respectively . For the utilization comparisons, as described above, some subjects in the original mr cohorts were excluded from the psm cohorts during the matching process . Those excluded were predominantly older (and costlier) tio and ipr patients, and younger fsc patients . This resulted in changes in the frequencies and means for outcomes in all treatment groups in the psm analysis . For example, in the mr analysis, 3.6% of fsc patients, 4.7% of tio patients, and 7.3% of ipr patients had one or more ed visit (p <0.001 for all differences between tio and fsc and between ipr and fsc).19 in the tio - fsc psm analysis, 3.4% of fsc patients and 4.5% of tio patients had one or more ed visit . In the ipr - fsc psm analysis, 3.8% of fsc patients and 6.6% of ipr patients had one or more ed visit (p <0.001 for both comparisons). Thus, in both analysis methods, the incidence of ed visits was lower in the fsc group, and differences between treatment groups were similar in magnitude . The excluded fsc patients had almost no impact on mean cost estimates for patients treated with fsc . However, for patients treated with tio and ipr, the exclusion of older and sicker patients resulted in lower cost estimates for copd - related medical services and total copd - related costs (figure 4). Several significant differences between the tio and fsc groups seen in the mr analysis were also seen in the psm analysis . The fsc group had a lower percentage of patients with an outpatient visit, outpatient visit associated with an oral corticosteroid, ed visit, or hospitalization / ed visit . In contrast to the mr analysis, the psm analysis found no difference in the percentage of patients with a hospitalization (p = 0.25) or outpatient visit associated with an oral corticosteroid (p = 0.08). For each outcome measure, the percentage of patients with an encounter was lower in the fsc cohort than in the tio and ipr cohorts, although, in the psm analysis, because of the excluded younger fsc and older tio patients, the fsc percentages increased slightly and the tio percentages decreased slightly, diminishing the absolute differences between the two groups . With the exception of pharmacy costs, differences in costs that were significant in the mr analysis were also significant in the psm analyses . Fsc was associated with lower medical services costs (fsc, us$1085 [95% ci: $10611108]; tio, us$1316 [95% ci: $12881345]), and total health care costs compared to tio (fsc, $2037 [95% ci: $19932081]; tio, us$2267 [95% ci: $22182316]). The original mr analysis found that, in each of the five categories of utilization events, a lower percentage of fsc patients compared to ipr patients experienced events . These findings were essentially duplicated in the psm analysis, despite the exclusion of 20% of the ipr patients . (p values for all differences were <0.001 in the mr analysis, and ranged from <0.001 to 0.03 in the psm analysis). Differences in copd - related costs that were significant in the mr analysis were also significant in the psm analysis . Fsc was associated with higher pharmacy costs (fsc, $917 [95% ci: $897936]; ipr, us$614 [95% ci: $601627]), but lower medical service costs (fsc, $1122 [95% ci: $10991146]; ipr, us$1746 [95% ci: $17091784]), and total costs compared to ipr (fsc, us$2039 [95% ci: $19962083]; ipr, us$2360 [95% ci: $23112411]). Several significant differences between the tio and fsc groups seen in the mr analysis were also seen in the psm analysis . The fsc group had a lower percentage of patients with an outpatient visit, outpatient visit associated with an oral corticosteroid, ed visit, or hospitalization / ed visit . In contrast to the mr analysis, the psm analysis found no difference in the percentage of patients with a hospitalization (p = 0.25) or outpatient visit associated with an oral corticosteroid (p = 0.08). For each outcome measure, the percentage of patients with an encounter was lower in the fsc cohort than in the tio and ipr cohorts, although, in the psm analysis, because of the excluded younger fsc and older tio patients, the fsc percentages increased slightly and the tio percentages decreased slightly, diminishing the absolute differences between the two groups . With the exception of pharmacy costs, differences in costs that were significant in the mr analysis were also significant in the psm analyses . Fsc was associated with lower medical services costs (fsc, us$1085 [95% ci: $10611108]; tio, us$1316 [95% ci: $12881345]), and total health care costs compared to tio (fsc, $2037 [95% ci: $19932081]; tio, us$2267 [95% ci: $22182316]). The original mr analysis found that, in each of the five categories of utilization events, a lower percentage of fsc patients compared to ipr patients experienced events . These findings were essentially duplicated in the psm analysis, despite the exclusion of 20% of the ipr patients . (p values for all differences were <0.001 in the mr analysis, and ranged from <0.001 to 0.03 in the psm analysis). Differences in copd - related costs that were significant in the mr analysis were also significant in the psm analysis . Fsc was associated with higher pharmacy costs (fsc, $917 [95% ci: $897936]; ipr, us$614 [95% ci: $601627]), but lower medical service costs (fsc, $1122 [95% ci: $10991146]; ipr, us$1746 [95% ci: $17091784]), and total costs compared to ipr (fsc, us$2039 [95% ci: $19962083]; ipr, us$2360 [95% ci: $23112411]). The mr and psm analyses produced fairly similar ors for various categories of health care utilization, with ors produced by the psm analysis being slightly lower . For example, in the mr analysis, the statistically significant hospitalization / ed visit ors for tio and ipr (with respect to fsc) are 1.28 and 1.72, respectively; these values are 1.21 and 1.67 in the psm analysis, respectively . Nonetheless, both analyses show that tio and ipr patients have higher ors, compared to fsc patients, for outpatient visit, outpatient visit with oral corticosteroid, ed visit, and hospitalization / ed visit . The ipr and fsc comparison also showed higher ors for hospitalization and for an outpatient visit with an antibiotic . However, while the mr analysis calculated slightly higher odds for hospitalization for tio (or: 1.19 [95% ci: 1.041.37]) compared to fsc, the psm analysis found no difference (or: 1.10 [95% ci: 0.941.28]), nor was any difference in risk found between tio and fsc for an outpatient visit with an antibiotic (or: 1.14 [95% ci: 0.981.32]). The irrs for health care utilization events in the tio and ipr groups with reference to the fsc group are shown in figure 5 . Again, both analytic methods yielded fairly similar irrs, with the psm analysis producing slightly lower irrs for all categories of utilization . In all comparisons in the psm analysis, as in the mr analysis, ipr patients were found to be at significantly higher risk for events, compared to fsc patients . For the tio group compared to the fsc group, however, in the psm analysis, irrs for outpatient visits with oral corticosteroid and for hospitalizations were no longer significant . In this analysis of data from an observational, retrospective cohort study of initial maintenance therapies for copd, we demonstrated the similarity of results using two analytic approaches to observational research . Specifically, we compared results from a psm analysis with those from a previously published, parallel mr analysis.13 we found that both methods yielded similar health care utilization and cost outcomes . General agreement between mr and psm methods has been found in other studies . In a review of 177 comparative method studies, sturmer concluded that substantial changes in treatment effects were seen when point estimates were calculated with and without adjustment for covariates, but that the method of adjustment itself mr or psm made little difference.1 in psm, a high degree of propensity score overlap after matching is desirable in terms of internal validity . When overlap is minimal, unmeasured confounding bias in treatment groups probably cannot be resolved using either mr or psm techniques.1 in the present psm analysis, large proportions of patients in both the tio and ipr cohorts (89.1% and 80.2%, respectively) were matched to fsc patients, and there was substantial overlap in propensity scores between groups . In other words, matching produced cohorts with similar baseline characteristics . In general, the few statistically significant differences remaining after matching were minor in terms of effect size and practical significance, and had small absolute standardized differences . Characteristics that would be expected to considerably skew utilization outcomes, such as comorbid cardiovascular disease, were not different between matched groups . Some differences may be due to the smaller psm sample size, since the excluded patients were a contributing explanatory factor for the lower psm utilization and cost estimates . While the mr analysis was a population - based study, the psm analysis, as a result of the matching process, excluded some younger individuals, with minimal comorbidities, who were treated with fsc, and some older, sicker individuals who were treated with ipr or tio . Exclusion of the older and sicker individuals resulted in lower mean costs for ipr and tio patients, while costs for fsc patients were quite similar in both analyses . Event frequency also may be a factor in the differences in findings between analysis methods . Multivariable logistic regression and propensity matching have been found to produce similar results when events are not infrequent.2325 through simulations, cepeda and colleagues found that the use of propensity scores yielded less biased estimates than multivariable logistic regression only when there were eight or fewer modeled events per covariate.26 when the ratio of modeled events was higher, multivariable logistic regression was the better method . Other studies have determined that ten events per covariate is a desired ratio when using maximum likelihood methods.27 the main outcomes in our analyses, (copd - related outpatient visits associated with an antibiotic or oral corticosteroid, ed visits, and hospitalizations), although of great concern clinically, occur relatively infrequently, from a statistical standpoint, when averaged across a large population of copd patients that is unrestricted in terms of disease severity . The outcome of outpatient visit with an oral corticosteroid had the smallest number of events per covariate modeled, with 877 of 32,338 patients having at least one event, which translates to 20 events per covariate in the multivariate logistic regression analysis . This compares to 65 events per covariate for the combined endpoint of hospitalization / ed visit . The lower ratios of events per covariate for some outcomes may have been a factor in the different findings of the two analyses for ors and irrs . On the other hand, costs (copd - related medical service costs and pharmacy costs) were universally incurred, and both analyses found that, compared to fsc, tio and ipr were associated with higher costs for copd - related medical services, and higher total costs, even though costs associated with tio and ipr were reduced in the psm analyses . Both mr and psm methods adjust associations between treatment effects and outcomes to reduce potential bias from observed covariates . Other researchers have reported that results from the two methods appear to be consistent when there is large overlap between groups in propensity for a given treatment, which ensures minimal loss of observations, and when outcomes can be modeled with a relatively large number of events per covariate.1,4,24 our findings support this view and suggest that, with regard to less frequent events, in particular when effect sizes may be small, consideration should be given to analyzing outcomes using both methods, assuming a large proportion of subjects can be matched . While psm is a more transparent method, in the sense that it allows one to see the degree of equality between groups after matching, in this study, psm provided little advantage over mr in terms of the validity of the results . Because of the inevitable reduction in sample size and change in overall composition of treatment groups being compared, the choice of whether to use psm or mr will depend on the question being investigated, whether a population effect is being measured, and whether review of a non - representative population of patients receiving treatment is acceptable (or even preferred). This point is addressed by dagostino, who recommended that when patients are excluded in matched analyses, researchers need to be particularly clear in their descriptions of the included and excluded patients, and of the populations to which study results are applicable.28 strengths of this study include the large sample sizes of both analyses and the high degree of propensity matching, with approximately 80% and 89% of the original ipr and tio cohorts matched, respectively, to fsc patients . The exclusion of some original subjects from the psm cohorts due to lack of a match does mean, however, that any additional information these subjects might have provided was lost, and statistical power affected . We measured exacerbations using claims data, defining exacerbations as copd - related health care events . Using an alternative definition of exacerbation based on symptoms, lung function, or other clinical parameters could influence observed effect sizes.14 however, we would not expect a different definition of exacerbations to influence effect sizes differently for mr than for psm, or for it to change the overall findings of this study . Since both mr and propensity matched analyses attempt to reduce bias through adjustment using covariates, the ability to do this is dependent on the capture of all relevant factors . In this analysis was an observational study utilizing administrative claims data, information about patients clinical status was not available . We could not ascertain lung function status, disease severity, or other clinical characteristics . However, we did control for two key characteristics of interest disease severity and exacerbation frequency by using prior copd - related health care and pharmacy utilization (particularly oral corticosteroids / antibiotics) as proxy measures . Results obtained in our analysis suggest that both mr and psm methods are appropriate analytic techniques for addressing and mitigating bias in observational research . In this example of an observational study of maintenance therapy for copd, more than 80% of the original treatment groups used in the mr analysis were matched to a comparison group for the psm analysis . While some sample size was lost in the psm analysis, results from both methods were similar in direction and statistical significance . Further, this analysis underscores the need for researchers to have a good understanding of the populations undergoing treatment and the factors associated with both receipt of treatment and occurrence of the measured outcomes.

In spite of the relatively high accuracy of endoscopic ultrasound - assisted fine - needle aspiration (eus - fna) in diagnosing lymphomas, inadequate sampling by eus - fna often makes it difficult to perform immunohistochemical analysis, thus limiting its application in the classification of lymphoma . Natural orifice transluminal endoscopic surgery (notes) is a surgical technique by which procedures such as exploration, biopsy, organ resection, and anastomosis can be performed using an endoscope passed through a natural orifice [such as the mouth, stomach, colon (or rectum), vagina, bladder, or esophagus] and then entered into the abdominal cavity, mediastinum, or thoracic cavity through an internal incision . The advantages of notes include reduced trauma, faster recovery, absence of scarring, and painlessness, and such procedures have been regarded as third - generation surgery . Here we report an eus - assisted retroperitoneal lymph node biopsy performed in a patient who had developed enlarged retroperitoneal lymph nodes with an unknown cause . This procedure was carried out on november 10, 2014, after obtaining the approval of the ethics committee and informed consent documents signed by the patient . A 60-year - old male patient was admitted to our hospital complaining of epigastric discomfort, which had persisted for 1 month . A computerized tomography (ct) scan suggested the presence of multiple soft - tissue density masses in the patient's abdominal cavity, the largest of which was 7.7 cm 7.2 cm [figure 1a and b]. Positron emission tomography - ct (pet - ct) showed that these masses had abnormal f - fdg uptake [figure 2a and b]. The patient then underwent eus examination; multiple enlarged retroperitoneal lymph nodes were found between the body of the pancreas and the gastric wall . We then performed eus - fna [figure 3] to obtain a tissue sample for biopsy . Pathological examination revealed only a few heterotypic cells [figure 4]. Because of the lack of definite pathological evidence, diagnosis of the patient's condition was extremely difficult . Ct scan showing multiple, enlarged soft tissue - density images in the abdominal cavity pet - ct showing the accumulation o f abnormal radioactivity in soft tissue - density images in the abdominal cavity eus - fna of a lymph node eus - fna showing a few heterotypic cells to obtain adequate tissue samples of the enlarged lymph nodes for immunohistochemical analysis, we performed eus - assisted retroperitoneal lymph node biopsy . A standard single - channel gastroscope (epk - i, pentax, tokyo, japan) was used throughout the endoscopic procedure; a linear array ultrasonic endoscope (eg3830ur; pentax precision instrument corporation, orangeburg, ny, usa) was used to evaluate the size of the lymph nodes, their echo characteristics, and localization . A triangle - tip knife and an insulated - tip (it) knife (both from olympus corporation, tokyo, japan) were used for resection of the gastric wall and enucleation of the lymph node . A pair of hot forceps (fd-410lr, olympus corporation, tokyo, japan) was used for gastric wall hemostasis . Adequate preoperative communication with the patient and his family was performed and associated issues including the necessity, feasibility, safety, and probable complications of the operation were explained thoroughly . For the procedure, the patient was placed in a supine position and he received standard intravenous anesthesia with propofol . The site nearest to the retroperitoneal lymph nodes in the posterior wall of the gastric body was chosen for puncture . A methylthioninium chloride and saline compound solution was injected into the puncture channel for labeling when the needle was retrieved . The lymph node was also marked by a triangle tip knife with the cautery under eus - guidance . Then, the ultrasound transducer was pulled out; therapeutic gastroscopy with a transparent cap was then performed . A triangle - tip knife was used to incise the full thickness of the gastric wall along the labeled site . The triangle - tip knife was used to separate the tissues surrounding the stomach wall sufficiently until the targeted lymph node capsule was exposed . Then, enucleation of the targeted lymph node was performed using an it knife [figure 5]. After tissue samples were obtained, the hot forceps were used to stop the bleeding . The endoscope was retrieved from the stomach and the procedure was completed by closing the incision in the stomach wall using metal clips [video 1]. The results showed: cd3(large cell-); vimentin(+); pax-5(-); cd15(-); cd20(large cell+); cd21(+); ki-67(large cell8%+); cd30(-); cd68(partly+); ck(-); mum-1(-); cd10(-); bcl-6(+); bcl-2(+). The diagnosis was: non - hodgkin lymphoma, germinal center b - cell - like diffuse large b - cell lymphoma [figure 6]. (a) the gastroscope entered into the abdominal cavity after incision of the full thickness of the gastric wall . The prelabeled lymph node was found, (b) the removed lymph node tissues immunohistochemical staining: cd3(large cell-); vimentin(+); pax-5(-); cd15(-); cd20(large cell+); cd21(+); ki-67(large cell8%+); cd30(-); cd68(partly+); ck(-); mum-1(-); cd10(-); bcl-6(+); bcl-2(+). The diagnosis was non - hodgkin lymphoma, germinal center b - cell - like diffuse large b - cell lymphoma the patient was given standard postoperative treatments and nursing care including ecg monitoring, ceftazidime as prophylaxis against infection, proton pump inhibitors, and nutritional support . The patient's highest temperature after the procedure was 37.2c and he only felt mild epigastralgia . The blood test results after the procedure were: white blood cell (wbc) count 12.8 10/l and percentage of neutrophils 80.3% . The wbc count decreased to 6.5 10/l and the percentage of neutrophils decreased to 61.8%, 4 days after the procedure . The patient gradually returned to a normal diet and normal physical activities by 3 days after the procedure . The patient was then transferred to the department of hematology to undergo further therapy . The r - chop regimen (pathological evidence is an indispensable part of the diagnosis and differential diagnosis of lymphoma and is significant for the classification of lymphomas . Precise pathological classification is critical for the choice of chemotherapeutic regimen in cases of lymphoma . In the early 1990s, eus - fna was first used for tissue biopsy of tumors around the gastrointestinal tract . In spite of its high accuracy, the lack of sufficient tissue material obtained using this technique often renders immunohistochemical staining inconclusive and limits its application in the classification of lymphomas . How to obtain an adequate sample that can be used for immunohistochemical testing is a primary problem in need of a solution . In a study by mohamad et al ., the results of eus - fna of two patients who had suspected lymphoma were negative . However, positive results were obtained by use of eus - guided trucut biopsy (eus - tcb). The authors suggested that the use of eus - tcb with 19 g needle could permit more tissue materials to be obtained in those who had a negative eus - fna result . This minimally invasive procedure can be used for the preoperative diagnoses of some difficult cases . Analyzed and compared the efficacies of eus - fna and eus - tcb in the diagnosis and classification of lymphoma . Among the 24 included patients, 23 patients underwent eus - fna . Only one patient received eus - tcb alone, while the other 22 patients received both eus - fna and eus - tcb . The results showed that the accurate diagnostic rate of eus - guided biopsy was 79% (19/24) and the accurate rate of eus - guided biopsy for classification was just 66.6% (16/24). This indicated that eus - guided biopsy was of limited value in the classification of lymphoma . There have been more than 300 reports of notes clinical applications from around the world . Over 50 cases of cholecystostomy and endectomy by transvaginal notes have been performed in germany, and 116 notes surgeries (including 77 transgastric cholecystotomy cases) have been reported in brazil . However, there are few case reports regarding the clinical application of notes in china . Wang et al . Presented a case of laparoscopy - assisted transgastric endoscopic biopsy of a retroperitoneal lymph node . In this case, an endoscopic full - thickness resection (eftr) with the aid of laparoscopy was used to extirpate an enlarged retroperitoneal lymph node . Pathological and immunohistochemical tests confirmed the diagnosis of retroperitoneal b - cell lymphoma (diffuse large b - cell lymphoma). In recent years, these studies showed that eus was very useful for creating transgastric access and locating the targets . In this study, we successfully used eus - assisted notes to perform enucleation of a retroperitoneal enlarged lymph node without laparoscopic assistance . The use of a minimally invasive procedure not only enables more tissue materials to be obtained but also causes less trauma than a laparoscopy - assisted approach . In this patient, blood test results recovered to normal levels by 4 days after the procedure and the highest postoperative body temperature was just 37.2c . He was also able to return to a normal diet 3 days after the procedure . Our experience suggests that this is an alternative and minimally invasive approach for the biopsy of retroperitoneal lymph nodes.

Periodontitis is a local inflammatory process mediating destruction of periodontal tissues triggered by bacterial insults periodontal subgingival pathogens affect local and systemic immune and inflammatory response . Local inflammatory response to these gram - negative bacteria and bacterial products is characterized by the infiltration of periodontal tissues of the inflammatory cells, including polymorphonuclear leucocytes, macrophages, lymphocytes, and plasma cells . Activated macrophages release cytokines and some individuals respond to microbial challenge with an abnormally high delivery of such mediators as pge2, il-1, and tnf-. These cytokines are involved in the destruction of periodontal connective tissue and alveolar bone they can also initiate a systemic acute phase response . During the acute phase of many diseases, a characteristic group of changes occur in the plasma cells and of blood termed acute phase response and the substances undergoing characteristic alteration of serum levels are termed acute phase reactants . Systemic acute phase response is characterized by features, such as fever, neutrophilia, changes in lipid metabolism, and induction of various acute phase proteins, such as c - reactive protein (crp), fibrinogen, and serum amyloid . Crp is a type i acute phase protein that is produced by the liver in response to diverse inflammatory stimuli . Crp levels are found in trace amounts, that is, <0.3 mg / l serum of crp could exceed 100 mg / l in the presence of overwhelming systemic infection, which provides a useful marker for tracking the course of infection . Recent investigations suggested that even a moderate increase in crp levels, such as those found in periodontitis patients, may predict a risk for atherosclerosis and cardiovascular disease(cvd) the mechanism by which crp participates in cvd is not clear; however, crp may activate the complement system and be involved in foam cell formation in atheromas . Recent studies showed that crp is a strong predictor of future coronary artery disease in healthy men and women the purpose of the present study is to quantitatively evaluate the serum levels of crp in both male and female subjects with various degrees of periodontitis (chronic and aggressive form) and compare them with controls who have a clinically healthy periodontium . This was a retrospective clinical study conducted in the department of periodontics, peoples dental college, bhopal, india . The nature and purpose of the study was explained to the patients and an informed consent was obtained . A detailed case history was recorded in a specially prepared form, which included information regarding the patients overall medical status / general health and wellbeing . Mouth mirror, williams periodontal probe, explorer, tweezer, disposable 5cc syringe, spirit cotton swab, handcuff, and edta - coated glass test tube . Patients aged between 25 and 50 years, they should not have received any antibiotic therapy in the previous 3 months . They should not have undergone any extractions or periodontal therapy in the previous 3 months . Patients with known systemic diseases and presence of other chronic infections, patients taking contraceptive pills, pregnant or lactating females . Based on the periodontal status, group i: (control group) 15 subjects with attachment loss (al) 2 mm and pocket depth (pd) <3 mm were included . Group ii: (generalized aggressive periodontitis) 15 subjects with generalized pattern of severe periodontal destruction with al of at least 5 mm on 8 or more teeth . Group iii: (chronic periodontitis) 15 subjects diagnosed with moderate and severe forms of chronic periodontitis were included . Moderate periodontitis: subjects with a minimum of 20 natural teeth, at least 1 molar tooth in each quadrant and at least 4 sites with al> 2 mm and <4 mm and pd> 5 mm and <7 mm . Severe periodontitis: subjects with a minimum of 20 natural teeth, at least, 1 molar tooth in each quadrant and at least 4 sites with al> 5 mm and pd> 7 mm . After the selection of subjects a detailed case history was taken and the following clinical parameters were recorded . Clinical parameters for the study were plaque index, gingival index, bleeding index, probing pd, and clinical attachment level . These parameters were assessed for subjects in all the 3 groups . For the crp assessment, plaque index (silness and loe) scoring was done for 6 surfaces of all the teeth distobuccal, buccal, mesiobuccal, mesiolingual, lingual, and distolingual . Criteria for the plaque index: 0:no plaque in the gingival area.1:a film of plaque adhering to the free gingival margin and adjacent area of the tooth . The plaque may be recognized only by running a probe across the surface.2:moderate accumulation of soft deposits within the gingival pocket and on the gingival margin and/or on the adjacent tooth surface that can be seen by the naked eye.3:abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface . A film of plaque adhering to the free gingival margin and adjacent area of the tooth . The plaque may be recognized only by running a probe across the surface . Moderate accumulation of soft deposits within the gingival pocket and on the gingival margin and/or on the adjacent tooth surface that can be seen by the naked eye . Abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface . Bleeding index (ainamo and bay): 0:absence of bleeding.1:presence of bleeding . Gingival index (loe and silness); 0:normal gingiva.1:mild inflammation, slight change in color, slight edema, and no bleeding on palpation.2:moderate inflammation, redness and edema, ulceration, and tendency to spontaneous bleeding.3:severe inflammation, marked redness and edema, ulceration, and tendency to spontaneous bleeding . Mild inflammation, slight change in color, slight edema, and no bleeding on palpation . Severe inflammation, marked redness and edema, ulceration, and tendency to spontaneous bleeding . Probing pd was measured from the gingival margin to the probable pd at the mesiobuccal, midbuccal, distobuccal, mesiolingual, midlingual, and distolingual surface of all the teeth and clinical attachment level was measured from the cementoenamel junction, to the probable pd of all the teeth on the same surfaces, using the williams periodontal probe to the nearest millimeter . About 45 ml of blood sample was collected from each of the subjects from the brachial vein, by aseptic technique using a 5 cc syringe and transferred to an appropriately labeled tube and allowed to clot, centrifuged, and the smear layer removed carefully . The serum thus obtained was stored at 20c for the analyses at a later date . Serum crp levels were assessed by means of a commercially available high - sensitivity crp (hs - crp) enzyme immunoassay . (diagnostics biochem canada inc elisa kit the eiasy way) mean and standard deviation are calculated for all the groups and periodontal parameters . Mean values of each parameter were compared between the groups using one - way analysis of variance with post hoc test of least significant difference method . Pearson's correlation was used to assess the correlation between severity of periodontitis and serum crp levels . In the present study, p value of 0.05 was considered as significant . Statistical package for social science (spss) version 15 analysis of covariance was used for comparison of mean values between the groups to adjust the age . Mouth mirror, williams periodontal probe, explorer, tweezer, disposable 5cc syringe, spirit cotton swab, handcuff, and edta - coated glass test tube . Patients aged between 25 and 50 years, they should not have received any antibiotic therapy in the previous 3 months . They should not have undergone any extractions or periodontal therapy in the previous 3 months . Patients with known systemic diseases and presence of other chronic infections, patients taking contraceptive pills, pregnant or lactating females . Based on the periodontal status, group i: (control group) 15 subjects with attachment loss (al) 2 mm and pocket depth (pd) <3 mm were included . Group ii: (generalized aggressive periodontitis) 15 subjects with generalized pattern of severe periodontal destruction with al of at least 5 mm on 8 or more teeth . Group iii: (chronic periodontitis) 15 subjects diagnosed with moderate and severe forms of chronic periodontitis were included . Moderate periodontitis: subjects with a minimum of 20 natural teeth, at least 1 molar tooth in each quadrant and at least 4 sites with al> 2 mm and <4 mm and pd> 5 mm and <7 mm . Severe periodontitis: subjects with a minimum of 20 natural teeth, at least, 1 molar tooth in each quadrant and at least 4 sites with al> 5 mm and pd> 7 mm . After the selection of subjects a detailed case history was taken and the following clinical parameters were recorded . Clinical parameters for the study were plaque index, gingival index, bleeding index, probing pd, and clinical attachment level . These parameters were assessed for subjects in all the 3 groups . For the crp assessment, plaque index (silness and loe) scoring was done for 6 surfaces of all the teeth distobuccal, buccal, mesiobuccal, mesiolingual, lingual, and distolingual . Criteria for the plaque index: 0:no plaque in the gingival area.1:a film of plaque adhering to the free gingival margin and adjacent area of the tooth . The plaque may be recognized only by running a probe across the surface.2:moderate accumulation of soft deposits within the gingival pocket and on the gingival margin and/or on the adjacent tooth surface that can be seen by the naked eye.3:abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface . A film of plaque adhering to the free gingival margin and adjacent area of the tooth . The plaque may be recognized only by running a probe across the surface . Moderate accumulation of soft deposits within the gingival pocket and on the gingival margin and/or on the adjacent tooth surface that can be seen by the naked eye . Abundance of soft matter within the gingival pocket and/or on the gingival margin and adjacent tooth surface . Bleeding index (ainamo and bay): 0:absence of bleeding.1:presence of bleeding . Gingival index (loe and silness); 0:normal gingiva.1:mild inflammation, slight change in color, slight edema, and no bleeding on palpation.2:moderate inflammation, redness and edema, ulceration, and tendency to spontaneous bleeding.3:severe inflammation, marked redness and edema, ulceration, and tendency to spontaneous bleeding . Mild inflammation, slight change in color, slight edema, and no bleeding on palpation . Severe inflammation, marked redness and edema, ulceration, and tendency to spontaneous bleeding . Probing pd was measured from the gingival margin to the probable pd at the mesiobuccal, midbuccal, distobuccal, mesiolingual, midlingual, and distolingual surface of all the teeth and clinical attachment level was measured from the cementoenamel junction, to the probable pd of all the teeth on the same surfaces, using the williams periodontal probe to the nearest millimeter . About 45 ml of blood sample was collected from each of the subjects from the brachial vein, by aseptic technique using a 5 cc syringe and transferred to an appropriately labeled tube and allowed to clot, centrifuged, and the smear layer removed carefully . The serum thus obtained was stored at 20c for the analyses at a later date . Serum crp levels were assessed by means of a commercially available high - sensitivity crp (hs - crp) enzyme immunoassay . Mean values of each parameter were compared between the groups using one - way analysis of variance with post hoc test of least significant difference method . Pearson's correlation was used to assess the correlation between severity of periodontitis and serum crp levels . In the present study, statistical package for social science (spss) version 15 was used for statistical analysis . Analysis of covariance was used for comparison of mean values between the groups to adjust the age . A total number of 45 male and female subjects with the age range between 25 and 50 years participated in the study . All the patients who participated in the study were systemically healthy and were adjusted for factors known to elevate crp levels . The mean crp concentration in the groups i, ii, and iii were calculated . A statistically significant difference (p = 0.012) was found in the crp level between groups i and ii and between groups ii and iii and between groups i and iii [table 1]. Comparison of c - reactive protein levels among all the groups the results of the present study indicated an increase in serum crp levels in subjects with generalized aggressive periodontitis and chronic periodontitis compared with controls . Clinical parameters, such as bleeding on probing, showed a positive correlation with crp levels in aggressive periodontitis group and a positive correlation was also seen for probing pd, clinical attachment level, and crp in chronic periodontitis group of subjects . Of particular concern could be the elevation in crp levels in younger individuals as represented by aggressive periodontitis patients that may contribute to an early cvd in susceptible patients . Earlier it was considered simply as a chronic localized infection; however, a growing body of evidence suggests that the pathology of periodontitis may affect the outcome of several systemic diseases, such as myocardial infarction, stroke, or preterm low birth weight babies gram - negative anaerobes present in large numbers in subgingival dental plaque in periodontal pockets affect the local and systemic inflammatory response . Endotoxins derived from gram - negative microorganisms interact with toll - like receptors expressed on the surface of neutrophils, macrophages, lymphocytes, and plasma cell, which are abundant in periodontal inflammation . Toll - like receptors - ligand complexes activate single transduction pathways in both the innate and adaptive immune systems leading to the production of cytokines, which coordinate the local and systemic inflammatory responses . Some individuals respond to microbial challenge with an abnormally high delivery of such inflammatory mediators as pge-2, il-1, and tnf . Crp is a very strong acute phase protein . In healthy young subjects and resting situations plasma crp is produced only by hepatocytes, predominantly under transcriptional control by the cytokine il - 6, although other sites of local crp synthesis and possibly secretions have been suggested . Crp has been known to be present in monocyte - derived macrophages, in atherosclerotic plaques, lymphocytes, and alveolar macrophages . Acute phase proteins not only appear in acute and severe disease processes, but also in longstanding, chronic conditions . For example, crp has often been found at relatively low levels (range, 0.33.0 mg / l) in subjects with chronic stomach ulcers associated with helicobacter pylori, in persons with chronic lung infections, such as chlamydia pneumonia, and in individuals with a chronic cytomegalovirus infection . Simultaneously, it has been established that crp in particular showed a strong association with cvd . Slightly elevated (> 0.33 mg / l) and chronically present levels of crp were determined to have a predictive value for the occurrence of a cardiovascular event . Both periodontal and cvds share several risk factors, including smoking, diabetes mellitus, age, socioeconomic status, obesity, and psychologic stress . The epidemiologic evidence to date show a significant but modest relationship between periodontitis and cvd . Crp production is part of the nonspecific acute phase response to most forms of inflammation, infection, and tissue damage and was therefore considered to provide clinically useful information . A high sensitivity assay for measuring crp levels has been developed to detect the levels of crp below what was previously considered the normal range . In healthy individuals, crp levels are found in trace amounts with levels <0.3 mg / l, in acute inflammation crp could exceed 100 mg / l, and the level decreases in chronic inflammation . Accumulating evidence suggests that small elevation of serum crp within the range of 110 mg / l is a significant indicator of risk of atherosclerosis, cvd, and type 2 diabetes . Positive crp may indicate any of a number of possibilities, rheumatoid arthritis, rheumatic fever, cancer, tuberculosis, pneumococcal pneumonia, myocardial infarction, systemic lupus erythematosus . Positive crp results also occur during the last half of pregnancy or with the use of oral contraceptive pills, increase with aging, obesity, high blood pressure, alcohol use, smoking, low levels of physical activity, chronic fatigue, coffee consumption, elevated triglycerides, insulin resistance and diabetes, a high protein diet, suffering sleep disturbances, and depression . Alcohol can cause inflammation and raise crp . The best way we know to reduce crp levels are exercise and a diet that includes omega-3 fatty acids as statins appear to protect against inflammation as well as cholesterol . Recent studies have indicated that serum crp of patients with periodontal diseases is elevated with deep periodontal pockets, severe attachments loss, subgingival microflora, and alveolar bone loss . Treatment of periodontal infection, whether by intensive mechanical therapy, drug therapy, or extraction significantly lowers the serum crp levels . Reported an increase in crp levels even in generalized aggressive periodontitis patients (3.72 mg / l), which is similar to the findings of the present study (4.54 mg / l). In the present study, although the crp levels were found to be elevated in aggressive periodontitis group of subjects, the mean levels were found to be lower than in the chronic periodontitis group . The reason for this difference in crp levels between aggressive and chronic periodontitis groups is not exactly understood at this point in time but could be attributable to the longstanding nature and chronic course of the disease process of chronic periodontitis, thus exerting its systemic influence over a long period of time compared with aggressive periodontitis, which runs a shorter course . Also the mean age values of chronic periodontitis subjects and aggressive periodontitis subjects in the present study were in accordance with the prevalence studies of aggressive periodontitis and chronic periodontitis, which have shown an increased prevalence for the occurrence of aggressive periodontitis in younger age groups and occurrence of chronic periodontitis in older age groups . In the present study, clinical parameters such as bleeding on probing showed a positive correlation with crp level in aggressive periodontitis group and a positive correlation was also seen for probing pd, clinical attachment level, and crp in chronic periodontitis group of subjects . This is similar to the results of earlier studies, which revealed increased bleeding on probing depth and al to be significantly associated with elevated crp concentrations . The results of the present study indicated an increase in serum crp levels in subjects with generalized aggressive periodontitis and chronic periodontitis as compared with controls, which was statistically significant . Clinical parameters such as bleeding on probing showed a positive correlation with crp levels in aggressive periodontitis group and a positive correlation was also seen for probing pd, clinical attachment level, and crp in chronic periodontitis group subjects . However, the result of the present study cannot be used to determine the causality of the associations between periodontitis and crp due to some limitations, one being the small sample size and the other is that the study is only cross - sectional . Moreover, the subjects might have undiagnosed systemic factors that could influence the crp levels . But keeping in view the results of the earlier studies and that of the present study, it would be appropriate if large sample based, well - controlled, longitudinal trials are performed to determine the relationship between periodontitis and elevated crp levels and the effect of periodontal therapy on serum crp concentration.

Therapeutic plasma exchange (tpe) is used for many indications in patients presenting to a variety of medical disciplines . The efficacy and safety of tpe is the subject of recent reviews and guidelines from professional bodies including the american society for apheresis and the american academy of neurology . However, strong recommendations on practical aspects of the delivery of tpe are not available . Membrane therapeutic plasma exchange (mtpe) and centrifugal therapeutic plasma exchange (ctpe) are both well - established techniques . In both, plasma is selectively removed and replaced typically with human serum albumin or fresh frozen plasma, chosen on the basis of the indication for tpe and patient clinical parameters . One uncontrolled comparison carried out> 25 years ago used a ctpe device that is no longer available . In another study, although apheresis registry data have been published, these do not include details of practical differences between mtpe and ctpe or the advantages of each method . Between november 2010 and march 2011, we had the opportunity to evaluate mtpe and ctpe techniques at our institution . Here we describe three patients with unequivocal indications for therapeutic plasma exchange who were all treated with both mtpe and ctpe . We report practical aspects of their treatment with emphasis on reliability and safety of the techniques . In the autumn of 2011, we had made access to both membrane tpe and a centrifugal tpe system . Our established treatment system was mtpe, but during this period we had arranged for a trial of a ctpe system . As a consequence, exchange volumes, anticoagulation, replacement fluid employed and additional calcium supplementation used in tpe are prescribed in our unit on the basis of a written protocol (see figure 1). Many of the elements of this protocol of the unit were employed with the ctpe device . The main change was that exchange volumes for mtpe procedures were estimated by the prescribing physician, whereas the ctpe device calculated exchange volumes precisely according to patient parameters . The mtpe device required a blood flow of 100150 ml / min for efficient treatment but a higher blood flow did not shorten treatment duration . The ctpe device could operate with a blood flow of up to 140 ml / min, but could run as low as 5 ml / min if necessary . Higher blood flow had an immediate effect on treatment duration, as with higher flows treatment time was shortened considerably . We were advised by the manufacturer that platelet losses would be minimized (to <1%) at a blood flow of 65 ml / min, therefore we included this flow rate in our procedure protocol . Table 1.patient characteristicspatient (age, gender, weight)diagnosistreatmentpre - treatment result (date)date of last tpepost - treatment result (date)1 (50, f, 75)crescentic glomerulonephritis with anti - gbm antibodiescyp, mp, 12 tpeanti - gbm 747 iu / ml (20 november 2010)14 december 2010anti - gbm 67 iu / ml (17 december 2010)2 (23, m, 94)crescentic glomerulonephritis with anti - gbm antibodiescyp, mp, 17 tpe, anti - gbm> 600 iu / ml (27 january 2011)18 february 2011anti - gbm 36 iu / ml (22 february 2011)3 (57, m, 81)anca - associated small vessel vasculitiscyp, mp, 7 tpe,10.1 iu / ml (14 december 2010)30 december 2010<1.3 iu / ml (30 december 2010)cyp, cyclophosphamide; mp, methylprednisolone; aav, anca - associated vasculitis; tpe, therapeutic plasma exchange; hd, haemodialysis anti - gbm . Patient characteristics cyp, cyclophosphamide; mp, methylprednisolone; aav, anca - associated vasculitis; tpe, therapeutic plasma exchange; hd, haemodialysis anti - gbm . The first patient was a 50-year - old woman (75 kg) with acute kidney injury . Plasma exchange treatments (table 2) were started with membrane filtration technology (mtpe), using the gambro prisma system with a tpe 2000 set (gambro). The set was routinely primed as per policy and manufacturer's instructions with 4 l of sodium chloride 0.9%, with 5000 iu unfractionated heparin added to the last litre of fluid . Table 2.plasma exchange procedurespatienttype of tpentotal heparin used during procedure (iu)total acd - a infused to patient (ml)procedure time (min)time to exchange 1 l of plasma (min)1mtpe57290 3171143 6144 14ctpe649 21104 3629 52mtpe37750 750138 3234 13ctpe1362 13116 1328 43mtpe1630016040ctpe681 25112 628 4all patientsmtpe97333 2317144 940 12ctpe2563 21112 2028 4 plasma exchange procedures during the first treatment, an initial heparin bolus of 1000 iu was used and the heparin infusion rate was 1000 iu / h . These doses were with 13 iu / kg lower than per protocol (33 iu / kg), as the patient had a renal biopsy the day before the exchange . At 55 min into the procedure, a rise in transmembrane pressure suggested imminent filter clotting and a further 1000 iu heparin bolus was given . Despite this, the filter clotted shortly after . The set was changed and the patient received a further bolus of 2000 iu heparin in addition to a continued heparin infusion of 1000 iu / h . Two hours after the second bolus (time 115 min), the filter clotted again and the set was replaced for a second time . The patient received a fourth bolus of heparin (2000 iu) at 190 min and the heparin infusion rate was increased to 1500 iu / h . The third attempt to complete the exchange was uneventful but the total cumulative dose of heparin was 8750 iu . The procedure took 237 min to complete of which only 124 min were spent performing the exchange . The patient underwent mtpe daily on the next 3 days and completion of these procedures required large heparin doses . Altogether, four mtpe procedures were performed with one prematurely terminated because of severe clotting in the filter before the prescribed plasma exchange had been delivered . In addition, seven disposable sets were required to complete four tpe procedures . As per our treatment guidelines, the patient should have received on average of 5500 iu of heparin for a 4 l exchange but we had to use up to 9000 iu to complete tpe . We feared that the administration of such high doses of heparin could lead to systemic anticoagulation in a patient at risk of pulmonary haemorrhage . We therefore decided to use the ctpe (spectra optia apheresis) device with regional citrate anticoagulation of the extracorporeal circuit . Citrate (acid citrate dextrose formula a, acd - a solution, 0.113 mm citrate) was infused at a rate dependent on the patient's total blood volume (tbv). In our setting, we used a rate of 0.8 ml acd - a / min / l tbv which corresponds to between 0.0047 and 0.0068 mmol citrate a total of seven additional centrifugal plasma exchange procedures were performed with an average procedure time of 104 min . All seven ctpe procedures were uneventful and the prescribed dose was delivered on each occasion . In addition, the average lapsed time it took to exchange 1 l of plasma using ctpe was 29 min in contrast with 44 min using mtpe (gambro prisma system device). Treatment 9 was performed with a mixture of human albumin 4.5% and ffp and cryoprecipitate using the ctpe device . This proceeded without difficulties and contrasts with our experience of mtpe where this type of exchange prescription would have proved problematic . The patient's final tpe was delivered using mtpe and there were further difficulties with filter clotting . In total, the patient's tpe was delivered using an un - tunnelled right internal jugular (rij) central venous catheter (cvc) during sessions 16 and a tunnelled rij cvc for sessions 712 . Unfortunately, the patient's renal function could not be salvaged and she required long - term maintenance haemodialysis until her unrelated death at home 14 months after starting dialysis . The second patient was a 24-year - old male (94 kg) with a crescentic glomerulonephritis at renal biopsy, haemoptysis and anti - gbm antibodies . Significant problems with filter clotting were encountered despite high doses of heparin used . During the first session of mtpe, tmp started to rise after 1 h and the set clotted 25 min later . The prescribed session was completed, but a total of 7750 iu heparin was used . A second mtpe procedure was carried out successfully without clotting but 8500 iu of heparin was needed in a patient who should have only received 6000 iu according to the local protocol . Following these two sessions, we changed the delivery method to ctpe and 14 further procedures were carried out without problems . During the 15th procedure the patient briefly felt unwell and complained of having a metallic taste in his mouth . Blood flow was decreased to 40 ml / min and an additional 20 ml of calcium gluconate was given . A normal blood flow of 65 ml / min was resumed shortly after symptoms had subsided . A final plasma exchange was delivered using mtpe, requiring a total heparin dose of 7000 iu . The patient's tpe was delivered using an un - tunnelled rij cvc for sessions 15 and a tunnelled cvc for sessions 617 . The patient's renal function did not recover and he received maintenance dialysis until a successful transplant 23 months after presentation . The third patient was a 57-year - old man (81 kg) with anca - associated vasculitis, presenting with constitutional symptoms, skin, neurological and renal manifestations and bloody diarrhoea . He was treated with cyclophosphamide and corticosteroids initially and, in the absence of response to these interventions, tpe was prescribed . The fourth plasma exchange was an mtpe procedure where clotting occurred 30 min into the procedure (heparin infusion: 1000 iu / h; bolus: 1500 iu). Heparin infusion rate was increased to 1500 iu / h, two additional boluses of 2000 iu and later on a 1000 iu bolus were given and the prescribed tpe was completed without further clotting using a new disposable set . In total, subsequently, his renal function declined and he started on peritoneal dialysis 15 months after his initial presentation . The first patient was a 50-year - old woman (75 kg) with acute kidney injury . Plasma exchange treatments (table 2) were started with membrane filtration technology (mtpe), using the gambro prisma system with a tpe 2000 set (gambro). The set was routinely primed as per policy and manufacturer's instructions with 4 l of sodium chloride 0.9%, with 5000 iu unfractionated heparin added to the last litre of fluid . Set - up and priming usually took 40 min . Table 2.plasma exchange procedurespatienttype of tpentotal heparin used during procedure (iu)total acd - a infused to patient (ml)procedure time (min)time to exchange 1 l of plasma (min)1mtpe57290 3171143 6144 14ctpe649 21104 3629 52mtpe37750 750138 3234 13ctpe1362 13116 1328 43mtpe1630016040ctpe681 25112 628 4all patientsmtpe97333 2317144 940 12ctpe2563 21112 2028 4 plasma exchange procedures during the first treatment, an initial heparin bolus of 1000 iu was used and the heparin infusion rate was 1000 iu / h . These doses were with 13 iu / kg lower than per protocol (33 iu / kg), as the patient had a renal biopsy the day before the exchange . At 55 min into the procedure, a rise in transmembrane pressure suggested imminent filter clotting and a further 1000 iu heparin bolus was given . Despite this, the filter clotted shortly after . The set was changed and the patient received a further bolus of 2000 iu heparin in addition to a continued heparin infusion of 1000 iu / h . Two hours after the second bolus (time 115 min), the filter clotted again and the set was replaced for a second time . The patient received a fourth bolus of heparin (2000 iu) at 190 min and the heparin infusion rate was increased to 1500 iu / h . The third attempt to complete the exchange was uneventful but the total cumulative dose of heparin was 8750 iu . The procedure took 237 min to complete of which only 124 min were spent performing the exchange . The patient underwent mtpe daily on the next 3 days and completion of these procedures required large heparin doses . Altogether, four mtpe procedures were performed with one prematurely terminated because of severe clotting in the filter before the prescribed plasma exchange had been delivered . As per our treatment guidelines, the patient should have received on average of 5500 iu of heparin for a 4 l exchange but we had to use up to 9000 iu to complete tpe . We feared that the administration of such high doses of heparin could lead to systemic anticoagulation in a patient at risk of pulmonary haemorrhage . We therefore decided to use the ctpe (spectra optia apheresis) device with regional citrate anticoagulation of the extracorporeal circuit . Citrate (acid citrate dextrose formula a, acd - a solution, 0.113 mm citrate) was infused at a rate dependent on the patient's total blood volume (tbv). In our setting, we used a rate of 0.8 ml acd - a / min / l tbv which corresponds to between 0.0047 and 0.0068 mmol citrate / kg / min . At this rate, a total of seven additional centrifugal plasma exchange procedures were performed with an average procedure time of 104 min . All seven ctpe procedures were uneventful and the prescribed dose was delivered on each occasion . In addition, the average lapsed time it took to exchange 1 l of plasma using ctpe was 29 min in contrast with 44 min using mtpe (gambro prisma system device). Treatment 9 was performed with a mixture of human albumin 4.5% and ffp and cryoprecipitate using the ctpe device . This proceeded without difficulties and contrasts with our experience of mtpe where this type of exchange prescription would have proved problematic . The patient's final tpe was delivered using mtpe and there were further difficulties with filter clotting . In total, the patient's tpe was delivered using an un - tunnelled right internal jugular (rij) central venous catheter (cvc) during sessions 16 and a tunnelled rij cvc for sessions 712 . Unfortunately, the patient's renal function could not be salvaged and she required long - term maintenance haemodialysis until her unrelated death at home 14 months after starting dialysis . The second patient was a 24-year - old male (94 kg) with a crescentic glomerulonephritis at renal biopsy, haemoptysis and anti - gbm antibodies . Significant problems with filter clotting were encountered despite high doses of heparin used . During the first session of mtpe, the prescribed session was completed, but a total of 7750 iu heparin was used . A second mtpe procedure was carried out successfully without clotting but 8500 iu of heparin was needed in a patient who should have only received 6000 iu according to the local protocol . Following these two sessions, we changed the delivery method to ctpe and 14 further procedures were carried out without problems . During the 15th procedure the patient briefly felt unwell and complained of having a metallic taste in his mouth . Blood flow was decreased to 40 ml / min and an additional 20 ml of calcium gluconate was given . A normal blood flow of 65 ml / min was resumed shortly after symptoms had subsided . A final plasma exchange was delivered using mtpe, requiring a total heparin dose of 7000 iu . The patient's tpe was delivered using an un - tunnelled rij cvc for sessions 15 and a tunnelled cvc for sessions 617 . The patient's renal function did not recover and he received maintenance dialysis until a successful transplant 23 months after presentation . The third patient was a 57-year - old man (81 kg) with anca - associated vasculitis, presenting with constitutional symptoms, skin, neurological and renal manifestations and bloody diarrhoea . He was treated with cyclophosphamide and corticosteroids initially and, in the absence of response to these interventions, tpe was prescribed . The fourth plasma exchange was an mtpe procedure where clotting occurred 30 min into the procedure (heparin infusion: 1000 iu / h; bolus: 1500 iu). Heparin infusion rate was increased to 1500 iu / h, two additional boluses of 2000 iu and later on a 1000 iu bolus were given and the prescribed tpe was completed without further clotting using a new disposable set . In total, subsequently, his renal function declined and he started on peritoneal dialysis 15 months after his initial presentation . Therapeutic plasma exchange is a well - established treatment for renal diseases . Over a 5-month period, we had the opportunity to compare the ease of use, safety and reliability of mtpe and ctpe methods in three patients with severe renal disease . We performed 36 plasma exchange procedures on these patients, 9 using mtpe and 27 using ctpe . The most significant observation in our study was the high frequency with which the filter clotted using mtpe with conventional heparin anticoagulation despite doses of heparin larger than advocated in our local mtpe protocol . On occasions, multiple disposable sets had to be used to complete the plasma exchange procedure, increasing procedure cost . In addition to the requirement for larger than expected doses of heparin, the mtpe procedures in this small cohort were very time consuming . Mtpe took longer to set up and was more frequently complicated by the time and resource consuming need to change the extracorporeal circuit . This is problematic when expensive ffp with a limited shelf life is required for the exchange . A heparin bolus of 50 iu / kg and an infusion rate of 10002000 iu / h has been used in tpe without excess clotting . The protocol is also similar to that used in the canadian series [7, 8] where a bolus of 40 iu / kg (2800 iu) and a constant infusion rate of 20 iu / kg / h were used successfully . In our study, the heparin bolus was somewhat higher in mtpe procedures with clotting (median: 73 iu / kg; range: 4893 iu / kg) and without clotting (median: 48 iu / kg; range: 3267 iu / kg). This difference was not statistically significant (mann whitney u - test; p = 0.37). The heparin infusion rate was similar with clotting (median: 19 iu / kg / h; range: 1333 iu / kg / h) and without clotting (median: 21 iu / kg / h; range: 2127 iu / kg / h; p = 0.12). We can therefore conclude that clotting was not due to underdosing of heparin in these cases . . Suggest that every unit of heparin administered increased the risk for complications by 0.3% . However, the heparin dose used in the bramlage study at which complications started to decline, was significantly lower than that in our observations . It is highly likely that the circuit used contributes to the heparin requirement in the published observations . We also need to point out that during mtpe, antithrombin iii is removed from the circuit . As a result, heparin will therefore be less effective . In figure 2, all findings regarding clotting are summarized . With a heparin bolus at or below 2000 iu, clotting occurred in 67% of treatments, dropping to 25% with a bolus of> 2000 iu . Below 2000 iu / h, 83% of mtpe procedures clotted . At or> 2000 iu / ml, this proportion dropped to 13% . In our experience of centrifugal tpe transient hypocalcaemia effects can be counteracted by giving a bolus of calcium gluconate . To prevent hypocalcaemia, we used a continuous calcium gluconate 10% infusion, based on pre - tpe serum calcium levels . Proportion of clotting in mtpe and ctpe procedures . In two out of three patients, it is unclear to what extent a decline in platelet counts during a course of tpe is related to heparin exposure, bone marrow suppression secondary to therapeutic immunosuppression, platelet consumption or possibly heparin - induced thrombocytopenia . In patients with diseases which may be associated with pulmonary haemorrhage as was the case for patients 1 and 2, it seems intuitive to avoid unnecessary heparin and reduce the risk of residual systemic anticoagulation . No clotting was observed in the ctpe sessions where the extracorporeal circuit was anticoagulated with acd - a . In this respect, we confirm the results of previous studies using the spectra optia apheresis device [10, 11]. Overall, the main differences in our limited clinical comparison between mtpe and ctpe are related to anticoagulation and ease of use . However, other adverse effects may be more common with mtpe . Hypotension, fever, haemolysis and chills [4, 13] are described in the mtpe series in the literature . A retrospective comparison of complement activation using different techniques suggested that less complement activation is seen using centrifugal methods . When considering the extra costs of machine purchase and consumables for ctpe, it is worth considering the lower likelihood of clotting of the extracorporeal circuit and therefore having to use fewer consumables and expensive replacement fluids with limited shelf life after thawing . Having taken all this into account, we have established for our unit a cost saving of consumables of 8254.40 per year when using ctpe rather than mtpe . The impact of increased procedure time, set - up time and treatment duration on nursing resources should also be taken into account (table 2 and figure 3). In addition, even though we used central access on the patients reported, the centrifugal device also has the advantage that it can be used with peripheral access and also operates in single needle mode . Blood flow was somewhat slower with 4060 ml / min and procedure time accordingly somewhat longer, but we could not have treated this patient with our membrane device, as this needed a blood flow of at least 100 ml / min . Centrifugal tpe with citrate anticoagulation is an alternative to membrane - based tpe and heparin anticoagulation.membrane-based tpe may require substantial doses of heparin to anticoagulate the extracorporeal circuit . Centrifugal tpe with citrate anticoagulation is an alternative to membrane - based tpe and heparin anticoagulation . Membrane - based tpe may require substantial doses of heparin to anticoagulate the extracorporeal circuit.

Clinical histories and condition of host dogs: in total, 173 cotton rectal swabs were collected from 93 dogs treated at rakuno gakuen university (rgu) veterinary teaching hospital (ebetsu, japan; university hospital) and from 80 dogs treated at 8 companion animal clinics (10 samples per clinic, from different dogs) in the community of ebetsu (community clinics) from june to december 2005 (regardless of the clinical condition seen for the animal). All dogs admitted to the university hospital had also visited the community clinics previously . University hospital cases (15 male and 20 female dogs) included those with tumor, cataract, glaucoma, keratitis, hip dysplasia, cushing syndrome and herniated intervertebral discs . Community clinic cases (27 male and 24 female dogs) included those undergoing castration, panovario - hysterectomy or treatment for urinary tract infections, cystitis, chronic diarrhea, dermatitis, otitis externa, gingivitis, pharyngitis and keratitis . Dogs were aged 016 years (university dogs: 8.2 3.7 y [mean sd]; community dogs: 5.5 4.2 y). The 6-month history of antimicrobial use prior to sampling was also compared for the 54 dogs admitted to the university hospital and the 56 dogs admitted to the community clinics . Samples were streaked on deoxycholate hydrogen sulfide lactose (dhl) agar (nissui, tokyo, japan) and incubated for 24 hr at 37c . Colonies of suspected e. coli growing on these dhl agar plates were picked and subcultured on nutrient agar (nissui). After incubation, the biochemical properties of these colonies were assessed using triple sugar iron agar (nissui), lysine indole motility medium (nissui) and cytochrome oxidase tests . Final identification of e. coli was performed using api20e codes (biomrieux, tokyo, japan). The 173 canine samples were also assessed on dhl agar supplemented with 4 g / ml of enrofloxacin (enr; bayer, osaka, japan). Susceptibility testing: susceptibilities to a panel of antimicrobials were examined using the agar dilution method, according to the guidelines of the clinical and laboratory standards institute (clsi). Mueller hinton (mh) agar was obtained from oxoid (basingstoke, u.k . ). Ampicillin (amp), amoxicillin (amx), cefazolin (cfz), cephalexin (lex), gentamicin (gen), kanamycin (kan), dihydrostreptomycin (dsm), oxytetracycline (otc) and chloramphenicol (chl) were obtained from sigma - aldrich (st . Louis, mo, u.s.a . ), and cefpodoxime (cpd) was purchased from daiichi sankyo co., ltd . Staphylococcus aureus atcc29213, enterococcus faecalis atcc29212, e. coli atcc25922 and pseudomonas aeruginosa atcc27853 were used as controls . Resistance to dsm (32 g / ml) and otc (16 g / ml) was microbiologically defined as described in the japanese veterinary antimicrobial - resistance monitoring system . Intermediate interpretations for dsm and otc were defined as having two - fold lower minimum inhibitory concentration (mic) than those of the resistance category . Phe - arg--naphthylamide (pan; sigma - aldrich; final concentration: 20 g / ml) was used as an efflux - pump inhibitor . Organic solvent tolerance: organic solvent tolerance (ost) was investigated as previously described with slight modifications . An overnight culture of e. coli was diluted with 0.9% nacl (approximately 1 10 cells / ml). A drop of cell suspension (5 l) was spotted onto mh agar medium to form a circle with a diameter of 8 mm . The surface of the agar was overlaid with a mixture (3:1, 1:1, or 1:3 [vol / vol]) of n - hexane (96.0% pure; kishida chemical co., ltd ., osaka, japan) and cyclohexane (> 99% pure; merck kgaa, darmstadt, germany) to a depth of 3 mm . Cyclohexane is an organic solvent known to be a more effective agent against e. coli than n - hexane . Bacterial growth was assessed after the plates were incubated at 37c for 1618 hr in a sealed vessel . Confluent growth of the cells (confluent) was considered to be indicative of tolerance to the solvent tested . When only a few colonies (<10) grew on the plate or when no growth was observed, the cells were considered to be sensitive to the solvent tested (non - confluent). Determination of qrdr mutations, pmqrs, -lactamases and chl - resistance genes: mutations in qrdrs of gyra, parc, pare and gyrb were examined by direct dna sequencing of pcr products, as described by everett et al . . Pmqr genes (qnra, qnrb, qnrs, aac (6) ib - cr and qepa) were detected by pcr using specific primers (table 1table 1.sequences of oligonucleotides and fluorescence - labeled oligonucleotides used for pcr, direct sequencing and real - time rt - pcr in this studygeneforward primer (53)reverse primer (53)fluorescent probe (53)purposereferencegyraacgtactaggcaatgactggagaagtcgc cgtcgatagaacpcr and sequencinggyrbtgtatgcgatgtctgaactgctcaatagcagctcggaatapcr and sequencingparctgtatgcgatgtc tgaactgctcaatagcagctcggaatapcr and sequencingparetaccgag ctgttccttgtggggcaatgtgcagaccat cagpcr and sequencingqnraagaggatttctcacgccaggtgccaggcacagatcttgacpcrqnrbggmathgaaattcgccactgtttgcygyycgccagtcgaapcrqnrsgcaagttcattgaacagggttctaaaccgtcgagttcggcgpcraac (6)-ibttgcgatgctctatgagtggctactcgaatgcctggcgtgtttpcr and sequencingqepaaactgcttgagcccgtagatgtctacgccatggacctcacpcrblatematgagtattcaacattttcgttaccaatgcttaatcagtgpcr and sequencingblashvatgcgttatattcgcctgtgttagcgttgccagtgctcgapcrcata1agttgctcaatgtacctataaccttgtaattcattaagcattctgccpcrcata2acactttgccctttatcgtctgaaagccatcacatactgcpcrcata3ttcgccgtgagcattttgtcggatgagtatgggcaacpcrflorcgccgtcattcctcaccttcgatcacgggccacgctgtgtcpcrcmlattgcaacagtacgtgacatacacaacgtgtacaaccagpcracractatcaccctacgctctatcttcgcgcgcacgaacatacccgaacccggatcacactctrt - pcracrbgcggtcgtgtgaagaaagtttaactcccaacgagaagaggagaatgaccatcagcagcacgaacataccagtrt - pcrthis studytolcggtacgttgaacgagcaggatcccatcagcaatagcattctgttccctggcactgaacaatgcgctgagcaart - pcrthis studygapaaaaggcgctaacttcgacaagaacggtggtcatcagacctcaacgataacttcggcatcart - pcrthis studya) m, a, or c; h, a, or c or t; y, c, or t.) and direct dna sequencing [4, 15, 21]. To identify the amp - resistance mechanism, -lactamase genes, viz ., blatem and blashv, were detected by pcr and direct dna sequencing ., cata1, cata2, cata3, flor and cmla, were detected by pcr as described in previous studies [17, 27]. Nucleotide sequences were determined using a bigdye terminator v3.1 cycle sequencing kit with a 3130 genetic analyzer (applied biosystems, foster city, ca, u.s.a . ). A) m, a, or c; h, a, or c or t; y, c, or t. real - time reverse transcription - pcr: overnight cultures of e. coli isolates were diluted 1:100 in lb broth and grown to the mid - logarithmic phase . Rna was isolated using an rneasy mini kit (qiagen, hilden, germany) according to the manufacturer s instructions and stored at 80c until used . The concentration of rna was determined spectrophotometrically (biospectrometer, eppendorf, hamburg, germany). Gene expression (acra, acrb and tolc) was estimated by quantitative reverse transcription (rt) taqman - pcr . The respective primer pairs and probes (table 1) used for acrb, tolc and gapa in this study were designed according to the sequence of e. coli strain k12 substrain mg1655, which is deposited in genbank (accession number u00096). The probes were labeled by the manufacturer (sigma - aldrich) with the reporter dye 6-carboxyfluorescein (6-fam) at the 5-end and with the quencher dye 6-carboxytetramethylrhodamine (tamra) at the 3-end . Purified rna (2.5 ng) was used in one - step rt and real - time pcr amplification . Rt - pcr amplification mixtures (20 l) contained purified rna, 2 quantitect probe rt - pcr master mix, 0.2 l of quantitect rt mix (quantitect probe rt - pcr kit, qiagen), 0.2 m of probe and 0.5 m forward and reverse primers . The cycle conditions comprised 20-min reverse transcription at 50c; a 15-min initial activation step at 95c; and 45 cycles each of 55c for 1 min and at 60c for 30 sec in a lightcycler 480 (roche, mannheim, germany). E. coli strain ag100 (k-12 arge3 thi-1 rpsl xyl mtl d (gal - uvrb)supe44) was kindly donated by dr helen i. zgurskaya (university of oklahoma, norman, ok, u.s.a .) And used as a reference strain . Statistical analysis: statistical significance of differences between the isolates obtained from dogs admitted to the 2 types of treatment facilities was determined by student s t - test and fisher s exact test . Antimicrobial - resistance profile of canine e. coli isolates: there was a significant difference in the ages (p<0.05), but not in the gender distribution of the dogs admitted to the university hospital or the community clinics . Seventy - four e. coli isolates were obtained from 93 rectal samples from dogs admitted to the university hospital (79.6%) and 66 isolates from 80 rectal samples obtained from dogs admitted to the community clinics (82.5%), after culture on dhl agar plates that had not been supplemented with enr . There was no significant difference in the frequency of e. coli isolation between dogs admitted to the 2 types of treatment facilities (p>0.05). Of all the canine e. coli isolates, 44.3% (62 of 140 isolates) were resistant to at least 1 antimicrobial agent tested with aminopenicillin resistance being the most frequent (approximately 30%); approximately 50% of aminopenicillin - resistant isolates were also resistant to cephalosporins (cfz and cpd). Although there was no significant difference in the rate of resistance to amp or amx between isolates derived from university hospital cases and isolates derived from community clinics cases, when considering isolates with resistance as well as those with an intermediate interpretation to amp and amx, this rate was significantly more prevalent in the university hospital than in the community clinics samples (p<0.05, table 2table 2.antimicrobial susceptibility of e. coli strains derived from dogs attending rakuno gakuen university veterinary teaching hospital (rgu; university) and animal clinics in the community (community)antimicrobial(break point, g / ml)groupsrange(g / ml)mic50(g / ml)mic90(g / ml)number of strains (%) siri + ramp(32)university2>1284>12844 (59.5)*4 (5.4)26 (35.1)30 (40.5)*community0.5>1284>12850 (75.8)016 (24.2)16 (24.2)amx(32)university1>12816>12832 (43.2)**15 (20.3)**27 (36.5)42 (56.8)**community4>1284>12850 (75.8)016 (24.2)16 (24.2)cfz(32)university1>1282>12861 (82.4)1 (1.4)12 (16.2)13 (17.6)community1>1282>12857 (86.3)09 (13.6)9 (13.6)lex(32)university8>1288>12854 (73.0)5 (6.8)15 (20.3)20 (27.0)community4>1288>12847 (71.2)9 (13.6)10 (15.1)19 (28.8)cpd(8)university<0.125>1280.512862 (83.8)012 (16.2)12 (16.2)community0.25>1280.512857 (86.4)09 (13.6)9 (13.6)kan(64)university1>12823266 (89.2)1 (1.4)7 (9.5)8 (10.8)community2>1282>12859 (89.4)07 (10.6)7 (10.6)gen(16)university0.5>1281867 (90.5)07 (9.5)7 (9.5)community0.5641262 (93.9)04 (6.1)4 (6.1)dsm(32)university2>1284>12855 (74.3)1 (1.4)18 (24.3)19 (25.7)community2>1284>12848 (72.7)1 (1.5)17 (25.8)18 (27.3)otc(16)university2>1282>12856 (75.7)3 (4.1)15 (20.3)18 (24.3)community1>1282>12850 (75.8)016 (24.2)16 (24.2)chl(32)university4>12886454 (73.0)*9 (12.2)11 (14.9)*20 (27.0)*community4>1288861 (92.4)3 (4.5)2 (3.0)5 (7.6)enr(4)university0.011280.036459 (79.7)*015 (20.3)*15 (20.3)*community0.01640.031661 (92.4)05 (7.5)5 (7.6)amp: ampicillin, amx: amoxicillin, cfz: cefazolin, chl: chloramphenicol, cpd: cefpodoxime, dsm: dihydrostreptomycin, enr: enrofloxacin, gen: gentamicin, kan: kanamycin, lex: cephalexin, otc: oxytetracycline . The prevalence of chl - resistant and enr - resistant isolates was also significantly higher in the university hospital than in the community clinics samples (table 2). Amp: ampicillin, amx: amoxicillin, cfz: cefazolin, chl: chloramphenicol, cpd: cefpodoxime, dsm: dihydrostreptomycin, enr: enrofloxacin, gen: gentamicin, kan: kanamycin, lex: cephalexin, otc: oxytetracycline . P<0.05, * * p<0.01; difference versus community . In terms of susceptibilities to aminopenicillin and chl among the 15 enr - resistant isolates derived from the university hospital samples, 7 isolates showed resistance and/or intermediate interpretation to aminopenicillin, as well as resistance to chl . Six of these isolates showed resistance and/or intermediate interpretation to aminopenicillin, but susceptibility to chl, while the remaining 2 isolates showed susceptibility to both aminopenicillin and chl (data not shown). Among the 5 enr - resistant isolates derived from the community clinics samples, 1 isolate showed both resistance to aminopenicillin and chl, and 4 isolates showed resistance and/or an intermediate interpretation to aminopenicillin, but susceptibility to chl (data not shown). The prevalence of resistance to aminoglycosides (kan, gen and dsm) and otc was not significantly different between isolates derived from the university hospital cases and from the community clinics cases . Enr - resistant isolates frequently demonstrated concomitant resistance to aminopenicillins, cephalosporins, gen, dsm and chl (table 3table 3.prevalence of concomitant antimicrobial resistance on enr - resistant e. coli isolates derived from non - supplemented agarisolatesprevalence of concomitant resistance (%) ampamxcezlexcpdkangendsmotcchlenr - resistant (20)90.0**90.0**75.0**80.0**70.0**15.030.0**65.0**35.040.0**enr - susceptible (120)20.020.85.07.55.89.24.218.320.02.5amp: ampicillin, amx: amoxicillin, cfz: cefazolin, chl: chloramphenicol, cpd: cefpodoxime, dsm: dihydrostreptomycin, enr: enrofloxacin, gen: gentamicin, kan,:kanamycin, lex: cephalexin, otc: oxytetracycline . * prevalence of ost was significantly higher in isolates from the university hospital cases than from the community clinics cases (table 4table 4.organic solvent tolerance (ost) of e. coli strains derived from dogs in attending rakuno gakuen university veterinary teaching hospital (rgu; university) and animal clinics in the community (community)ost(n - hexane: cyclohexane)groupsnon - confluentconfluent3:1university32 (43.2)**42 (56.8)**community55 (83.3)11 (16.7)1:1university60 (81.1)**14 (18.9)**community63 (95.5)3 (4.5)1:3university67 (90.5)7 (9.5)*community65 (98.5)1 (1.5)values indicate the number of e. coli isolates and (percentage of the total). * amp: ampicillin, amx: amoxicillin, cfz: cefazolin, chl: chloramphenicol, cpd: cefpodoxime, dsm: dihydrostreptomycin, enr: enrofloxacin, gen: gentamicin, kan,:kanamycin, lex: cephalexin, otc: oxytetracycline . * values indicate the number of e. coli isolates and (percentage of the total). The average number of antimicrobials used for each dog was significantly higher in the university hospital than in the community clinics cases (table 5table 5.status of antimicrobial use in dogs attending rakuno gakuen university veterinary teaching hospital (rgu; university) and animal clinics in the community (community)antimicrobial useuniversitycommunityaverage number of antimicrobialsused for each dog1.4**0.8frequency of dogs treatedby fluoroquinolone24.1%**14.3%frequency of dogs treatedby all antimicrobials74.1%**50.0%we could obtain antimicrobial use history for 6 months prior to sampling from 54 dogs in the university and 56 dogs in the community . The frequencies of dogs treated with any antimicrobials and with fluoroquinolones were also significantly higher in the university hospital than in the community clinics cases (table 5). In addition, prevalence of fluoroquinolone - resistant isolates was significantly higher in dogs that had been treated with fluoroquinolones compared with that in dogs that had not been treated with this agent (p<0.05; data not shown). We could obtain antimicrobial use history for 6 months prior to sampling from 54 dogs in the university and 56 dogs in the community . * isolation of fluoroquinolone - resistant e. coli using enr - supplemented dhl agar plates: to investigate fluoroquinolone - resistance mechanisms and the occurrence of multidrug resistance involving fluoroquinolone, we selected enr - resistant e. coli on enr - supplemented dhl agar plates (fig . 1fig . 1.influence of enrofloxacin selection on isolation frequencies of e. coli isolated from canine rectal samples . Amp, ampicillin; amx, amoxicillin; cfz, cefazolin; chl, chloramphenicol; cpd, cefpodoxime; dsm, dihydrostreptomycin; enr, enrofloxacin; gen, gentamicin; kan, kanamycin; lex, cephalexin; otc, oxytetracycline . * statistical difference for isolation with deoxycholate hydrogen sulfide lactose (dhl) medium without antimicrobials; p<0.05 . ). Rate of resistance to aminopenicillins, cephalosporins, gen, dsm, otc and chl was significantly higher in isolates obtained from enr - supplemented dhl agar plates than those obtained from dhl agar plates that had not been supplemented with enr . Isolates obtained from enr - supplemented dhl agar plates were most frequently amp resistant . Influence of enrofloxacin selection on isolation frequencies of e. coli isolated from canine rectal samples . Amp, ampicillin; amx, amoxicillin; cfz, cefazolin; chl, chloramphenicol; cpd, cefpodoxime; dsm, dihydrostreptomycin; enr, enrofloxacin; gen, gentamicin; kan, kanamycin; lex, cephalexin; otc, oxytetracycline . * statistical difference for isolation with deoxycholate hydrogen sulfide lactose (dhl) medium without antimicrobials; p<0.05 . We further characterized the 31 e. coli isolates derived from enr - supplemented dhl agar plates (table 6table 6.characterization of antimicrobial and organic solvent susceptibility, qrdr mutations, existence of resistant genes and expression levels of acrab in e. coli isolates derived by enr - supplemented agarstraincanine case historyantimicrobial usefor 6 monthsbefore samplingqrdr mutationsmic (g / ml)-lactamasegenepmqrcp - resistancegeneexpression levelgyraparcpareampcpdenrchlacraacrbtolcs83d87s80e84a108university groupre18mastocytomacfz, lexlnig-->128>128128 (16)32 (16)n.d.n.d.n.d.2.623.763.27re21abdominal tumoramp, cfz, lex, enrlnig-->128>128128 (32)>128n.d.n.d.cata12.313.774.65re28rhabdomyosarcomacfz, lexlnig-->128>128128 (32)64 (16)blatem-1n.d.n.d2.177.133.46re33mastocytomacfz, lex, ofxlnig-->128>128128 (32)>128blatem-1n.d.cata12.8114.295.88re61herniated intervertebral discslexlnig-->1280.564 (8)16 (8)blatem-1n.d.n.d.1.432.343.21re63unknownamplnig--16 (8)264 (8)16 (8)n.d.n.d.n.d.0.752.681.87re20lung tumoramc, cfz, enrlniv-->128>12832 (4)16 (8)blatem-1n.d.n.d.2.162.93.95re2tumor of the breastgen, frmlni - t->128>128128 (16)32 (16)n.d.n.d.n.d.2.82.874.07re72glaucomacfz, ofx, orblni - t->128164 (8)16 (8)blatem-1n.d.n.d.0.890.961.77re80oral tumornonelni - t->128164 (8)16 (8)blatem-1n.d.n.d.1.021.011.72re4osteosarcomaamp, amx, frmlni--e460a>128>12864 (16)>128blatem-1n.d.cata11.361.52re64oral tumorcfzlni--e460a>1280.564 (16)>128blatem-1n.d.cata10.761.081.7re65unknownnonelni--e460a>1280.564 (16)>128blatem-1n.d.cata10.81.041.29re22multiple myelomaenr, minlni--s458a>1284128 (16)16 (8)blatem-1n.d.n.d.1.941.672.55re26unknowncfz, lexlni---4 (4)0.2516 (8)8 (4)n.d.n.d.n.d.1.11.582.36re50keratitisofx, orblni--->128>128128 (16)16 (8)blatem-1n.d.n.d.1.321.652.74re54biopsy of vertebral bodycfzlni--->128232 (16)>128blatem-1n.d.cata11.542.674.09re17cushing syndromecfzlwig--16 (8)164 (8)16 (8)n.d.n.d.n.d.1.362.763.87re39herniated intervertebral discsamplwig-->128>128256 (16)>128blatem-1n.d.cata11.183.283.74total (%) r84.263.110052.6 * 1.83 * 3.48**3.06**i + r94.752.610094.7**(13.9)(8.6*)community groupce7otitis externalex, genlnia-->128>128128 (16)>128n.d.n.d.cata10.881.42.01ce5unknownnonelnig-->1282128 (16)16 (8)blatem-1n.d.n.d.1.441.631.22ce6unknownlex, cfz, genlnig-->128>12864 (4)8 (4)n.d.n.d.n.d.0.250.370.43ce10diarrheanonelniv--4 (4)0.564 (8)4 (2)n.d.n.d.n.d.0.632.122.02ce14unknownnonelniv-->1280.5128 (16)4 (2)blatem-1n.d.n.d.0.841.261.6ce1unknownnonelni - t->128>12864 (8)16 (8)blatem-1n.d.n.d.0.91.271.32ce9otitis externalex, gen, lvxlni--e460a>128>12832 (8)16 (8)blatem-1n.d.n.d.1.71.891.72ce12gingivitisclilni--s458t>1280.532 (4)4 (4)blatem-1n.d.n.d.1.341.711.52ce13diarrheasxtlni--s458a>1282128 (8)8 (4)n.d.aac (6)-ib - crn.d.0.240.460.56ce3pharyngitisamp, lex, ofxlgr--->1283232 (8)8 (4)blatem-1n.d.n.d.0.911.61.82ce4unknownnonelgr--->1283232 (4)8 (8)blatem-1n.d.n.d.0.50.91.25ce8keratitislex, lvxlgi--->128>12832 (8)8 (4)n.d.n.d.n.d.0.951.511.7total (%) r91.758.31008.30.971.341.43i + r91.766.710033.3(8.0)(4.6)amc: amoxicillin - clavulanic acid, cli: clindamycin, frm: fradiomycin, lvx: levofloxacin, min: minocycline, ofx: ofloxacin, orb: orbifloxacin, sxt: trimethoprim - sulfamethoxazole . B) wild - type c) fold - reduction of mic by pan . E) mrna expression levels derived from real - time rt - pcr (relative amount of ag100). * p<0.05, * * p<0.01; statistical difference versus community group . ). All enr - resistant isolates had nucleotide substitutions in qrdrs accompanied by changes in 3 or 4 amino acids in qrdrs . The aac (6) ib - cr, one of the genes encoding pmqrs, was detected in only 1 strain . In total, more than 70% of the enr - resistant isolates had resistance or intermediate interpretation to amp and/or chl, and 74% of isolates with an amp mic of>128 g / ml possessed blatem-1, and 100% of isolates with a chl mic of>128 g / ml possessed cata1(table 6). Expression levels of acra, acrb and tolc and the effect of pan were higher in chl resistance and chl intermediate interpretable isolates than in chl - susceptible isolates (table 6). Isolates exhibiting ost had high acrb expression, while isolates with an intermediate interpretation to amp also exhibited ost and had higher acrb expression than did isolates that were amp - susceptible (data not shown). Amc: amoxicillin - clavulanic acid, cli: clindamycin, frm: fradiomycin, lvx: levofloxacin, min: minocycline, ofx: ofloxacin, orb: orbifloxacin, sxt: trimethoprim - sulfamethoxazole . B) wild - type c) fold - reduction of mic by pan . E) mrna expression levels derived from real - time rt - pcr (relative amount of ag100). * p<0.05, * * p<0.01; statistical difference versus community group . Among dogs from which we isolated e. coli on enr - supplemented dhl agar plates, the frequency of dogs treated with any antimicrobials was significantly higher in the university hospital (89.5%) than in the community clinics (58.3%) cases (table 6). In contrast, the frequency of dogs treated with fluoroquinolones was not significantly different between the university hospital (31.6%) and community clinics (25.0%) cases . Twenty - seven of 31 e. coli isolates obtained on enr - supplemented dhl agar plates showed resistance or an intermediate interpretation to amp and/or chl . Among the 27 dogs from which we isolated e. coli with resistant or an intermediate interpretation to amp and/or chl on enr - supplemented dhl agar plates, 18 dogs had been treated with fluoroquinolone and/or -lactam antimicrobials (table 6). In this study, e. coli isolates with resistant or an intermediate interpretation to aminopenicillins, chl or fluoroquinolone were more frequently obtained from dogs admitted to the universal hospital than from those admitted to the community clinics . Remarkably, isolates with resistance to fluoroquinolones more frequently showed resistance to aminopenicillins, cephalosporins, gen, dsm and chl, as compared with fluoroquinolone - susceptible isolates . This result suggested that the difficulty of providing effective antimicrobial treatment increases in secondary medical care . It indicated a need to investigate the mechanism underlying the emergence of this multidrug - resistance phenotype . To characterize in detail the fluoroquinolone - resistant isolates obtained from the university hospital and community clinics studied here, we investigated antimicrobial - resistance mechanisms of e. coli isolates derived from dogs using enr - supplemented dhl agar plates . All enr - resistant isolates obtained from enr - supplemented dhl agar plates possessed 3 or 4 mutations in qrdrs . A previous study showed that in vitro exposure to fluoroquinolone caused mutations in qrdrs and acrab this may indicate that in vivo fluoroquinolone exposure can also cause an increase in fluoroquinolone - resistant e. coli possessing multiple mutations in qrdrs and acrab tolc overexpression . Indeed, prevalence of fluoroquinolone - resistant isolates was significantly higher in dogs that had been treated with fluoroquinolones compared with that in dogs that had not been treated with this agent, as determined using on dhl agar plates that had not been supplemented with enr . Moreover, fluoroquinolone - resistant isolates derived from the university hospital had higher levels of acra, acrb and tolc expression than did such isolates obtained from the community clinics, as determined using enr - supplemented dhl agar plates . These findings suggested that the high prevalence of fluoroquinolone - resistant e. coli isolates derived from the university hospital may have been caused by frequent fluoroquinolone use in the university hospital and/or continuous fluoroquinolone use in the community clinics and the university hospital . This may have resulted in development of a mechanism that decreased fluoroquinolone susceptibility, viz ., overexpression of acrab tolc . In this study, chl, in addition to enr was another agent to which isolates derived from the university hospital showed a significantly higher prevalence of resistance than did those derived from the community clinics . All enr - resistant isolates with a chl mic of> 128 g / ml that had been derived from enr - supplemented dhl agar plates possessed cata1 . However, other resistant isolates with a chl mic of 32 and 64 g / ml and an intermediate interpretation isolates with a chl mic of 16 g / ml did not possess any specific chl - resistance gene . Among all antimicrobial agents that we tested, isolates with enr resistance were most frequently co - resistant to aminopenicillins, and all the isolates showing resistance to amp, but not to cepharosporins, possessed blatem-1 . However, isolates with intermediate interpretation to amp did not possess any of the -lactamase genes for which we tested . These results indicated that the main resistance mechanisms for fluoroquinolones, amp and chl involved by acquisition of mutations in qrdrs and a resistance - associated gene, e.g., blatem-1 or cata1, although there may also be other mechanisms that decreased their susceptibilities and conferred co - resistance to these agents . To evaluate the mechanism underlying decreased susceptibilities and co - resistance to fluoroquinolone, aminopenicillins and chl, we investigated acrab tolc function, because acrab tolc is a major resistance nodulation division (rnd) family - type efflux pump that excretes several antimicrobials [14, 19, 20]. Acrab overexpression increases the mics of aminopenicillins and chl to an intermediate interpretation (16 g / ml) or resistance (32 or 64 g / ml) level, and its effect is not limited to fluoroquinolone resistance [13, 21]. Tolc is also known to cause the efflux of several organic solvents, which cause cell death by breaking down microbial membranes; therefore, investigation of ost is useful for identifying e. coli isolates that have active acrab tolc . We observed that ost isolates with higher acrb expression and isolates with an intermediate interpretation to aminopenicillins and chl, as well as isolates resistant to aminopenicillins and/or with chl mics of 32 and 64 g / ml, also exhibited ost and higher acrb expression than did susceptible isolates, as seen by analysis using enr - supplemented dhl agar plates . A higher prevalence of isolates with ost, decreased aminopenicillin susceptibility and decreased chl susceptibility, was observed in isolates obtained from university hospital compared to those from community clinics cases, as seen on agar plates without enr supplementation . Tolc function contributes to a decrease in susceptibility to aminopenicillins and chl mics in some e. coli isolates obtained from dogs . Our study revealed that the frequency of total antimicrobial treatment as well as fluoroquinolone use was significantly higher in the university hospital than in the community clinics . This evidence suggested that the frequent use of antimicrobials in dogs admitted to the university hospital and/or their continuous use in dogs moving from the community clinics to the university hospital facilitate selection of antimicrobial resistant e. coli strains with qrdr mutations, beta - lactamase gene and cata1 . In addition, our study also revealed that dogs admitted to the university hospital tend to be treated with multiple antimicrobials . Indeed, our results showed that enr - resistant e. coli isolates had higher rates of resistance to several antimicrobials compared with enr - susceptible e. coli isolates, and enr - resistant isolates derived from the university hospital cases on enr - supplemented dhl agar showed a stronger development of the acrab tolc than did enr - resistant e. coli isolates derived from the community clinics cases . We considered that these findings substantially reflect the situation in japanese companion animal medicine, because the samples in this study were successively . In addition, a previous study also showed that amp or enr treatment led to the emergence of aminopenicillin enr chl - resistant e. coli isolates in dogs in the united states [2, 8]. Moreover, fluoroquinolone aminopenicillin chl - resistant e. coli isolates with overexpression of acrab tolc were frequently isolated from humans in university hospitals . These findings indicate that the emergence of this multidrug - resistant phenotype may mirror the same phenomenon in human and companion animal clinical fields in several countries in some cases . In these cases, a clearer strategy for choice and use of antimicrobials suitable to treatments is required in order to prevent the emergence and spread of these fluoroquinolone - resistant e. coli with decreased susceptibilities to several other antimicrobials . In particular, we suggest that it may be important to share the history of antimicrobials usage across the first and secondary medical care settings of companion animals to avoid treatment with several antimicrobials in the same period and to avoid extensive, continuous treatment with the same class antimicrobial . In conclusion, this study revealed that the higher prevalence of concomitant resistant and intermediate interpretations to fluoroquinolones, aminopenicillins and chl in isolates from the university hospital than in isolates from the community clinics was due not only to the acquisition of specific resistance mechanisms, such as -lactamases, cata1 and qrdr mutations, but also to overexpression of the acrab tolc efflux pump in canine e. coli.

When you hear hoofbeats, think of horses not zebras, the art of medicine is based on soundness: the higher the pretest probability, the sounder the diagnosis . The problem with this medical aphorism is that it actively encourages the clinician to turn a deaf ear (and a blind eye) to the possibility of lesser known and, therefore, more easily overlooked disease states that mimic or this report presents a case in point: a 47-year - old woman with triple - negative breast cancer on a clinical trial called primetime (nct02518958) who received the anti - pd-1 inhibitor nivolumab and the experimental anticancer agent rrx-001 for 18 weeks; initially treated for pneumonitis, an expected autoimmune complication of nivolumab, based on the development of dyspnea and ct abnormalities . The overall clinical picture, nevertheless, was atypical, which prompted the investigating team to aggressively pursue alternate possibilities, ultimately leading to the correct diagnosis: pulmonary tumor thrombotic microangiopathy or pttm . This example highlights the importance of exercising due diligence and not automatically jumping to conclusions with regard to the diagnosis of immune - related adverse events (iraes) such as pneumonitis during treatment with pd-1 or ctla-4 inhibitors . Analogous to another pulmonary medical aphorism, all that wheezes is not asthma, the differential diagnosis for breathlessness in the context of immune checkpoint inhibition is broader than only pneumonitis and should involve a systematic investigation for other etiologies, including the rare and rapidly progressive disorder pttm . A case history and review of the literature are presented for pttm, which we propose to define as a paraneoplastic syndrome (pns). In addition, a potential treatment option based on its pathophysiology is discussed . The goal of cytotoxic t - lymphocyte antigen-4 (ctla-4) and programmed death-1 (pd-1) pathway blockade, including nivolumab approved for the treatment of melanoma, squamous - cell lung cancer and renal cell carcinoma, is to overcome the t - cell suppression mediated by these inhibitory receptors (fig . 1); a potential side effect of revving up the immune system to attack malignant tumors is the breaking of self - tolerance and the induction of iraes, which include rash, colitis, hepatotoxicities, endocrinopathies, and interstitial pneumonitis . As the most serious irae, reportedly responsible for 5 total fatalities across the spectrum of nivolumab - treated patients, the incidence of pneumonitis increased from 3.4% on a melanoma trial to 6% on a nsclc clinical trial, according to a recent bristol myers squibb press release; this increase in incidence should raise the suspicion that increased awareness of and, consequently, narrowed focus on pneumonitis by oncologists has resulted in erroneous overdiagnosis . The clinical manifestations of pneumonitis are protean and include fever, chills, malaise, cough, chest tightness, hypoxia, and dyspnea, while the nonspecific radiological characteristics of ground glass opacities (i.e., lung opacities that do not obscure the associated vessels), consolidations (i.e., lung opacities that do obscure the associated vessels), and effusions also overlap with multiple other disease entities including acute respiratory distress syndrome, pneumonia, pulmonary embolism (pe), congestive heart failure, and the subject of this case report, pttm . Pttm is a rare and possibly underdiagnosed extrapulmonary sequella of metastatic cancer, specifically adenocarcinomas, formally described in 1990 by von herbay et al . That presents as acute cor pulmonale, a maladaptive response to pulmonary hypertension, resulting in dyspnea and hypoxemia as well as ground - glass opacity (or diffuse consolidation) and pulmonary edema on ct [12, 13]. The available literature on pttm is sparse, existing mostly as case reports or small case series from japan, with a lack of higher - order treatment studies . Adenocarcinomas, and gastric cancer in particular, have been linked with pttm in these japanese case reports, which is not surprising, given the high incidence rate of gastric cancer in japan . The etiologic mechanism of pttm is related to the intravasation of circulating tumor cells in the pulmonary vasculature; these circulating tumor cells release a plethora of vascular remodeling factors including vascular endothelial growth factor (vegf), fibroblast growth factor, osteopontin, and platelet derived growth factor (pdgf) associated with abnormal endothelial proliferation, the local activation of the coagulation cascade, and the development of pulmonary hypertension from resultant stenosis of the pulmonary capillaries and arterioles (fig . Which is only rarely diagnosed antemortem, due to a nearly uniform fatality rate, (almost all reported patients have died within 2 weeks of dyspnea onset), may be suspected in cancer patients ruled out for pe who develop acute or subacute right - sided heart failure, pulmonary hypertension, and abnormal coagulation parameters . Our nivolumab - treated patient with metastatic triple - negative breast cancer who is the subject of this case report recapitulated these clinical and laboratory abnormalities almost to a t, including, unfortunately, the time interval between onset of first symptoms and death . While the term textbook example is not applicable in the context of pttm, since no textbooks on it have been written (only case reports), this patient's clinical course and trajectory were indeed textbook for pttm, even though a default diagnosis of nivolumab - induced pneumonitis was initially made . However, in light of the atypical presentation, discussed below, and findings that did not quite add up, the team, suspecting that pneumonitis was a red herring, decided to trust their intuition, and pursued a further work - up, which ultimately led to the diagnosis of pttm . A 47-year - old female with rapidly progressive refractory triple - negative metastatic breast cancer, metastatic to the lungs, was treated at walter reed on a clinical trial called primetime (nct02518958) where she received the anti - pd-1 inhibitor nivolumab, 3 mg / kg, every other week in combination with weekly rrx-001, an experimental epi - immunologic agent . During her week 18 infusion on december 3, 2015, she developed fever (101f, 38.3c), headache, palpitations, and diaphoresis; the presence of fever prompted a sepsis work - up consisting of complete blood count, routine blood culture, urinalysis, and chest x - ray in the hospital to determine the source of the fever and rule out an infection . Her labs were otherwise significant only for anemia (hemoglobin 9.4 g / dl and hematocrit 30.6%) and a normal leukocyte count (5.8 10/l) with a high percentage of segmented neutrophils on the differential (normal 4373%) and no bandemia . As part of the work - up for sinus tachycardia, thyroid function tests were performed but thyroid - stimulating hormone (tsh) and free t4 were within normal limits . Her symptoms progressed to dyspnea and hypoxia the next day (on december 4, 2015) after administration of isotonic normal saline to restore volume . Chest ct, which had been clear on admission, revealed interlobular septal thickening, diffuse ground - glass attenuation, and bilateral effusions (fig . 3). A shortened list of differential diagnoses included atypical viral or bacterial pneumonia, cardiogenic pulmonary edema (since the patient had received doxorubicin in the past), and treatment - induced pneumonitis . On that basis, fluids were withheld, the patient was discontinued from the trial and combination treatment with broad - spectrum empiric antibiotics (vancomycin, zosyn and levaquin) and 1 mg / kg prednisone was started . However, the antibiotics and corticosteroids were withdrawn a week later due to worsening dyspnea and hypoxia . A ventilation - perfusion scan was performed on december 14, 2015 and read as low probability for pe (no perfusion defects). To identify the cause of the edema, a transthoracic echocardiography was ordered, which revealed a normal left ventricular ejection fraction with right ventricular dilatation and severely reduced right ventricular function secondary to pulmonary hypertension (a pressure> 50 mm hg is generally accepted as severe and her estimated right ventricular systolic pressure exceeded 65 mm hg). Probnp was also drawn; it was elevated at 3,226.0 pg / ml, indicative of heart failure (5125 nl range). The presence of acute cor pulmonale pointed away from pneumonitis and strongly suggested three rare possibilities: (1) occlusion of the pulmonary vessels from microscopic tumor emboli (also known as pulmonary tumor embolism), leading to pulmonary arterial hypertension (pah); (2) pttm, a related but even rarer pulmonary vasculopathy, associated with adenocarcinomas of the stomach, pancreas, breast, lung, and liver, in which minute tumor emboli in the peripheral pulmonary arteries damage the vascular endothelium, leading to accelerated coagulation and pah, and (3) pulmonary venous occlusive disease, the venous form of pah [19, 20], due to fibrous occlusion of the post - capillary vessels, which may or may not be associated with an autoimmune process (the association is only anecdotal). The pulmonary hypertension was managed with diuretics (furosemide 40 mg i.v . ), bosentan 62.5 mg, and oxygen (2 liters by nasal cannula) as well as intravenous epoprostenol, norepinephrine, and dobutamine; however, no improvement was observed . Since a lung biopsy carried too much risk, the patient was catheterized; pulmonary artery catheter - derived blood samples were negative for the presence of tumor emboli . Blood was also drawn for the measurement of coagulation parameters, since pttm is associated with coagulopathy . The results were as follows: elevated d - dimer (or serum fibrin degradation products) of 1.04 g / ml (normal <0.5 g / ml) and a prolonged prothrombin time of 16.5 s (normal 1114 s). Platelets were never outside of the normal range . The partial thromboplastin time and thrombin time were both prolonged at 67.2 s (normal 2535 s) and 48 s (normal 1420 s), respectively, due to treatment with a heparin gtt for potential venous clots . In the setting of adenocarcinoma, pulmonary hypertension, and a negative ct and ventilation - perfusion scan for pe, pttm is distinct from simple embolic obstruction because it is characterized by (1) the systemic activation of coagulation with the generation of intravascular fibrin and the consumption of procoagulants, leading to a disseminated intravascular coagulation - like picture, present in this case and (2) remodeling of the pulmonary vasculature due to expression of vegf and pdgf from embolic tumor cells (see fig . 2). Based on the proposed involvement of vegf and pdgf in the pathogenesis of pttm, the primary investigator planned to treat the patient with sunitinib, which dually inhibits vegf and pdgf pathways the observations in this case study strongly suggest that pd-1-induced pneumonitis should be a diagnosis of exclusion rather than a diagnosis by default, requiring a thorough work - up to rule out conditions that may mimic it, including pe, atypical pneumonia, pulmonary venous occlusive disease, congestive heart failure, and pttm . In the case of this acutely dyspneic patient, who initially received a pneumonitis by default diagnosis, pttm was only identified when her shortness of breath deteriorated despite treatment with high dose steroids, alerting the principal investigator to the possibility of heart failure, which led to further investigation . The treating oncologist must be alert to the development or presence of pns, defined as a pathology caused by tumor cells, which systematically produce a large amount of hormones, growth factors, cytokines and a variety of specific symptoms . These include: cushing syndrome, carcinoid syndrome, dermatomyositis - polymyositis, myasthenia gravis and syndrome of inappropriate antidiuretic hormone . To this list, we would add pttm, since its pathogenesis is related to the local release of mitogenic factors associated with vascular remodeling and coagulopathy . As a heretofore unrecognized pns, pttm requires background knowledge and a high index of clinical suspicion . In the absence of a biopsy, even though the case under discussion was refractory to standard therapies and the patient died before sunitinib, the multitargeted tyrosine kinase selective for vegf and pdgf receptors, could be started, it is reasonable to assume that early diagnosis and treatment would have resulted in a better outcome . The patient described in this case report has given his informed consent as part of the primetime clinical study (nct02518958). This study protocol has been approved by the walter reed national military medical center institutional review board.

The new global initiative for chronic obstructive lung disease (gold) 2011 system for copd severity assessment added chronic symptoms and exacerbation history to the traditional system of rating the degree of airflow obstruction by spirometry . It has been studied in a variety of research cohorts, but its impact in primary care is uncertain . In this analysis of 445 patients with spirometry proven copd managed in primary care practices from across the us, we find that the new gold system does reclassify substantial proportions of copd patients as compared to just spirometry alone, but how they are reclassified varies greatly by which symptoms questionnaire is chosen . Furthermore, the new reclassifications do not have any better agreement with physician s or patient s own impressions about copd severity than the traditional system . Clinicians and clinical scientists are interested in assessing copd severity to have objective measures of lung impairment, prognostic information, and parameters on which to guide treatment . Traditionally, copd severity has been solely based on the degree of airflow obstruction, in terms of percent of predicted forced expiratory volume in 1 second (fev1), as measured by spirometry . The use of fev1 to classify the severity of copd was used in drs charles fletcher and richard peto s studies of the natural history of copd in the west london cohort of a half - century ago,1 and spirometry - based severity systems have proven to be valid predictors of survival in many copd cohorts worldwide since then.13 traditional systems that use spirometry to describe copd progression, such as that recommended by the gold committee in its original 2001 guidelines, have also been shown in prospective studies to be predictive of a variety of other clinical outcomes including health - related quality of life,4,5 and the risk for episodes of acute deterioration in lung function known as copd exacerbations.6,7 however, traditional spirometry - based copd severity scales capture only one dimension of respiratory impairment, airflow, and neglect the multiple health dimensions negatively impacted by copd, such as chronic symptoms and comorbidities . The correlations between fev1 and most patient - reported clinical outcomes are not very strong, even in prospective studies comparing changes in lung function to symptoms scores or multi - dimensional measures.810 in the average pulmonary clinic, it is not difficult to find patients who have severe copd by spirometry but are minimally symptomatic, while others with only moderate traditional severity classification systems also do not address how to classify the large number of current and ex - smokers with restrictive spirometry characteristics, whose survival prognosis is at least as poor as those with moderate airflow obstruction.11,12 the limits of using spirometry measures to define copd are also highlighted by the persistent debate about the problem of potential over - diagnosis of copd when the traditional definition of obstruction as an fev1/forced vital capacity (fvc) ratio of less than 0.70 is applied to older populations.13 in 2011 the gold committee recommended a new copd assessment system that combines spirometry testing with measures of chronic respiratory symptoms, namely, the copd assessment test (cat) or modified british medical research council dyspnea scale (mmrc),14,15 along with an estimation of the future risk for adverse outcomes, as determined by either the recent history of acute copd exacerbations or the percent of predicted fev1.16 the tiered treatment recommendations that were based on the old spirometry paradigm were also revised to correspond to the new paradigm . The goal of these changes was to improve the clinical assessment and management of copd.17 since the introduction of the new gold assessment system there has been interest in understanding how it compares to the traditional spirometry - based staging system, but most studies to date have been conducted with copd patients recruited from university specialty clinics or research cohorts enrolled in longitudinal studies.1829 very few studies have been based on primary care copd populations.30 understanding how the new gold copd assessment system relates to the older spirometry - based severity system is a practical problem for primary care practitioners (pcps) who need to be able to rate the severity of their patient s lung disease and communicate that to the patient and to other health care providers.31 the primary objective of this analysis is to examine in a primary - care - based cohort how copd patients staged by the traditional gold spirometry - based severity system are reclassified by the new gold 2011 assessment systems . Because the history of exacerbations is an important component of the new gold system, the severity stages and assessment groups are further stratified by exacerbation history . We also examine how old and new classification systems align with patients and their pcps perceptions of copd severity . This was a cross - sectional observational study of 899 copd patients treated in individual primary care practices from across the us . A total of 95 pcps (general internal medicine or family practice) were recruited to participate in the study, and 83 pcps enrolled at least one patient . Their practice characteristics are described in an earlier report.32 investigators identified potential subjects in electronic records using a stratified random sampling approach (ie, selection of each nth patient) to ensure unbiased selection . Patients aged 40 or older with english language ability and documented care for at least 1 year at the pcp s clinic were included in the study . Patients were excluded if they had conditions that contraindicated the forced expiratory maneuver needed for spirometry, or were unable to complete study procedures, or had participated in a clinical trial within the prior 12 months . For this analysis, we only included patients who met the american thoracic society (ats) definition of spirometry proven copd (ie, fev1/fvc ratio <0.70 on tests meeting ats quality standards), and who provided all information needed for gold staging and appropriate self - assessment . Of the 899 enrolled in the study, eight withdrew before completing spirometry testing, leaving 891 who completed the spirometry phase . Of these, only 666 performed spirometry meeting ats quality standards, and provided complete clinical information needed to calculate the new gold stage . Four hundred and fifty - three of these were confirmed to have spirometry confirmed copd, and of these, only 445 properly completed the self - assessment questionnaire, and thus are the cohort included in these analyses . Data collection was performed by investigators during a scheduled office visit . During the visit, physicians recorded the patient s clinical history, spirometry results obtained during the visit, and health care resource utilization in a web - based case report form . Prior to spirometry testing, investigators recorded their global assessment of the patient s copd severity at the time of the study visit on a 5-point scale, ranging from 1 (no clinical symptoms or disease impact) to 5 (very severe). The 5-point scale was intended to correspond to the original gold copd staging system, which ranged from stage 0 for persons with risk factors or symptoms but no airflow obstruction, and stages 14 (mild, moderate, severe, and very severe) for those proven to have airflow obstruction . Patients completed a paper questionnaire to collect standardized assessments including the cat, mmrc, and a general assessment of severity at the time of the study visit on a 5-point scale, ranging from 1 (very mild) to 5 (very severe). Data were collected from february 2012 to november 2012 . This study was approved and overseen by sterling institutional review board (atlanta, georgia), study number 3,872 . Sites were provided an electronic, hand - held, microloop portable spirometer and associated spirometry pc software for the study . Following ats guidelines, relaxed spirometry testing was first used to capture three slow vital capacity results, and then forced spirometry testing was used to capture technically acceptable results for fvc and fev1 . Up to eight efforts were required from each patient to obtain up to three acceptable tests per ats guidelines . All spirometry measurements are reported pre - bronchodilator because it was not feasible to do pre- and post - bronchodilator testing in all clinics . Patients were asked not to use their copd medications on the morning of the test . Predicted values and the percentage of predicted fev1 (% pfev1) were calculated using national health and nutrition examination survey iii reference values.33 prior to patient enrollment, investigators and study site staff completed real - time, study - specific training via an online meeting platform . Training addressed study procedures, including standard ats spirometry procedures and use of the microloop spirometer . Following enrollment of the first three patients at each study site, spirometry results were sent to an independent respiratory therapist experienced and certified in pulmonary function testing for quality control review . Patients were classified into their traditional obstruction severity stage (stages 14, described as mild, moderate, severe, and very severe, respectively) based on their% pfev1 using gold guidelines.16 patients were classified into their new gold mmrc grade (abcd), and their gold cat grade (abcd), by stratifying them by their% pfev1 and their mmrc or cat scores, as per the new gold recommendations . Finally, we also classified patients by their pcps recorded history of exacerbations within the last 12 months . Pcp and patient s self - assessed overall severity ratings were also used for classification . Very few patients were self - described as very mild or physician - described as no clinical symptoms or disease impact, so these were combined with the mild or stage 1 category for all comparisons . Statistical comparisons of continuous variables were made with student s t - tests and analysis of variance, as appropriate . Counts and percentages were compared using chi - square analyses . To compare agreement between perceived severity measures and the spirometry - based severity results, this approach evaluates disagreement between levels of severity and provides a summary result ranging from 0 (no agreement) to 1 (perfect agreement). All analyses utilized a two - sided p of 0.05 for significance and were performed using sas 9.2 . This was a cross - sectional observational study of 899 copd patients treated in individual primary care practices from across the us . A total of 95 pcps (general internal medicine or family practice) were recruited to participate in the study, and 83 pcps enrolled at least one patient . Their practice characteristics are described in an earlier report.32 investigators identified potential subjects in electronic records using a stratified random sampling approach (ie, selection of each nth patient) to ensure unbiased selection . Patients aged 40 or older with english language ability and documented care for at least 1 year at the pcp s clinic were included in the study . Patients were excluded if they had conditions that contraindicated the forced expiratory maneuver needed for spirometry, or were unable to complete study procedures, or had participated in a clinical trial within the prior 12 months . For this analysis, we only included patients who met the american thoracic society (ats) definition of spirometry proven copd (ie, fev1/fvc ratio <0.70 on tests meeting ats quality standards), and who provided all information needed for gold staging and appropriate self - assessment . Of the 899 enrolled in the study, eight withdrew before completing spirometry testing, leaving 891 who completed the spirometry phase . Of these, only 666 performed spirometry meeting ats quality standards, and provided complete clinical information needed to calculate the new gold stage . Four hundred and fifty - three of these were confirmed to have spirometry confirmed copd, and of these, only 445 properly completed the self - assessment questionnaire, and thus are the cohort included in these analyses . Data collection was performed by investigators during a scheduled office visit . During the visit, physicians recorded the patient s clinical history, spirometry results obtained during the visit, and health care resource utilization in a web - based case report form . Prior to spirometry testing, investigators recorded their global assessment of the patient s copd severity at the time of the study visit on a 5-point scale, ranging from 1 (no clinical symptoms or disease impact) to 5 (very severe). The 5-point scale was intended to correspond to the original gold copd staging system, which ranged from stage 0 for persons with risk factors or symptoms but no airflow obstruction, and stages 14 (mild, moderate, severe, and very severe) for those proven to have airflow obstruction . Patients completed a paper questionnaire to collect standardized assessments including the cat, mmrc, and a general assessment of severity at the time of the study visit on a 5-point scale, ranging from 1 (very mild) to 5 (very severe). Data were collected from february 2012 to november 2012 . This study was approved and overseen by sterling institutional review board (atlanta, georgia), study number 3,872 . Sites were provided an electronic, hand - held, microloop portable spirometer and associated spirometry pc software for the study . Following ats guidelines, relaxed spirometry testing was first used to capture three slow vital capacity results, and then forced spirometry testing was used to capture technically acceptable results for fvc and fev1 . Up to eight efforts were required from each patient to obtain up to three acceptable tests per ats guidelines . All spirometry measurements are reported pre - bronchodilator because it was not feasible to do pre- and post - bronchodilator testing in all clinics . Patients were asked not to use their copd medications on the morning of the test . Predicted values and the percentage of predicted fev1 (% pfev1) were calculated using national health and nutrition examination survey iii reference values.33 prior to patient enrollment, investigators and study site staff completed real - time, study - specific training via an online meeting platform . Training addressed study procedures, including standard ats spirometry procedures and use of the microloop spirometer . Following enrollment of the first three patients at each study site, spirometry results were sent to an independent respiratory therapist experienced and certified in pulmonary function testing for quality control review . Patients were classified into their traditional obstruction severity stage (stages 14, described as mild, moderate, severe, and very severe, respectively) based on their% pfev1 using gold guidelines.16 patients were classified into their new gold mmrc grade (abcd), and their gold cat grade (abcd), by stratifying them by their% pfev1 and their mmrc or cat scores, as per the new gold recommendations . Finally, we also classified patients by their pcps recorded history of exacerbations within the last 12 months . Pcp and patient s self - assessed overall severity ratings were also used for classification . Very few patients were self - described as very mild or physician - described as no clinical symptoms or disease impact, so these were combined with the mild or stage 1 category for all comparisons . Statistical comparisons of continuous variables were made with student s t - tests and analysis of variance, as appropriate . Counts and percentages were compared using chi - square analyses . To compare agreement between perceived severity measures and the spirometry - based severity results, a cohen s kappa coefficient was used . This approach evaluates disagreement between levels of severity and provides a summary result ranging from 0 (no agreement) to 1 (perfect agreement). All analyses utilized a two - sided p of 0.05 for significance and were performed using sas 9.2 . The demographic characteristics of the 445 copd patients included in the analysis are presented in table 1 . Most were older (mean age 68 years) and well - established patients of the participating pcp, with a mean attendance in their clinic of 11 years . Most were current (38%) or former smokers (56%), with mean lifetime smoking histories of 39 and 52 pack - years, respectively . Approximately two thirds were overweight or obese, and 95% were being treated for at least one other chronic comorbidity . The majority of patients in this cohort had moderate or severe airflow obstruction according to the traditional spirometry stage system (table 2). Patients self - assessments of their copd severity were poorly congruent with their spirometry - based stage (=0.13), and more were wrong about their severity stage than correct (46% underestimated and 13% overestimated) (figure 1). The pcp s severity ratings were also inconsistent and tended to underestimate their patient s severity; 34% were accurate as compared to the traditional spirometry stage, with 57% underestimated and 9% overestimated, for an overall kappa of 0.11 (figure 2). Agreement between patient and their physician s assessments was also poor, with doctor s impressions tending to be less severe than the patient s (figure 2). Patients were then reclassified by the new gold system using their mmrc or cat scores (table 3). Substantial proportions of patients from the old severity system are reclassified, but how they are reclassified varies greatly by whether the mmrc or cat system is selected . After application of the new gold mmrc system, 48% (n=206) of the patients are re - stratified higher or lower than their spirometry level when distributed into the gold a, b, c, or d groups (table 3). Among persons with mild airflow obstruction (stage 1), 81% are allocated to group a, and the remainder to group b. at the other end of the spectrum, patients with the most severe airflow obstruction (stage 4) tend to be in group d (70% vs 30% in group c). Patients with moderate airflow obstruction (stage 2) are relatively evenly distributed between groups a and b, and patients with severe obstruction (stage 3) are relatively evenly distributed between c and d. therefore, the mmrc system is re - stratifying patients in the middle ranges of airflow obstruction according to their chronic symptoms, while those with the highest and lowest degrees of obstruction tend to stay in the highest (a) and lowest (d) groups . However, the agreement between the gold mmrc level and either the physician s global impression of severity or the patients self - perception of severity is still poor (=0.17 and 0.13, respectively) (figures 1 and 2). After reclassification by the new gold system using the cat scores, 41% (n=179) of patients were re - stratified into a level higher or lower than their spirometry - based severity, but the distributions were much different than the mmrc results (table 3). Among patients with the mildest obstruction (stage 1), only 38% are in group a; among those with moderate obstruction (stage 2), 88% are in group b; and among those with severe obstruction (stage 3), 90% are found in group d; thus the ability of the cat to discriminate patients in the middle ranges of airflow obstruction by their chronic symptoms is very limited . Furthermore, the agreements between gold cat severity level and either physician impression or patient self - assessment are even worse than by spirometry grade alone (=0.07 and 0.09, respectively) (figures 1 and 2). We then stratified the history of exacerbations within the last 12 months by the gold spirometry, gold mmrc, and gold cat systems (table 4). We noted that physicians identified 14.8% of patients as frequent exacerbators (two or more exacerbations requiring steroids in the previous 12 months) while only 13.3% of patients self - reported two or more exacerbations requiring steroids, creating a possible misclassification error due to recall bias if patient history alone is used (data for patient - reported exacerbations not shown). As expected, the incidence of exacerbations within the last year increased with the severity of airflow obstruction (gold fev1 stages 14) (table 4). The percentage of patients who had one exacerbation or frequent exacerbations also increased linearly by gold mmrc group (gold mmrc groups a to d, table 4). Of the 433 patients who were reclassified under gold mmrc, seven of these group a patients and 12 group b patients would be promoted to groups c and d, respectively, because of their high risk for exacerbations . Therefore, after adjusting the copd mmrc system by exacerbation history according to the physician, 33% were in group a, 22% in group b, 19% in group c, and 26% in group d. the exacerbation history by gold cat group did not increase steadily with severity (gold cat groups a to d, table 4). None of the 40 gold cat group a patients were frequent exacerbators, so all would stay in group a. of the 199 patients in gold cat group b, 20 were frequent exacerbators and would therefore be upgraded to group d. therefore, after adjusting the gold cat system by exacerbation history according to the physician, 9% were in group a, 45% in group b, 4% in group c, and 42% in group d. the majority of patients in this cohort had moderate or severe airflow obstruction according to the traditional spirometry stage system (table 2). Patients self - assessments of their copd severity were poorly congruent with their spirometry - based stage (=0.13), and more were wrong about their severity stage than correct (46% underestimated and 13% overestimated) (figure 1). The pcp s severity ratings were also inconsistent and tended to underestimate their patient s severity; 34% were accurate as compared to the traditional spirometry stage, with 57% underestimated and 9% overestimated, for an overall kappa of 0.11 (figure 2). Agreement between patient and their physician s assessments was also poor, with doctor s impressions tending to be less severe than the patient s (figure 2). Patients were then reclassified by the new gold system using their mmrc or cat scores (table 3). Substantial proportions of patients from the old severity system are reclassified, but how they are reclassified varies greatly by whether the mmrc or cat system is selected . After application of the new gold mmrc system, 48% (n=206) of the patients are re - stratified higher or lower than their spirometry level when distributed into the gold a, b, c, or d groups (table 3). Among persons with mild airflow obstruction (stage 1), 81% are allocated to group a, and the remainder to group b. at the other end of the spectrum, patients with the most severe airflow obstruction (stage 4) tend to be in group d (70% vs 30% in group c). Patients with moderate airflow obstruction (stage 2) are relatively evenly distributed between groups a and b, and patients with severe obstruction (stage 3) are relatively evenly distributed between c and d. therefore, the mmrc system is re - stratifying patients in the middle ranges of airflow obstruction according to their chronic symptoms, while those with the highest and lowest degrees of obstruction tend to stay in the highest (a) and lowest (d) groups . However, the agreement between the gold mmrc level and either the physician s global impression of severity or the patients self - perception of severity is still poor (=0.17 and 0.13, respectively) (figures 1 and 2). After reclassification by the new gold system using the cat scores, 41% (n=179) of patients were re - stratified into a level higher or lower than their spirometry - based severity, but the distributions were much different than the mmrc results (table 3). Among patients with the mildest obstruction (stage 1), only 38% are in group a; among those with moderate obstruction (stage 2), 88% are in group b; and among those with severe obstruction (stage 3), 90% are found in group d; thus the ability of the cat to discriminate patients in the middle ranges of airflow obstruction by their chronic symptoms is very limited . Furthermore, the agreements between gold cat severity level and either physician impression or patient self - assessment are even worse than by spirometry grade alone (=0.07 and 0.09, respectively) (figures 1 and 2). We then stratified the history of exacerbations within the last 12 months by the gold spirometry, gold mmrc, and gold cat systems (table 4). We noted that physicians identified 14.8% of patients as frequent exacerbators (two or more exacerbations requiring steroids in the previous 12 months) while only 13.3% of patients self - reported two or more exacerbations requiring steroids, creating a possible misclassification error due to recall bias if patient history alone is used (data for patient - reported exacerbations not shown). As expected, the incidence of exacerbations within the last year increased with the severity of airflow obstruction (gold fev1 stages 14) (table 4). The percentage of patients who had one exacerbation or frequent exacerbations also increased linearly by gold mmrc group (gold mmrc groups a to d, table 4). Of the 433 patients who were reclassified under gold mmrc, seven of these group a patients and 12 group b patients would be promoted to groups c and d, respectively, because of their high risk for exacerbations . Therefore, after adjusting the copd mmrc system by exacerbation history according to the physician, 33% were in group a, 22% in group b, 19% in group c, and 26% in group d. the exacerbation history by gold cat group did not increase steadily with severity (gold cat groups a to d, table 4). None of the 40 gold cat group a patients were frequent exacerbators, so all would stay in group a. of the 199 patients in gold cat group b, 20 were frequent exacerbators and would therefore be upgraded to group d. therefore, after adjusting the gold cat system by exacerbation history according to the physician, 9% were in group a, 45% in group b, 4% in group c, and 42% in group d. the new gold copd assessment system adds chronic respiratory symptoms information and recent exacerbation history to reclassify persons into a two - dimensional matrix that should better characterize the disease impact on chronic symptoms and risk for exacerbations and be a more accurate guide for therapy.16,17 in this study of primary care copd patients, we found as expected that the traditional copd severity system based solely on spirometry did not correlate well with either patient or physician perception of severity, although there was a weak correlation between exacerbation history and degree of airflow obstruction . The new gold system using the mmrc questionnaire does reclassify relatively equal proportions of patients with stage 2 (moderate) and stage 3 (severe) airflow obstruction based on their chronic dyspnea, so it appears to at least have the potential to characterize these patients in a clinically useful way . The history of exacerbations also increases steadily by mmrc level, which helps validate that the system is working as expected . However, the distributions by the cat scores are so heavily skewed toward the b and d groups that only 13% of the cohort are left in either a or c, making it unlikely that the cat questionnaire will add much to the spirometry assessment of any given patient . Adding exacerbation history to either the mmrc or cat stratification reclassifies only an additional 4% of all patients, and the exacerbation histories are variable depending on whether they come from the physician or the patient . Finally, the agreement between physician and patient assessments of copd severity and the gold mmrc and cat levels are not substantially better than those of the traditional spirometry - based system, and may be worse . In summary, the results of reclassifying primary care copd patients by the new gold assessment system varies greatly by whether the cat or mmrc system is chosen, and it is not clear that either adds much practical benefit to the traditional spirometry - based system . A key motivation to move away from the traditional spirometry - only copd assessment was the poor correlation between the degree of airflow obstruction and other clinical outcomes, which made the basis for treatment recommendations unstable.16,17 it was presumed that adding the additional dimensions of chronic respiratory symptoms and exacerbation history would result in a more practical tool that would stratify patients into groups with similar characteristics that merit specific treatments . For example, among patients with increased chronic respiratory symptoms, those with stage 1 or stage 2 airflow obstruction would have indication for use of long - acting bronchodilators, and those with stage 3 or stage 4 airflow obstruction might merit triple therapy (inhaled corticosteroid + long - acting 2-agonist and long - acting anticholinergic). However, if a score of 10 is used as the cut - point for the cat questionnaire, then the effect in a primary care population is to put approximately nine out of ten patients into a more aggressive treatment group, and one might reasonably ask whether it is worth the effort of giving the questionnaire to ten patients to find the one who does not merit additional medication . The mmrc does has the advantage of differentiating the patients with moderate or severe obstruction into more balanced groups, and thus it has the potential of differentiating more patients into clinically relevant treatment groups, but prospective analyses will be needed to confirm this . An interesting finding in this project is that the agreement between patient or physician assessment of copd severity and the objective measures of severity were not improved by the new gold assessment systems . An important feature of qualitative clinical assessment tools is the face validity, which is the transparency or relevance of a test as it appears to participants.34,35 the copd assessment systems that were only based on spirometry were lacking in face validity because too often the measure (mild, moderate, or severe stage) did not correspond well with the patient s experience of symptoms and other disease consequences . If it works as expected, then the face validity of the new gold system should be improved as compared to the spirometry - only system because of the addition of the symptoms questionnaires . Unfortunately, our data suggest that face validity is not substantially improved by the gold mmrc system, and possibly worsened by the gold cat system . Therefore, it is likely that the new gold system will also be limited by one of the main criticisms of the traditional spirometry - based system, that being a poor correlation with clinical perceptions about disease severity and health status . Furthermore, to become practical tools for primary care, severity assessment systems will need to be validated as accurate prognostic measures, such as in their ability to predict morbidity (eg, risk for copd exacerbations) and mortality . Patients were well - established copd patients who had been seeing their pcps an average of 11 years . It is not known whether results would be similar in newly diagnosed copd patients or among patients in other countries . There are also likely to be selection biases based on patients willingness to participate in research that could affect survey responses . We used standardized questionnaires that were administered by staff specifically trained for this study, and it is possible that patients participating in clinical research will behave and answer questions differently than they would in normal clinical conditions . Another limitation is the problem of language how does one define mild, moderate, or severe copd? There are several problems introduced by defining severity by a simple linear 1-to-4 system based on spirometry that are further complicated by converting it to a 2-by-2 matrix that combines spirometry, either the mmrc or the cat score, and exacerbation history . For example, the matrix scheme does not follow the usual progression of disease in that persons in group b (increased chronic symptoms but low risk of future adverse events) are more likely to progress to group d (increased chronic symptoms and future adverse events) than to group c (minimal chronic symptoms but high risk of adverse events). In a study of 6,628 copd patients from the copenhagen heart study, gold mmrc - derived group b patients had significantly worse 3-year all - cause hospitalization rates and survival than group c patients.18 to compare how well the new gold system compares to the traditional gold severity scale in terms of how well it matches patients self - assessments and their physicians global assessment, we have assumed that group b equates to moderate and group c equates to severe, but acknowledge that this is not a very stable assumption . Our results were similar to those found in a study of copd patients derived from general practices from the united kingdom.30 haughney et al performed a retrospective survey of 6,283 copd patients who had fev1 and mmrc data . By the new gold system 36% were a, 19% b, 20% c, and 25% d, as compared to the spirometry grades of 17% stage 1, 52% stage 2, 26% stage 3, and 5% stage 4 . They also found some degree of gradation in exacerbation risk by category, but their system for identifying exacerbations was based on chart review, and direct comparison between their exacerbation data and ours is not feasible from the published data . The studies that have compared gold mmrc and cat classification in non - primary care populations also found wide discrepancies between them.2225,28,29 we found that the new gold copd system reclassifies a substantial number of primary care patients as compared to the traditional spirometry - based severity system, but the reclassification is highly variable depending on whether the mmrc or cat system is chosen . Furthermore, the poor agreement between the patients and physicians global assessments of severity scales even by the gold mmrc system makes it doubtful that this new system is capturing the major determinates that affect their perceptions about their disease progression or current status . It remains to be seen whether the new system improves pcps decisions about treatment or helps patients understand their lung disease.

It is usually the result of leakage from the thoracic duct or one of its main draining lymphatic vessels . The most common causes of chylothorax in children are lymphoma and trauma caused by thoracic surgery . The effusion can be identified by its white and milky appearance which is due to its high levels of triglycerides and lymphocytes . Postoperative chylothorax occurs in less than 1% of thoracic procedures with a prevalence ranging from 0.5% to 2% . Postoperative chylothorax is a serious complication with a high mortality, which can approach 50% in untreated patients . It causes nutritional deficiencies, respiratory dysfunction, dehydration, immunosuppression, and increased vulnerability to infections . The initial management consists of indwelling pleural drainage and feeding with a milk formula rich in medium chain triglyceride (mct) along with total parenteral nutrition if required . In resistant cases, ligation of thoracic duct or placement of pleuroperitoneal shunts may be considered . Somatostatin, or its analog octeriotide, has recently been used with success in a number of pediatric cases of postoperative and iatrogenic chylothorax . In pediatric patients the reported effective doses of intravenous somatostatin ranges from 3.5 to 12 mcg / kg / h . We report two cases of successful management of postoperative chylothorax, following surgery for congenital diaphragmatic hernia, both in full - term newborn babies, using an escalating regimen of octeriotide infusion . A term female 3.5-kg infant, diagnosed with left diaphragmatic hernia on antenatal ultrasound scan done at 19 week of gestation, was born by spontaneous vaginal delivery in a very good condition . She was electively intubated and stabilized for surgical repair of diaphragmatic hernia which was done uneventfully on third day of life [figures 1 and 2]. During surgery left diaphragm was found to be very vascular, which is a known risk factor for postoperative chylothorax . She developed left pleural effusion on third postoperative day requiring ongoing ventilation and an indwelling chest drain . The amount of fluid drained was high (130 ml / day).the initial pleural fluid was serosanguinous with a protein content of 26 g / dl and normal triglyceride level (during this time the baby was only on tpn with no oral feeds). The oral feeds were gradually built up over the next 8 days . By the age of 13 days the pleural fluid developed classic consistency of chylothorax: milky appearance with high lymphocyte and triglyceride (protein 28 g / dl and wbc 8000 with 98% lymphocyte). The condition was initially managed with enteral feeding with medium chain triglyceride formula (monogen) and total parenteral nutrition . There was no reduction in the amount of chylothorax drainage over a period of 1 week (day 20 of life) [figure 3]. On day 21 of life intravenous octeriotide infusion was started at a dose of 3 mcg / kg / hr . The enteral feeds were stopped because of reports of high risk of necrotizing enterocolitis with octeriotide infusion . The dose of octeriotide was gradually increased by 1 mcg / kg / hr everyday till we reached a dose of 9 mcg / kg / hour after 8 days . There was a sudden drop in the chylothorax output once the dose octeriotide dose reached 9 mcg / kg / hr . The infusion was maintained at the same level (9 mcg / kg / hr) for 11 days . During this period, the chyle drainage per 24 hours reduced gradually to a minimal amount with significant response noted 2 days after reaching 216 mcg / kg / day (9 mcg / kg / hr). The infant was extubated successfully to nasal cannula and then to room air within 3 days after administration of octeriotide infusion (day 20 postsurgical repair). This resulted in transient increase in chylothorax drain which resolved spontaneously [figure 4]. The octeriotide infusion was weaned over 5 days by decreasing the dose at a rate of 2 mcg / kg / hr everyday till the infusion was discontinued . During octeriotide therapy the baby was monitored closely, on daily basis, for any evidence of glucose intolerance, liver and renal impairment . No side effects were noted . Left diaphragmatic hernia before surgery chest x - ray of our patient immediately after surgery left chylothorax with chest tube drainage chylothorax drainage (pink line), octeriotide dose mcg / kg / hr (blue line), gray zone reflect days of enteral feed, white zone reflects days of exclusive tpn with no oral feeds the infant was discharged home self - ventilating in room air after 1 week on monogen formula . Medium chain triglyceride (mct) oil and oral polycose were added to the feed to increase her caloric intake and promote weight gain . On postdischarge follow - up in neonatal and dietetic clinics she had symptomatic of massive gastroesophageal reflux which required antireflux medication . A term male 3.5 kg infant was born by spontaneous vaginal delivery in a good condition . The chest drain placed during surgery - drained blood - stained fluid which decreased gradually and chest tube was removed on 7 post - op day . Oral feeding with breast milk was started on 9 post - op day . The next day baby developed respiratory distress requiring reintubation and ventilation . The initial pleural fluid was serosanguinous with a protein of 26 g / dl and normal triglyceride level . During this time the baby was only on tpn with expressed breast milk feeds . Over the next few days the contents became typical of chylothorax with triglyceride level of 4 mmol / l and lymphocytes count of> 91% . Management with formula feed containing medium chain triglycerides (monogen) and total parenteral nutrition did not reduce the amount of chylothorax drainage . 1 mcg / kg / hr everyday till we reached 10 mcg / kg / hr on post - op day 24 [figure 5]. A dramatic response in terms of reduction of pleural drainage was noted once a dose of 10 mcg / kg / hr was reached . The baby was extubated successfully to nasal cannula and then room air within 3 days . The octeriotide infusion was kept at the same dose (10 mcg / kg / hr) for 5 days and then gradually reduced at a rate of 2 mcg / kg / hr every day over the next 5 days . Within three days the baby was discharged home self - ventilating in room air and on full enteral feeding with monogen formula . During the phase of high pleural drainage the baby was also supported with i.v . The baby was monitored closely for any evidence of glucose intolerance, liver and renal impairment . A term female 3.5-kg infant, diagnosed with left diaphragmatic hernia on antenatal ultrasound scan done at 19 week of gestation, was born by spontaneous vaginal delivery in a very good condition . She was electively intubated and stabilized for surgical repair of diaphragmatic hernia which was done uneventfully on third day of life [figures 1 and 2]. During surgery left diaphragm was found to be very vascular, which is a known risk factor for postoperative chylothorax . She developed left pleural effusion on third postoperative day requiring ongoing ventilation and an indwelling chest drain . The amount of fluid drained was high (130 ml / day).the initial pleural fluid was serosanguinous with a protein content of 26 g / dl and normal triglyceride level (during this time the baby was only on tpn with no oral feeds). The oral feeds were gradually built up over the next 8 days . By the age of 13 days the pleural fluid developed classic consistency of chylothorax: milky appearance with high lymphocyte and triglyceride (protein 28 g / dl and wbc 8000 with 98% lymphocyte). The condition was initially managed with enteral feeding with medium chain triglyceride formula (monogen) and total parenteral nutrition . There was no reduction in the amount of chylothorax drainage over a period of 1 week (day 20 of life) [figure 3]. On day 21 of life intravenous octeriotide infusion was started at a dose of 3 mcg / kg / hr . The enteral feeds were stopped because of reports of high risk of necrotizing enterocolitis with octeriotide infusion . The dose of octeriotide was gradually increased by 1 mcg / kg / hr everyday till we reached a dose of 9 mcg / kg / hour after 8 days . There was a sudden drop in the chylothorax output once the dose octeriotide dose reached 9 mcg / kg / hr . The infusion was maintained at the same level (9 mcg / kg / hr) for 11 days . During this period, the chyle drainage per 24 hours reduced gradually to a minimal amount with significant response noted 2 days after reaching 216 mcg / kg / day (9 mcg / kg / hr). The infant was extubated successfully to nasal cannula and then to room air within 3 days after administration of octeriotide infusion (day 20 postsurgical repair). This resulted in transient increase in chylothorax drain which resolved spontaneously [figure 4]. The octeriotide infusion was weaned over 5 days by decreasing the dose at a rate of 2 mcg / kg / hr everyday till the infusion was discontinued . During octeriotide therapy the baby was monitored closely, on daily basis, for any evidence of glucose intolerance, liver and renal impairment . No side effects were noted . Left diaphragmatic hernia before surgery chest x - ray of our patient immediately after surgery left chylothorax with chest tube drainage chylothorax drainage (pink line), octeriotide dose mcg / kg / hr (blue line), gray zone reflect days of enteral feed, white zone reflects days of exclusive tpn with no oral feeds the infant was discharged home self - ventilating in room air after 1 week on monogen formula . Medium chain triglyceride (mct) oil and oral polycose were added to the feed to increase her caloric intake and promote weight gain . On postdischarge follow - up in neonatal and dietetic clinics she had symptomatic of massive gastroesophageal reflux which required antireflux medication . A term male 3.5 kg infant was born by spontaneous vaginal delivery in a good condition . The chest drain placed during surgery - drained blood - stained fluid which decreased gradually and chest tube was removed on 7 post - op day . The initial pleural fluid was serosanguinous with a protein of 26 g / dl and normal triglyceride level . During this time the baby was only on tpn with expressed breast milk feeds . Over the next few days the contents became typical of chylothorax with triglyceride level of 4 mmol / l and lymphocytes count of> 91% . Management with formula feed containing medium chain triglycerides (monogen) and total parenteral nutrition did not reduce the amount of chylothorax drainage . Octeriotide infusion was started at 2 mcg / kg / hr and increased gradually by 1 mcg / kg / hr everyday till we reached 10 mcg / kg / hr on post - op day 24 [figure 5]. A dramatic response in terms of reduction of pleural drainage the baby was extubated successfully to nasal cannula and then room air within 3 days . The octeriotide infusion was kept at the same dose (10 mcg / kg / hr) for 5 days and then gradually reduced at a rate of 2 mcg / kg / hr every day over the next 5 days . Within three days the baby was discharged home self - ventilating in room air and on full enteral feeding with monogen formula . During the phase of high pleural drainage the baby was also supported with i.v . The baby was monitored closely for any evidence of glucose intolerance, liver and renal impairment . Chylothorax may occur spontaneously in the neonatal population e.g., due to abnormal congenital lymphatic malformations or in the postoperative setting after thoracic duct injury or disruption of lymphatic channels . The incidence of chylothorax following surgery for congenital diaphragmatic hernia ranges from 7 to 28% . A number of therapeutic interventions have been used to reduce chyle production and promote resolution of chylothorax . Milk feeds, high in medium - chain triglycerides (mct), or parenteral nutrition may be used . Mct is transported directly into the portal system, bypassing the lymphatic pathways, thus diminishing lymphatic flow through the thoracic duct . Mct formulas have been shown to produce resolution of chylothorax in approximately one - third of patients after two weeks, while parenteral nutrition typically results in resolution in 75 - 80% of cases by that time . In resistant cases, pleurodesis, ligation of thoracic duct, or placement of drains and pleuroperitoneal shunts may be considered . However, the failure rate with these options is high and only pleurodesis works in severe cases . Recently, octreotide has emerged as an alternative option for management of patients with chylothorax resistant to conventional therapies ., it is a potent inhibitor of growth hormone, glucagon, insulin and thyroid stimulating hormone . Moreover, by increasing splanchnic arteriolar resistance and decreasing gastrointestinal blood flow, octeriotide indirectly reduces lymphatic duct flow . Some authors have mentioned another mechanism: octeriotide blocks pancreatic and biliary secretion by inhibition of serotonin and other gastrointestinal peptides . Potential adverse effects of octeriotide therapy are bradycardia, stomachache, headache, hypo or hyperglycemia, hypothyroidism, nausea and vomiting . One published report mentions an association between the use of octeriotide and necrotizing enterocolitis in a baby who had postoperative chylothorax . Although infusions of octreotide appear physically stable when mixed with parenteral nutrition solutions, the mixture may result in the formation of a glycosyl octreotide conjugate, resulting in reduced efficacy . Combined tpn and octeriotide increase the speed of chylothorax resolution in children and avoid later surgical intervention, which can have up to 10% perioperative mortality rate . It is almost always used as a second line therapy following failure of initial management with no oral feeds, tpn and or mct feeds . There is significant heterogeneity in dosing regimens, therapeutic duration, and time to start octeriotide . Most authors began treatment with a lower dose and progressively raised it to achieve a response . The exact maximum dose at which significant reduction of chylous drainage can be achieved has been variable . In our two cases, we started octeriotide infusion at a rate of 2 mcg / kg / hr which was gradually increased by 1 mcg / kg / hr every day till we reached a maximum dose of 10 mcg / kg / hr . After being at this dose for 48 hours, we observed a dramatic reduction of chylous drainage which kept on decreasing gradually over the next few days . Similarly there is no established protocol for weaning the octeriotide infusion once chylothorax has resolved . In our two cases we weaned octeriotide by reducing the infusion at a rate 2 mcg / kg / hr every day . We reviewed the literature to find out the most effective dose or regimen of octeriotide infusion in the management of chylothorax following repair of congenital diaphragmatic hernia . The results, as expected, were very variable . Based on these studies we constructed table 1 which shows a summary of therapeutic regimens of octeriotide in postoperative chylothorax following surgery for congenital diaphragmatic hernia . The chyle drainage was significantly reduced within 48 - 72 hours once a maximum dose was reached . Previously published studies on the use of octeriotide in postoperative chylothorax following repair of diaphragmatic hernia octeriotide is a relatively safe second line therapy in the management of chylothorax secondary to surgery for congenital diaphragmatic hernia . A trial of octeriotide therapy can prevent potential permanent surgical procedures like pleurodesis or pleuroperitoneal shunts.

Thirty patients with zygomatic complex fractures were treated with one point fixation [figures 13]. Preoperative peripheral nerve stimulation x - ray preoperative computed tomography scan under general anesthesia, nasoendotracheal intubation was done . The incision can be made from anterior to posterior or from medial to lateral and should extend through mucosa, submucosa, and any buccinators muscle fibers [figure 4]. Rowe's zygomatic elevator was then inserted behind the infra temporal surface of the zygoma, and bone was reduced into its correct anatomical position using superior, lateral and anterior force . An audible click and fullness of the cheek together with palpation for normal contour of the zygomatic bone and orbital rim gave an idea about the adequacy of the reduction . One hand over the side of the face was used to assist in the reduction . A four hole plate with a gap was fixed with 4 mm 2.5 mm screws on the zygomatic buttress [figure 5]. Immediate post operative immediate peripheral nerve stimulation x - ray six months postoperative and peripheral nerve stimulation x - ray for all the patients, immediate postoperative and 6 months postoperative peripheral nerve stimulation x - rays were taken, and the x - rays review successful reduction . None of the patients complained of any paresthesia, bony movements or pain in the frontozygomatic or zygomatic buttress region . Since intraoral approach was used, all the patients had an aesthetic facial profile without any unsightly scars . The integrity of the zygoma bone is critical in maintaining normal facial width and prominence of the cheek . The zygomatic bone is a major contributor to the orbit and plays an important role in protecting the eyes . Zygomatic bone alone is rarely involved in fractures; usually its articulating surfaces which are maxilla, temporal, frontal and sphenoid bones are also involved . The fractured fragments of a tripod or tetrapod zygomatic complex fracture near these suture lines needs to be restabilized by open reduction followed by fixation . Studies suggest that two point gives a considerable stabilization, and three point fixation gives the maximum stabilization . However other studies suggest that one point fixation for zymatic complex fractures gives an excellent results considering the esthetics and stabilization for simple tripod fractures without any comminution of the zygomatic bone or the lateral orbital wall one point fixation with a single mini plate in the frontozygomatic area through the lateral eyebrow incision have been suggested by many authors . I n these cases it was found that when a tripod fracture without any comminution or mild or no displacement can be stabilized very well with a single point fixation in the frontozygomatic area without any complications of diplopia or enopthalmos . However, zygoma provides the attachment point for muscles of mastication and facial animation, but amongst these, it is the masseter that provides the most significant intrinsic deforming force on the zygomatic body and arch . The integrity of zygomatic buttress is necessary for withstanding the contraction force of the masseter muscle . In 2002 fujioka et al . In vivo studies successfully proved that one point fixation at the zygomaticomaxillary complex gives three point alignment and sufficient rigidity when the fractures are not comminuted . In 2011 kim et al . Found out that lateral eyebrow incision for mini plate fixation at the frontozygomatic area led to unaesthetic scar and few patients underwent plate removal through a second surgical re - entry through the existing scar of the lateral eyebrow incision which further enhanced the unsightly scars and compromised facial esthetics . Since the skin over the lateral eyebrow region is thin there are more chances of palapation of the mini plates after fixation, and it may lead to pain . As early as in 1994 tarabichi et al . Proved that in vitro studies are misleading regarding the mini plate fixation along the orbital margins and successfully applied transsinus reduction through anterior comminuted sinus wall . In 2012 kim et al . Successfully reduced the zygomatic complex fractured fragments through intraoral approach and gained sufficient rigidity and excellent esthetics with one point fixation at the zygomatic buttress region . We also found that one point fixation with a single mini plate at the zygomatic buttress through intraoral incision provided excellent stability and esthetics in the selected cases of simple zygomatic complex fractures without any comminution of the zygoma or the lateral orbital rim without or with minimal displacement and none of our patient complained of pain or palpation or bony movements in the postoperative study period of 6 months rather they were happy to get operated without any unaesthetic facial scars.

Sotos syndrome is a dysmorphic syndrome characterized by early overgrowth, developmental delay, advanced bone age and characteristic craniofacial appearance . Sotos syndrome results from mutation involving the nuclear receptor set - domain - containing protein (nsd1) gene, located on chromosome 5q . The mutational mechanism can be a point mutation in the nsd1 gene or a microdeletion that includes nsd1 . Fluorescence in situ hybridization (fish) did not detect microdeletion of 5q35 in this patient . Nsd1 gene mutations are also found in weaver syndrome where camptodactyly is a common feature . This report describes camptodactyly for the first time in a girl with sotos syndrome and provides further evidence that sotos and weaver syndrome are allelic disorders . We describe a two and half years old girl born of non - consanguineous tamilian parents . Milestones were delayed with head holding at 6 months, walking at 2 years and delayed speech . Family history was unremarkable . At two and a half years she weighed 15 kg, height was 97 cm and head circumference was 52.5 cm (all above 90 centile). She had a high forehead with frontal bossing, dolichocephaly, large ears, pre - auricular pits, down - slanting palpebral fissures, high arched palate, pointed chin and pectus carinatum [figure 1]. She had three caf au lait spots distributed on the chest and trunk, large hands and camptodactyly of the left hand [figure 2]. Fish studies carried out using probe rp11 - 265k23 did not reveal a microdeletion of the 5q35 region . Face showing the facial features of sotos syndrome left hand showing camptodactly a clinical diagnosis of sotos syndrome was made based on the criteria comprising of rapid early growth, advanced bone age, developmental delay and characteristic facial appearance . Camptodactyly in sotos syndrome has not been previously described in literature to the best of our knowledge . A high frequency of congenital heart defects has been reported in patients with intragenic mutations of the nsd1 gene and phenotypic overlap with other overgrowth syndromes, in particular with weaver syndrome is seen . Though this sotos patient is likely to have a point mutation of the nsd1 gene, this could not be confirmed due to lack of facilities . Sotos syndrome was first recognized as a distinct clinical syndrome in new england in 1964 . The diagnosis is based on the clinical criteria of rapid early growth (pre and post natal), advanced bone age, developmental delay and characteristic facial appearance . Growth is rapid in the first years of life but final height may not be excessive . Intellectually, the iq ranges from 21 to 103 with a mean of 74 and almost half of affected children achieve normal schooling . Behavioral issues are common and are one of the key areas that can influence the outcome . Hypotonia is usually present from birth and although this improves during childhood, subtle evidence may remain even in adults . Congenital heart disease is not very common in this condition and overall incidence of cardiac defects is approximately 8% . An association of sotos syndrome with tumor development was documented over 30 years ago and has been a point of debate ever since . Gorlin et al . Estimated a risk of 3.9% of benign or malignant tumors in sotos syndrome . Handicaps in sotos syndrome are fewer than previously believed and tend to improve with age . In patients with sotos syndrome harboring a chromosomal translocation kurotaki et al . Isolated the nuclear receptor set - domain - containing protein (nsd1) gene from the 5q35 breakpoint . Added noted a large difference between japanese and non - japanese patients in the frequency of microdeletions, which occurred in 49 (52%) of the 95 japanese but in only 1 (6%) of the 17 non - japanese . There was a strong correlation between presence of an nsd1 alteration and clinical phenotype, in that 28 of 37 (76%) patients with typical sotos or sotos - like phenotype had nsd1 mutations or deletions . Studied nsd1 gene in a series of typical sotos patients (23/39), sotos - like patients (lacking one major criteria, 10/39) and weaver patients (6/39). They conclude that nsd1 mutations account for most cases of sotos syndrome and a significant number of weaver syndrome cases . Comparing the clinical phenotype of children carrying either a deletion or a mutation, rio et al . Failed to detect distinctive features except for the severity of mental retardation . They reported, 4/6 children carrying a nsd1 deletion were extremely severely mentally retarded with no language at all, major delay in motor milestones and autistic features . By contrast, in patients carrying nsd1 mutations, mental retardation was usually mild to moderate with verbal skills being more affected . The major differential diagnoses for sotos syndrome are other conditions with overgrowth including beckwith - weidemann, weaver, nevo and simpson golabi behmel syndromes . . However nsd1 gene mutations have been found in beckwith - weidemann syndrome, weaver syndrome and the 11p15 abnormalities seen in beckwith - wiedemann syndrome have been found in some cases of sotos syndrome . Camptodactly has not been previously described in literature to the best of our knowledge with sotos syndrome but is seen in weaver syndrome where nsd1 mutations have been described . These could be due to, allelic heterogeneity, effect of other modifying genes ethnic background and nutritional status adding to the overall expression of a syndrome . Microdeletions of chromosome 5 were not detected in our case suggesting a likely point mutation in the nsd1 gene and further evidence of that weaver and sotos syndrome are allelic . Further delineation of the phenotype with molecular studies will provide correct genotype - phenotype correlations.

In march 2013, cases infected with a novel reassortant avian - origin influenza a (h7n9) virus emerged in china and had high mortality . That month, a patient with h7n9 influenza was admitted to our hospital, and daily lung ultrasound was performed . A 54-year - old woman, who ran a convenience store beside a poultry market, complained of cough and high fever for 4 days . Her temperature was 38.6c, and she had a heart rate of 113 beats per minute and a respiratory rate of 26 breaths per minute . Her white blood cell count was 2.7 10/l, and neutrophil, lymphocyte, and monocyte levels were 72.4%, 22%, and 5.2%, respectively . Her partial pressure of oxygen in arterial blood was 72 mm hg, and her fraction of inspiratory oxygen (fio2) was 40% . Avian - origin influenza a (h7n9) virus was confirmed from the pharyngeal swabs by real - time reverse transcriptase - polymerase chain reaction . Treatment with oseltamivir (150-mg capsule taken by mouth twice a day) was initiated, and she was admitted to an isolated room in the infectious diseases department . Bothell, wa, usa) with c60 convex probe (2 to 5 mhz) was performed, and the lung ultrasound score (lus) was recorded, and both effectively reflected the progression of pneumonia (figure 1). Dynamic changes of chest computed tomography (ct), radiography, and lung ultrasound in a patient with h7n9 influenza . (a - c) ct showed pneumonia in the left upper lung, with partial consolidation on admission . (d - f) lung ultrasound corresponding to ct in (a - c) showed multiple abutting b2 lines, and some regions presented a tissue pattern (arrow). (g - i) ct on day 6 after admission showed that the pneumonia was partially absorbed . (j - l) lung ultrasound corresponding to ct in (g - i) showed that the number of b lines was obviously decreased, and the consolidation disappeared . (m - o) ct on day 9 after admission showed that the size of the lesion was obviously reduced . (p - r) lung ultrasound corresponding to ct in (m - o) indicated that only the a line and few b lines were visible . (s - u) chest radiography on days 1, 3, and 6 after admission showed no obvious change of the pneumonia . (v) dynamic changes of lung ultrasound score (lus) (total of 48 for normal lung). The onset of h7n9 influenza in this case was manifested by hyperpyrexia and flu - like symptoms and progressed to lobar pneumonia 4 days later . Chest radiograph is the routine tool for assessment of pneumonia, but its sensitivity and accuracy were not so good . Ct is regarded as the gold standard, but its application is limited in cases with this new emerging virus since strict protection should be followed to avoid person - to - person transmission . Ultrasound has many advantages, including convenience, rapidness, non - invasiveness, availability for repeated examination, and absence of radiation . The right lung presented an a line with few isolated b lines, whereas the left lung presented multiple abutting b lines and consolidation . When the patient improved, both b lines and the area of consolidation were decreased and the lus was synchronously increased . This case highlights that ultrasound can be an adjutant to chest radiography and ct in caring for patients with h7n9 influenza . Written informed consent was obtained from the patient for publication of this letter and accompanying images.

The need for categorization of anomalies and congenital aberrancies formed due to developmental vascular defects produce identifiable birthmarks of the skin and mucosa and a variable degree of underlying soft tissue abnormalities . Presently a surge in the knowledge of criterias to classify these various anomalies has put forth classifications purely with respect to histopathological features of the disease . These lesions predominantly occur within the head and neck and affect approximately 1 in 22 children . Involvement of the oral cavity is common but frequently requires unconventional treatment strategies for its management . Though previously termed angiomas or vascular birthmarks, vascular anomalies are divided into two main categories: vascular tumors and vascular malformations . Infantile hemangiomas comprise the majority of vascular anomalies and are considered the predominant vascular tumor type composed of rapidly proliferating endothelial cells . Blood vessel architecture is incomplete and surrounded by hyperplastic cells in hemangiomas and other vascular tumors . In contrast, vascular malformations do not contain hyperplastic cells but consist of progressively enlarging aberrant and ectatic vessels composed of a particular vascular architecture such as veins, lymphatic vessels, venules, capillaries, arteries or mixed vessel type . The latter comprises lymphangiomas or lymphatic malformations which are congenital collections of ectatic lymph vessels that form endothelial lined cystic spaces . The pathogenesis of these tumors could be of importance in thoroughly understanding the mode of these varying histopathological presentations . They represent about 6% of the total number of benign tumors of the soft tissue in patients aged less than 20 years . Regarding gender distribution of lymphangioma, it is equally divided between males and females, with about 50% of the lesions being noted at birth and 90% developing by 2 years of age . Oral lesions may occur at various sites but they form most frequently on the anterior two thirds of tongue . They may increase in size, producing macroglossia which may lead to difficulties in mastication, deglutition, and speech; and displacement of the teeth, with a resulting malocclusion . They may interfere with normal breathing, particularly during sleep, produce sleep apnea, and in certain instances, produce a life - threatening upper airway compromise . They can also be present in the palate, buccal mucosa, gingiva and lip . The tumor is superficial in location and demonstrates a white pebbly surface that resembles a cluster of translucent vesicles . The deeper lesions could mimic various soft tissue tumors since the color which is classically used for diagnosing such tumors would seem to be irrelevant . They appear as a nodule or masses without significant change in surface texture or color . A 9-year - old female patient reported to the department of oral & maxillofacial pathology, i.t.s cdsr, with a complaint of a painless growth with respect to left side of tongue . Patient had given a history of trauma due to tongue bite around 3 months back and was enlarging slowly in size the swelling was initially small, peanut sized, which increased to the present size . On examination of the swelling a growth of 2 1 cm on the anterior part of the dorsal surface of tongue . The lesion was pale pink in color and oval in shape with well - defined margins [figure 1]. Intraoral photograph showing nodular swelling resembling cluster of vesicles on the left side of dorsum of tongue an incisional biopsy was performed and the tissue was histopathologically diagnosed as lymphangioma, since large lymphatic vessels lined by flattened endothelial cells pushing into the overlying epithelium were seen [figure 2]. Patient was recalled after 4 days and a total excision of the lesion was performed under local anesthesia (la). Photomicrograph of incisional biopsy showing large lymphatic vessels (h and e, 10) examination of gross macroscopic appearance revealed the excised tissue to be oval shaped, measuring 1.5 1 cm in size and was creamish brown in color with a pebbly surface . Microscopic examination of the excised lesion showed numerous large, dilated lymphatic channels of irregular shape, lined by flattened endothelial cells, of which some of the vessels were filled with lymph . Numerous large- to medium - sized channels with thin endothelial lining, engorged with rbcs, were also present in the deeper area of the connective tissue [figure 3, inset]. Lymphangioma was first described by virchow in 1854, and in 1872, krester hypothesized that hygromas were derived from lymphatic tissue . The origin of lesion is considered to be congenital abnormality of lymphatic system rather than true neoplasm . A portion of the jugular lymphatic sac is thought to sequestrate from the primary sacs during fetal development with failure to establish communications with other lymphatic system . The fact that most lymphangiomas manifest clinically during early childhood and develop in areas where the primitive lymph sacs occur (neck, axilla) provides presumptive evidence for this hypothesis . On the contrary, it is argued that instead of being a congenital malformation, lymphangioma is a true neoplasm resulting from transformed lymphatic endothelial cells and/or stromal cells . The classic sequence of events in embryology and development of vasculogenesis falls into three stages: the undifferentiated capillary network stage, the retiform developmental stage and the final developmental stage . The first theory is that the lymphatic system develops from five primitive sacs arising from venous system . Concerning the head and neck, endothelial outpouchings from the jugular sacs spread centrifugally to form the lymphatic systems . Another theory proposes that the lymphatic system develops from mesenchymal clefts in the venous plexus reticulum and spreads centripetally toward the jugular sacs . Several studies have been published regarding possible lymphangiogenic growth factor involvement in the etiology of lymphatic malformations . These factors include vascular endothelial growth factor (vegf)-c, vascular endothelial growth factor receptor 3 (vegfr-3), and transcription factor prox-1 . Vegf - c and vegfr-3 have been shown to be upregulated in lymphatic malformed tissue, and both are involved in lymphatic tissue proliferation . The tumor may be localized in a small area of tongue or floor of mouth or it may diffusely infiltrate these areas . If the tumor is located in a deeper area, it may present as submucosal mass . Cervical lesions in a child cause dysphagia and airway obstruction which is rare in adults . The misunderstanding on the nosologic distinction between oral hemangiomas and vascular malformations leads to diagnostic mistakes . Hemangiomas are differentiated from vascular malformations by their clinical appearance, histopathological features, and biologic features . The natural history of hemangiomas involves rapid proliferations for the first several months of life with subsequent spontaneous regression . Vascular malformations are often recognized at birth and grow proportionately with the child, with many becoming more prominent at puberty . Histologically, hemangiomas in the proliferating phase show endothelial hyperplasia and large number of mast cells . In contrast, vascular malformations show normal number of mast cells, and consist of mature, often combined, capillary, arterial, venous, and lymphatic elements . Lymphatic malformations / lymphangiomas are classified microscopically into four categories: lymphangioma simplex (lymphangioma circumscriptum) composed of small, thin - walled lymphatics; cavernous lymphangioma comprising dilated lymphatic vessels with surrounding adventitia; cystic lymphangioma (cystic hygroma) consisting of huge, macroscopic lymphatic spaces with surrounding fibrovascular tissues and smooth muscle; and benign lymphangioendothelioma (acquired progressive lymphangioma), in which lymphatic channel dissects through dense collagen bundles . Occasionally, channels may be filled with blood, a mixed hemangiolymphangioma, an uncommon developmental anomaly with a propensity to invade underlying tissues and to recur locally, distinguishing it from the simple lymphangioma or hemangioma . Although histologically it is a benign disorder, local invasion into the muscle, bone, and underlying tissue can lead to severe deformity . In the present case, numerous large - sized lymphatic channels along with medium- to large - sized channels entrapped with rbcs, lined by endothelium, were seen and hence it was subcategorized as hemangiolymphangioma . We reviewed the archival cases of lymphatic malformations in our department, the demographical information, location and histopathological features of which are shown in table 1 . The only significant difference in the three archival cases and the present case was in the histopathological features of lymphangioma and hemangiolymphangioma . The demographic information, location and histopathological features these anomalies present the necessity for sound discretion with regards to their approach therapeutically.although spontaneous regression of lesions is rarely encountered, the treatment seems to weigh heavily on individual assessments of the observer . Sclerosing agents are ineffective, probably as a result of the discontinuous basement membrane of the lymphatic vessels . Nd - yag laser surgery has been widely preferred because of its advantages of less bleeding and edema . Due to a rate of recurrence of nearly 21%, long - term follow - up is essential of these tumorigenic anomalies . The vascular lesions consist of both blood vessels and lymphatic vessels . Whether these can be termed as hemangiolymphangioma or just vascular malformation is still confusing . Thus through the present article we would like to highlight the complexities which can arise from the terminal categorization of the large group of tumors called vascular neoplasms when based on their histopathological representation . Further detailed analysis of a larger case series would be imperative in the correct classification and diagnosis which could enormously help to accurately ascertain prognosis and direct treatment.

Study population and sampling - this study was conducted between august - december 2011 and the women were recruited from central laboratory municipal campo grande, state of mato grosso do sul, brazil, when they were forwarded to gynaecological exams in the public health system . Women were eligible to participate if they were 18 years of age and had not undergone a hysterectomy . A total of 171 women provided written informed consent and completed the questionnaire at the time of enrollment . Participating women underwent two interventions for hpv dna detection: with verbal and diagrammatic instruction, they self - collected a vaginal specimen; afterward, a health professional used a speculum and collected an endocervical specimen . Dna isolation and hpv testing - the endocervical and vaginal dna were extracted using a wizard genomic dna purification kit (promega, corporation, madison, wi, usa). Hpv dna detection was performed by polymerase chain reaction (pcr) amplification with the use of the pgmy09/11 primers (gravitt et al . Samples that amplified the pgmy09/11 primers were genotyped by type - specific pcr using primers for high - risk hpv (hr - hpv), hpv16, 18, 31, 33, 45 (guo et al . 2007) and low - risk hpv (lr - hpv), hpv6, 11 (silva et al . 2003). The pcr products were analysed using 1.5% agarose gel electrophoresis with ethidium bromide staining to visualise the dna under ultraviolet light . Statistical analysis - agreement between the self and clinician - collected samples was measured using kappa () statistics . The chi - square test was used to analyse frequency data obtained on the questionnaire . Of the samples collected from the 170 participants, only one was excluded because -globin could not be amplified . A total of 30% (51/170) of the samples were hpv dna - positive . The women in this study were 18 - 65 years of age (median, 35 years), while the average age at first sexual intercourse was 17 years (range, 11 - 30 years). We found a lower frequency of hpv infection in women 30 years (p = 0.009). Hpv tests results showed that there was 84.6% concordance between the self and clinician - collected samples (= 0.72), which indicates good agreement . Six women tested hpv - positive on clinician - collected samples, but hpv - negative on self - collected samples . Twelve women tested hpv - positive on self - collected samples (table i). Hpv of any type was detected in 22.9% (39/170) of the clinician - collected samples and 26.5% (45/170) of the self - collected samples . Table i concordance between human papillomavirus (hpv) dna detected by self and clinician - collected clinician - collectedself - collected n (%) total n (%) kappaconcordance (%) negativepositive negative119 (70)12 (7.1)131 (77.1)--positive6 (3.5)33 (19.4)39 (22.9)0.720.84 total125 (73.5)45 (26.5)170 (100)-- a: concordance between methods . A: concordance between methods . Hpv16, the most frequently detected hr - hpv type, was present in six samples obtained by both methods . The specific hpv types identified in the self and clinician - collected samples are shown in table ii . Table ii specific human papillomavirus (hpv) types detected by self and clinician - collectedhpv types (n)clinician - collected n (%) self - collected n (%) high - risk 453 (7.7)3 (6.7) 184 (10.2)3 (6.7) 314 (10.2)4 (8.9) 335 (12.8)3 (6.7) 166 (15.4)6 (13.3)low - risk 6/118 (20.6)12 (26.7) undetermined9 (23.1)14 (31) total39 (100)45 (100) lr - hpv types were detected at a higher frequency in the self - collected samples than in the clinician - collected samples (23.5% and 15.7%, respectively; p = 0.78). However, hr - hpv types were identified more frequently in the clinician - collected samples than in the self - collected samples (33.3% and 27.4%, respectively; p = 0.55). The concordance of the specific hpv type results between the collection methods demonstrated that 27.4% of the samples had complete agreement for hr - hpv types and 13.7% had complete agreement for lr - hpv types (table iii). Table iii concordance between low - risk (lr) human papillomavirus (hpv) and high - risk (hr) hpv dna detection in self and clinician - collected hpv (n)clinician / self n (%) clinician / self n (%) clinician / self n (%) clinician / self n (%) concordance (%) kappalr517 (13.7)1 (1.9)5 (9.8)38 (74.5)88.20.6hr5114 (27.4)3 (5.9)-34 (66.7)94.10.9 a: positive; b: negative; c: concordance between methods . A: positive; b: negative; c: concordance between methods . Hpv infection with multiple types was detected in 20.5% (8/51) of the clinician - collected samples and 15.5% (7/51) of the self - collected samples . One sample tested positive for hpv16, 18, 31, 6 and 11 using both methods . Herein, we evaluated the hpv dna detection agreement between self and clinician - collected samples . Studies have found that the use of self - collected samples can enable the identification of the hpv types that infect the cervix (gravitt et al . Our results demonstrated that self - collection sampling generates comparable amounts of material for hpv testing to those of clinician samples (both amplified 99.4% of the -globin gene). Moreover, the concordance between the methods was satisfactory (84.6%, = 0.72). Studies reported a concordance of 87% between the two methods (brink et al . A recent study showed agreement (93%; 0.849) between self - sampling and the reference smears in regards to hr - hpv detected by real - time pcr with a modified gp5+/6 + primer mix (jentschke et al . One explanation for the high concordance is that the self - collected specimens represent an admixture of vaginal and cervical cells and the sampling order (self - collection first) may increase the number of positive samples owing to a higher number of exfoliated cells (gravitt et al . In addition, hpv testing using pgmy09/11 primers has higher hpv dna detection accuracy than other tests (bhatla & moda 2009). Similarly, we found that the frequencies of hpv dna detection in self and clinician - collected samples were similar (26.5% vs. 22.9%, respectively) and that hpv infection could be detected in both the vaginal and endocervical epithelia . Hr - hpv types were well detected in both methods and the concordance between the methods was higher for the detection of hr - hpv dna than that for that of lr - hpv . The hypothesis that sample self - collection may be suitable as a novel method of cervical cancer screening by molecular tests was supported by other studies (jentschke et al . (2013) recently reported that the positive predictive value of this test decreased when the sample was self - collected, with better predictive outcomes associated with high - grade lesions . (2013) detected a positive rate of 12.3% for hr - hpv using care hpv (qiagen, usa) for detection in self and professionally collected samples . These authors also observed a slightly higher frequency of hr - hpv positive results in the self - sampling group than in the professionally sampled group (13.5% vs. 11%, respectively), although the results obtained by other authors (castle et al . 2007, petignat et al . 2007). In the present study, women were recruited from the public health system after they were referred to a gynaecologist and this may explain the high positive rate of hpv dna (30%) in our samples . The type of test used in the analysis of hpv dna is another relevant variable to consider when determining the efficiency of both collection methods . The more sensitive the detection method, smaller the amount of sample required for successful detection (de sanjos et al . Another factor to consider is the type of instrument used to collect the cells (liquid - based, swab or endocervical cytobrush), which may affect the amount of sample collected (lorenzato et al . Compared to other hpv types, hpv16 and hpv18 confer a higher risk of cervical cancer (koutsky et al . Hr - hpv16 was the most frequently detected type in both the self and clinician - collected samples and thus, self - collected samples show promise as an alternative diagnostic tool, as well as for epidemiologic studies and vaccine trials . The type - specific primers used in this study are considered the most prevalent viral types worldwide (walboomers et al . 1999). Regarding hpv types obtained from different samples, the detection of high - risk oncogenic hpv was more common in the clinical collection group . A study comparing the detection of hpv types in samples of cervical and vaginal origin found that low - risk oncogenic hpv was more prevalent in the vaginal epithelium . Hence, it is likely that the oncogenic hpv types have different survival mechanisms and viral production compared to lr - hpv types, which rarely produce cytological abnormalities and prefer to infect cells in the vagina, where the tissue is keratinised (castle et al . This fact may be associated with the restricted choice using only the primers to lr - hpv6 and 11 types . In addition to oncogenic hpv, we verified that sample self - collection has the potential to detect multiple hpv infections . It is remarkable that infections with multiple hpv types were frequently found in a study of brazilian women (tozetti et al . Multiple hpv infections increase a woman s risk of developing cervical neoplasia, even if the co - infections is with an lr - hpv, since it could influence the development of low - grade squamous intraepithelial lesions (trottier et al . Another risk factor of hpv infection is age, as one study of sample self - collection by adolescents showed that hpv infection is more common in sexually active younger women (silva et al . 1998). In our study, we found lower frequency of infection in women 30 years of age . These results were consistent with those of other studies (lindell et al . 2002), that reported that hpv prevalence differs by age and is less common in women over age . It was suggested that screening using hpv - dna tests is more appropriate in women> 30 years of age since hpv infection is less likely to be transient in this age group unlike in younger women (franco 2003). Hpv dna testing has the potential to improve the efficacy of cervical cancer screening and is a more cost - effective solution . Using this strategy, the screening interval can be extended to every three years compared to the use of annual pap smears (chow et al . 2010). Recognising this, women who are underserved in terms of cervical cancer screening, mainly those in remote areas of large countries such as brazil, can justify the use of this self - collected method to the public health service . In this study, we demonstrated that the results of the self - collected sampling method are in good agreement with those of the clinician - collected sampling method for the detection and typing of hpv dna . Use of the self - collected sampling method as a primary prevention strategy in countries with few resources could effectively identify those women with hr - hpv . The self - collection method is better accepted among women; therefore, it could enhance cervical cancer screening program coverage and contribute significantly to reducing the incidence of cervical cancer.

Paola ricciardi - castagnoli (university of milano, italy) and were grown in rpmi 1640 medium (paa, linz, austria) supplemented with 2 mm glutamine and 10% (heat - inactivated) fcs (life technologies ltd ., paisley, scotland), 100 u / ml penicillin, and 100 g / ml streptomycin as described previously (2). Human monocytes were isolated from buffy coats by one - step gradient (percoll; pharmacia biotech spa, cologno monzese, italy) or by adherence on plastic petri dishes . After isolation, cells were kept in culture for 5 d in rpmi medium containing 2 mm glutamine, 5% human serum, 100 u / ml penicillin, and 100 g / ml streptomycin . Il-1 and il-6 in the supernatant of lps (sigma chemical co., st . Louis, mo) treated cells were measured with the intertext-1x mouse il-1 elisa kit and intertext-6x mouse il-6 elisa kit, respectively (genzyme srl, cinisello balsamo, italy). All reagents used were dissolved in endotoxin - free water (sigma) and checked for endotoxin contamination . Microglial cells (25 10/ well) were plated in microtiter plastic wells in culture medium and incubated in a co2 incubator at 37c in the absence or presence of lps for 24 h. at the end of this incubation, the monolayers were thoroughly rinsed with saline solution and supplemented with 100 l of a special diluent buffer (firezyme ltd ., san diego, ca) to stabilize extracellular atp and directly placed in the test chamber of a luminometer (firezyme). Then, 100 l of luciferin - luciferase solution (firezyme) was added, and light emission was recorded . As a control, paola ricciardi - castagnoli (university of milano, italy) and were grown in rpmi 1640 medium (paa, linz, austria) supplemented with 2 mm glutamine and 10% (heat - inactivated) fcs (life technologies ltd ., paisley, scotland), 100 u / ml penicillin, and 100 g / ml streptomycin as described previously (2). Human monocytes were isolated from buffy coats by one - step gradient (percoll; pharmacia biotech spa, cologno monzese, italy) or by adherence on plastic petri dishes . After isolation, cells were kept in culture for 5 d in rpmi medium containing 2 mm glutamine, 5% human serum, 100 u / ml penicillin, and 100 g / ml streptomycin . Il-1 and il-6 in the supernatant of lps (sigma chemical co., st . Louis, mo) treated cells were measured with the intertext-1x mouse il-1 elisa kit and intertext-6x mouse il-6 elisa kit, respectively (genzyme srl, cinisello balsamo, italy). All reagents used were dissolved in endotoxin - free water (sigma) and checked for endotoxin contamination . Microglial cells (25 10/ well) were plated in microtiter plastic wells in culture medium and incubated in a co2 incubator at 37c in the absence or presence of lps for 24 h. at the end of this incubation, the monolayers were thoroughly rinsed with saline solution and supplemented with 100 l of a special diluent buffer (firezyme ltd ., san diego, ca) to stabilize extracellular atp and directly placed in the test chamber of a luminometer (firezyme). Then, 100 l of luciferin - luciferase solution (firezyme) was added, and light emission was recorded . As a control, 1 shows that a 24-h incubation in the presence of 10 g / ml lps triggers release of il-1 and that this is blocked by pretreatment with the selective p2z / p2x7 inhibitor (13) oatp . To show that the effect of oatp is not due to a nonspecific inhibition of cell responses, we have also monitored il-6 release, which is much less affected . As further proof that oatp does not have nonspecific effects, we show that il-1 release is restored in lps - treated, oatpinhibited cells by the k ionophore nigericin, an agent known to cause il-1 release through a receptor - independent pathway (4, 10). Autocrine / paracrine stimulation of purinergic receptors can also in principle be prevented by exogenously added atp - consuming enzymes such as apyrase or hexokinase . 2 a shows that apyrase completely inhibits lps - dependent il-1 release (the inactivated enzyme has no such effect). The main difference between apyrase and hexokinase is that the first hydrolyzes atp and adp, thus generating amp, whereas hexokinase uses atp as phosphorus donor to phosphorylate glucose, thus generating glucose 6 phosphate and adp . It is known that adp is an agonist at p2z / p2x7 receptor, though less potent than atp (12). Thus we checked whether the potentiating effect of hexokinase is mediated by stimulation of the p2z/ p2x7 receptor by accumulated adp . This seems to be the case because pretreatment with oatp blocks il-1 secretion due to the combined addition of lps and hexokinase (fig . 2 a), and more importantly, exogenous adp (adpe) is a much more potent stimulus than atp (fig . These experiments suggest that il-1 release could be modulated by atpe and adpe, probably released by the inflammatory cells themselves under lps stimulation . An obvious sine qua non of this hypothesis is that microglial cells must release atp in response to lps . 3 a shows that microglial cells chronically stimulated with lps release atp . Because the incubation medium is changed right before atp determination, extracellular atp measured in this experiment is very likely not accumulated in the bulk phase but continuously generated by the microglial cells . In support of this interpretation, we consistently found very little extracellular atp in the cell - free supernatant (not shown). The lps dose response curve for atp release closely matched that for il-1 release, as shown in fig . 3 b. it has been shown previously that atp is a powerful stimulus for il-1 secretion from macrophages (10, 11), thus suggesting that this nucleotide might also have a role in autocrine / paracrine stimulation of these cells . In support of this hypothesis, 4 shows that atp is released by human macrophages isolated from three different subjects after stimulation with lps . The mechanism of il-1 processing and release is a key issue in immunology (59, 15). Rather surprisingly, recent evidence points to a decrease in cytoplasmic k as a pivotal stimulus for ice activation and il-1 maturation (4, 10). However, lps itself does not directly activate plasma membrane k channels, and mouse microglial cells express inwardly but not outwardly rectifying k channels (16), thus raising the issue of the mechanism responsible for lowering the cytoplasmic k concentration . It has been suggested that this might be achieved by a lps - dependent increase in the number of voltage - dependent k channels in the macrophage plasma membrane (4), but typical k channel inhibitors blocked il-1 release only at concentrations far above those necessary to inhibit these channels (4). The p2z / p2x7 receptor is a good candidate to mediate cytoplasmic k depletion . This receptor is typically expressed in macrophages and macrophage - like cells (2, 17, 18), and it is modulated by inflammatory cytokines (17, 19). A brief stimulation with atpe triggers massive k efflux (12) and release of processed il-1 (2, 10, 11), whereas a sustained activation causes cell death (1, 17, 20). Our data suggest that il-1 release from microglial cells requires a double stimulation: first, lps - dependent transcription of the il-1 gene and cytoplasmic accumulation of proil-1; second, paracrine / autocrine activation of the p2z / p2x7 receptor that causes release of the mature cytokine . Adenine nucleotides can originate from many different sources: (a) the microglial cells themselves can release atpe, either spontaneously or under lps stimulation; (b) injured or damaged cells certainly release significant amounts of this nucleotide, a process likely to occur in vivo at sites of inflammation; (c) in the central nervous system, atpe can be released by neurons that establish close contact with the microglial cells . It might seem paradoxical that adp is a better il-1 releasing agent than atp, although notoriously it is a less potent stimulus at the p2z / p2x7 receptor . However, this is not unexpected because adp, in contrast with atp, is devoid of cytotoxic activity, and data from our laboratory show that release of il-1 is optimal in response to a submaximal, noncytotoxic stimulation of the p2z / p2x7 receptor, such as that due to adpe (d. ferrari and f. di virgilio, manuscript in preparation). Involvement of the p2z / p2x7 purinergic receptor in lps - dependent il-1 release may allow the development of new pharmacological antagonists (i.e., oatp and derivatives) to modulate the in vivo production of this cytokine in pathological conditions such as septic shock or chronic inflammatory diseases . Oxidized atp inhibits lps - dependent release of il-1. N13 microglial cells were incubated in 24-well plates in rpmi medium supplemented with 10% fcs at a concentration of 2 10 and incubated 24 h in the presence or absence (controls) of 10 g / ml lps . In the experiments with oatp, cells were treated with this inhibitor (300 m) for 2 h and then rinsed before addition of lps . Stimulation with nigericin (20 m) was performed for 30 min after removal of oatp . Data are averages of duplicate determinations from a single experiment repeated on three separate occasions . (a) where indicated, cells were incubated in the presence of apyrase (apy, 0.4 u / ml) or hexokinase (hex, 100 g / ml) throughout lps treatment (10 g for 24 h). As a control, the enzymes were boiled for 30 min (b apy and b hex) before being added to the cell monolayers . Pretreatment with oatp (300 m) was peformed for 2 h; then the monolayers were rinsed and challenged with the different stimuli . (b) cells were first stimulated for 2 h with lps (10 g / ml), and then stimulated with either 1 mm atp or adp for 30 min . Microglial cells were plated in 24-well plates as described in fig . 1 for il-1 secretion or microtiter plastic wells as described in materials and methods for atp release and stimulated with lps for 24 h in a co2 incubator at 37c . For measurement of atp, release samples were processed as follows: monolayers were rinsed and 100 l of diluent buffer (firezyme) were added (see materials and methods). Data for il-1 release are duplicates from a single experiment repeated with similar results with three different batches of microglial cells . Data for atp release are means of quadruplicate determinations sd from a single experiment repeated in three different occasions . Macrophages were isolated from three different donors (a c) as described in materials and methods and plated in microtiter plastic wells at a concentration of 50 10/well . After plating, cells were stimulated for 24 h with lps and atp release measured as detailed in fig.

A 23-year - old engineering graduate presented with primary palmoplantar hyperhidrosis, for which he was advised an alternate day schedule of tap water iontophoresis . On his next visit, he presented with a very simple iontophoresis device that he devised on his own . The device was constructed with a rechargeable 12 volt battery, two aluminum trays and copper wires, and connecting clamps [figure 1]. Hence, using his engineering background he constructed this simple device based on basic mechanism behind iontophoresis . He followed an alternate day schedule of 20 min utes immersion for initial 4 weeks, followed by once a week for next 8 weeks . He achieved an excellent reduction in palmoplantar sweating without any adverse effect, within 3 months of starting iontophoresis . A simple user - made iontophoresis device iontophoresis is defined as passing of an ionized substance through intact skin by application of direct current (dc). Tap water iontophoresis is a reliable and effective method for the treatment of palmar and plantar hyperhidrosis, when practiced with appropriate technique and timing . Many dermatologists consider simple tap water iontophoresis to be first line therapy for primary focal palmar and plantar hyperhidrosis . The mechanism of production of anhidrosis is not completely understood; however, obstruction of sweat duct has been suggested as a possible cause . Few brands of iontophoresis devices are commercially available; however, they are expensive and are not readily available . Commercially available construction of an iontophoresis device has been described by levit, in which output of the 115 volt isolation transformer is rectified by the full wave selenium rectifier and then filtered by the choke and capacitors, and the potentiometer acts as a voltage divider . Levit had suggested that such devices can be constructed at home, and circuit diagram could be found in his original report, but we feel that the procedure for assembling such a device will be difficult for a layperson . For tap water iontophoresis, patients are instructed to apply petroleum jelly with a cotton swab to cover any cuts over the treated area before the session . The trays should be filled with tap water, then, the affected areas should be immersed in the tap water . A monday - wednesday - friday schedule should be followed until the condition improves; subsequently, the treatment should be tapered once a week for 8 weeks and then once a month for maintenance . Additionally, the patient should wear rubber or plastic footwear and should keep himself from directly touching the floor . Burning and pin pricking sensations are very common and erythema and vesiculation are transient; topical corticosteroids cream can be applied for persistent erythema and vesiculation . Pregnant women, people with pacemaker or metal implants, cardiac conditions, or epilepsy are contradictions for the use of iontophoresis machine . Once a home device is obtained and the patient has received adequate education and training, the maintenance cost and effort are minimal for the patient and health care provider alike . Iontophoresis machines basically produce a voltage sufficient to drive a dc of 15 - 20 ma through the hands of patients . An ampere - meter could be used to measure the output current of such user - made devices and can upgrade the voltage of the battery, provided the output is low in terms of current . Simple user - made devices such as this one would make the process of iontophoresis very easy, safe, and cost - effective . There are no conflicts of interest.

Intertrochanteric femoral fractures (iffs), also called proximal femoral fractures, usually occur between trochanter major and trochanter minor and these fractures are observed in old people in a quite common way, since they are prone to decline in bone density and strength due to aging . Apart from old people, young people can also experience these types of fractures as a result of sudden excessive force or stress . Stable and unstable fractures are the two types of proximal femoral fractures . In order to fix these two different types of fractures, either extramedullary implants such as dynamic hip screw (dhs) or implant selection is vital for the treatment of stable and unstable trochanteric femoral fracture types . In stable iff, extramedullary implants should be selected and intramedullary implants should be preferred for unstable iff according to the recent studies [1, 2]. In addition to these studies, parker and handoll who compared intramedullary and extramedullary implants for iff concluded that dhs should still be considered as the gold standard device for stable and unstable iff . Nevertheless, there are several common problems in the treatment of iff with dhs such as implant failure and the cut - out of lag screw due to trabecular bone failure . The mechanical role of the lag screw is to stabilize the fracture line preventing the slide and separation of fracture fragments . The force due to the body weight is transferred to distal femur via the dhs lag screw . On some occasions the cut - out can be defined as the scission of the implant from the inner region of the femoral head or a movement of the femoral head towards the varus direction . Multiple factors such as implant positions, bone quality, fracture types, and implant designs play a role in the cut - out risk . Most of the clinical and biomechanical studies focused on the lag screw positions in the femoral head . However, which positions of the lag screw in the femoral head increase the cut - out risk and implant failure is still a controversial subject . Some researchers recommend the central placement, but others suggest the inferior and inferior posterior region in the lateral view [3, 6, 7]. Some authors believe that the cut - out risk in posterior (p) region is lower compared to the other region . There is no unanimous agreement on the ideal position of the lag screw in the femoral head . Besides these recommendations, called tip - apex distance (tad), the length of the distance from the tip of the lag screw to the apex of the femoral head on an anteroposterior and lateral radiograph, to estimate the cut - out risk . This method has been used as a reliable method in most clinical practices [1, 5, 1012]. Nonetheless, according to a recent study, another factor of the cut - out risk and implant failure is the fracture type of femur trochanteric region . Therefore, the implant selection and position in the femoral head are of paramount importance for different iff types in terms of the cut - out of the lag screw and implant failure . In this study, the effects of three factors (lag screw positions, fracture types, and tad) in the cut - out risk were evaluated using finite element analysis (fea) in a patient - specific femur . The aim of the fea study was to assess how the different positions of the lag screw and fracture types can influence the risk of cut - out systematically . 3d femur cortical and trabecular models were modelled via computerized tomography (ct) images obtained from a male patient aged 57 using a toshiba aquilion ct scanner in the department of radiology of the medicine faculty at the university of kocaeli . Ct images consist of parallel layers having a pixel size of 0.774 0.774 mm at the lateral position and a voxel resolution of 473 473 235 . The images were recorded in the digital imaging and communications in medicine (dicom) format . These images were then transferred to the mimics 12.1 (materialise, leuven, belgium) 3d image - processing software . The surface errors (spike, intersection, etc .) Of the models of femur cortical and femur trabecular bones were corrected with the help of geomagic studio 10 software (raindrop inc . After the correction of the surface roughness of the model, 3d smooth solid models were developed and imported into solidworks program (dassault systmes solidworks corp . Two- and three - part trochanteric fractures were formed as 31-a1.1 (stable fracture type) and 31-a2.1 (unstable fracture type) in the muller ao classification accompanied with and without medial support at the level of the lesser trochanter in solidworks program . The angle of the fracture line with the femoral anatomic axis was assumed to be 30 and the proportion of the intrusion distance of the medial fragment to the distance of the fracture complex was assumed to be 30% that is mostly encountered (figure 1). The geometrical dimensions of the dhs with a 130 four - hole standard barrel plate were obtained from the implant manufacturer catalogue [tipsan co. inc . ]. The femoral head was schematically divided into nine different positions as shown in figure 2 . The models of dhs and fractured femur were combined with different lag screw positions in accordance with clinical practice . Tad values were measured in both ap and lateral views in solidworks program as suggested by baumgaertner et al . And were illustrated as a gauge bar in the femoral head (figure 3). Finally, the femur models with dhs implants positioned as mentioned above were imported into ansys workbench software (ansys inc ., canonsburg, pa) in iges file format for fea . It was assumed that the material properties of the bones and dhs models are linear elastic and isotropic . The material of dhs was considered to be made of 316l stainless steel which is commonly utilized in the treatment of iff . The material property values that were obtained from the literature were determined as shown in table 1 . Mesh convergence was tested by refining the element size from 6 to 3 at 1 mm interval on the femur and 4 to 1 at 0.5 mm interval on the dhs plate . The most suitable element size for the optimum results was determined as 4 mm and 1.5 mm for the whole femur and dhs plate, respectively . The element types of solid 186 (hexahedron - dominant) and solid 187 (tetrahedron) were used in the whole finite element model . In fea, several mesh sizes for the additional refinement were defined at some critical locations such as the screw threads and the corner of the dhs model in order to get convergence . The number of elements and nodes changed from 65.000 and 150.000 to 75.000 and 245.000, in a successive way . The interactions of all contact surfaces were presumed as a frictional contact except the interactions between trabecular and cortical bone . Friction coefficients were defined as 0.42 for the interactions between the bone and the implant, 0.2 for the interactions between the implant and the fragment of the implant itself, and 0.46 for the interactions of the fragments of the fractured bone . The fractured femur models fixed with dhs were subjected to a static load obtained from the literature in accordance with the value reported for a person walking at a normal speed . The coordinate system for the femur was defined based on the definition by bergmann et al . . Considering body weight, the maximum forces resulting from walking were applied to the femoral head surfaces in ansys workbench for x - y - z force vectors, as shown in figure 4 . The force of the abductor muscle was applied as presented by duda et al . . The distal ends of the fractured femur models were constrained taking into consideration the contact surface of the knee joint as shown in figure 4 . The compressive strain criterion was selected to predict the cut - out risk of the femoral head models in the trabecular bone according to schileo et al . . Expected femur trabecular bone failure is supposed to occur when the strain level exceeds the trabecular bone yield strain equaling to 1% of the compressive strain of the trabecular bone [22, 23]. The volume percentages of the trabecular bone exceeding the yield strength of the compressive strain for each position were calculated and compared to each other . The best lag screw location was determined according to the amount of minimum volume percentage . The contour plots in figures 5 and 6 illustrate the minimum principal strain (compressive) results in a cross section of the trabecular femur head for nine different models with both fracture types . Furthermore, the volume percentages of the compressive strain level on the trabecular femur are shown as a pie chart in figures 5 and 6 . The gauge bar in figures 5 and 6 indicating strain levels was divided by strain bands . The maximum value in the gauge bar was accepted as 1% of the compressive strain of the trabecular bone . Based upon the compressive strain criterion, posterior regions (p, pi) of 31-a1.1 fracture type models had the largest failure regions on the trabecular bone which is close to dhs - femur neck region as shown in figure 5 . The lowest cut - out risk was specified in the middle region with reference to the trabecular bone failure criterion . The as, s, and i regions had a lower cut - out risk compared to the pi and p regions in a comparison with the percentages surmounting the compressive strain at a rate of 1% . As expected, higher compressive strain values were predicted for the 31-a2.1 compared to 31-a1.1 fracture types owing to the load transfer pathway of the femur . The values of all a2.1 fractured femur models surpassed the value of the compressive strain at 1% . Accordingly, all regions for both fracture types were at the risk of a cut - out in defined loads and boundary conditions . The values in excess of the strain values at 1% were detected at the upper side region of the lag screw and at the intersection region between the lag screw and fracture surfaces for all models . Pertaining to the results, as the most suitable region for the cut - out risk, the middle placement of the lag screw was determined with reference to the yield strain criterion of the trabecular bone . The higher cut - out risk regions were the pi, ai, and a regions as shown in figure 6 . All tad values as to the lag screw positions were fewer than 30 mm except the tad value of ai position having the maximum values at 30 mm as shown in figure 3 . The results demonstrated that the pi and ai regions had the higher risk and also the higher tad values . Although the ps and s regions had higher tad values compared to the as, a, p, and i regions, the volume percentages of the trabecular failure in the ps and s regions were less than in as, a, p, and i regions . Hence, the results of tad proved incompatible in the regions of ps and s in a2.1 fracture type . The cut - out risk of the lag screw in two iff types can be estimated by utilizing the technique of the fe simulations . Biomechanical studies on the lag screw positions usually evaluate only the positions of s, m, and i regions [7, 24] as shown in figure 3 contrary to many clinical studies [5, 1012]. There is no biomechanical or clinical study about how fracture types affect the cut - out risk in different lag screw positions according to our literature search . In this study, the effects of the varieties of the lag screw positions observed in clinical practices on the cut - out risk were evaluated using fe method in two types of the femur trochanteric fractures . The forces of the abductor muscle were applied in fea and the other muscles were ignored in this study . Reported that the muscle forces had no significant effect on the strains of the intramedullary nail used for the treatment of femur trochanteric fractures . Besides, konstantinidis et al . Concluded that the muscle forces have little effect on the fracture displacement for trochanteric fractures . Indeed, particularly the force of the abductor muscle has a fundamental effect on the strain values of the femur [26, 27]. In the light of these studies, we arrived at a decision that only the force of the abductor muscle should be added to fea . The critical strain value was exceeded in all positions of both fracture types . Comparing the volume percentages of the strain between each other in all positions, we found that the lag screw placements of p regions (p, p - i, and p - s) and i regions (a - i, i, and p - i) of the femoral head increased the failure risk of the trabecular bone . In contrast, the placement of the lag screw in the middle region leads to a lower risk compared to other placements . These incompatible results originated from several reasons such as the type of fixation, femur fracture type models [5, 6], boundary conditions [613, 15], and different tad values [3, 58, 28]. Another reason for incompatibility between this study and clinical studies [8, 28] is the complex structures of the trabecular bone . In reality, the material structure of the proximal part of the trabecular bone is very complex and it is very difficult to represent this complex structure of the bone material in fea . It was assumed that the femur consisted of isotropic material and homogeneous trabecular bone density . Upon taking a glance at studies about bone density, we realized that the central region of the femoral head had the strongest trabecular bone, whereas the superior regions of the head had the weakest trabecular bone [29, 30]. Under these circumstances, the cut - out risk may increase at the superior region and decrease at the center and inferior regions . As to these factors, even though the superior regions seem to be safer than the other regions except the region of m in our study, the possibility of the cut - out in superior regions is higher than expected . On the other hand, the possibility of the cut - out at the ai, i, pi, a, and p regions is lower than expected . Fundamentally, the assumptions of the homogeneous isotropic properties for the trabecular bone simplify the models and thus weaken the conclusions . Therefore, with our study the fact that the density distribution of the trabecular bone is a more efficient factor compared to the positions of the lag screw in the cut - out risk considering the clinical study outcomes [5, 6, 8] can be presumably stated . Further studies can be conducted about how the elasticity of different trabecular bone regions affects the strain results of the patient's femoral head . The highest compressive region was found at the upper region of the lag screw threads on the trabecular bone as illustrated in figures 5 and 6 . However, according to the recent study, a critical region was determined in different places most of which were near the intersection between the fracture line and the lag screw unlike our finding . The main reason for this discrepancy can be originated from modelling taking into consideration the bone density of the femoral head and the tad values . In addition, the loads are transferred to the knee via the lag screw in a2.1 fracture type . Nonetheless, the transferring path of loads in a1.1 fracture type is via both the lag screw and the fracture surfaces with the medial support . While the load is transferred to the distal femur, the fragments of the femoral head are enforced to be separated from each other in the superior region of the fracture line . Conversely, the fracture surfaces in the inferior region of the fracture line are pressed against each other . Thus, the critical regions of the trabecular bone are observed at the tip of the lag screw and at the intersection region between the lag screw and the fracture line . Tad depends on the placement of the lag screw into the femoral head and thereby affects the strain on the trabecular bone . A significant number of clinical studies have been carried out for the relation between tad and the cut - out . These studies regard tad as the best predictor for the cut - out risk [5, 912, 30]. Nevertheless, it is not an accurate predictor in that it cannot reflect the inhomogeneous distribution of the bone in femoral head regions . If just tad is used to determine risk, it may cause a higher risk of failure due to the placement of superior regions . Based on our results, the risk of the cut - out is predicted by tad except the s and ps placements in 31a2.1 fracture type regarding the volume percentages of strain exceeding the yield point . One reason for not being predicted in s and ps placements can be explained by the fact that the volume of the trabecular bone at the tip of the lag screw is less than that of other regions . Other reasons can be explained by the ignorance of the distribution of the bone density and the selection of volume percentages regardless of the maximum strain values as an evaluation method . Consequently, there is a compatible relation between the cut - out risk and tad values as the other numerical and clinical studies have found [5, 6, 8, 1012, 28]. These are usually assumed to be the linear, homogeneous, and isotropic material properties in many fea studies [6, 24] such as in this study . However, these tissues have anisotropic and heterogeneous material properties . One other limitation is that the behaviour of muscle and tendon tissues surrounding the fracture location was not included . Another limitation of the study is that the only normal walking loading case which did not create the worst loading case for the models was used . The other limitation is that the femur - implant interfaces were assumed to be ideally contacted with each other . In reality, contact ratio is changeable from patient to patient according to application of surgeon and bone porosity . The validation of the fe model is crucial to take accurate results . In this study furthermore, the resulting comparisons of the eighteen models give the idea that the results are accurate . The fea results showed that femur trochanteric fracture types are crucial for the treatment of the femur fractures . In other words, fracture types affect the cut - out risk in different lag screw positions . Some obvious distinctions were recorded between the stable (31-a1.1) and unstable (31-a2.1) fracture types in terms of the minimum principal strain distributions . The unstable fracture increasing the strain levels of the femoral head caused a higher cut - out risk of the lag screw . For this reason, there is a possibility of the trabecular bone yielding at the tip of the lag screw in the unstable fracture models . The bone density and the location of the lag screw at the femoral head are fundamental factors for the cut - out risk . In addition furthermore, the method of tad used for the determination of the cut - out risk in clinical practices also proves to be useful as a predictor in our study . All in all, we can supposedly say that the density distribution of the trabecular bone is a more efficient factor compared to the positions of the lag screw in the cut - out risk.

The order siluriformes is the most diverse and well - distributed within the ostariophysi, and includes 3093 species, 478 genera and 36 families (ferraris jr, 2007). In the neotropical region, there are 1648 nominal species grouped in 15 families (reis et al ., 2003). The distribution of neotropical siluriformes appears to be limited by temperature since most of the species live in tropical areas, with few reaching the southern portion of south america or the northern edge of north america (nelson, 2006). Many species of this order occur in small headwater streams with clear water, strong currents and a high oxygen content, while others have adapted to stagnant and often polluted waters in which oxygen levels are extremely low (burgess, 1989; m.r . Britto, 2002, doctoral thesis, universidade de so paulo, so paulo, brazil). Among the headwater fishes of the southeastern region of south america, representatives of the subfamily neoplecostominae are the most prominent . There is controversy regarding which genera belong to the neoplecostominae, although important progress has been made through the phylogenetic contributions of montoya - burgos et al ., representatives of the genus neoplecostomus occur in the headwater streams of southern and southeastern brazil . Langeani (1990), who reviewed the genus neoplecostomus, recognized n. microps and n. granosus, and described n. paranensis, n. espiritosantensis, n. ribeirensis and n. franciscoensis . Bizerril (1995) subsequently described n. variipictus from the paraba do sul river basin, and zawadzki et al . (2008a) recently described three new species of neoplecostomus (n. corumba, n. selenae and n. yapo) from the upper paran river basin . Neoplecostomus species are morphologically very similar (langeani, 1990), although some can be very different genetically, as shown by zawadzki et al . (2004a), who compared neoplecostomus corumba (neoplecostomus sp . In that work) and n. paranensis using allozyme electrophoresis . In view of the difficulty in identifying species of this genus, in the present study, two populations of neoplecostomus, one from so domingos stream of the grande river in the municipality of muzambinho, in minas gerais state, and another from paraitiguinha stream of the tiet river basin in the municipality of salespolis, so paulo state (both in the upper paran river basin) were compared using allozyme gel electrophoresis in order to improve our understanding of the biodiversity within this genus twenty - nine specimens of neoplecostomus sp . 1 (figure 1a) were collected in paraitinguinha stream (tiet river basin) at 233039,84 s/455132,22 w and an altitude of 786 meters in the municipality of salespolis, so paulo state (figure 2). 2 (figure 1b) were collected in so domingos stream (grande river basin), 212047,22 s/462800,79 w and an altitude of 1021 meters in the municipality of muzambinho, minas gerais state (figure 2). Specimens of the two populations reported here differed morphologically from the four species of neoplecostomus described for the upper paran river basin by the following characters: (1) a well - developed adipose fin distinguished them from n. corumba and n. paranensis that have a reduced / absent adipose fin or no adipose fin, respectively, and (2) homogeneously dispersed hypertrophied odontodes in the dorsal region of the head and not bordered by swollen skin vs. more hypertrophied odontodes in front of the eyes and the lateral margin of the snout surrounded by swollen skin in n. selenae, and more hypertrophied odontodes bordered by hypertrophied skin only on the lateral margin of the snout in n. yapo . The fish were frozen in liquid nitrogen and transported to the universidade estadual de maring . Voucher specimens were deposited in the ichthyological collection of the ncleo de pesquisas em limnologia, ictiologia e aquicultura (nuplia) of the universidade estadual de maring (neoplecostomus sp . 1 under accession number nup 6102 and neoplecostomus sp . 2 under accession number nup 6103). Samples of liver and white muscle were homogenized with a plastic pestle in polypropylene tubes (1.5 ml) containing 100 l of 0.02 m tris - hcl, ph 7.5 . To the liver samples 100 l of carbon tetrachloride (ccl4) was added to facilitate homogenization of this fatty tissue (pasteur et al ., aliquots of the protein extracts were applied to 15% corn starch (penetrose 50) gels (val et al ., 1981) by using small (4 mm x 8 mm) whatman 3 mm filter paper strips soaked in the samples followed by horizontal electrophoresis under refrigeration . Two buffer solutions were used: 0.135 m tris/0.043 m citric acid, ph 7.0 (tc), diluted 15 times during preparation of the gel, and 0.18 m tris/0.1 m boric acid/0.004 m edta, ph 8.6 (tbe), diluted four times during preparation of the gel . The gels were run for 17 h (current of 50 v at the ends of the gel). After electrophoresis, the gels were cut horizontally into two slices that were then incubated with specific histochemical solutions to detect the bands of enzyme activity in each system, according to standard protocols (murphy et al ., 1996). The genetic interpretation of the electrophoretic profiles was based on the structure of each enzyme, according to ward et al . Genetic variability was estimated by calculating the expected (he) and observed (ho) heterozygosities, according to nei (1978), as well as genetic identity (i) and distance (d), which were calculated from the allele frequencies . All analyses were done using the software genepop 1.31 (yeh et al ., 1997). We analyzed 12 enzyme systems (table 1) in two populations of neoplecostomus and obtained 19 loci (table 2) with a total of 29 alleles . Of the 49 individuals analyzed, 29 belonged to the morphotype neoplecostomus sp . 1, collected in paraitinguinha stream, and 20 to neoplecostomus sp the electrophoretic patterns of the 12 enzyme systems obtained in this study were similar to those reported by zawadzki et al . The two populations differed at nine (aat, acp, adh, gdh, idh, mdh - c, pgm and sorb-1 - 2) of the 19 loci . These loci were diagnostic, i.e., they possessed alleles for each morphotype with a frequency of 100% . 2 (from muzambinho) was monomorphic at all 19 loci, whereas neoplecostomus sp . 1 (from salespolis) was monomorphic at all but one locus (5.26% polymorphism; only the idh loci showed allelic variation). Based on the gene frequencies, the genetic identity (i) and distance (d) were 0.5281 and 0.6384, respectively . The nei (1978) genetic distance represents the average number of nucleotide substitutions per locus (detectable by electrophoresis) that have accumulated in populations since they diverged from a common ancestor, i.e., the substitution is proportional to evolutionary time (dobzhansky et al ., 1977; thorpe, 1982; thorpe and sol - cava, 1994). The negative value of fis (0.0741) indicated an excess of heterozygotes for the idh locus in the neoplecostomus sp . 1 population . On the other hand, the mean fit value (0.9844) indicated an excess of homozygotes for both species . According to wright (1978), the average fst score for the loci analyzed was 0.9855, indicating marked genetic differentiation between the two samples; for nine loci (aat, acp, adh, gdh, mdhc, pgm, sorb-1 and sorb- 2) the fst value was 1.00 . According to thorpe and sol - cava (1994), populations belonging to the same species have genetic identity values (i)> 0.85, whereas those belonging to different genera have i <0.35 and species belonging to the same genus have i values of 0.350.85 . The i value for neoplecostomus sp . 1 and neoplecostomus sp . 2 was 0.5281 (with d = 0.6384), indicating that these populations belong to two species of the same genus . Neoplecostomus species are morphologically very similar (langeani, 1990), but very different genetically, as shown by zawadzki et al . (2004a). The detection of fixed divergent alleles in syntopic populations of diploid organisms generally reflects a restricted gene flow and, consequently, the existence of different biological species (richardson et al ., 1986; murphy et al ., 1996 as shown here, nine of the 19 loci surveyed were diagnostic (table 2), leading us to conclude that the two populations studied represented different species . In contrast to the marked genetic divergence seen here between the two populations, other studies based on allozyme characters in allopatric populations of loricariid fishes have found no diagnostic markers . (2008b) found no fixed diagnostic markers for three populations of hypostomus regani from the corumb river, itaipu reservoir (both in the upper paran river basin) and manso river (in the paraguay river basin). (2009) found no fixed markers in two populations of rineloricaria pentamaculata above and below an 80 m high waterfall on the iva river . (2009) also found no fixed markers for four populations of n. yapo along tributaries of the tibagi and pirap rivers . The lack of genetic divergence in these loricariid populations highlights the relevance of the marked differentiation seen between neoplecostomus sp . 1 and neoplecostomus sp the finding that almost half of the surveyed loci were fixed to different alleles in each population suggests that there are strong geographic barriers to neoplecostomus fish that try to move from the headwaters of the tiet river basin to the headwaters of the grande river basin, or vice versa . Since specimens of neoplecostomus occur only in medium to small headwater streams, we believe that the main channel of large rivers such as the tiet, paran and grande acts as a barrier to free dispersion . 1 was polymorphic at only a single locus (idh) contrasted with other studies in which the percentage of polymorphic loci in loricariids was generally greater than that observed here . (2004a) reported that several loci (gpi - b, ldh - b and pgm - a) were polymorphic in a population of neoplecostomus sp . (= n. corumba) whereas no polymorphism was observed in n. paranensis . (1999) found that the percentage of polymorphic loci in three populations of hypostomus from the iguau river basin ranged from 20 to 40%, whereas paiva et al . (2005) detected 20% polymorphic loci in h. strigaticeps and hypostomus sp . 1 and no polymorphism in hypostomus sp . 2 from ribeiro maring . (1999) found low he values of 0.011 in hypostomus derbyi and 0.017 in h. myersi from the iguau river basin, but an extremely high value (he = 0.107) for another species of hypostomus (hypostomus sp .) From the itaipu reservoir in the paran river basin (zawadzki et al ., 2005). 1 in the present study was 0.0069, a low value when compared to that observed by zawadzki et al . (2004a) for neoplecostomus sp . (he = 0.030) and also low in relation to other loricariids from the paran - paraguay river basin (zawadzki et al ., 2002, 2004b; paiva et al ., 2005; renesto et al ., 2007 2 was zero, as also reported for n. paranensis from hortel stream (zawadzki et al ., 2004a). 2 is low when compared to the average he of 0.051 estimated for 195 species of different fish species around the world (ward et al ., 1992). According to zawadzki et al . (2004a), the unusual absence of allozyme genetic variability in n. paranensis from hortel stream could be explained by the endogamic process and ecological restrictions imposed by geographical or environmental barriers to species of neoplecostomus . Likewise, in the present study, the low levels of genetic variability for the two populations of neoplecostomus may indicate that they are mainly sedentary and probably restricted to small areas . Loricariids are generally non - migratory (burgess, 1989; montoya - burgos, 2003). Moreover, the short length of most neoplecostomus species and the currently restricted distribution of their populations (limited to head - waters) point towards a low rate of migration (chiachio et al ., 2008). The sedentary nature of these fish leads to mating within the same family group and results in low genetic variability . These characteristics suggest a possible restricted range and reduced gene flow among neoplecostomus species compared to other fish species . A reduction in gene flow and genetic events, such as inbreeding, may favor rapid speciation and endemism (strieder et al ., 2009). For example, stochastic events such as genetic drift could lead to the fixation of alternative alleles (kerr and wright, 1954) in these presumably small populations and may provide a reasonable explanation for the low intraspecific and high interspecific variation in neoplecostomus species . Our findings suggest that other genetically - differentiated populations may be revealed as more headwater streams in southeastern brazil are sampled.

The incidence of animal bites in the world is estimated at 250 out of 1000 people . In iran, 180 people in 100,000, and the incidence of rabies <1 in a million is calculated . According to statistics published by the who, this disease causes between 1.3 and 2.6 million dally in a year . Although rabies is preventable with safe and effective vaccines, it is still a health problem so that approximately 60,000 deaths occur annually in the world, and most cases occur in asia and africa . Annually, in different parts of the world, more than 15 million people due to animal bites refer to special centers to treat . The real number of cases is probably higher than the figures reported due to the lack of advanced care system . In addition to the public human health, the incidence of the disease in animals causes significant economic losses . The growing cases of stray dogs and also the increasing number of animal bites and rabies distribution in many provinces has caused massive annual costs to prepare vaccines, serum, and preventive actions . And that more attention needs to be paid to control the disease and research about its different aspects . Furthermore, wide geographical distribution, ecological diversity, and dependency of the risk factors of rabies to wildlife species, and also different levels of health knowledge, indicate that separate investigations should be conducted in different regions of the country . Being aware of the epidemiology, prevalence, and at risk age groups, we can provide the officials with good ways to prevent this health problem in the health systems . This study aimed to evaluate the incidence of animal bites in the lorestan province in the west of iran, its distribution, and human rabies deaths from the disease over a period of eleven years from 2004 to 2014 to prevent its growing in future planning . This was a descriptive cross sectional study performed in lorestan province, west of iran . The population of this study were comprised those bitten by animals from the beginning of 2004 to the end of 2014 . They had referred to all medical science units in province belonging to lorestan university, to get rabies prevention treatment . Is called one bitten by an animal and refers to the rabies prevention centers due to animal bites and fear of rabies . A person is said rabies case whose infection is confirmed by the pasteur institute . During the study, the required information in all cases of animal bites and human rabies were collected by questionnaire . Questions included age, sex, the bitten organ, place of occurrence, the bite time, and the kind of aggressive animal . The collected data were entered into the spss statistical software version 20 (ibm corp . Released 2011 . Armonk, ny: ibm corp .) And were analyzed by descriptive statistics such as frequency distribution and percentage . To calculate the incidence rate, the population of lorestan province was obtained from management and planning organization of the province, and the calculations were conducted based on them . During 2004 till 2014, the number of animal bite cases in the province which has received preventive treatment care was 43,892 . The incidence of animal bites during this period was an average 223.23 in 100,000 inhabitants [table 1]. Seventy - eight percent of all cases of animal bites in rural areas and 22% in urban areas, respectively . Totally, 33,230 (76%) were men, and 10,662 (24%) occurred in women, respectively; the incidence of most animal bites 21.1% occurred between the ages of 29 and 20 and 19 and 10 years with a 20.3% of cases . Frequency distribution and incidence rate of animal bite cases in lorestan province, west of iran (2004 - 2014) most cases of lower limb for limb bites (feet), with 24,861 (57%) followed by the upper extremities (hands) with 14,716 (33%), trunk with 3079 (7%), and head and neck with 1236 (3%), respectively . The report included dogs with the most bites, 36,222 cases (82.5%), followed by cats with 5894 cases (13.4%), and other animals in 1776 (1.4%) [table 2]. Distribution of animal bite cases based on month and gender indicated that most cases of animal bites occurred in spring and summer [table 3]. Distribution of animal bite cases in lorestan province, west of iran (2004 - 2014) based on gender, residency, age, bite site, type of biting animal and job frequency distribution of animal bite cases in lorestan province, west of iran (2004 - 2014) based on month and gender human rabies infections which were observed in four of all cases were confirmed by the pasteur institute of iran . Two of them were females (3 and 18-year - old) who had been affected by a fox, and two were males (16 and 50-year - old). Four cases, respectively, happened in the years 2009, 2010, 2012, and 2013 . Findings of this study showed that 43,892 people in the years 20042014 in lorestan province had been bitten by the animals . During this time, the animal bite was 223.23 out of 100,000 that in comparison to the same period all over iran was (an average of 180/10,000) higher . Increasing the incidence can lead to permanent educational programs in urban and rural health centers and health homes to prevent the occurrence of rabies in humans and raising awareness of the risk caused by the biting animals in the province . On the other hand, inaction and inadequacy of the measures taken by the animal (stray dogs) rabies control committee, especially in the rural areas in most cities and the lack of widespread implementation of the vaccination of domestic dogs and cattle can increase the incidence of rabies . The incidence of the disease is higher than the study conducted by riahi et al . In tabas sabouri ghannad et al . In ilam, saghafipour et al . In qom, and sadeghi et al . In the west of azarbayejan however, it is nearer to the reports by kassiri et al . In kermanshah and khuzestan, amiri and khosravi in shahrood and sheikholeslami et al . In rafsanjan . In studies conducted by khazaei et al . In hamedan, qala in the north of iran, the amount of reported cases, respectively, is 423, 7773 and 1222 in 100,000 people . Higher incidence of animal rabies in the mentioned areas is due to the climatic conditions where the presence of the main reservoirs of the disease including wolf - likes, and other wild animals are higher than lorestan province . In this study, the result of the observed cases of animal rabies is the same as the results taken in different provinces of iran . It is higher in men in comparison to women, because men have more exposure to animals, and also spend most of their time outside the home environment and also sense of adventure in men is more exposure than women maybe, due to the social and climate conditions, both of them are equally at risk of animal bites . For example, in ethiopia ramos study shows that animal bite is almost equal in both sexes . According to the results of this study, high percentage of people bitten by animals was under 20 years in 17,125 (39%), and most of the observed cases were students in 11,765 (26.8%). The reason of high percentage of bite among the students is that the students and those who are in the same range are more willing to play with animals, or hurt them . The results show that on this age and work group, training at schools about rabies, and its transmission should be done more . It can especially be effective in reducing the incidence of animal bites . In all other reported studies, the most cases have occurred in the 1019 age group, at least 23% in dehghani's study and up to 49.3% in bahonar et al . Anatomically, most of the bites were related to feet (56.7%). In a study conducted by charkazi et al . In aq qala 69.4%, haratynejad and khanjani in rashtkhar in khorasan province 63.9%, dadypour et al . In kalaleh 67%, amiri and khosravi in shahrood 60%, and alavi and alavi in khuzestan 58% were cases related to the feet . Kassiri's study in khuzestan 61.4%, yalcin et al . In turkey 53%, and erfanian et al . In mashhad 43.4% showed that the most bites happened in upper limbs . In naghibi the differences between the results of studies may be related to the ways of facing the animal . In taller adults and in cases where an animal attacks a person fleeing, feet are more exposed to bites . However, in cases where a person is playing with or harassing an animal or has shorter stature (like children), it is more likely to bite upper limbs, head, and face . In this study, most people injured were rural (79%), which is consistent with most of the studies . Animal bites occur more in rural areas, because in most villages, livestock or agriculture is the main occupation of the people, especially in forests and mountainous areas, it is more likely for the people to face stray dogs and wild animals . However, studies conducted in the centers of province or city, for instance saghafipour et al . In qom, apart from the study conducted by kassiri et al . In which the animal bite has happened more slightly in fall and winter, in other studies, most cases have occurred in spring . Higher exposure to animals, especially in rural areas, is due to agricultural activity and contact with the animals and the increase in leisure travels to areas of good weather in spring by travelers . In terms of spices, respectively, 83% was related to dogs and 13% to cats, which shows the same results conducted in iran or abroad . Dogs face wild animals more, especially wolves and canines, which statistically are the main source of disease . Most observed cases of animal bites and human rabies result from dog and canine bites . Therefore, vaccination, containment of domestic dogs and cattle (at least during the day) and enable the special committee to lose the stray dogs, seem necessary . None of these people had referred for preventive services . In bahonar's study in ilam province, where conditions are similar to lorestan province, four fatal cases were reported . This shows that despite the efforts made, and providing prevention services, lack of awareness of disease risks, and also poor information do not let all the people who are attacked by animals refer to the centers to get services . Due to the rather high rate of human rabies and animal rabies in the province, we can conclude that wildlife of the province is infected with the virus that causes disease in domestic animals, owner dogs or some cases, with human bites carry rabies to people . According to the results of this study and other studies, students and residents of villages are more at risk . Hence, training the people at risk about hurting and mistreatment of dangerous animals, ways of transmitting the disease, convincing the owners of sheep dogs and domestic dogs to go to the veterinary, and vaccination offices to vaccinate and collar their dogs and their dogs can play an important role in reducing the incidence of animal bites and rabies cause death.

The protein folding problem, or the protein structure prediction problem, is one of the most interesting problems in biological science . Studies have indicated that proteins biological functions are determined by their dimensional folding structures . Because the structure of a protein is strongly correlated with the sequence of amino acid residues, predicting the native conformation of a protein from its given sequence since the problem is too difficult to be approached with fully realistic potentials, the theoretical community has introduced and examined several highly simplified models . One of them is the hp model of dill et al . 1 ., 2 ., 3 . Where each amino acid is treated as a point particle on a regular (quadratic or cubic) lattice, and only two types of amino acids although the hp model is extremely simple, it still captures the essence of the important components of the protein folding problem (4). The protein folding problem in the hp model has been shown to be np - complete, and hence unlikely to be solvable in polynomial time 5 . .. for relatively short chains, an exact enumeration of all the conformations is possible . In dealing with longer chains, the methods used to find low energy structures of the hp model include genetic algorithm (ga; ref . 8 ., 9 . These algorithms can find optimal or near - optimal energy structures for most benchmark sequences, however, their computation time is rather long . In this paper, a branch and bound algorithm is proposed to find the native conformation for the two - dimensional (2d) hp model . The experimental results have shown that our algorithm is very efficient, which can find optimal or near - optimal conformations in a very short time for a number of sequences with lengths ranging from 20 to 100 monomers . The monomers are numbered consecutively from 1 to n along the chain, which is folded on the square lattice, and each monomer occupies one site with the center on the lattice point . Note that each monomer should be connected to its chain neighbors and is unable to occupy a site filled by other monomers . If monomer i is placed on the square lattice, then the coordinates of its location are denoted by (xi, yi). The hp model is based on the assumption that the hydrophobic interaction is one of the fundamental principles in the protein folding . An attractive hydrophobic interaction provides for the main driving force for the formation of a hydrophobic core that is screened from the aqueous environment by a shell of polar monomers . Therefore, the energy function of the hp model is defined as:(1)e=-i, j <i-1ij where i = 1 if the i monomer in the chain is hydrophobic, otherwise i = 0 . In other words, the energy of a conformation can be obtained by counting the number of adjacent pairs of hydrophobic monomers (h h) that are not consecutively numbered, and multiplying by 1 . The goal of the protein folding problem is to find the conformation with the minimal energy . It can be seen that each monomer occupies one lattice site connected to its chain neighbors . The energy of this conformation is 4, which is the lowest energy state of the sequence . In our algorithm, a conformation is built by adding a new monomer at an allowed neighbor site of the last placed monomer on the square lattice . In order to obtain a self - avoiding conformation, the monomers are placed consecutively until all the n (the length of the chain) monomers are placed, that is, our algorithm is a growth algorithm . If k 1 (1 k n) monomers have been placed on the square lattice, the k monomer may have three possible locations: turn 90 right, turn 90 left, or continue ahead . Figure 2 gives a partial conformation where four monomers have been placed on the square lattice . The next monomer, namely monomer 5, can be placed at any one of these unoccupied positions, resulting in three different partial conformations accordingly . In this way as shown in figure 3, a search tree representation can be used to denote all possible folding conformations, with three descendants at most for each node . Each node in the search tree corresponds to a partial conformation, and a line between two nodes represents a placement choice of a new monomer to the existing partial conformation . Consequently, leaf nodes at the end of the tree correspond to the complete conformation . From figure 3, it is obvious that the conformational space grows exponentially when the length of the protein chain increases . As mentioned by unger and moult (12), the number of possible (self - avoiding) conformations for an l - long sequence on a 2d square lattice is al, where 2.63 and 0.333 . Accordingly, for a protein chain of not too short length, the search space is too huge to find the lowest energy conformation within a reasonable running time . To reduce the computational cost, a so - called branch and bound method is introduced in this paper . In this search method, only the promising nodes are kept for further branching and the remaining nodes are pruned off permanently . Since a large part of the search tree is pruned off aggressively to obtain a solution, its running time is polynomial in the size of the problems . In our algorithm, we treat h monomers and p monomers differently . For a partial conformation where k1 monomers have been placed on the square lattice, if the k monomer is p, then all possible branches should be kept . Otherwise, if the k monomer is h, then the benefit of all possible branches of the k monomer will be evaluated and some branches may be pruned . That is to say, the main part of our algorithm is centered on the evaluation and pruning of the h monomers . This strategy maintains the diversity of the conformations and eliminates the hopeless partial conformation at the same time . The details are as follows: we set two variables, uk and zk, as the thresholds to evaluate the benefit of all branches for monomer k. here, uk is defined as the lowest energy of the partial conformation with length k that has ever been generated so far, and zk is the arithmetic average energy of the partial conformation with length k so far . After pseudo - placing monomer k at a possible location, we calculate ek, which is defined as the energy of the current partial conformation with k monomers placed . It should be pointed out that the term pseudo - place means that it is just a test and the placing process can be reverted . Then we compare ek with thresholds uk and zk: if ek uk, it means that this partial conformation is very promising and this branch should be kept . If ek> zk, that means the benefit of the partial conformation is below the average, so this conformation is discarded with probability 1 otherwise, if zk ek> uk, the partial conformation is discarded with probability 2 . The pseudo - code of this subroutine is presented in figure 4, including the details of evaluation criterion and the pruning mechanism, which is the main part of our algorithm . The above process is implemented in a recursive way until all the conformations are either pruned or hit length n. from the conformations hitting length n, we choose one with the lowest energy as the output of the algorithm . It should be mentioned that the search could be implemented by depth - first or breadth - first, where the two results are identical . In this paper, our algorithm is implemented by depth - first . Here, emin is the minimal energy of the complete conformations ever built . Note that the first two monomers of a chain can be placed on the square lattice randomly . The initial values of the two thresholds uk and zk are both 0 . Obviously, if 1 = 0 and 2 = 0, the search space will be the complete tree (no node be pruned) and it will take a prohibitively long time to search for the lowest energy conformation . If 1 = 1 and 2 = 1, it takes a very little time to search the entire search space because the thresholds are so high that many promising nodes may be discarded . That is to say, the higher the value of the probabilities, the more difficult a branch is to be kept . Therefore, choosing the value of 1 and 2 is an essential factor affecting the speed and efficiency of this approach . In this paper the probability 2 is chosen to be less than 1 because a partial conformation with energy below average is more promising than a high energy partial conformation . In this way, ek, the energy of the partial conformation, can be viewed as the energy expectation of the partial conformation after looking one step ahead and zk is expressed as the mean energy of the already generated partial conformations of length k. zk keeps a historical record, which is, to a large extent, conducive to the formulation of promising conformations . For any partial conformation, it would have more opportunities to procreate if holding higher individual quality (ek), which is in accordance with the law of natural selection . To test the performance of the branch and bound algorithm, we compared it with the mc, ga, and mixed search (ms; ref . 13) algorithms by using 10 benchmark sequences for evaluation (table 1). Table 2 presents the results obtained by the four methods on the 10 different sequences . As shown in the table, our branch and bound algorithm can find the optimal lowest energy conformations for six sequences . It is noteworthy that our algorithm can find one native state for the sequence of length 60, whereas the other three methods failed . For the two long sequences of length 85 and 100, respectively, our algorithm can find near - optimal energy conformations . It should be pointed out that predicting the longest sequence of length 100 is a hard problem, whose native state can only be obtained by a few methods such as the perm algorithm 14 ., 15 . And the guided simulated annealing method (7). We did not compare the speed with other methods directly because the machines were different . Moreover, the running time of the other three methods was presented in terms of number of steps while the exact cpu time was used in our test . All the computations in this study were carried on a 2.4 ghz pc with 512 m memory . The cpu time for all sequences was less than 10 s except the sequence of length 64, for which the cpu time was 39.46 s. it can be seen from unger and moult (12) that the number of steps of mc and ga methods increases badly with the increase of sequence lengths, therefore, it is imaginable that the computational speed of mc and ga methods in unger and moult (12) for practical applications is unacceptable . The resulting folding conformations for sequences with 24, 36, 60, 85, and 100 monomers are given in figure 5, respectively . For sequences with 24, 36, and 60 monomers, the corresponding conformations are all of the lowest energy . For the other two sequences with longer lengths, the corresponding conformations are also of near - optimal energy . It can be seen that the conformation has a single compact hydrophobic core for all sequences, which is analogous to the real protein structure . The branch and bound algorithm proposed in this paper is a novel and effective tool for the conformational search in the low - energy regions of the protein folding problem in the 2d hp model . The experimental results on 10 benchmark sequences demonstrate that our algorithm outperforms other three methods in terms of speed and efficiency . Our algorithm is similar to the population control scheme (15) where individuals would have more opportunities to procreate if holding higher individual quality, and the pruning mechanism reduces considerably the computational burden of search . We should point out that, the coding of this algorithm is very simple and hence it can be easily implemented by practitioners.

Standard radiation therapy for cervical carcinoma patients undergoing primary chemosensitized radiation therapy usually consists of external beam therapy followed by an intracavitary brachytherapy boost (eifel et al ., 2004). Using this approach, the brachytherapy serves to provide a tumorical dose to the cervix while limiting the dose to surrounding anatomy, such as the bladder and rectum, which have a lower dose tolerance . Typically, external beam radiation delivers a dose of approximately 45 gy to encompass the primary tumor and regional pelvic lymph nodes . The brachytherapy boost results in a total dose ranging from 70 to 95 gy to the primary tumor (assuming an alpha / beta ratio of 10 gy), depending on tumor stage and anatomy . In certain circumstances, the brachytherapy boost may not be feasible due to coexisting medical conditions, unfavorable anatomy, or patient refusal to undergo the procedure . In these cases, a higher dose of external beam radiation (ebrt) may be given, but the total dose delivered is usually less than when a brachytherapy procedure is performed . Predictably, the results when brachytherapy is not performed are inferior . For instance, barraclough et al . Delivered a total dose of 5470 gy through the addition of an ebrt boost to patients unable to receive the brachytherapy boost . The majority of patients developed a central recurrence in less than 5 years and had a 5-year overall survival rate of 49.3% (barraclough et al . This compares unfavorably to combined external beam therapy with a brachytherapy boost where 5-year local control and survival are in the 6070% range (rose et al . Brachytherapy takes advantage of the inverse square law in that high doses of radiation are given to the target (cervix in this case) and low doses are given to the normal anatomy by moving them out of the way with packing material exploiting the rapid dose fall - off and inhomogeneous dose distribution seen with brachytherapy . Stereotactic body radiotherapy (sbrt) provides a potential alternative method to boost the cervix in those cases where brachytherapy is not performed . Sbrt emulates brachytherapy by having multiple non - coplanar beams intersecting at the target (cervix) delivering a high therapeutic dose while minimizing beam traversal through normal anatomy reducing dose to these areas . By prescribing to a specific isodose line (i.e., the dose line that covers the volume of interest), the tumor receives an inhomogeneous dose similar to that delivered with brachytherapy . Technological advances using the cyberknife (accuray incorporated, sunnyvale, ca, usa), a robotic radiation delivery system, allow more precise targeting and delivery of radiation to the cervix while sparing normal anatomy compared to conventional radiation . This potentially allows dose escalation to the cervix to a dose comparable to the brachytherapy boost while respecting the normal tissue tolerance of the bladder and rectum . The cyberknife s use of a large number of small radiation beams also allows delivery of an inhomogeneous dose distribution similar to that of brachytherapy (fuller et al ., 2008). The cervix is not a fixed pelvic organ, rather one that is subject to movement during treatment . For example, a study from the university of california at san diego showed that the cervix can move as much as 18 mm during intensity - modulated radiation therapy (imrt) treatment (haripotepornkul et al ., 2011); other studies of cervical motion have shown similar movement (hombaiah et al ., 2006; taylor and powell, 2008). Given the large movement possible, continuous tracking of the cervix during treatment is imperative in ensuring proper delivery of dose to the tumor particularly when giving larger than conventional daily doses of radiation as is the case with the sbrt . Lastly, since sbrt is given in a week, the total treatment time frame is comparable to external beam therapy with a brachytherapy boost thus limiting the deleterious effect observed in prolonged treatments extending beyond 7 weeks (fyles et al ., 1992; girinsky et al ., 1993; lanciano et al ., 1993; perez et al ., 1995; petereit et al .,, we present preliminary local control results on the treatment of six patients with cervical cancer who did not have a brachytherapy boost and were treated with an sbrt boost resulting in a total dose of 7785 gy to the cervix . This is a retrospective chart review of cervical cancer patients treated with combined external beam radiation and sbrt boost to the cervix at winthrop - university hospital from 3/2009 to 8/2011 . All patients received a series of conventionally fractionated radiation therapy followed by an sbrt dose . One of two dose schemes was used . Early in our program of treating cervical cancer patients with an sbrt boost the conventionally fractionated treatment consisted of a 45 gy dose to the pelvis using 15 mv photons followed by an imrt boost to the cervix and uterus to a total delivered conventionally fractionated radiation therapy dose of 50.4 gy . Subsequently, we modified our treatment so that the conventionally fractionated treatment began with a dose of 45 gy to the pelvis using 15 mv photons followed by two imrt boosts, one to the uterus and cervix that increased the delivered dose to 50.4 gy and a second imrt boost to the cervix alone resulting in a total delivered conventionally fractionated radiation therapy dose of 61.2 gy . The bladder and rectum dose constraints required no more than 5% of their volume to receive 70 gy (i.e., v70 gy 5%). However, in cases where the tumor s anatomical location necessitated a high dose to the bladder and/or rectum a point dose of up to 75 gy was allowed . Following conventionally fractionated radiation therapy, patients had three to four gold fiducial markers placed into the cervix and upper vagina . Fiducial placement began with a lidocaine gel and a betadine prep and proceeded under direct visualization in the lithotomy position . The fiducials were placed into the cervix at the 3 and 9 oclock position and superiorly into the vaginal fornices in an orientation to prevent overlap in the plane of the x - ray imaging . Treatment planning ct scans at a slice thickness of 1.25 mm and an mri scan using a slice thickness of 12 mm were performed 1 week after fiducial placement . All pretreatment imaging was performed with the patient in the same position used for sbrt delivery . The pulse sequence used for mri acquisition was gradient echo which maximized the signal void attributable to the fiducials and allowed for clear visualization of the fiducials in the mr image . This allowed for the fusion of the mr and ct data sets using the fiducials . The gross tumor volume (gtv) was contoured by the attending radiation oncologist using both ct and mri images to accurately delineate the cervical anatomy and to define the interface between the cervix and anterior wall of the rectum . All patients received sbrt boost using the cyberknife system (accuray incorporated, sunnyvale, ca, usa) which consists of a 6-mv linear accelerator mounted on a robotic arm . Using this system two orthogonal kilovoltage x - ray imagers provide real - time image guidance and automatic correction for movement of the cervix throughout the treatment . Target tracking and patient positioning were accomplished by registering the location of the fiducial markers in the real - time images to their planning ct location . The robotic delivery system automatically changes the linear accelerator s position to correct for both rotational and translational movement of the patient and cervix during treatment . The total clinical accuracy for treatment is less than 1 mm (kilby et al ., 2010). Patients had a bowel prep including dulcolax (boehringer, germany) and a fleet enema on the morning of each treatment . Additionally, patients received 1500 mg of amifostine (medimmune, llc, gaithersburg, md, usa) mixed in saline as a rectal suppository at least 1520 min prior to each treatment as a radioprotectant . For the lower conventionally fractionated dose (50.4 gy) the sbrt boost to the cervix was 19.5 gy in three fractions of 6.5 gy each . For later patients who received a conventionally fractionated dose of 61.2 gy the sbrt boost to the cervix was 20 gy in five fractions of 4 gy each . In all cases, the margins were 3 mm anteriorly and posteriorly to limit dose to the bladder and rectum . Four of the six patients received systemic chemotherapy during their radiation consisting of cisplatin at a dose of 40 mg / m . Patients were followed at 3 weeks after treatment and every 3 months thereafter . Follow - up assessments were based on physical examination by the radiation oncologist and treating gynecologic oncologist . Toxicities were scored based on radiation therapy oncology group (rtog) rectal and urinary toxicity criteria . Six consecutive cervical cancer patients were treated with combined external beam radiation and sbrt boost to the cervix at winthrop - university hospital from 3/2009 to 8/2011 . The median patient age was 80 years (range, 7194 years). One patient refused brachytherapy; all other patients were unable to receive a tandem and ovoid brachytherapy boost because of either anatomic (n = 3) or medical (n = 2) conditions . The first patient treated received a conventionally fractionated total dose of 50.4 gy followed by an sbrt cervix boost of 19.5 gy delivered in three fractions . The five subsequent patients received a conventionally fractionated total dose of 61.2 gy followed by an sbrt cervix boost of 20 gy delivered in four fractions . Five percent volumes of the bladder and rectum were kept to 70 gy (i.e., v75 gy 5%) with the exception of maximal post doses up to 75 gy when necessary based on tumor location (table 2) figure 1 shows a sample treatment plan and dose volume histogram for a patient receiving an sbrt boost of 20 gy . Observed cervix motion during treatment consisted of drift in the anterior posterior or superior inferior axes; sporadic movement in the anterior posterior, superior in addition, table 2 summarizes the maximal rectal and bladder doses for each patient . (a) representative treatment plan for a patient receiving an sbrt boost of 20 gy delivered in four fractions . (b) dose volume histogram showing the bladder (yellow) rectum (green), cervix (red), and ptv (purple). All patients tolerated the treatment well with no grade 3 or higher urinary or rectal toxicities . Grade 1/2 urinary and bowel toxicities occurred in four patients following conventional external beam radiation . All of these symptoms resolved by the time of sbrt boost . At a median follow - up of 14 months (range, 128 months) from completion of the sbrt boost in addition, for the five patients with a minimum of 12 months follow - up all (100%) remain locally and distantly controlled with no evidence of disease . This report demonstrates the feasibility of using robotic sbrt as an alternative to brachytherapy in cervical cancer patients unable to undergo brachytherapy . The motivation for this series stems from the markedly inferior reported outcomes for treatment of such patients with a conventionally fractionated radiation boost compared to brachytherapy . (2008) report on the treatment of 44 patients with a conventional external beam boost to a total dose of 5470 gy when intracavity therapy could not be performed . At a median 2.3 years follow - up, recurrent disease was seen in 48% of patients with a median time to recurrence of 2.3 years . In addition, they observed late grade 3 toxicity in 2% of patients and late grade 1 and 2 bowel and bladder toxicities in 41% of patients (barraclough et al ., 2008). The poor outcomes in these studies are likely explained by the low doses given to the paracervical region in order to respect tissue tolerance of the surrounding anatomy such as the bladder and rectum . Indeed, most institutions do not exceed 7580 gy (combined external beam and ldr brachytherapy dose) to the international commission on radiological units (icru) and measurements bladder reference point and 7075 gy to the rectal reference point (fletcher and hamberger, 1980; eifel et al ., 2004). Other studies using a conventional linear accelerator have reported on a stereotactic boost for gynecologic cancers . In a case study, hsieh et al . (2010) reported on a patient who was unable to undergo a brachytherapy boost due to multiple uterine myomas . This patient received conventionally fractionated treatment to 54 gy followed by a helical tomotherapy boost of 24 gy and concurrent chemoradiotherapy . At 14 months (2005) reported on a mixed population of 23 patients with either endometrial (n = 9) or cervical (n = 7) cancer including two patients with local relapse . The patients received a 14 gy boost delivered with a linac - based micromultileaf collimator in two fractions at 47 days intervals . At a median 12.6 months follow - up one previously irradiated relapse patient had a grade 3 rectal bleed; no other patients developed severe urinary or intestinal toxicity . One recurrence occurred 12 months following treatment for a cervical cancer patient; no other failures occurred . Following a treatment planning comparison the authors concluded that sbrt improved dose homogeneity to the ptv and reduced rectal dose compared to brachytherapy . In a follow - up publication, jorcano et al . (2010) reported on 17 endometrial and 9 cervical cancer patients treated with 4550.4 gy ebrt followed by a sbrt boost of 14 gy delivered in two fractions . Acute toxicities consisted of 23 and 25% rtog grade 3 or less urinary and lower - gastrointestinal toxicities, respectively . At a median 47 months follow - up, the 3-year locoregional failure rate was 96% for both endometrial and cervical patients . The authors conclude that sbrt is feasible, well tolerated, and could be considered an acceptable alternative to brachytherapy . The university of north carolina reported on treatment with a cyberknife sbrt boost of 25 gy in five fractions for a cervical cancer patient unable to undergo brachytherapy . At a follow - up of 10 months the patient exhibited no rtog toxicities, however, the patient died from progression of liver metastases . In the present series, one patient received 50.4 gy with a 19.5 gy sbrt boost and the later five patients received 60 gy with 20 gy sbrt boosts delivered using robotic sbrt with real - time motion tracking . The inclusion of motion tracking with cyberknife delivered sbrt offers a more accurate dose delivery to the target potentially accounting for the lack of significant toxicity in this patient population despite a higher delivered dose than the conventional linear accelerator delivered sbrt boost results (molla et al ., 2005; jorcano et al ., 2010) in addition, the lack of any failure for the five patients with a minimum of 12 months follow - up is highly promising compared to the ebrt boost results for which the cancer - specific overall survival at 1 year was already only 80% (barraclough this paper is the among the first to report on using robotic sbrt in patients with real - time motion tracking for the treatment of locally advanced cervical cancer in patients who are unable to undergo brachytherapy . These preliminary results suggest that cyberknife robotic sbrt is a safe and effective modality in the treatment of cervix cancer for those patients unable to undergo brachytherapy . Additional confirmatory prospective studies with larger numbers of patients and longer follow - up are required to validate the durability of these results . Dr . Haas has received speaker s honoraria from accuray inc ., sunnyvale, ca, usa.

Subjects and sampling - the study was carried out in porto velho, ro, an unstable malaria - endemic area, where p. vivax accounts for more than 75% of all malaria cases (oliveira - ferreira et al . Symptomatic patients diagnosed with malaria infection by a thick blood smear in an outpatient clinic in porto velho were asked to participate in the study . A total of 71 patients were enrolled for the study, 47 and 24 of whom were infected with p. vivax and p. falciparum, respectively . Blood samples were collected by venipuncture from each patient at the day of diagnosis (d0 - in the acute phase) and, after collection, all patients were treated with the regimen recommended by the brazilian ministry of health (ms 2010). Patients returned 15 days later (d15 - in the convalescent stage) for follow - up examinations and paired blood samples were collected from 40 p. vivax and 15 p. falciparum infected patients . All patients were symptomatic and had clinical symptoms ranging from very mild illness to full - blown paroxysms, but there were no severe or complicated malaria cases . The patients were positive for either p. falciparum or p. vivax parasites as determined by microscopy using thick and thin blood smears at d0 . Asexual blood forms of p. falciparum or p. vivax were cleared from the peripheral blood of all patients included in the study following therapy and no parasite reappearance was observed during follow - up . The control group (n = 12) was composed of apparently healthy individuals who lived in the same area, but were negative for malaria parasites as determined thick blood smear and had not reported any malaria episodes for at least one year . Ethical approval for the study was granted by the oswaldo cruz foundation ethical committee and by the national ethical committee of brazil and informed consent was given by the patients . Laboratory tests - thick and thin blood films were stained with giemsa and the plasmodium species were identified and parasitaemia was determined by microscopic examination at d0 and d15 . Parasitaemia levels were estimated by counting the number of parasites (all species and stages) per 200 white blood cells (wbc) on blood films . If fewer than nine parasites were detected, 300 additional leucocytes were counted to obtain more precise results . Complete blood cell counts, including haematologic indices, were performed at d0 and d15 using an automatic haematology analyser (pentra abx) and peripheral blood smears were performed for routine differential blood cellular quantification . The cell counters provided data on wbc counts and red blood cell (rbc) counts, haemoglobin (hb) levels, haematocrit and reticulocyte, platelet, lymphocyte, eosinophil, segmented neutrophil, band cell, monocyte and basophil counts . The patients were considered anaemic when their hb levels were 13 g / dl blood in males and 12 g / dl of blood in females . Multiplex microsphere cytokine immunoassay - the levels of 16 cytokines and chemokines were detected in plasma samples using luminex technology (luminex corporation, austin, tx, usa). Thirteen cytokines [il-1, il-2, il-4, il-5, il-6, il7, il-10, il-12 p70, il-17, ifn-, tnf-, g - csf, granulocyte - macrophage colony - stimulating factor (gm - csf)] and three chemokines (il-8, mcp-1 and mip-1) were analysed using a bioplex - kit assay (bio - rad laboratories, hercules, ca, usa). The assay was performed according to the manufacturer s instructions using a bioplex - kit in combination with the luminex system . Briefly, 50 l of standard or test sample along with 50 l of mixed beads were added into the wells of a pre - wetted 96-well microtitre plate . After 1 h of incubation and washing, 25 l of detection antibody mixture was added and the samples were incubated for 30c min and then washed . Finally, 50 l of streptavidin - pe was added and after 10c min of incubation and washing, the beads were resuspended in 125 l assay buffer and analysed using a bioplex suspension array system (bio - rad laboratories) and the bio - plex manager software (v.3.0). A curve fit was applied to each standard curve according to the manufacturer s manual and sample concentrations were interpolated from the standard curves . The limit of cytokine detection using this method was 2 pg / ml for all cytokines and chemokines . The median cytokine and chemokine levels in 12 healthy controls were 2 pg / ml for il-1, il-2, il-4, il-5, il-6, il-7, il-10, il-12 p70, il-10 and gm - csf, 15.53 pg / ml for ifn-, 12.58 ml for tnf-, 4.3 pg / ml for gcs - f, 495 pg / ml for mcp-1 and 594.5 pg / ml for mip-1. Statistical analysis - survey data were recorded and entered into a database created with epi info 2007 (centers for disease control and prevention, atlanta, ga, usa). Analyses were performed using predictive analytics software v.17.0 (spss inc, chicago, il, usa) and prism v.5 (graphpad software inc, san diego, ca, usa). Differences in median haematological parameters and cytokine levels were expressed as medians and interquartile ranges (ir) and compared using bonferroni s multiple comparison test . When this test indicated a significant difference (p <0.05) among pairwise groups, a mann - whitney u test was used . To evaluate the significant differences in haematological and cytokine parameters between the acute and convalescent phases from the same patient, finally, the correlations between parasitaemia, blood cells and cytokine levels were calculated using spearman s rank correlation coefficient and p <0.05 were considered statistically significant . Study subjects - seventy - one patients infected with malaria were enrolled in the study . There were no differences in mean age, time of residence in the endemic area and number of past malaria episodes between p. vivax (n = 47) and p. falciparum (n = 24) infected patients . All patients presented general clinical symptoms such as history of fever and headache at the time of enrolment independent of plasmodium species . The time elapsed between the appearance of the first symptoms and malaria diagnosis was similar between patients with p. vivax (3 days) and p. falciparum (3.5 days). Although the mean parasitaemia was higher in p. falciparum - infected individuals than p. vivax - infected individuals, this difference was not statistically significant . All patients were parasitaemia - negative by day 15 of follow up after receiving effective drug treatment . The characteristics of the participants are presented in table i. table iepidemiological and parasitological data of plasmodium vivax and plasmodium falciparum infected - patients p. vivax p. falciparum (n = 47) (n = 24)male [n (%)] 35 (74.5)19 (79.2)age [n (%)] 28 (22 - 38)28.5 (23 - 41)years of residence in malaria endemic area [n (%)] 24 (21 - 36)27 (19 - 38)years of residence in the state of rondnia [n (%)] 23 (16 - 28)23 (16 - 28)total number of past malaria episodes [n (%)] 3 (1 - 8)3.5 (1 - 10)months since last malaria episodes [n (%)] 10 (2.2 - 24)12.5 (2 - 102)parasitaemia (number of parasites/l)2,293 (874 - 17,933)1,328 (793 - 12,623)days since the symptoms began [n (%)] 3 (1 - 8)3.5 (1.5 - 10)symptoms [n (%)] fever39/8322/92chills32/6820/83headache39/8321/87vomiting23/4920/83myalgia31/6621/87the values on table indicate median (interquartile range). Frequency of symptoms and gender were compared between p. vivax and p. falciparum infected - patients by chi - squared test . Mann - whitney u test were used to compare parasitaemia, days since the symptoms began, time since the last malaria infection, number of previously malaria episodes and time in malaria endemic area . There were not statistical differences on epidemiological, clinical and parasitological data between patients infected by p. falciparum and p. vivax . Frequency of symptoms and gender were compared between p. vivax and p. falciparum infected - patients by chi - squared test . Mann - whitney u test were used to compare parasitaemia, days since the symptoms began, time since the last malaria infection, number of previously malaria episodes and time in malaria endemic area . There were not statistical differences on epidemiological, clinical and parasitological data between patients infected by p. falciparum and p. vivax . Haematological results - to investigate haematological changes during malaria infection, differential haematological parameters during the acute and convalescent phases, expressed as the median (ir), are shown in table ii . The median lymphocyte and platelet counts in p. falciparum and p. vivax patients during acute disease were lower than in the control subjects and returned to control reference levels during the convalescent stage . In contrast, the median band cell counts were elevated in both p. vivax and p. falciparum - infected patients during the acute phase (p = 0.0041 and p = 0.0001, respectively) and returned to normal levels during the convalescent stage . We also found that patients with acute p. vivax infection had low eosinophil counts (p = 0.013, control values 153/l) that increased during the convalescent stage . All other haematological values were similar among p. falciparum - infected, p. vivax - infected and control subjects . Although no differences in hb levels were observed between p. vivax and p. falciparum patients during the acute phase, anaemia was detected in 29.2% of p. falciparum and in 55.3% of p. vivax patients . However, these frequencies were not significantly different from those of control subjects, 38.9% and they remained similar during the convalescent phase, during which 60% of patients previously infected by p. vivax and table iicomparison of haematological profiles of control group and patients infected by plasmodium vivax and plasmodium falciparum on acute and convalescent phase of infection p. vivaxp . Falciparum acute phaseconvalescent phaseacute phaseconvalescent phasecontrol(n = 47)(n = 40)(n = 24)(n = 15)(n = 12)erythrogramrbc (x106/l)4.6 (4.3 - 5.1)4.3 (4 - 4.7)4.9 (4.5 - 5.4)4.9 (4.7 - 5.3)4.6 (4.2 - 5)haematocrit (%) 41 (38 - 45)39 (35.5 - 42)44 (39 - 45)39 (38 - 43)39 (38 - 43)haemoglobin (g / dl)14 (12.5 - 15.5)12.6 (11.7 - 13.9)14.5 (13.9 - 15.2)13.8 (11.9 - 14)13.8 (13 - 15)reticulocyte (%) 0.5 (0.3 - 0.8)0.3 (0.25 - 0.5)0.35 (0.27 - 0.45)0.4 (0.3 - 0.55)0.35 (0.25 - 0.50)platelet (x103/l)156 (105 - 182)a, b277 (234.5 - 342.5)135 (96.25 - 135)a, b261 (195 - 365)275 (231 - 315)leucogram (/l)wbc5,100 (4,000 - 6,600)5,550 (5,125 - 7,000)4,650 (3,825 - 6,375)5,900 (5,000 - 7,300)6,400 (5,650 - 7,550)lymphocyte1,020 (780 - 1,406)a, b2,062 (1,625 - 2,389)1,038 (571.5 - 1,536)a, b2,000 (1,770 - 2,920)2,250 (1,872 - 2,570)basophil0 (0 - 0)0 (0 - 0)0 (0 - 0)0 (0 - 0)0 (0 - 0)eosinophil67 (33 - 168)b, c288.5 (162.8 - 418.5)82 (34 - 255)288 (108 - 629)153 (82.5 - 265.5)band cell63 (0 - 282)d0 (0 - 0)118 (36 - 369.5)d0 (0 - 0)0 (0 - 0)neutrophil3,468 (2,240 - 4,480)3,048 (2,377 - 3,558)3,432 (2,060 - 4,212)2,911 (2,031 - 3,650)3,830 (3,075 - 4,654)monocyte360 (214.5 - 470.5)360 (214.5 - 470.5)350.5 (215 - 527.3)292 (216 - 426)351.5 (250.5 - 547.5)a: p <0.001 between indicated infected group and control; b: p <0.0001 between acute and convalescent phase of indicated group; c: p <0.05 between indicated infected group and control; d: p <0.01 between indicated infected group and control . Comparison between control group and patients infected by p. vivax and infected by p. falciparum were evaluated by bonferroni s multiple comparison test . When the test indicated a significant difference (p <0.05) between groups pairwise, mann - whitney u test were used . To assess the significant differences in haematological parameters between acute and convalescent phase from the same patient, no statistical differences were observed between p. vivax and p. falciparum - infected patients on acute or convalescent phase . Acute phase: day of diagnosis; convalescent phase: 15 days after diagnosis; rbc: red blood cell; wbc: white blood cell . A: p <0.001 between indicated infected group and control; b: p <0.0001 between acute and convalescent phase of indicated group; c: p <0.05 between indicated infected group and control; d: p <0.01 between indicated infected group and control . Comparison between control group and patients infected by p. vivax and infected by p. falciparum were evaluated by bonferroni s multiple comparison test . When the test indicated a significant difference (p <0.05) between groups pairwise, mann - whitney u test were used . To assess the significant differences in haematological parameters between acute and convalescent phase from the same patient, non parametric paired t tests were used . No statistical differences were observed between p. vivax and p. falciparum - infected patients on acute or convalescent phase . Acute phase: day of diagnosis; convalescent phase: 15 days after diagnosis; rbc: red blood cell; wbc: white blood cell . Circulating cytokine and chemokine levels during the acute and convalescent phases of a malaria episode - the data in fig . 1 compare circulating cytokine and chemokine levels in patients infected with p. vivax and p. falciparum . First, the cytokines il-5, il-7 and gm - csf were not detectable in most plasma samples and no differences were observed in mcp-1 levels compared with controls . During the acute phase, p. vivax and p. falciparum patients had significantly higher il-6, il-8, il-17, ifn-, tnf-, mip-1 and g - csf plasma concentrations than controls . To investigate changes in cytokine levels during infection, we compared cytokine levels in the sera from the same patient during the acute and convalescent phases and plasma levels of il-6, il-8, il-17, ifn-, tnf- mip-1 and g - csf were higher during the convalescent phase . Although p. falciparum and p. vivax malaria patients have similar cytokine profiles during infection, p. falciparum patients presented higher levels of il-6, il-8, il-17, ifn-, mip-1 and g - csf than p. vivax patients during the convalescent phase . In contrast, only p. vivax patients presented higher levels of tnf- during the convalescent phase than during the acute phase of infection . Il-10 levels were detected at high concentrations in the majority of p. falciparum and p. vivax patients during the acute phase and returned to completely normal levels during the convalescent phase . The median il-10 concentration during the acute phase was 1,175 pg / ml (ir = 155 - 3,135) at d0 and 2 pg / ml (ir = 2 - 2) at d15 and 1,187 pg / ml (ir = 502.5 - 3049) at d0 and 2 pg / ml (ir = 2 - 149.8) at d15 in p. vivax and p. falciparum - infected patients, respectively . 1: comparison of serum cytokines and chemokines levels between control, plasmodium vivax and plasmodium falciparum patients in acute and convalescent phase of infection . The control group was indicated by white bars, while acute and convalescent phase of infection were indicated by light and dark gray bars, respectively . The boxes represent the values between 25 - 75% quartile and the line indicates the median . Comparison between control group and patients infected by p. vivax and infected by p. falciparum were evaluated by compared by bonferroni s multiple comparison test . When the test indicated a significant difference (p <0.05) between groups pairwise, mann - whitney u test were used . To assess the significant differences between acute and convalescent phase in p. vivax and p. falciparum infected - patients non parametric paired t tests were used . G - csf: granulocyte - colony stimulating factor; ifn: interferon; il: interleukin; mip: macrophage inflammatory protein; tnf: tumour necrosis factor . The levels of il-1, il-4 and il-12 were similar to those of the controls during the acute phase for both p. falciparum and p. vivax patients and were higher during the convalescent phase, with the exception of il-12, which was higher only in the p. falciparum group . The plasma il-2 concentration was determined only during the acute phase in p. falciparum patients . Although the median il-2 levels were higher during the convalescent phase, these differences were not statistically significant . Relationship between parasitaemia and other variables - spearman s correlation coefficient values and p values are shown in fig . Vivax patients, we found a statistically significant negative correlation between platelet count and parasitaemia during the acute phase (fig . The acute phase plasma il-10 concentration was positively correlated with parasitaemia in p. vivax (fig . The same was true for the tnf- concentration in p. falciparum - infected patients (fig . No relationship was found between parasitaemia and the other blood cell counts or the concentration of others cytokines assayed (data not shown). Associations between parasitaemia, blood cells and cytokines level were investigated by spearman s rank correlation coefficient and p values <0.05 were considered statistically significant . Haematological changes, such as alterations in total and differential wbc counts, are widely used to differentiate between several types of infections and to monitor the course of diseases (ventura et al . Malaria - induced changes in the differential white cell counts are very diverse and contradictory and include leucopoenia, lymphopaenia, lymphocytosis, the presence of atypical lymphocytes, monocytosis, neutropaenia, neutrophilia, immature neutrophils (band cells), eosinopaenia, eosinophilia and leukemoid reactions (wickramasinghe & abdalla 2000, price et al . The findings of our study show that increased band cells and low lymphocyte and eosinophil counts are common during acute p. falciparum and p. vivax malaria . The decreased lymphocyte levels during malaria infection have been attributed to the reallocation of cells to deep lymphoid organs or by parasite induced apoptosis of human mononuclear cells (hviid et al . Fifteen days following treatment, when no parasites were detected in either p. falciparum and p. vivax patients, the lymphocyte counts were similar to those in the control subjects, indicating that this period of time was sufficient for the patients to achieve lymphocyte homeostasis . With respect to eosinopaenia during the acute phase, it has been suggested that malaria either suppresses eosinophil production and release from the bone marrow or enhances the peripheral removal of these cells (davis et al . The increased eosinophil counts we observed post - treatment have been observed in previous studies (kurtzhals et al . The induction of eosinophils was attributed to various factors such as higher release of eosinophils after temporary bone marrow suppression caused by plasmodium, a direct response to the parasite or a response to antimalarial drugs . The transitory increase in band cells that was observed in both infections indicates a stronger stimulus for neutrophil production during the acute phase . In this case, early or premature release of neutrophils from the bone marrow occurs, resulting in an increased proportion of younger, less well - differentiated neutrophils into the circulation . Though this alteration is common knowledge in other acute diseases, very few studies evaluating these disturbances have been conducted for this cell type in malaria patients (hanscheid et al . Erythrogram abnormalities are also very common in malaria patients and the most prominent alterations are anaemia and thrombocytopaenia (collins et al ., the absence of marked anaemia in malaria patients may be due to the early diagnosis and prompt treatment, free of charge, provided by the malaria control program in brazil . Although some authors have described more intense thrombocytopaenia during acute falciparum malaria compared to vivax malaria whereas others have described the opposite, no difference in thrombocytopaenia was observed between these types of malaria in our study (ghosh 2007, taylor et al . However, we did observe a negative correlation between platelet counts and parasitaemia during acute p. vivax infection only . These inconsistent relationships may reflect differences in epidemiology, the immune status of malaria patients and many others factors (casals - pascual et al . . Disseminated intravascular coagulation, immune mechanisms, dysmyelopoiesis and hypersplenism are some examples of mechanisms that could be related to platelet reduction in malaria patients (patel et al . 2011). The role of cytokine signalling during malaria episodes is still far from being understood . The most famous inflammatory marker of severe malaria is tnf-, which is closely associated with fever, paroxysms, anaemia, ce- rebral malaria and many other systemic infection symptoms (karunaweera et al . 2005). In our study, the cytokine and chemokine profiles in acute p. vivax and p. the acute phase was characterised by the presence of pro - inflammatory cytokines (il-1, il-2, il-6, il-17, ifn-, tnf-), anti - inflammatory cytokines (il-4 and il-10), chemokines (il-8, mip-1) and g - csf in most malaria patients . During the convalescent phase (d15), the levels of all these cytokines increased compared with d0, except for il-10 levels, which were elevated only during the acute phase and were associated with parasite density . We and others have shown a marked il-10 response during symptomatic uncomplicated p. vivax malaria infection and a significant positive correlation between plasma il-10 levels and parasite density during p. vivax and p. falciparum infection . The discordant results regarding cytokine production during the convalescent phase in our study suggests different regulatory mechanisms for early parasite clearance . Whether the differences in serum cytokine levels noted in our study are biologically significant is also unclear . It is tempting to speculate that the phagocytic cells are committed to a more th1-biased phenotype during drug - induced clearance of parasitaemia and release of parasite metabolites, such as haemozoin, which is a known inducer of pro - inflammatory responses via signalling through toll - like receptors 9 (coban et al . 2005). Nonetheless, before the initiation of antimalarial treatment, a notably high il-10 concentration that markedly decreased with the resolution of parasitaemia was observed and this down regulation of the th2 response discriminated the successfully treated malaria patients . Il-10 has a number of effects and il-10 inhibited il-6, ifn- and tnf- secretion and function in an in vitro malaria model when anti - il-10 antibody was produced . Another plausible cause for the increase in several cytokine levels between the acute and convalescent phases could be the diminished suppressive effect by il-10 on other cytokines such as pro - inflammatory cytokines, as well as a reduced systemic inflammatory response due to all haematological alterations returning to references values . Il-10 perturbations appear to have the most significant inhibitory effect on other cytokine concentrations . In this endemic area, we were unable to rule out concomitant intestinal parasite infections with organisms such as helminths, which potentially influenced the results (hartgers & yazdanbakhsh 2006). An association of il-10 levels with parasitaemia has also been reported in plasmodium knowlesi and p. vivax infections . Moreover, il-10 levels in both p. vivax and p. knowlesi patients were elevated, but were not associated with markers of disease severity (cox - singh et al . In contrast, the ifn/il-10 ratio has been successfully used as a marker for pathological inflammatory activity in p. vivax patients with varying disease severity (andrade et al . Several studies report that il-10 has been implicated in malaria pathophysiology (dodoo et al ., il-10 predominated in the early anti - inflammatory response in p. falciparum and p. vivax - infected patients and dropped drastically during the convalescent phase when malaria had been cured in all patients . In conclusion, a complex array of cytokines is released in adult patients with uncomplicated malaria infection with apparent feedback inhibition and cross - regulatory functions . Il-10 appears to be involved during the acute phase of the disease and its decrease correlates with recovery as biological and clinical malaria features disappear . Further studies are required to determine whether these elevated il-10 levels play a beneficial role by reducing the parasite - induced inflammatory response . Additionally, there are no reports of cytokine concentrations in humans 15 days after the beginning of treatment; therefore, the data presented here could for the first time indicate a shift from a th1/th2 balanced response to a more pronounced th1-regulated immune response during the first 15 days of uncomplicated malaria treatment in brazilian endemic areas . Differences in epidemiology, nutritional status, demographic factors and the presence of co - infections are factors that could be related to the ambiguous findings of previous studies.

A 61-year male presented to the emergency department with a history of road traffic accident . He arrived hemodynamically stable with a blood pressure of 126/76 mmhg and a heart rate of 78 beats per minute . On plain radiograph (fig . 1a) anteroposterior and two judet 45 oblique view1) and computed tomography (ct) scan of pelvis (fig . 1b), the findings revealed both column fracture of acetabulum without hip dislocation, but no presence of femoral head fracture or onfh . Buttress plating through ilioinguinal approach was performed using a reconstruction plate, which was supplemented by a compact hand plate . The patient was transfused 8 units of whole blood, 3 units of fresh frozen plasma and 8 units of packed red blood cells . Intra - operative hb was 9.7 gm%; the average mean arterial pressure was 91.82 mmhg during the operative procedure . Post - operatively the patient was transfused 2 units of whole blood and 1 unit of fresh frozen plasma . The hb postoperatively was 10.3 gm%, the patient was shifted to intensive care unit for a day, later was transferred to the ward . The post - operative x - ray (fig . 2a) and ct scan revealed an acceptable reduction of the fracture fragments and a concentric hip . Sitting up was performed on the first postoperative day; the patient subsequently began formal physical therapy and active range of motion exercises . Partial toe touch weight bearing (20 to 30 lb; 9 to 13.6 kg) with a walker was maintained for 6 - 8 weeks . Progression to full weight bearing was started on the basis of the follow - up radiographs . The patient's 4-month postoperative x - ray revealed a radiolucent lesion in the superolateral part of femoral head, crescent sign, and sclerosis . 2b) showed collapse and sclerosis, findings consistent with onfh . A ct scan (fig . On was diagnosed only when the radiographic findings provided a clear differentiation from wear of the femoral head2). The joint pain increased due to the onfh, we performed a total hip replacement (fig . 3b) 12 months after the index surgery . Late complications of acetabulum fractures include heterotopic ossification and onfh, which are present in less than 10% of the population3). The incidence of onfh is known to be high in transverse and posterior wall fractures associated with posterior dislocation6). On also occurs in conjunction with approximately 3% of anterior hip dislocations and in more than 13% of posterior hip dislocations . In a recent meta analysis of 3,670 surgically treated displaced acetabular fractures the incidence of onfh showed an overall incidence of 5.6%3), suggesting that it is grossly overestimated and that most of the observed changes in the head of the femur are probably due to osteoarthritis5). Onfh is caused by inadequate blood supply to the affected segment of the subchondral bone . When posterior surgical approaches have been used, on rates as high as 42% within the first year after surgery have been reported7). Many systemic conditions are associated with on, but 25% of all cases are described as idiopathic and can contributes as a cause9). Trauma is one of the most common causes of on, interruption of the blood supply to the affected segment of the bone being the cause of ischemia . In this case the exact cause of onfh eludes us, especially in the absence of any patient related predisposing risk factors, except presence of fracture without hip dislocation and subsequent intervention by an ilio - inguinal approach . A probable theory of etiology could be the intra - operative hypovolaemia, low mean arterial pressure, causing compromised flow to the femoral head being so as to act as the final blow . Alteration of the blood supply to vital organs during hypovolaemia is well established . With mean arterial pressure usually in the range of 50 to 60 mmhg, the flow to the femoral head is potentially compromised10) so as to act in an accumulative stress theory, as suggested by kenzora and glimcher9). It is questionable as to whether this alone would be enough to explain the development of on.

Pericardiocentesis is an invasive procedure which is usually performed in a patient who has pericardial effusion to resolve the pressure in the pericardial sac . In 1653, riolanus (1) first described as a trephination of the sternum to relieve fluid surrounding the heart . Due to frequent complications this procedure was out of interest until ultrasound guided technique emerged (2). Herein, we report a case of iatrogenic tension pneumopericardium, which exhibit impending cardiac arrest . A 70-year - old male presented with severe dyspnea and general weakness on march 8, 2013 . He was referred from a local hospital for pericardiocentesis and further work - up due to a large pericardial effusion . He had a past medical history of ischemic stroke 15 years prior to his visit to the hospital and of syncope a day before his visit to the hospital . The vital signs of the patient in the emergency room (er) were as follows: blood pressure of 163/93, heart rate of 135 beats per minute, respiratory rate of 30 breaths per minute, body temperature of 37.0c, and oxygen saturation of 91% . The patient had distended neck veins and muffled heart sounds but did not have low blood pressure . Echocardiography was performed by an emergency physician, and a right ventricle (rv) free wall collapse in was observed in the diastolic phase . An emergency pericardiocentesis was indicated, and it was performed by a subxiphoid approach . Approximately 700 ml of serous effusion was drained through a catheter; the patient s heart rate dropped to 110 and his blood pressure was maintained above 130 . A water - sealed chest tube bottle was connected at the end of the catheter for further drainage . The patient was transferred to a computerized tomography (ct) room for a chest ct to examine the cause of his pericardial effusion . Before he left after the patient returned to the er from the ct room, his heart rate fell to 30, and he exhibited impending cardiac arrest . An intravenous dose of 0.5 mg atropine was given, and the patient was hydrated with crystalloid solution . The patient s chest ct confirmed tension pneumopericardium, and imaging showed that pericardial air was compressing the right ventricle and that the catheter tip was placed behind the left ventricle (lv) (fig . 1). Approximated 500 ml of pericardial air was evacuated rapidly through the previously implanted catheter, and the patient s vital sign became stable . The patient was admitted to the intensive care unit and subsequently transferred to a long - term care hospital . A contrast - enhanced computed tomography scan of the chest . (a) axial view showed the air compressing the right ventricle (arrows) and tip of the catheter inside pericardium (arrow head). Pneumopericardium is defined as the presence of air inside the pericardial space . In 1910, wenkebach first described the x - ray findings of pneumopericardium, and in 1967, cimmino (6) described the diagnostic features of pneumopericardium . In a review of the literature, toledo et al . (7) classified the etiology of pneumopericardium into four categories: iatrogenic, pericarditis, fistula formation between the pericardium and an adjacent air - containing organ, and trauma . (8) reported that trauma and positive pressure ventilation are the major causes of pneumopericardium . Iatrogenic cases of pneumopericardium associated with various procedures, such as thoracentesis, paracentesis, poststernal bone marrow aspiration, postcauterization of esophageal webs, pericardiocentesis, radiofrequency ablation, and pacemaker insertion, have been reported (7910). If the patient has tension pneumopericardium, physical examination may show tachycardia, distended neck veins, and hypotension . In 1844, bricheteau was the first to describe the mill wheel murmur in auscultation, which is a characteristic churning or splashing auscultatory sound due to blood mixing with air in the pericardial sac . A chest x - ray showing air surrounding the heart and the small heart sign pericardial air can be mistaken for mediastinal air, but the air in the pericardial sac does not rise above the pericardial reflection of the proximal great vessels . Also a chest x - ray taken from the decubitus position may show a shift of air if the air is in the pericardium, but mediastinal air does not shift (12). A small amount of air in the pericardial sac is indistinguishable by plain chest x - ray but can be detected by ct scan . Bedside echocardiography in the er is an alternative method for detecting air in the pericardial sac, but a large amount of air may hinder the penetration of the ultrasound beam, so diagnosis by this method may be challenging . The needle should be placed 1 cm inferior to the left xiphocostal angle at a 30-degree angle to the skin . It should be aimed toward the left shoulder and advanced while maintaining negative pressure (13). After the insertion of the catheter, a drainage tube is connected to a water sealed device . In our case, a conventional chest tube bottle was used, and during transportation to the ct room, the drainage device was not clamped ., the water in the bottom of the bottle could have swung back and forth . Originally, the tube connected to the catheter would have been sealed with water, but this swinging motion would have provided the opportunity for air to enter the catheter and, subsequently, the pericardial sac . Iatrogenic pneumopericardium is rarely reported after pericardiocentesis, but it can lead to tension pneumopericardium, which is a life threatening condition . Physicians should be aware of this serious complication of pericardiocentesis and take extra precautions in handling drainage devices because this iatrogenic complication can lead to cardiac arrest and a medical dispute.

Vehicles, which are characteristics of civilization have turned into a big problem in different social and public health respects due to increasing the number of the road and city accidents and high mortality rate . The most important factor behind death of those who are between one to forty is injuries caused by the variety of accidents that includes 12% of illness being; furthermore, this one is a third factor behind the total mortality . Meanwhile, causes of injuries are including road accidents and findings of world health organization (who) show that 25% of losses due to injuries throughout the world . It is predicted that until 2020, the number of death cases due to driving accidents increase up to 65% throughout the world and up to 80% in developing countries . The vital point is to the extent that who suggested the motto of safe road in 2004 . The organization has put the responsibility upon the health department for collecting information, investigating about driving accidents, and interfering in traffic safety . Iran has one of the highest rates of road traffic crashes mortality rates in the world; furthermore, driving accidents, after heart maladies, is nationally regarded as the second factor behind death in iran . The road traffic crashes mortality rate in iran was 30/100,000 people in which is 23 and 14 times higher in comparison with the world and eastern mediterranean respectively . According to the statistics of iranian legal medicine organization, from the perspective of losses rate, the number of dead people due to accidents had 10% growth in the year . The index of the number of death to one hundred thousand persons has had an ascending trend over the last decade and has increased from 5.20 in 1996 to 5.40 in 2006 . Growth rate of the index has almost been stopped due to reduced birth rate and measures adopted in the safety area, to an extent that the number has reached 31.2 in 2009, which reduced 25% in comparison with 2006 . However, according to the statistics of road maintenance and transportation organization of iran, the number of accidents, injuries and its losses is still increasing every year . Traffic accidents are a complex phenomenon, which is caused by the non - linear combination and interaction of homogeneous agents . Vital factors involved in occurrence of incidents are man, vehicles, road and environment from which contribution of man factor has been calculated 95%, the road and environment 28% and of vehicles 8% . Analyzing the road accidents in iran shows that from the four factors, man is accounted as the most important agent of accidents . Among these factors, drivers errors, risky behaviors of some professionals in the roads and a large portion of the public are the biggest contributors to the incidents . Risky driving, defined as those patterns of driving behavior that place drivers at risk for morbidity and mortality involving legal violations but not alcohol or drug use, is a main risk factor for traffic crashes . Risky driving has been consistently recognized as a key contributor to road crashes, and many studies have observed an association between several risky driving behaviors and road crashes, particularly for younger drivers . Risky driving behaviors such as speeding, passing violations, tailgating, lane - usage violations, right - of - way violations, illegal turns, and control signal violations happen most frequently . Therefore, attempt to change the behaviors has a great impact upon reduction of accidents and their consequences . Changing risky driving behaviors like other risky behaviors, requires a concept basis for helping to explain how the behavior occurs, how health education is conducted and how health education affects this ongoing behavior . Driving will be dangerous especially if the driver is willing to take the risk in the roads . Many people engage in driving behaviors that are risky, either inadvertently or with the intention to take the risk . Perhaps because they tend to be inexperienced and lack the skills needed to negotiate difficult on - road driving situations or having positive attitudes to taking risks . Risk taking has been identified as an important contributor to occurrence of many health problems like accidents . Classic definition of risk is incidence as well as consequences that follow necessarily . Whereas, the definition of risk in incidence is what is engaged in behaviors, which includes potential negative outcome . The relationship between risk taking attitude and risky driving behaviors has been proved . In recent years, our country has been turned into a center of crisis, moreover; recent studies and investigations of world bank have officially considered the state of iran traffic safety critical . Based on the reports of the legal medical organization and road maintenance and transportation organization of iran, 241240 of people have been killed on roads over 1380's . Drivers, and the highest mortality rate in vehicle accidents was related to motorcars . Many factors have a role in incidents; the outcome of every unsafe action is an incident which will result in death or injury of drivers and passengers . Due to this matter that individuals must avoid risks intrinsically, and saving themselves and others lives is a religious and intellectual duty it is questionable that why risk taking and doing risky behaviors are in high levels? The most widely method used to investigate risky driving behaviors is based on self - reports which is the best method to collect information . Risk taking can be measured by a questionnaire having two items of risk taking behaviors and risk taking attitudes . Hence, in the present study, data collection tool is a questionnaire that measuring risk taking by two items of risky driving behaviors and risk taking attitudes . To design the questionnaire, the first part includes demographic information and accident records and the second part includes risky driving behaviors and risk taking attitudes, in which respondents show every deviation in driving by likert scale from 1 (never) to 5 (almost always). Risky driving behaviors include speeding, distraction while driving, aggressive driving, violation of the road laws, not using the seat belts and incautious driving . Risk taking attitudes include attitudes toward rule violation and speeding, attitude toward the careless driving of others and concern for others [figure 1]. This cross - sectional study was carried out in the center and west of iran (isfahan and kermanshah) upon 540 ordinary and taxi drivers who were driving regularly from bus terminals and travel agencies to other cities . Because an overwhelming majority of inter - urban drivers consists of men, therefore then data were analyzed by the spss v.18 software by using the pearson correlation, and logistic regression . After devising the questionnaire, to assess its validity, experts were asked to judge . In fact, the questionnaire was given to experts and chief of road police officer in isfahan to modify questions . In a pilot study, to assess reliability, 30 professional drivers were asked to answer questions and mark the ones which were unclear . Data obtained were analyzed by the spss v.18 software to assess the validity and reliability . To assess the stability of indices, cronbach's alpha test was used, which was equal to 0.863 . As it can be seen in table 1, the amount of cronbach's alpha is at a high level in most cases . Number of items, mean scores and cronbach's alpha for all measures the mean age of drivers with driving experience of 17.62 12.61 was 41.39 13.21; also 15.6% had bsc and upper degree, 55% had diploma degree, and 29.4% had degree under diploma . 51.5% of drivers had the experience of accidents (in the last year had at least one accident) and in 47.8% of the accidents occurred, driver had driving offense . 11.5% of these accidents have resulted in physical injuries . From these persons, 1.9% has reported their skill level of driving weak, 54.4% good, 34.4% very good, and 18.3% excellent . There is a high correlation between risk taking attitudes and risky driving behaviors (p <0.001, r = 0.442). In table 2, the relationship between different variables has been displayed . There is a positive significant relationship between most variables and just between distraction while driving, and concern for others a reverse relationship was noticed . Intercorrelations (pearson's r) between factors measuring risk taking (n=540) the results of logistic regression test showed that both independent variables of risky driving behaviors and risk taking attitudes are important for predicting the amount of individual's risk taking (p <0.001). However, risky driving behaviors had the highest regression coefficient (= 0.73 for risky driving behaviors and = 0.43 for risk taking attitude) which shows that risky driving behaviors have an important impact upon the rate of drivers risk taking . The logistic regression test also shows that risky driving behaviors can be a predictor driving accidents due to individuals risk taking (p = 0.014). Aggressive driving, violation of the road laws and distraction are predictors of high risky driving behaviors, and attitude toward rule violation and speeding are predictors of risk taking attitudes (p <0.001). Among all of these variables, attitude toward rule violations and speeding, aggressive driving and violation of the road laws respectively are most important predictors of drivers risk taking (p <0.0010) [figure 2]. Estimated model (n = 540) total mean of all risky driving behaviors was 2.01 0.38 and total average of risk taking attitudes was 1.98 0.46 . It has also been specified that among risky driving behaviors, the following behaviors have allocated the highest percents to themselves respectively: wrong and improper overtaking, not giving up against other drivers behaviors, talking with other passengers while driving and not reducing the speed while drivers behind are trying to overtake . Given risk taking attitudes of drivers, a majority of them agree that rule violation is not an indicator of a bad driver . On the contrary, they believe that driving with high speed is exciting, and a good driver is a person who can drive faster than others . Finally, it was clarified that there is a reverse relationship between rate of drivers risk taking and age (p <0.001); namely, by aging, the rate of risk taking has been reduced [chart 1]. There is a significant relationship between the rate of risk taking and educations (p <0.001). In fact, risk taking in those who have bsc and upper degree is significantly more than that of those who are under diploma [chart 2]. Correlation between age and risk - taking variables correlation between education and risk - taking variables there was also a reverse relationship between rate of risk taking and driving experience (p = 0.037). There is a significant relationship between the rate of risk taking and number of accidents . In other words, those who had more accidents had more rate of risk taking (p = 0.037). Totally, the rate of drivers risk taking was more moderate (83.1%) and none of the individuals of the population had high - risk taking [chart 3]. Most of studies have used interview, questionnaire and polls to analyze driving accidents or they benefited from an observational study methods to determine different errors of drivers and the errors, which create existing conditions in road accidents . Self - reports of driving accidents can be an indicator of individual's driving behaviors in future, also one of the major motivations of man for a driving offense is their risk taking . In the present study, which has been carried out about aiming at measuring the amount of risk taking, a questionnaire has been designed as much as possible according to the islamic culture of iran . Because drivers behaviors are different from that of other countries such as using alcoholic drinks, which is a normal matter in other countries but in our country is opposite to our religion and rule, it is not possible to use the questionnaire designed in other countries . However, the questionnaire had high validity and reliability to measure the amount of risk taking in iranian drivers . In studies which have done to measure risk taking, respondents were asked to show how they take risks in a variety of actions (with responses from never too often). The average score in every scale was made based on existing items inside each scale . High score in the scale showed that driving is highly dangerous . In the questionnaire, risk taking was also measured by likert scale and the average score has been made up of existing items . Like other studies, a significant relationship was noticed between two variables of risk taking attitude and risky driving behaviors, it is unlike other studies carried out upon this respect which showed that attitude is predictive of risk taking, in the present study, risky driving behaviors are a stronger predictors of risk taking in iranian drivers . However, in these studies it has been mentioned because attitude and behavior are measured simultaneously, it is difficult to claim that attitude is predictive of risk taking . The results show that in iran although attitude toward risk taking has been located at a low level by different ways, a desired result was not obtained from the reduction of those high risky behaviors; in fact, high rate of accidents and traffic incidences in iran indicate this matter well . Furthermore, between these two variables, just risky driving behaviors are predictive of accidents due to risk taking of iranian drivers, which is congruent with other studies . Moreover, from among a variety of variables have been mentioned in the study, attitude toward rule violation and speeding are the strongest predictive for risk taking of iranian drivers, which absolutely match the findings of a study carried out by shams in iran and iversen . The results of the present study showed that there is a reverse relationship between the rate of drivers risk taking and age; which means, by increasing the age, the amount of risk taking has been reduced . This is congruent with most studies carried out in this field like the studies carried out by fernandes et al ., tronsmoen . When drivers are young, they are willing to speed and do high risky behaviors due to lack of sufficient skills and internal excitement . By aging and increasing the results also showed that there is a reverse relationship between the amount of risk taking and driving experience as a study carried out by lin in taiwan showed that risk taking is reduced by increasing the experience . Educational level is an effective agent upon drivers perception while driving in traffic flows . If a person had a suitable education, their perception from environmental conditions and dangerous factors would grow, and they would pay more attention to road signs and barriers . In the present study, there is a relationship between the amount of risk taking and education . In fact, risk taking of those who have bachelors or higher degree is significantly more than those who are under diploma . Similar results were reported by tuokko, that is, congruent with a study carried out by almadani . In the present study, in other words, those who had more accidents have obtained a higher risk taking score . In the study carried out by lin et al . Upon the impact of accident experience on risk taking in young persons, they concluded that those who have accident experience have obtained a higher risk taking score based on risk taking factors . The current study shows that more evaluation is required concerning the impact of traffic safety interventions on attitudes and behaviors of iranian drivers . To reduce the amount of risk taking, the first important factor is increasing police control, reforming the penalties and effectiveness of driving fines . One of ways for effectively of driving fines is making the deadline of fines payments in a short time . Another factor is culture building in a way that driving laws be institutionalized . In the driving test in iran, attention is paid to the driver celerity more than any other factors . Whereas, in countries which have more organized driving laws, compliance with laws is noticed more and training needed is provided in this respect . Insurance policies need to be modified in our country . To increase the amount of the risk aversion and need to be arranged, according to the driver's character and records.

She was referred to saitama hospital due to severe headache and nausea on october 2008 . Brain mri detected a 1.5 cm abscess mass with extensive edema in the right frontal lobe . We performed intensive therapy using some antibiotics that included cefotaxime and meropenem and depressants for intracranial pressure for six weeks . There was a good prognosis for the woman and her fetus without any sign of neurological abnormalities . Early medical intervention is required before it is too late for brain abscess in pregnancy . Brain abscess caused by bacterial infection has extremely low incidence, and a high mortality rate of 30% . It causes poor prognosis for both mother and fetus, regardless of the state of pregnancy . Unlike non - pregnant women a 24-year - old woman who lived in saitama, japan had three pregnancies, two childbirths, body mass index (bmi) of 22.3, and unremarkable past medical and family histories . She also had an uneventful first trimester, but developed a fever of> 39c at 22nd week, 1st day of pregnancy . Because of prolonged headache and nausea, she was referred to our hospital in saitama for complete physical examination on october 2008 . On admission, she had blood pressure of 103/51 mmhg, heart rate of 100 beats per min (bpm), body temperature of 39.0c, mild stiffness in the neck, and cold extremities . However, brain computed tomography (ct) for the prolonged headache revealed a 1.5 cm mass in the right frontal lobe, while hematological analysis showed an elevated white blood cell count of 12,400 cells/l (neutrophils, 87.7%). Cerebrospinal fluid findings were positive for gram - positive bacteria, an increased cell count (especially for neutrophils) of 2,332 cells/l, and a low glucose concentration of 30 mg / dl . Brain mri revealed a 1.5 cm mass with a high intensity signal inside and a low intensity t2 signal on the margin in the deep white matter of the right frontal lobe . Based on the above findings and a high intensity zone surrounding the mass on diffusion - weighted images, she was immediately placed on intensive therapy with concurrent administration of antibiotics cefotaxime (2 g / day) and meropenem (3 g / day), as well as glycerin 20 g / day to reduce intracranial pressure . Table 1 shows a list of examinations performed in search of causal factors, while the results show the isolation of methicillin - sensitive staphylococcus aureus (mssa) from the throat . On the other hand, she had no dental problems . Because of unremarkable upper gastrointestinal endoscopy findings and a negative fecal occult blood test result, the possibility of brain metastasis of a malignant tumor was ruled out . After six weeks of intensive therapy with concurrent administration of two antibiotics and glycerin, the headache and nausea disappeared along with a reduction in the number of white blood cells . Subsequent brain mri at 28th week, 4th day of pregnancy showed no enlargement of the abscess and disappearance of the surrounding edema, with no indication of puncture drainage . At this point, she was switched to oral administration of amoxicillin 750 mg / day for four weeks and was discharged at 29th week, 3rd day of pregnancy . Body temperature slowed down after the day 7 causes of brain abscess mssa: methicillin - sensitive staphylococcus aureus, cns: coaglese negative staphylococcus she vaginally delivered a 2,890 g girl baby at 38th week, 5th day of pregnancy, with no abnormalities . No neurological abnormalities were evident during a five - year follow - up observation conducted over the phone . Mri findings at the 22nd and 28th week of pregnancy are shown in figure 2 . A: axial image at 22ne week of pregnancy shows the large right frontal abscess with severe edema . B: axial image at 28th week of pregnancy shows no enlargement of the abscess and disappearance of the surrounding edema despite the extremely low incidence, brain abscess caused by bacterial infection has a high mortality rate of 30% and is therefore a disease with poor prognosis for both mother and fetus, regardless of the state of pregnancy . Although we listed previous reports on brain abscess during pregnancy (table 2), it should be noted that the number is extremely small (16). Approximately, 7% of the previous cases were related to dental treatment (7), but no dental abnormalities were observed in the present case . During the pregnancy, maternal immunity is reduced due to a hormonal imbalance, and according to lanciers et al ., 26.6% of pregnant women, as opposed to 11.0% of non - pregnant women, are significantly infected with helicobacter pylori (8). It goes without saying that organisms with low pathogenicity under normal circumstances can cause serious infection during pregnancy . In this case, the clear source of infection was not identified . It seems that the pregnant woman whose immunity was diminished is vulnerable to mssa, which was extremely rare and considered as a serious case . Brain abacess in pregnancy (literature review) the symptoms of brain abscess include headache, nausea, and localized neurological abnormalities (9). Headache is the most common symptom, occurring in 75% of pregnant women, followed by 67% of neurological abnormalities and 58% of altered consciousness (10). Although no adverse effects of mri have been reported (11, 12), the ct should be avoided as much as possible because there are some problems about the degree of radiation exposure in pregnant women . Therefore, mri may be a safer and is a highly sensitive diagnostic imaging modality for use in pregnancy (13). Yet, because of potential thermal tissue damage due to the high magnetic field, the national radiological protection board recommends that pregnant women avoid mri examination during the first trimester . To treat a brain abscess, it is necessary to select antibiotics capable of effectively crossing the blood brain barrier and their sensitivity should be proven in bacterial culture . The use of steroidal drug is also recommended to prevent an increase in intracranial pressure and the development of brain edema (13). However, because intensive therapy for a brain abscess with antibiotics and steroidal drugs takes somewhere between six to eight weeks, its effect on the fetus is a huge concern . Betamethasone and dexamethasone, which are transported via the placenta, should be avoided because they may affect the development of the fetal central nervous system . Furthermore, the early administration of antiepileptic drugs is recommended because 70% of patients with a brain abscess develop epilepsy (13). Even infection by vulnerable bacteria becomes serious and early treatment intervention is desirable because immunity power diminishes during the pregnancy . Our treatment obtained ethics approval from the regional ethics committee responsible for human experimentation and conformed to the provisions of the declaration of helsinki.

Caustic esophageal injury in infants is a devastating insult to the gastrointestinal tract and will often require major reconstructive surgery to replace the damaged esophagus . Esophageal replacement with colonic interposition has been utilized since dale and sherman performed the first retrosternal colonic interposition in 1955 . Up to 80% of patients with colonic interposition endoscopic dilation is relatively safe and effective for the initial treatment of anastomotic strictures, but surgical management is indicated in refractory cases . When surgery is required, graft revision utilizing both a thoracotomy and laparotomy is common . We report a case of cologastric stricture treated with resection and reconstruction of the anastomosis solely through an abdominal approach, which can offer less morbidity and mortality . A 31-year - old male developed a caustic esophageal injury after ingestion of an alkaline solution when he was 2 years old . He required emergent esophagectomy, proximal gastrectomy and reconstruction with a colonic interposition graft from the cervical esophagus to the stomach . The patient also had a pyloric stricture, for which a gastrojejunostomy was performed . Over the next three decades, he required frequent hospital admissions for abdominal pain and dysphagia, and had multiple endoscopic dilations performed for a severe cologastric anastomotic stricture (fig . The patient had severe malnourishment, with a body mass index of 14 kg / m . He had a jejunostomy feeding tube for nutritional support, which had been removed due to abdominal pain a few months prior to presentation . Endoscopic evaluation revealed the severe cologastric stricture, severe inflammation just proximal to the cologastric anastomosis, and significant ulcerative disease at his gastrojejunal anastomosis . The patient underwent resection of the cologastric anastomosis and the gastrojejunal anastomosis with ulcerated stomach, neo - cologastric anastomosis and neo - gastrojejunal anastomosis via a transabdominal approach without a thoracotomy . Intraoperative endoscopy was utilized during the case to ensure that the cologastric anastomotic stricture was entirely resected . Figure 2:preoperative cologastric and pyloric strictures (a) and post - operative changes including new cologastric, gastrojejunal, duodenojejunal anastomoses (b). Preoperative cologastric and pyloric strictures (a) and post - operative changes including new cologastric, gastrojejunal, duodenojejunal anastomoses (b). The patient tolerated the procedure well and was transferred to the intensive care unit . On post - operative day 2, he was transferred to the floor . His post - operative course was remarkable for development of an intra - abdominal fluid collection, which required percutaneous drainage, but was otherwise uncomplicated . Severe esophageal damage may require resection with creation of a neo - esophagus . Because these operations occur in children, complications in regards to the colonic interposition graft classically, a transthoracic approach has been used to resect the entire colonic graft . In this situation, a repeat colon graft may be needed, which carries high morbidity and mortality . In particular, the majority of the proximal colon graft, which was functional, was able to be spared . Given our patient's preoperative nutritional status, he would be at a predisposed risk for wound healing complications . Via transabdominal approach, to the best of our knowledge, this is the first written report of using a completely transabdominal approach for revision of the colonic graft . Our patient had previously been refused surgery by multiple surgeons . If this relatively less complex surgical management was used, perhaps he would have had definitive treatment much earlier . Our patient did well with our transabdominal approach given the chronicity of his symptoms . In light of his clinical dilemma of continued non - operative versus operative intervention, his symptoms were relieved immediately . This surgical approach should be considered in patients with history of colonic interposition requiring reoperation for complications of the colonic graft.

Panic disorder (pd) is characterized by unexpected recurrent panic attacks that lead to distressing thoughts about future episodes, physical harm, and maladaptive preventive behaviors.1 the main characteristic, lack of objective triggers or clues, is helpful to distinguish pd from panic attacks that occur in the context of other psychiatric disorders . A panic attack is defined as a rapid and intense peak of fear presenting with physical impairments, such as accelerated heart rate and excessive sweating, and also cognitive symptoms, including fear of death or losing control . Pd is one of the major anxiety disorders to be managed by several genetic factors.2 the red cell distribution width (rdw), which is a measure of heterogeneity in the size of circulating red blood cells, is a component of the complete blood count . It is calculated as a percentage of the standard deviation of the red cell volume divided by the mean corpuscular volume . The rdw is commonly used to distinguish iron deficiency - induced microcytic anemia and thalassemia, or hemoglobinopathies - related anemia . Increased rdw levels are often caused by impaired erythropoiesis or erythrocyte degradation.3 recent studies have suggested a relationship between increased rdw levels and certain diseases, such as cardiovascular disease (cvd).4 moreover, there is a growing amount of evidence showing that inflammation has a key role in the pathogenesis . The rdw has been also shown to be associated with inflammatory markers in many disorders.5,6 platelets, which are useful to study the intracellular signal transduction, have been extensively used in psychiatry as a peripheral model of the serotonergic system, since they express the 5-hydroxytryptamine (ht) 2a receptors and 5-ht transporters identical to those present in the brain.7,8 the uptake of the 5-ht platelet from the plasma is mainly dependent on the 5-ht transporter . Platelets may indicate biochemical alterations happening in the brain under several psychiatric conditions.9 current studies have suggested that platelets may be affected by diverse stressors, including psychological ones . Platelets offer an interesting vantage point for understanding the neurophysiology of various psychiatric disorders.9 the mean platelet volume (mpv), which is the measure of the platelet size, is the main determinant of the platelet function.10 although previous studies have investigated the role of mpv levels in pd, many have shown limited and controversial findings . On the other hand, to the best of our knowledge, therefore, we aimed to evaluate, for the first time, the rdw levels combined with mpv levels in patients with pd . This retrospective study included a total of 30 treatment - nave patients who were diagnosed with pd (study group) and 25 age- and sex - matched healthy volunteers (control group) between 18 and 59 years of age in the emergency medicine department of harran university . The patients with pd were diagnosed by a psychiatrist, according to the diagnostic and statistical manual of mental disorders, fifth edition criteria . Patients with hypertension, iron deficiency anemia, liver disease, coronary artery or heart valve disease, neurological deficits, pulmonary diseases, endocrine disorders, and urinary tract infections were excluded . The control group consisted of a total of 25 healthy asymptomatic subjects with a nonspecific medical history and normal physical examination findings . None of the control subjects were on any medication or antioxidant vitamin supplementation, such as vitamins e and c. they were all free of acute or chronic diseases . The study was conducted in accordance with the principles of the revised 2000 declaration of helsinki . The white blood cell count (wbc), mpv, and rdw levels were measured in both groups using the same devices and kits . Abbott cell - dynruby cell - dyn 3200 system device (abbott laboratories, santa clara, ca, usa) was used for the analysis of complete blood count . This retrospective study included a total of 30 treatment - nave patients who were diagnosed with pd (study group) and 25 age- and sex - matched healthy volunteers (control group) between 18 and 59 years of age in the emergency medicine department of harran university . The patients with pd were diagnosed by a psychiatrist, according to the diagnostic and statistical manual of mental disorders, fifth edition criteria . Patients with hypertension, iron deficiency anemia, liver disease, coronary artery or heart valve disease, neurological deficits, pulmonary diseases, endocrine disorders, and urinary tract infections were excluded . The control group consisted of a total of 25 healthy asymptomatic subjects with a nonspecific medical history and normal physical examination findings . None of the control subjects were on any medication or antioxidant vitamin supplementation, such as vitamins e and c. they were all free of acute or chronic diseases . The study was conducted in accordance with the principles of the revised 2000 declaration of helsinki . The white blood cell count (wbc), mpv, and rdw levels were measured in both groups using the same devices and kits . Abbott cell - dynruby cell - dyn 3200 system device (abbott laboratories, santa clara, ca, usa) was used for the analysis of complete blood count . There were no statistically significant differences in the age and sex between the two groups (p>0.05). The mean wbc, mpv, and rdw levels were 9,173.032,400.31/mm, 8.191.13 fl, and 12.471.14%, respectively, in the study group . These values were found to be 7,090.241,032.61, 6.850.67, and 11.630.85, respectively, in the healthy controls . The wbc, mpv, and rdw levels were significantly higher in the patients with pd, compared to healthy controls (p=0.001, p=0.001, and p=0.003, respectively). There was no significant difference in the platelet number between the study and control groups (p>0.05). This study is the first to demonstrate that patients with pd have significantly higher rdw levels, compared to the healthy controls . In addition, wbc, mpv, and rdw levels were significantly higher in the patient group, compared to the control group . Several study findings have demonstrated that there is a blood brain relationship between platelets and the neuronal 5-ht transporter.11 previous studies have shown that is a correlation between platelets and synaptosomal re - uptake . Parallel similar changes can be found in the human blood, brain and cerebrospinal fluid 5-ht levels, following the administration of 5-ht - releasing agents . Furthermore, some authors have suggested an association between depression and an increased risk of vascular events due to the platelet dysfunction . In addition, a meta - analysis confirmed the previous reports, suggesting a correlation between platelet 5-ht uptake and depression.11 depression and anxiety disorders have been suggested to be the main risk factors in the etiology of mortality in cvd.12 anxiety disorders have been demonstrated to increase the risk of myocardial infarction,13 and cvd.14 pd is one of the most common anxiety disorders . Some authors have also shown an association between pd and cvd.15 at pathophysiological levels it has been hypothesized that biological mechanisms may be affected by stress - related conditions, resulting in worsening of cardiovascular functions . Platelet activity increases with the emotional stress, and coronary events such as myocardial infarction can be induced . Furthermore, increased mpv levels may indicate either increased platelet activation or an increased number of large and hyperaggregated platelets.16 our results showed that this increase may reflect the abnormality of platelets rather than increase in their counts . Although previous studies have investigated the mpv levels in pd, these results are limited and controversial . Kokacya et al17 found increased mpv levels in the patients with pd, compared to the mpv levels of the control group . On the other hand, gogcegoz gul et al10 reported reduced mpv levels in the patients with pd, compared to the mpv levels of the control group . In this study, we found significantly higher mpv levels in the patients with pd, compared to the mpv levels of the control group . Therefore, we conclude that an abnormal 5-ht metabolism in platelets may indicate the abnormal function of platelets and increased mpv levels . Furthermore, anxiety, depression, or disruptive behavior disorder have been shown to be associated with increased catecholamine levels, sympathetic activity, and cortisol secretion.18 in a study, vizioli et al19 reported that increased sympathetic activity could result in increased mpv values . Also, anxiety and depressive disorders have been demonstrated to be associated with increased inflammatory cytokine levels, endothelial dysfunction, and platelet reactivation . Some authors reported that platelets were stimulated by the sympathoadrenal activation through 2-adrenoreceptor activation.20 the activation of the platelets was shown to induce shape changes and increase mpv levels.21 in a study, ataoglu and canan reported increased mpv levels in patients with major depression.22 the authors also reported that mpv levels were statistically signifi - cantly lower compared to the baseline following treatment . In another study, aschbacher et al23 found a varying degree of alteration in platelets in patients with anxiety disorder . Moreover, another study reported that mpv levels could be increased due to the increased sympathetic activity.19 as a result, the increased mpv levels in patients with depression can be attributed to the increased sympathetic activity.25 the rdw is used as a predictor of mortality in the overall population.26 there are studies that reported increased rdw levels, despite being within normal reference ranges, were associated with adverse events in patients with heart failure, coronary artery disease, pulmonary hypertension, diabetes mellitus, alzheimer s disease, and stroke.27 however, the pathophysiology remains to be elucidated . On the other hand, to the best of our knowledge, the rdw levels of pd have not been reported, yet . In our study, we found a statistically significant difference in the rdw levels in the study group, compared to the rdw levels of the control group . Our study findings show that the mpv and rdw levels can be used in pd . We recommend these simple and relatively inexpensive methods for the initial examination and prognosis of the disease in these patients . In conclusion, this study is the first to demonstrate that the rdw levels combined with mpv levels significantly increase in patients with pd . We think that the increase in rdw and mpv levels can be attributed to the increase in sympathetic activity . We believe that increase in rdw and mpv levels can be used as a novel marker for pd . However, further prospective clinical studies are required to confirm these findings.

Peritoneal dialysis (pd) is a form of home - based renal replacement therapy for patients with end - stage kidney disease (eskd) that uses a patient's peritoneum as a dialysis membrane across which water and solutes (e.g., electrolytes and glucose) are exchanged between dialysis fluid and blood . Pd has several advantages including greater ease of technique to master, greater preservation of residual renal function (rrf), early survival advantage, and superior cost effectiveness compared to haemodialysis [13]. Greater preservation of rrf is significant as it leads to a better technique survival by enhancing pd adequacy and ultrafiltration capacity . Despite these benefits, the outcome of pd patients remains poor and cardiovascular events (cve) continue to be the leading cause of death in pd patients . Higher cve burden in chronic kidney disease (ckd) patients compared to those without ckd is astounding (proportion of patients without cve 38.7% versus 61.7%). Moreover, the relative risk of death is paradoxically higher in ckd patients identified as the lower risk group (i.e., younger patients or those with a lower prevalence of cve), supported by data from the united states renal data system . In contrast to the general population, advances in medical therapy for patients with cve (e.g., aspirin, lipid - lowering agents) have not decreased the cve - related burden in patients with eskd . An increase in the delivery of dialysis dose has not translated into a mortality benefit in pd patients . Additional risks have been attributed to the presence of nontraditional risk factors, such as inflammation, which have been shown to promote proliferation and infiltration of inflammatory cells into the tunica intima of small arteries, leading to the development of atherosclerosis and stenosis . An association between a decline in rrf in patients with ckd and progressively increased level of systemic inflammatory burden which is most marked in those receiving renal replacement therapy, such as haemodialysis, has been well established [11, 12]. At present, there is no clear evidence to suggest any significant difference in the systemic inflammatory burden based on the type of dialysis modality received (i.e., haemodialysis versus peritoneal dialysis). Inflammation can be defined as a localised protective response elicited by injury or destruction of tissues that serves to destroy, dilute, or sequester both the injurious agent and injured tissue . Hence, it is a physiological response and in the form of an acute response to infections, trauma, or toxic injury, it helps the body to defend against pathophysiological insults . However, if inflammation becomes prolonged and persistent in the form of the so called chronic acute - phase reaction, it may lead to adverse consequences, such as decline in appetite, increased rate of protein depletion in skeletal muscle, hypercatabolism, endothelial damage, and atherosclerosis [1419] (figure 1). There are several markers that can be measured to gauge the level of inflammatory burden, such as c - reactive protein (crp). Crp levels can rise rapidly and markedly in response to acute inflammatory stimulus from increased synthesis by hepatocytes to contribute to host defense and innate immune response . Its induction in hepatocytes in turn is regulated by cytokines such as interleukin-6 (il-6), which is a pleiotropic immunomodulatory cytokine that plays a critical role in many innate and acquired inflammatory processes . Dysregulation of il-6 signalling has been implicated in a variety of chronic disease pathologies and in immune and inflammatory diseases . However, the activities of these proinflammatory cytokines depend on the involved cell types and its microenvironment . For example, after an acute injury, tumor necrosis factor - like weak inducer of apoptosis (tweak) promotes tissue regeneration by stimulating progenitor cells but in chronic diseases where tweak is persistently activated it alters tissue repair by inhibiting differentiation of the same progenitor cells [22, 23]. The inflammatory pathways are clearly complex and dependent on many conditions (e.g., acute versus chronic, microenvironment) and therefore are often difficult to clearly characterise . In pd patients, inflammation can be broadly compartmentalised into two types, systemic and local intraperitoneal inflammation . As recently reported by the global fluid study, these two represent distinct underlying processes that likely require different preventative or therapeutic approaches . The reported prevalence of systemic inflammation measured using crp ranges between 12% and 65% in pd patients, depending on the cut - off value used to define the level of inflammation [25, 26]. A number of longitudinal studies have also been reported increasing burden of inflammation measured using interleukin-6 (il-6) with longer time on pd at both systemic and intraperitoneal levels [2729]. Interest in inflammatory markers as targets of therapeutic intervention has been considerable as they are recognised as predictors of poor patient outcomes (e.g., mortality). However, prior to embarking on strategies to reduce inflammatory burden, it would be of paramount importance to define the underlying causes that drive the chronically inflamed state . The present review aims to comprehensively describe clinical causes of inflammation in pd patients at which potential future therapeutic targets may be aimed . A number of studies have reported an association between lowered rrf and higher systemic inflammatory burden in predialysis and dialysis patients [30, 31]. It remains uncertain as to whether these associations are primarily a result of an impaired renal clearance of inflammatory cytokines, direct stimulation of cytokine generation by uraemic milieu, or simply a consequence of adverse effect of inflammation on rrf . The importance of renal elimination of proinflammatory cytokines was described using animal models where the half - lives of injected interleukin-1 (il-1) and tumour necrosis factor (tnf) were increased after nephrectomy . In addition, preclinical studies have demonstrated pathogenic mechanisms of uraemic toxins on inducing proinflammatory cytokine production and renal tubular cell injury via nuclear factor - kappa (nf-) and oxidative stress pathways, respectively . The direct stimulation of systemic inflammatory burden by uraemic toxins was further supported by the findings from a recent cross - sectional observational study of 149 chronic kidney disease (ckd) patients (mean egfr 40 9 ml / min/1.73 m; range 2559 ml / min/1.73 m) which showed that serum uraemic toxin levels (i.e., indoxyl sulphate) were significantly and independently associated with serum il-6, tnf-, and interferon- (ifn-) concentrations (unpublished). Nonetheless, the relationship between rrf and inflammation becomes less clear once patients commence dialysis due to the presence of dialysis - specific factors (e.g., peritonitis) that can stimulate systemic inflammatory cytokine production independent of the background rrf decline . In fact, the global fluid observational study involving 959 pd patients from 10 centres in korea, canada, and the united kingdom did not observe any significant association between patients' residual urine volume and systemic il-6 concentrations in their prevalent (p = 0.7) or incident cohorts (p = 0.3). Similarly, a biomarker substudy of the balanz trial was not able to demonstrate the presence of any statistically significant association between the loss of rrf and serum il-6 concentrations over the 24 months of follow - up period in the 175 incident pd patients (p = 0.27). In contrast to these reports, chung and colleagues described an association between a greater loss in rrf and higher serum crp concentrations (10 mg / l) after 12 months of pd in incident patients (p <0.05). Some of the differences in observed outcomes could have resulted from dissimilar statistical analysis techniques (e.g., continuous versus categorical data analyses) and the inflammatory marker measured (il-6 versus crp). Similarly, the impact of rrf on intraperitoneal inflammation remains unclear due to conflicting reports from published literature . A previous peritoneal biopsy study has observed significantly worse peritoneal membrane injury in patients with uraemia (predialysis) compared to those with normal renal function (p = 0.01). Therefore, it is plausible that the uraemic milieu itself may promote the extent of peritoneal injury and better preserved rrf may lower the intraperitoneal inflammatory burden associated with peritoneal injury . The global fluid study reported significantly lower levels of dialysate il-6 with a higher urine volume in their prevalent cohort (coefficient 0.1 per litre, p = 0.01) but not in incident cohort (coefficient 0.03 per litre, p = 0.2), whereas the balanz trial observed no significant association between rate of rrf decline with dialysate il-6 concentrations (n = 88, p = 0.67). Conclusions that can be drawn from these studies were however limited by the absence of longitudinal data and relatively small sample size [28, 29] which could have lowered the statistical power to detect differences in outcome . Therefore, at present, it remains uncertain as to what the true implication of rrf loss is, for systemic and local inflammatory burdens in pd patients . It is likely that rrf has some role in influencing these levels, but its impact may be overshadowed by the presence of other competing factors, such as infections or repeated exposures to pd solutions . Perhaps some of these questions can be better answered through future studies evaluating the relationship between presence of uraemic toxin levels and inflammatory markers in pd patients . The cumulative and progressive nature of peritoneal membrane injury with longer pd duration has been well documented . Conventional pd solutions are characterised by their acidic ph (5.05.8), high lactate concentrations (75.5214 mmol / l), high osmolality (320520 mosm / kg), and contamination by glucose degradation products (gdp) and have been shown to contribute to adverse outcomes demonstrated in preclinical studies [3941]. Repeated exposures to conventional pd solutions and peritonitis episodes contribute to peritoneal injury, which in turn is an important cause of local inflammation with resultant adverse functional outcomes, such as higher peritoneal solute transport rate (pstr) [4345]. Indeed, dialysate il-6 concentration has been identified as the most reliable predictor of pstr by a number of single centre studies and has now been substantiated by the large multicentre global fluid study [24, 27, 46]. Il-6 is secreted in large quantities by peritoneal mesothelial cells in response to inflammatory stimuli and is modulated by exposure to pd solutions . An increase in intraperitoneal il-6 concentrations with longer pd duration (i.e., at 24 months) was consistently demonstrated by extension studies of the balnet trial (biocompatible 57.6 54.5 pg / ml versus 143 69.6 pg / ml, p <0.001; standard 47 31.2 pg / ml versus 121 69 pg / ml, p <0.001) and the balanz trial (median 7.22 pg / ml versus 31.35 pg / ml, p <0.001). In contrast to these consistent results pertaining to the relationship between pd duration and intraperitoneal inflammation, there are contradicting reports about the impact of pd duration on systemic il-6 concentrations . In a single - centre, retrospective observational study of incident pd patients (n = 31) receiving treatment using conventional pd solutions, pecoits - filho and colleagues described a significant increase in plasma il-6 concentrations from baseline to one year (median 3.7 pg / ml versus 6.5 pg / ml, p <0.05). Similar results were observed from a substudy of the balanz trial (n = 175) at 24 months (p = 0.006). The global fluid study however described a longer pd duration as a significant predictor of a random plasma il-6 level in prevalent (coefficient 0.02 per year; p = 0.04) but not in incident pd patients (coefficient 0.2 per year; p = 0.4). Furthermore, a prospective observational study (n = 109) reported a lack of significant change in serum il-6 concentrations over twelve months . Although the reasons for such discrepant findings are unclear, some of the differences may stem from variations in the study design, differences in assay techniques and samples (serum versus plasma) used to measure il-6 levels, and the duration over which these changes were measured . Furthermore, whereas intraperitoneal inflammation is mainly driven by pd - related factors, such as repeated exposures to pd solution or peritonitis, systemic inflammation can be additionally influenced by many pd - independent factors such as systemic infection that could have affected the observed outcomes . A recent report by ayuzawa and colleagues suggests that some of peritoneal membrane injury from pd can be minimised by using pd solutions that are more minimisation of gdp formation has been achieved through development of the multicompartment bag system, which allows for heat sterilisation and storage to occur at a lower ph . Moreover, a bicarbonate - buffer system has been used to lower exposure to lactate . Several preclinical studies have demonstrated that use of these solutions has resulted in improved cytokine profiles and cellular function, including the host immune system [5156]. Therefore, the use of these biocompatible pd solutions may lead to changes in the intraperitoneal environment with the potential benefits of decreasing the level of intraperitoneal inflammatory burden and improving peritoneal membrane function (i.e., pstr). Indeed, cho and colleagues in their prospective observational study involving 187 incident pd patients described an increase in pstr in patients receiving standard solutions over 12 months unlike those treated using biocompatible solutions who maintained a stable pstr . However, this study suffered from a relatively high proportion of patient drop - outs (41.1%) and the choice of therapy (biocompatible versus standard) was at the discretion of each patient's treating physician, thereby introducing a risk of selection bias . More importantly, the study did not report whether there were any differences in the dialysate il-6 concentrations between patients who received standard versus biocompatible pd solutions . Over the past few years, several rcts conducted to examine differences in clinical outcomes from the use of biocompatible pd solutions have not been able to demonstrate a reduction in dialysate il-6 levels with its use [5759]. To date, only one study conducted by the bicarbonate / lactate study group reported a significant decrease in dialysate levels of il-6 in patients who received biocompatible pd solutions (n = 61) compared to conventional pd solutions (n = 31) over 6 months (p = 0.01). However, the strength of conclusions that can be drawn from these studies was restricted by large drop - out rates (> 20%), risk of carry - over effects due to cross - over design, and a lack of accounting for the confounding effect of peritonitis [5760]. More recently, the global fluid study and a substudy of the balanz trial explored the impact of biocompatible pd solutions use on dialysate il-6 concentrations and found no significant difference based on the type of pd solutions received [24, 28]. Comparable results were yielded when analyses were repeated in the peritonitis - free cohort (n = 56). The results from these studies were also however challenged by several limitations including lack of detailed examination of the history of biocompatible pd solutions exposure in the study participants (i.e., patients indicated as using biocompatible pd solutions could have been treated with conventional pd solutions prior to study entry), analysing data in a cross - sectional manner, the risk of selection bias, and a small sample size (n = 88). Therefore, at present, based on a generally suboptimal level of evidence, there is no convincing effect of biocompatible pd solutions use on decreasing the level of dialysate il-6 . The use of biocompatible pd solutions may theoretically decrease the inflammatory burden at a systemic level by lowering the extent of peritoneal injury and gdp - mediated nephrotoxicity leading to residual renal function decline . N = 50) were the first to present the data demonstrating an improvement in systemic inflammation levels, as evidenced by lower serum crp measurements, in patients using biocompatible pd solutions at 12 months (1.77 0.42 mg / l versus 7.73 2.42 however, several rcts comparing the effect of biocompatible pd solutions to standard pd solutions on systemic il-6 concentrations have not been able to demonstrate any differences between patients receiving biocompatible or standard solutions [29, 48, 58, 59, 63]. Although the lack of difference observed between the two groups could have resulted from relatively short follow - up (i.e., <12 months), cross - over study design, inclusion of biocompatible pd solutions with higher gdp content [59, 63], small sample size, or a large drop - out rate, it could be a real phenomenon . Therefore at present, based on the best available evidence, in spite of a demonstrated beneficial effect on maintaining stability of pstr, the use of biocompatible pd solutions does not appear to lower the burden of inflammation at both systemic and intraperitoneal levels . Whilst the majority of the literature has attributed morphologic and functional changes of the peritoneal membrane to pd solutions and peritonitis, the pd catheter itself can also induce peritoneal inflammation independently with associated disruption of peritoneal membrane integrity [64, 65]. Certainly, the development of biofilm bacterial growth in pd catheters due to skin bacteria and pd peritonitis episodes is well acknowledged and can lead to dissemination of bacteria into the pd fluid with resultant peritonitis . However, there are reports of proinflammatory responses associated with the use of pd catheters independent of bacteria - related biofilm . For instance, flessner and colleagues described amplification in the peritoneal inflammatory response and peritoneal membrane injury in rodent models when they administered low - gdp bicarbonate - buffered solution via catheters compared to needle - injection over a 20-week study period . They also observed formation of a sterile inflammatory cell layer (i.e., biofilm) within the catheter lumen, which they proposed as a source of proinflammatory cascade . Although the applicability of their findings to humans remains questionable, these results raise questions about the role of pd catheters in promoting inflammation in pd patients . Pd - related peritonitis is an important source of inflammation at both intraperitoneal [70, 71] and systemic levels [72, 73] and contributes to approximately 20% of pd technique failures and 26% of deaths [75, 76]. Pd peritonitis can lead to excessive peritoneal inflammatory responses leading to mesothelial cell injury and thickening of the submesothelium compartment, resulting in peritoneal fibrosis and sclerosis . The severity and extent of peritoneal membrane damage correlate with the number and severity of peritonitis episodes . An elevation in proinflammatory cytokines from pd dialysate samples (e.g., il-1 and il-6) is evident from the time of clinical presentation with acute peritonitis and their levels remain significantly elevated for at least 6 weeks after the initial presentation (compared to control patients, p <0.001). Furthermore, lack of a decrease in dialysate il-6 concentrations with treatment of acute peritonitis has been shown to predict relapsing peritonitis . Similarly, the onset of peritonitis is associated with an increase in serum crp levels [72, 73] and higher crp levels have been associated with worse short - term outcomes (e.g., transfer to haemodialysis) and long - term patient outcomes (e.g., subsequent peritonitis event, all - cause mortality). Although the adoption of several preventative strategies, such as the use of disconnect (twin - bag and y - set) systems [79, 80] and preoperative administration of intravenous antibiotics prior to pd catheter insertions [81, 82], has decreased overall peritonitis rates, there remains significant room for further improvement . Peritoneal membrane dysfunction can be clinically manifested as inadequate small solute clearance and ultrafiltration failure . Loss of ultrafiltration can in turn lead to the development of volume overloaded state, including the risk of bowel oedema, which can precipitate endotoxemia by promoting translocation of macromolecules from the gut . Other factors that are thought to promote endotoxin translocation in ckd patients include uraemia [84, 85], malnutrition leading to atrophy of intestinal mucosa, and constipation through bacterial overgrowth . Bacterial endotoxin is a lipopolysaccharide which makes up the majority of the outer membrane of gram - negative bacteria found in the gut . In ckd patients, significantly higher endotoxin levels were observed amongst patients classified as fluid - overloaded (defined by inferior vena cava diameter adjusted for body surface area> 11.5 mm / m) when compared with patients with normal fluid status (0.85 0.11 ng / l versus 0.61 0.05 ng / l, p <0.05). More importantly, endotoxin is a strong proinflammatory stimulus and endotoxemia has been consistently associated with an increase in the level of systemic inflammation in ckd, hd, and pd patients . At present, it remains uncertain whether interventions, such as improvement in fluid status or the level of uraemia, can result in a decrease in endotoxemia and systemic inflammation in humans and should be studied in future . Beyond the aforementioned possible interventions for reducing inflammation in pd patients (table 1), there have only been a limited number of studies on treating the chronic inflammatory state in patients receiving pd . These include the use of agents known to possess anti - inflammatory (e.g., statins) or antioxidant properties (e.g., n - acetylcysteine) that resulted in a decreased level of systemic inflammation burden . Others have proceeded with targeted treatment in those diagnosed with clinical significant periodontitis with similar results . Although these outcomes are encouraging, they need to be interpreted with caution as they were relatively small sized studies (largest study n = 76) from single - centres and their results have not been validated by others . Inflammation is a common complication of pd patients at both systemic and local (i.e., intraperitoneal) levels . Chronic inflammatory status is associated with a number of clinically significant adverse patient outcomes, including malnutrition, peritoneal membrane dysfunction, and cardiovascular events . Although there are a number of potentially modifiable clinical causes of inflammation, a limited number of intervention studies to date have not been able to successfully identify effective strategies to lower inflammatory burden in this patient group . Future studies should focus on better defining of the pathogenic mechanisms underlying peritoneal and systemic inflammatory cascade in pd patients and evaluating the efficacy of interventions targeting these identified factors.

Study sites - north sinai is located in the northeastern part of egypt (30.5n 33.6e), marking the point of connection between asia and africa . North sinai is bordered by the gulf of suez, the red sea and the mediterranean sea and is inhabited mainly by bedouins . The regions comprise the following districts: el - hassana, beer el abd, nekhel, sheikh zuweid, beer lehfen and rafah (fig . 1). The study sites were selected based on the distribution of cl cases in sinai to understand the potential role of both the sandfly and rodent in the dynamics of leishmania transmission (samy 2009, ministry of health of egypt, unpublished observations). The weather in north sinai is characterised as hot and dry, with marked differences in temperature between day and night . Dramatic weather - related changes, as presented by the annual averages of environmental factors during the study period from january 2005-december 2011, are listed in supplementary data and some habitats are illustrated in fig . 2 . Fig . 1: regional and local map of the study sites in north sinai . The six districts of north sinai are denoted by black dots and egypt with the black solid line . 2: sampling localities showing different habitat types . A: wire - box rodent traps used during the study with an individual rodent collected during the study; b: rodent burrows; c: habitat of low hygiene support rodent and sandfly populations; d: a sample of the outdoor habitats sampled in the study . Sandfly collection and processing - sandfly collection was carried out using sticky paper traps and cdc light traps (lt) (john w hock, gainesville, fl, usa) for eight nights / year . Five collection sites were selected randomly to represent each district in the study; 10 cdc lt and 50 sticky traps (st) were used for each study district (2 cdc and 10 st / collection site). The collection sites were chosen to represent the most productive ones for fly capture based on our preliminary studies conducted in different sites of sinai . The recovered st were placed in labelled plastic bags, transported to a temporary field laboratory and then sent to the research and training centre laboratory (rtc) of ain shams university, cairo for processing . The live flies captured by the cdc traps were collected with a mechanical aspirator and dissected in saline with 50 u / ml of amikacin sulphate on a glass slide . The digestive tract was examined under an optical microscope with 400x magnification to identify flies harbouring parasites in their gut and for species identification via morphological keys (lane 1986). Female digestive tracts that had flagellates were transferred to an eppendorf tube with saline containing 50 u / ml of amikacin sulphate and then inoculated into novy mac neal nicolle (nnn) culture medium . Rodent trapping and processing - rodents were trapped using wire - box rodent traps (morsy et al . Each district was represented by five - eight collection sites where 10 - 18 traps each were used; the traps were set before sunset and recovered the next morning . The rodents were identified using regional taxonomic keys (osborn & helmy 1980) and then transported to the ain shams animal facility where they were maintained for at least six months to observe the development of any characteristic leishmania lesions . Full - thickness punch - biopsies were removed from the border of suspected lesions and processed for parasite isolation in nnn medium . Giemsa - stained impression smears were also performed for the lesions and examined for the presence of leishmania amastigotes (soliman 2006). All care and use of animals was conducted in compliance with the animal welfare act and in accordance with the principles set forth in the guide for the care and use of laboratory animals, institute of laboratory guiding principles for biomedical research involving animals (cioms 1985). Molecular characterisation of leishmania cultures - isolates from rodents and sandflies with suspected leishmania parasites were initially inoculated from tissue samples and maintained in culture medium through subculture passages in nnn culture medium with 500 iu penicillin g / ml of blood . Promastigotes from positive cultures were transferred to glass vials containing schneider s drosophila cell culture medium supplemented with 10% fetal calf serum (sigma, saint louis, mo, usa and gibco - brl, gaithersburg, md, usa) for mass rearing . One millilitre of each high - density (~1 x 10 cells ml) leishmania culture was concentrated by centrifugation at 12,000 g for 10 min . Dna was extracted from the pellet using the qiagen dna mini kit (qiagen, valencia, ca, usa). Approximately 25 l of the culture pellet was transferred to a sterile 1.5 ml tube, extracted as per the protocol instructions and eluted in 100 l elution buffer . The ribosomal its-1 was amplified using the primer pair l5.8s and litsr (el tai et al . Amplicons were analysed on 1.5% agarose gels by electrophoresis and visualised by ultraviolet light . A reaction was considered positive when a band of the correct size (300 - 350 bp) was observed . The polymerase chain reaction (pcr) product was digested with the restriction endonuclease haeiii . The restriction fragment length polymorphism - pcr approach was applied for the detection and identification of leishmania parasites in the rodent and sandfly isolates . Fragments were separated by electrophoresis on 2.5% agarose gels and compared with those of reference strains of l. major (mhom / eg/06/rtc-63) and l. tropica (mger / eg/06/rtc-74) using distilled water as a negative control . . 1997) was used to estimate the biodiversity index for both the sandfly and rodent populations . The bray - curtis similarity was used in cluster analysis to estimate the similarity between the sandfly or rodent populations across different districts of north sinai, egypt . Chi - squared analysis was used to test the deviation of the resulting fly sex ratios (female: male) from the expected 1:1 ratio . Ethics - verbal informed consent was obtained from the heads of the households from which sandflies were collected . We provided detailed information about the vector - borne diseases with a special focus on leishmaniasis risk, vectors and reservoirs in language understandable to the local bedouins communities . We also provided information for community - based control measures to help the communities to protect themselves against disease risk . The views expressed in this article are those of the authors and do not necessarily reflect the official policy or position of the egyptian or the united states of america government . The experiments reported herein were conducted in compliance with the animal welfare act and in accordance with the principles set forth in the guide for the care and use of laboratory animals, institute of laboratory animals resources, national research council, national academy press and council for international organizations of medical sciences . Sandfly species composition - a total of 9,849 sandflies were collected from different districts during the study (table i) on 56 nights using 480 cdc and 2,800 st . Males comprised 62.8% (n = 6184) of the catch (female: male ratio of 0.6). A total of 23.3% (404 males, 1,892 females) of the collected flies were caught indoors and the rest of the flies were caught outdoors and from around the rodent burrows . These flies represented six species of two genera: p. (phlebotomus) papatasi (scopoli), phlebotomus (paraphlebotomus) kazeruni (theodor & mesghali), p. (paraphlebotomus) sergenti (parrot), phlebotomus (paraphlebotomus) ale- xandri (sinton), sergentomyia (sergentomyia) antennata (newst .) And sergentomyia (sintonius) clydei (sinton). The predominant species was p. papatasi (83.5%, 8,221 flies), whereas p. sergenti and p. kazeruni represented 9% and 3.3% of the total, respectively . P. alexandri, the vl vector, represented only 1% and was found in limited distribution in nekhel . Table iphlebotomine sandflies collected by cdc light traps (lt) and sticky paper traps (st) from six districts of north sinai, egypt, from january 2005-december 2011 number of collected flies (f: m) speciescollection methodel hassananekhelrafahbeer el abdbeer lehfenseikh zuweidtotalratio (f: m) phlebotomus papatasi lt383/142813/156966/23117/44546/35831/172,756/9482.9:1st141/1,069121/85585/1,33625/6988/6634/61464/4,0531:8.7 phlebotomus kazeruni ltna / na29/17na / nana / nana / nana / na29/171.7:1stna / na52/225na / nana / nana / nana / na52/2251:4.3 phlebotomus sergenti lt24/2345/12614/73na / na5/17na / na88/2391:2.7st2/9881/22177/43na / na2/37na / na162/3991:2.4 phlebotomus alexandri ltna / na26/43na / nana / nana / nana / na26/431:1.6stna / na0/33na / nana / nana / nana / na0/330 sergentomyia antennata lt3/14/40/23/70/1na / na10/151:1.5st1/2027/331/44/190/12na / na33/881:2.7 sergentomyia clydei lt1/2na / nana / na3/6na / nana / na4/81:2st10/2118/292/1510/471/4na / na41/1161:2.8 totallt411/168917/346980/30623/57551/37631/172,913/1,2702.3:1st154/1,208299/1,396165/1,39839/13591/7164/61752/4,9141:6.5f: female; m: male; na: not available . Sandfly sex ratios - sex ratios (females: males) showed that males were overall approximately twice as common, with an overall sex ratio of 1:1.7 . There was a difference between the sex ratios of different sandfly species using both trapping methods; the cdc traps collected more females than males for both the p. papatasi and p. kazeruni collections, but more males were collected from both species when the sticky paper traps were used (table i). Both trapping methods collected more males of p. sergenti, p. alexandri, s. antennata and s. clydei . The chi - squared analysis revealed a significant difference (p = 0.00) between the overall sex ratio (female: male) and the equilibrium 1:1 sex ratio for all species, except with regard to the cdc collection of p. kazeruni (p = 0.08), s. antennata (p = 0.32) and s. clydei (p = 0.25). Sandfly natural infection - the results of sandfly dissections revealed the presence of leishmania - like flagellates in 15 p. papatasi specimens (0.5% of 3,008 dissected females). None of the p. kazeruni, p. sergenti and p. alexandri individuals were infected (table ii). There was a significant difference in the infection rate between the different districts (p <0.05); the highest infection rates were in beer lehfen (0.73%) and rafah (0.72%), whereas the infection rates in nekhel and el - hassana were low (0.37% and 0.26%, respectively). All the females collected from beer el abd and sheikh zuweid were negative for infection . The leishmania - like flagellates were inoculated into nnn medium and the parasites survived in only six out of 15 culture passages . Table iinumber and species of phlebotomus () dissected and naturally infected with leishmania major in different districts of north sinai, egypt, from 2005 - 2011speciesel hassana n (%) nekhel n (%) rafah n (%) beer el abd n (%) beer lehfen n (%) sheikh zuweid n (%) phlebotomus papatasi 383 (0.26)813 (0.37)966 (0.72)17 (0)546 (0.73)31 (0) phlebotomus kazeruni 0 (0)29 (0)0 (0)0 (0)0 (0)0 (0) phlebotomus sergenti 24 (0)126 (0)73 (0)0 (0)5 (0)0 (0) phlebotomus alexandri 0 (0)26 (0)0 (0)0 (0)0 (0)0 (0) total407 (0.24)994 (0.30)1,039 (0.67)17 (0)551 (0.72)31 (0) rodent species composition and natural infections - a total of 159 individual rodents were collected from different districts (table iii). These rodents represented eight species: rattus norvegicus (n = 39), rattus rattus frugivorous (n = 13), rattus rattus alexandrinus (n = 4), gerbillus pyramidum floweri (n = 38), gerbillus andersoni (n = 28), mus musculus (n = 5), meriones sacramenti (n = 22) and meriones crassus (n = 10). Thirty - two rodents were found to be positive for infection by amastigote impression smear testing: g. p. floweri (n = 16), g. andersoni (n = 5), r. norvegicus (n = 7), r. r. frugivorous (n = 3) and r. r. alexandrinus (n = 1) (table iii). None of the m. musculus, m. sacramenti and m. crassus specimens were positive for leishmania infection . The infected rodents included rodents collected from el - hassana (1 r. r. alexandrinus), rafah (7 r. norvegicus, 14 g. p. floweri and 5 g. andersoni) and beer lehfen (3 r. r. frugivorous and 2 g. p. floweri). No positive infections were found in the rodents collected from the nekhel, beer el - abd and sheikh zuweid . All rodent samples were inoculated into nnn medium and the parasites survived in 29 out of 32 culture passages . Table iiinumber of rodents trapped in different districts of north sinai, egypt, from 2005 - 2011 and infection percentages with leishmania speciesel hassana n (%) nekhel n (%) rafah n (%) beer el abd n (%) beer lehfen n (%) sheikh zuweid n (%) total n (%) rattus norvegicus 1 (0)0 (0)34 (20.58)1 (0)0 (0)3 (0)39 (18) rattus rattus frugivorous 2 (0)1 (0)0 (0)1 (0)9 (33.33)0 (0)13 (23.07) rattus rattus alexandrinus 3 (33.33)1 (0)0 (0)0 (0)0 (0)0 (0)4 (25) gerbillus pyramidum floweri 0 (0)0 (0)31 (45.16)0 (0)7 (28.57)0 (0)38 (42.10) gerbillus andersoni 0 (0)0 (0)23 (21.74)0 (0)1 (0)4 (0)28 (17.85) mus musculus 2 (0)1 (0)1 (0)0 (0)0 (0)1 (0)5 (0) meriones sacramenti 0 (0)0 (0)19 (0)0 (0)3 (0)0 (0)22 (0) meriones crassus 0 (0)0 (0)8 (0)0 (0)1 (0)1 (0)10 (0) total8 (12.5)3 (0)116 (22.41)2 (0)21 (21.73)9 (0)159 (20.12) sandfly, rodent diversity and habitat clustering: sandfly species diversity - both simpson diversity and berger - parker dominance indices revealed different diversity between the different districts, with the highest overall diversity in nehkel and beer el abd; the least diverse site was sheikh zuweid, where p. papatasi was the only species occurring at this site (fig . 3: biodiversity index of both the sandfly and rodent populations collected from six districts of north sinai . A: the simpson (1-d) and berger - parker dominance biodiversity index for the sandfly species (1/d); b: the shannon (h) and berger - parker dominance biodiversity index for the rodent species . Rodent species diversity - all districts sampled in the study had a different diversity index based on both shannon (h) and berger - parker dominance indices of rodent populations (fig . The highest overall diversity index was that of rafah (1/d = 3.412, h both nekhel and beer lehfen had higher diversity indices compared to el - hassana, beer el abd and sheikh zuweid . Habitat clustering - bray curtis cluster analysis of the different districts in north sinai revealed levels of similarity between the habitats clusters . Based on the sandflies collected from the different districts, two clusters were identified: sheikh zuweid and beer el abd formed a distinct cluster separated from the rest of the districts, which comprised a different cluster (fig . However, the cluster analysis based on rodent data revealed different cluster patterns than those produced by the sandfly data, with both beer lehfen and rafah forming a distinct cluster and the other districts comprising another cluster in which beer el abd was separated from the lower part of the core (fig . 4b). Finally, the bray curtis analysis for the combination of the sandfly and rodent data formed two distinct clusters: one included both sheikh zuweid and beer el abd and the second cluster included the other districts, with rafah separated from the lower part of the core (fig . 4: dendrogram from bray - curtis cluster analysis based on the sandfly populations data (a), rodents populations data in six districts of sinai peninsula (b) and both the sandfly and rodents populations data (c). Leishmania identification and characterisation - thirty - five samples from both the infected sandfly p. papatasi (n = 6) and rodent reservoirs (n = 29) produced viable cultures in nnn medium . These samples were found to be positive for l. major dna only (supplementary data). Twenty - nine rodent samples found to be positive for l. major were r. norvegicus (n = 7), r. r. frugivorous (n = 3), r. r. alexandrinus (n = 1), g. p. floweri (n = 13) and g. andersoni (n = 5). All l. major - infected rodents were collected from the rafah (n = 23), beer lehfen (n = 5) and el - hassana (n = 1), with no evidence for the presence of infections in the beer el abd, nekhel and sheikh zuweid . This study represents a comprehensive report of seven years in north sinai and provides evidence for the circulation of only one species of the leishmania parasite . Previous studies in egypt reported the presence of only l. major circulating in sinai (wahba et al . 2003), though the most recent study in sinai reported the incursion of cl caused by l. tropica in a remote border area of north sinai on the egyptian - palestinian border . The possibility of the incursion of l. tropica from neighbouring countries could not be excluded according to a recent study (shehata et al . Therefore, we carried out our study to reveal insight into the ecological system for cl transmission with regard to sandflies and rodents by examining of several criteria used by the who to implicate either the vector(s) or reservoir(s). There are several criteria adopted by the world health organization (who) to implicate p. papatasi as the potential vector for circulation of leishmaniasis in sinai, including anthropophilic behaviour, the ability to feed on the reservoir host(s), the presence of natural infections, the ability to support the growth of the parasite and the ability to transmit the parasite by bites (who 2010). However, the results revealed no evidence for the presence of infection in most of the sandflies collected; for instance, the only species found infected with leishmania promastigotes was p. papatasi, with an infection rate close to 0.5% . The sandfly p. papatasi, the potential vector of l. major in the sinai peninsula (wahba et al . 2009), was the most prevalent sandfly in our catches . In the current study, most p. papatasi females were caught indoors and in large numbers, whereas, more males were collected outdoors . The difference in the indoor and outdoor catches reported here might suggest that female p. papatasi is more endophagic compared to p. sergenti, p. kazeruni and p. alexandri . There was a significant difference in the infection rates of the sandflies between different study districts, which might be attributed to the host preference of p. papatasi for different vertebrates . The host preference is influenced by the availability of hosts, for example, p. papatasi in beer lehfen and rafah had infection rates approximately 0.73% and 0.72%, respectively, correlating with the high density of gerbils at both sites . To understand cl eco - epidemiology, the ecology of the animal reservoir populations and their roles in disease transmission were also considered in our study . The most predominant species sampled in all the districts was r. norvegicus, previously identified in similar habitats in sinai as a potential leishmaniasis reservoir host (morsy et al . 1992). However, the current study revealed the presence of infections in g. p. floweri, r. rattus and g. andersoni; infections were also recovered from r. norvegicus . Similar observations were reported in different sites in egypt (morsy et al . 1992, fryauff et al . 1993), but, interestingly, these observations also refer to the difference in the eco - epidemiology of cl in egypt and other countries; for instance, jordan and morocco, where psammomys obesus was identified as the potential animal reservoir (saliba et al . The burrows of p. obesus are identified by halophytic vegetation and by the remnants of plant material at the entrances (who 2010). The structure of habitats in the six districts of the current study was relatively similar to the p. obesus habitat, but with no record for the species during the seven years of collection . Several criteria were also proposed by the who for the implication of animal reservoirs (who 2010) with cl transmission; one such criterion was fulfilled by isolating the parasite from wild rodents with positive infections collected from different sites in the study . Secondly, the parasite was found to be identical to that isolated from patients attending clinics in north sinai communities (am samy, unpublished observations). Some criteria depend on the availability of the parasite in the skin in sufficient numbers for the sandfly to transmit . 2006) to infer the potential role of these animals in the dynamics of this disease . Throughout the late phases of our study, we used cluster analysis to infer similarity between the habitats using the data from the collection of sandflies, rodents or the combination of both . Interestingly, the areas identified to have disease risk formed a distinct cluster, for instance, the distinct cluster that included rafah, nekhel, beer lehfen and el hassana (fig . These observations revealed the importance of multivariate methods in the study of disease ecology and in inferring the area with a favourable habitat for cl circulation . One of the interesting findings of this study was the presence of infections in different animal reservoirs that were not necessarily previously known as potential reservoirs (morsy et al . These changes in the animal hosts may be a response to climate change, especially in the presence of continuous heavy rains and floods in sinai . These environmental changes coincided with the increase in cl incidence in sinai due to a change in the vector and rodent populations and consequently a change in the disease dynamics in the area . Our report identified the presence of only l. major, whereas no l. tropica was detected during seven years of observations in the study areas . 2009) may be allochthonous, i.e., the parasite may have originated from other sites where l. tropica is established (jacobson et al . Sergenti, the presumed vector of l. tropica, was found in this study, though we found no rock hyraxes, the main l. tropica reservoir in countries including israel and kenya (mebrahtu et al . Other factors that could mask the dynamics of l. tropica transmission might include differences in the seasonality of vectors or distinct reservoir populations for different transmission cycles (faulde et al . L. major infections circulate in the country through different seasons of the year, with three incidence peaks in november, march and august and few sporadic cases were reported during the rest of the year . These peaks correspond to the time after the peaks of sandfly abundance (samy 2009, fahmy et al . The continuous circulation of l. major is maintained by the highest densities of both the p. papatasi and gerbil populations after the heavy rains that are considered as favourable habitats for the survival of the vector and reservoir populations . The number of zoonotic cutaneous leishmaniasis (zcl) cases is still underestimated due to the bedouin traditions of preventing females to visit clinics and their dependence on leishmaniasis treatment using routine heat therapy . The mean annual cases reported to the official public health centres in north sinai during 2006 - 2011 were 296.67 cases (ministry of health of egypt, unpublished observations), with the highest infection rate reported during 2008 - 2010 due to a change in environmental conditions . Toward the end of this period, the incidence of zcl caused by l. major decreased after control efforts for both vectors and rodent reservoirs by the egyptian ministry of health . Due to such continuous disease dynamics in response to environmental changes, we plan in our future research to investigate the potential role of rodent populations in the circulation of the parasite in the sinai, to study in detail the coarse - resolution ecology and to study the biogeography of disease through mapping exercises and site suitability analysis using efficient quantitative techniques.

Sternoclavicular joint septic arthritis (ssa) and its clinical presentation are infrequently seen and often difficult to manage . Presenting symptoms of ssa can vary, with chest and shoulder pain being the most common clinical features . After thorough literature search, no cases have yet been reported on ssa leading to vocal cord palsy . Vocal cord palsy is an important sign of thoracic and head and neck pathology that is caused by an extremely wide set of pathology . A 67-year - old gentleman presented to the emergency department with a 3-week history of worsening dysphagia and hoarse voice . Routine examination of the patient in the emergency department revealed that he was haemodynamically stable and apyrexial and exhibited tenderness in the left anterior neck . Examination by the otolaryngology team demonstrated no evidence of cervical lymphadenopathy but tenderness of the lower left anterior triangle, as well as evident swelling, erythema and mild bruising of the anterior chest wall . On questioning the patient regarding this, he revealed that he burnt his chest using a hot water bottle 3 weeks previously and he also admitted to having stiffness and pain in the left shoulder over this same period . Indirect laryngoscopy with flexible nasendoscopy revealed non - discrete swelling / oedema of the left pharayngeal wall and reduced mobility of the left vocal cord . Routine haematological investigation revealed a white cell count of 18.6 10/l, c - reactive protein of 288 mg / l and platelets of 499 10/l . No other haematological abnormality was noted on admission . With a working differential of parapharyngeal space infection and possible malignancy, the patient was referred for a computed tomography (ct) scan of the neck and thorax with contrast . The patient was also started empirically on intravenous co - amoxiclav as treatment for neck space collection . Ct imaging, performed 24 h after admission, revealed no evidence of malignancy or indeed any paraphayrngeal space collection . Few small lymph nodes were noted on the left side of the neck, but were deemed to be reactive in nature, and left vocal cord palsy was evident (fig . 1). The key finding was that of a left sternoclavicular joint collection and closely associated superficial anterior chest wall, soft tissue swelling and oedema (fig . 2). This inflammatory process was also noted deep to the manubrium and sternum and extending somewhat into the mediastinum with evident enlarged mediastinal lymph nodes (fig . The ct findings were in keeping with ssa with associated superficial and deep tissue inflammation and oedema . With no other cause found, the vocal cord palsy was attributed to the inflammation within the mediastinum, which in turn was caused by superficial burn from hot water bottle use . Findings: left vocal cord palsy indicated by the para - median position of the left vocal cord in comparison with the right . Findings: left sternoclavicular joint collection and closely associated superficial anterior chest wall, soft tissue swelling and oedema . Findings: soft tissue oedema of the chest seen retrosternally (marker a) and superficially on the left anterior chest (marker b) as well as evidence of mediastinal lymph node enlargement . Computed tomography . A 67-year - old male with ssa . Findings: left vocal cord palsy indicated by the para - median position of the left vocal cord in comparison with the right . Findings: left sternoclavicular joint collection and closely associated superficial anterior chest wall, soft tissue swelling and oedema . Computed tomography . A 67-year - old male with ssa . Findings: soft tissue oedema of the chest seen retrosternally (marker a) and superficially on the left anterior chest (marker b) as well as evidence of mediastinal lymph node enlargement . The antibiotic regimen for the patient was converted to intravenous benzylpenicillin (1.2 g four times per day) and flucloxacillin (1 g four times per day). Response to antibiotic therapy was limited in the first few days of admission with little change in haematological inflammatory markers . After discussion with the microbiologist, the flucloxacillin was increased to 2 g four times a day on the fourth day of admission . The patient made slow but positive improvements over the course of the next 8 days while on intravenous antibiotics, after which he was successfully discharged . He continued on oral antibiotics and on outpatient review 3 weeks after his admission, his external swelling, erythema and voice had returned to normal . Repeat ct performed 3 months following discharge demonstrated complete resolution of the deep and superficial inflammatory process as well as the mediastinal lymph nodes . Vocal cord palsy can be due to weakness in one or both vocal cords, and diagnosis is made when reduced mobility is evident by laryngoscope examination . In a review of 117 cases, benninger et al . Attributed the following as the most common causes of vocal cord palsy: surgical trauma (44%), malignancies (17%), endotracheal intubation (15%), neurological disease (12%) and idiopathic causes (12%). Furthermore, a review of 389 vocal cord palsy cases by holinger et al . Makes no reference to the cause being related to a septic sternoclavicular joint . Explanations for this unusual presentation of ssa seen in this case include tracking infection from the septic sternoclavicular joint, resulting in a vocal cord palsy due to reactive mediastinal lymphadenopathy . Spreading infectious sequeale of ssa significant contributing factors to these outcomes are the methicillin - resistant staphylococcus aureus (mrsa) strains, which are becoming increasingly prevalent . A literature review of 180 cases shows mediastinitis as a clinical feature in up to 13% of patients with ssa . Reports of fibrosing mediastinitis and descending necrotizing mediastinitis leading to vocal cord palsy have been documented . The mild reactive mediastinal inflammation seen in the presented case has not been presented in the literature as a cause of vocal cord palsy . Therefore, as mentioned previously, it is most likely explained by mediastinal lymphadenopathy, which is a known cause of left vocal cord palsy in malignancy and atypical infections such as tuberculosis . It has been shown that if radiological findings indicate a limited extent of disease, then medical therapy alone should be sufficient . This empirical antibiotic coverage should be active against s. aureus, the most common infective agent in ssa . Joint resection would only be indicated if extensive bony destruction, chest wall phlegmon or abscess, retrosternal abscess, mediastinitis or pleural extension is evident on ct / mri imaging . It is clear from the haematological and radiological findings, as well as the response to treatment, that all the presenting features of this patient were as a result of the septic focus in the sternoclavicular joint.

Vertically aligned zno nanorods (nrs) and nanowires (nws) are attracting much interest for several applications such as nanophotonics, dye - sensitized solar cells, electron field emitters, surround - gate field effect transistors, and nanopiezotronics . A number of preparation methods by high temperature vapor transport and low temperature chemical synthesis were developed . For comparison, the nr arrays can be classified from several aspects: physical and geometrical properties of the individual building blocks and their uniformity in length, in diameter, and in axis - to - substrate angle . The nrs / nws can be distributed either randomly or in a well - defined way . For instance, photonic crystals with well - defined defects are of importance in nanophotonics . Another demanding application is the construction of zno nw - based dc current generator, where the nws convert the mechanical energy of a vibrating pt - coated, zig - zag - shaped electrode to electric energy by exploiting the piezoelectric nature of zno . Even for nanosensors, however, the generated power density (~80 nw / cm) should be significantly increased . As liu et al . Have pointed out the output voltage of the system, being now typically in the order of ~10 mv, can be drastically improved by increasing the number of the active nw - s, i.e., the ones which are in continuously contact with the zigzag top electrode . Therefore, two approaches were proposed: improving the uniformity of the nws on one hand and patterning the array according to the dimension and shape of the top electrode . Vertical zno nanoarrays arranged in a designed pattern were recently produced by a few groups using different techniques, however, either the geometrical non - uniformity of the nws or the low density of the vertical microcrystals (~1 nr/m) makes their use in nanogenerator application difficult . Solid (vls) method the metal catalyst droplet on the top of the nw can hinder the formation of the required schottky contact at the top electrode / nw interface . Here, we demonstrate alternative fabrication routes which fulfill all the above crucial requirements by providing highly uniform, crystallographically oriented nrs in the 100-nm diameter range, in predefined, dense patterns . Our method benefits of the catalyst free, low temperature epitaxial growth, and the direct writing nanolithography . We have tried two options for the formation of nr arrays . In the first, the desired nucleation pattern was drawn in a polymethyl - methacrylate (pmma) layer, which was subsequently removed resulting in an all - zno structure . In the second route, the nucleation pattern was realized in a hard metal coating; therefore, the fabricated nrs were electrically contacted at the anchoring surface . The process flow for the fabrication of all - zno nr arrays is shown in fig ., the zn- and o - terminated single crystal zno wafers were washed ultrasonically in acetone, ethanol, and deionized water, which was followed by a thermal - annealing step in a quartz tube at 1,050 c for 8 h in oxygen atmosphere . In order to prevent the sublimation of zn, the substrates were placed between yttrium stabilized zirconia (ysz) wafers before annealing . The 250-nm - thick pmma resist layer was exposed by e - beam lithography in an elionix els-7500ex instrument (fig . Circular spots of different (50100 nm) diameters arranged in a triangular (tri) or honeycomb (hc) lattice were generated . The aqueous bath contained the same (4 or 40 mm) molar amount of zinc nitrate hexahydrate (zn(no3)2 6h2o) and hexamethylene tetramine ((ch2)6n4). During the zno nanostructure growth, the specimen was mounted upside - down on a polytetrafluoroethylene (ptfe) sample holder . The nanocrystal growth was carried out without an electric field applied in a multipurpose oven for 13.5 h periods at a set temperature of 85 c . However, due to the high heat capacity of the glass container and the dry atmosphere, the warming up was relatively slow: the bath temperature reached 80 and 82 c after 2 and 3 h, respectively . Following slow cooling, the sample was thoroughly washed in de - ionized water and purged in nitrogen . Afterward, the pmma layer was removed in acetone . This step also helps to lift - off the parasitic zno debris formed in the solution volume (fig . Schematic process flow of all - zno (a d) and anchored (e h) nanorod arrays . The processing steps for all - zno structure are: surface treatment of zno substrates (a), pattern generation in pmma by e - beam lithography (b), chemical nanowire growth (c), and pmma removal (d). Processing steps for the anchored zno array are: ru thin film deposition (e), e - beam lithography (f), arion milling (g), and chemical nanorod growth after pmma removal (h) nanorods grown through a hard metal mask obtained by ar - ion milling are anchored in the single crystal substrate in the recessed dips etched during metal milling . Thereby the fabrication of arrays of electrically contacted nrs however, here the surface treatment process of zno substrate was followed by the deposition of a 30-nm - thick, high - quality ru layer by using ion - beam sputtering (fig . 1f) and was transferred into the hard metal film by ar ion milling (fig . The same chemical growth method was used as for the all - zno arrays (fig . The preparation condition details for both all - zno and anchored arrays are summarized in table 1 . Summary of the growth parameters and the obtained nanorod dimensions the obtained nanostructures were visualized by a hitachi s4800 field emission scanning electron microscope (fesem). Transmission electron microscope (tem) images were obtained by a 200 kv jeol jem-2010 instrument . The electrical characterization of the individual nws was carried out in air by conductive afm technique by means of a sii nanotechnology inc ., the spring constant and resonant frequency of the used au - coated cantilever is 1.4 n / m and 26 khz, respectively . The process flow for the fabrication of all - zno nr arrays is shown in fig ., the zn- and o - terminated single crystal zno wafers were washed ultrasonically in acetone, ethanol, and deionized water, which was followed by a thermal - annealing step in a quartz tube at 1,050 c for 8 h in oxygen atmosphere . In order to prevent the sublimation of zn, the substrates were placed between yttrium stabilized zirconia (ysz) wafers before annealing . The 250-nm - thick pmma resist layer was exposed by e - beam lithography in an elionix els-7500ex instrument (fig . Circular spots of different (50100 nm) diameters arranged in a triangular (tri) or honeycomb (hc) lattice were generated . The aqueous bath contained the same (4 or 40 mm) molar amount of zinc nitrate hexahydrate (zn(no3)2 6h2o) and hexamethylene tetramine ((ch2)6n4). During the zno nanostructure growth, the specimen was mounted upside - down on a polytetrafluoroethylene (ptfe) sample holder . The nanocrystal growth was carried out without an electric field applied in a multipurpose oven for 13.5 h periods at a set temperature of 85 c . However, due to the high heat capacity of the glass container and the dry atmosphere, the warming up was relatively slow: the bath temperature reached 80 and 82 c after 2 and 3 h, respectively . Following slow cooling, the sample was thoroughly washed in de - ionized water and purged in nitrogen . Afterward, the pmma layer was removed in acetone . This step also helps to lift - off the parasitic zno debris formed in the solution volume (fig . Schematic process flow of all - zno (a d) and anchored (e h) nanorod arrays . The processing steps for all - zno structure are: surface treatment of zno substrates (a), pattern generation in pmma by e - beam lithography (b), chemical nanowire growth (c), and pmma removal (d). Processing steps for the anchored zno array are: ru thin film deposition (e), e - beam lithography (f), arion milling (g), and chemical nanorod growth after pmma removal (h) nanorods grown through a hard metal mask obtained by ar - ion milling are anchored in the single crystal substrate in the recessed dips etched during metal milling . Thereby the fabrication of arrays of electrically contacted nrs is achieved . The process shown in fig . However, here the surface treatment process of zno substrate was followed by the deposition of a 30-nm - thick, high - quality ru layer by using ion - beam sputtering (fig . 1f) and was transferred into the hard metal film by ar ion milling (fig . The same chemical growth method was used as for the all - zno arrays (fig . The preparation condition details for both all - zno and anchored arrays are summarized in table 1 . The obtained nanostructures were visualized by a hitachi s4800 field emission scanning electron microscope (fesem). Transmission electron microscope (tem) images were obtained by a 200 kv jeol jem-2010 instrument . The electrical characterization of the individual nws was carried out in air by conductive afm technique by means of a sii nanotechnology inc ., the spring constant and resonant frequency of the used au - coated cantilever is 1.4 n / m and 26 khz, respectively . The sem images of the all - zno arrays fabricated at optimized conditions are shown in fig . C . The c - axis - oriented nrs show hexagonal cross section, which are according to the crystal orientation of the substrate collectively aligned to each other . The sidewalls of the prism - shaped rods correspond to the most stable non - polar faces . Note the ~250 nm high bottleneck - shaped part at the bottom of the nanocrystals in fig . We have found that by changing the template geometry, the diameter and the length of the nrs can be tuned in the range of 90170 nm and 0.52.3 m, respectively . The perpendicularly standing nrs reflect excellent geometrical uniformity . According to the image analysis done on the fesem image (pixel size of 1.4 nm) shown in fig . This is the diameter of a circle having the same area as the hexagonal cross section of the object . We have tried the same growth conditions on zn- and o - polar zno surfaces, but no significant difference was found in the obtained arrays . A typical example observed during the optimization of the growth parameters is inserted in fig . 2d . When the concentration in the growth solution is increased to 40 mm, the growing nrs coalesce at their non - polar sides to form a contiguous network . Fesem images on all - zno nanorod arrays prepared by soft - masking method in honeycomb (a, d) and on triangular (b, c) arrangements . The single crystal nanorods have hexagonal cross - sections; the uniformity of diameter can be <2% (b inset). When the concentration of the growth solution is increased to 40 mm, a coalescence of nanorods is observed (d) anchored, i.e., metal back contacted arrays show similar geometrical features as the all - zno structures (fig ., we have also downscaled the pattern: the densest array had an rod - to - rod distance of 175 nm, which in hc lattice corresponds to a nr density of 25 nr/m . However, in the case of high aspect ratio (~26:1) and short rod - to - rod distance, a self - attraction of nr tips occurs (fig . 3c). Perspective view (a) and top view (b) fesem images on bottom contacted, anchored zno nanorods prepared by hard - mask method . When the aspect ratio is high, during the drying process (c) the nanorods attach to each other at their tips similar phenomenon was described by other groups, as well, albeit they used high temperature vapor transport methods . Wang et al . Explained the self - attraction by the accumulated coulomb charges at the nr / au catalyst droplet interface when charged by the primary electrons during sem observation . Have also observed self - attracted nws prepared by catalyst - free vapor solid (vs) preparation method . Therefore, the charging cannot be ascribed to the presence of catalysts . In our case, the nr tip attachment can be attributed to surface tension of water during the drying process, as it was described by segawa et al . For hybrid organic inorganic nr . We believe that further down - scaling is limited mainly by the resolution of our e - beam lithography facility rather than by growth kinetics . In fig . 4a, the cross - sectional fesem image of the so - called anchored - type nrs is provided . The arrows on top and bottom mark the characteristic diameter of the rods being ca . The development of this taper is the effect of the finite growth rate on the nonpolar faces of the sidewalls . Figure 4b reflects the anomaly encountered during ion - milling of the base - metal film (ru) through the pmma holes formed by e - beam lithography . After the removal of the pmma mask, a cylindrical object is left surrounding the ion - milled hole in the metal . This cylinder is composed of sputtered residues originating from the ru - film, mixed with zno from the underlying substrate and polymers formed from pmma components . A schematic cross section of the structure after ion - milling, but before pmma removal the hexagonal faceting forms outside of this cylinder . That gives rise to the neck observed on the bottom of the nrs in fig . Fesem image of the cross section of anchored - type zno nanorods with indication of the size - distribution (a), the parasitic ring remaining after removal of the pmma mask (b), and from the ar - ion milled structure shown in the sketch in cross section (c) the tem observations revealed that both all - zno and anchored, contacted nrs are wurtzite type single crystals of high quality (fig . 5), where the rotational axis is parallel to the direction . The tem observation reveals the single crystalline nature of the nanorods . The fast growing crystallographic direction is parallel to the longitudinal axis the electrical properties of the individual nrs in fig . This can be ascribed to the effect of the condensates on the mantle surface of the nrs . 6), which can be originated either from the contact between probe - tip and nr - tip or from the collar - shaped zno / ru interface at the bottom of the nr . However, as it was shown earlier and found here as well, the ru / single crystal zno interface - contact has ohmic character . Therefore, the au / zno nr contact is responsible for the observed rectifying behavior . Voltage characteristic recorded on an individual nanorod by conductive afm . In order to obtain reproducible results in air increased contact force is required, which can be ascribed to the condensate formation on the nanorods (inset) in order to correctly describe the electrical behavior by an equivalent circuit and to separate the contributions of contact resistance, internal resistance of the nr, surface conductance, and piezoelectricity induced schottky barrier height change, a refinement of the measurement technique and further systematic investigation is required . Still, in our work the successful formation of a rectifying schottky contact between zno nr and the measuring tip could reproducibly be obtained . This was pointed out by liu et al . To be a necessary requirement for the operation of the dc nanogenerator with vibrating top contact . We have demonstrated that by using homoepitaxial chemical growth method highly uniform, single crystalline nr arrays arranged in a predefined pattern can be prepared . By changing the growth parameters, diameter and length of the nrs can be tuned in the range of 90170 nm and 500 nm2.3 m, respectively . The monodispersity of the diameter of single crystalline nrs can be <2% by maintaining an excellent uniformity in the longitudinal dimension . We exploited two alternative synthesis routes using soft and hard under - layer to obtain all - zno and metal contacted, anchored nr arrays, respectively . The former one can be a promising candidate for nanopillar - based photonic crystals, especially if a refractive index contrast between the nr and the zno substrate is realized . On the other hand, anchored nr arrays contacted on the bottom are promising structures for nanopiezotronics . The arrays show excellent uniformity in length and the dense pattern (~30 nr/m) can be adjusted to the top vibrating electrode of the nanogenerator . Thereby a significant improvement in the output voltage, hence a more efficient energy harvesting can be predicted . This work was supported by the nanotechnology network project of the ministry of education, culture, sports, science and technology (mext) in japan, and by the hungarian fundamental research found (otka) under contract pd 77578.